WO2017060283A1 - Épitopes peptidiques immunodominants spécifiques pour vaccin contre polyomavirus - Google Patents

Épitopes peptidiques immunodominants spécifiques pour vaccin contre polyomavirus Download PDF

Info

Publication number
WO2017060283A1
WO2017060283A1 PCT/EP2016/073760 EP2016073760W WO2017060283A1 WO 2017060283 A1 WO2017060283 A1 WO 2017060283A1 EP 2016073760 W EP2016073760 W EP 2016073760W WO 2017060283 A1 WO2017060283 A1 WO 2017060283A1
Authority
WO
WIPO (PCT)
Prior art keywords
bkpyv
seq
hla
peptides
cells
Prior art date
Application number
PCT/EP2016/073760
Other languages
English (en)
Inventor
Hans H. HIRSCH
Céline LEBOEUF
Original Assignee
Universität Basel
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universität Basel filed Critical Universität Basel
Publication of WO2017060283A1 publication Critical patent/WO2017060283A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/14011—Baculoviridae
    • C12N2710/14041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/22011—Polyomaviridae, e.g. polyoma, SV40, JC
    • C12N2710/22023—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/22011—Polyomaviridae, e.g. polyoma, SV40, JC
    • C12N2710/22034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention relates to recombinant immunodominant peptide epitopes of polyomavirus, and vaccines against polyomavirus infection comprising such epitopes.
  • BK polyomavirus is a small non-enveloped double-stranded DNA virus and one of by now at least 12 human polyomaviruses (Rinaldo C.H., Hirsch H. H., APMIS
  • the risk factors of BKPyV replication and nephropathy vary in different kidney transplant studies and include steroid pulses for acute rejection, maintenance immunosuppression such as tacrolimus-mycophenolate versus cyclosporine-mycophenolate, older age of recipients, male gender, and higher number of HLA-mismatches. According to the recent OPTN/SRTR report, these risk factors are present in a substantial number of kidney transplant patients (Matas A.J. et al., Am J Transplant. 2015;15 Suppl 2:1 -34).
  • T-cell responses to the LVGR-encoded capsid viral protein VP1 were generally more
  • interferon (IFN)-y responses were largely derived from CD4+T-cells and to a lesser extent from CD8+T-cells (Binggeli S. et al., Am J Transplant. 2007;7:1 131 -9). Since most of these studies used overlapping 15mer-peptide pools, the contribution of individual CD8+T cell-restricted epitopes to these responses are largely undefined. With few exceptions, HLA-restricted T- cell responses to BKPyV are mostly reported from HLA-A * 02 individuals (Provenzano M. et al., J Transl Med. 2006;4:47; Randhawa P.S.
  • the invention relates to recombinant immunodominant peptide epitopes of a
  • polyomavirus such as BK, JC or MC polyomavirus
  • carriers such as virus-like particles, virosomes or nanoparticles, comprising such epitopes
  • vaccines against polyomavirus infection comprising such peptides and/or carriers, and methods of prophylaxis and treatment using such vaccines.
  • the invention further relates to nucleic acids encoding these proteins and epitopes, vectors comprising such DNA, and host cells comprising such vectors.
  • the invention further relates to a diagnostic method using these peptide epitopes or nucleic acids encoding these.
  • the graph depicts 20 top-scoring 9mer-epitopes predicted in BKPyV EVGR (early viral gene region) sequence for common HLA-A and -B types in Europe and North America, according to Immune Epitope Database (X) and Syfpeithi ) algorithms.
  • FIG. 1 BKPyV IgG serology of 42 healthy individuals
  • Normalized BKPyV IgG antibody levels are shown at 1 :100, 1 :200 and 1 :400 dilutions (median, box shows 25 th and 75 th percentile, whiskers 5 th and 95 th percentile). Positive serological status was defined as OD 4 92n m ⁇ 0.100 (dotted line) at the 1 :200 dilution.
  • A IFN- ⁇ ELISpot assay using PBMCs directly after isolation from fresh blood (d-1 , left panel) or after 9 day-expansion with BKPyV EVGR peptides (d+9, right panel).
  • Cells were treated with medium (NC, negative control), Staphylococcus enterotoxin B (SEB), the pooled 9mer-peptides (9mP), an overlapping 15mer-peptide pool spanning the BKPyV EGFR sequence (15mP) or with a longer peptide pool (LPP).
  • NC negative control) and with (right panel) HLA-B * 0702 molecules bearing 9m27 peptide.
  • E CD8+T-cell proliferation during in vitro expansion. PBMCs were stained at day 0 with CFSE dye that dilutes upon cell division (y-axis). Proliferation of CD8+T-cells (left panel) and HLA-B * 07-positive 9m27-specific T-cells (right panel) are shown.
  • G 9mer-specific cytotoxic activity of expanded T-cells.
  • Autologous PHA blasts stained with 51 Cr and pulsed with 9mP ( ⁇ ) or 9m27 (A ) were used as target cells and incubated for 4h with expanded T-cells (effector cells).
  • Percentage of target cells lysis (y-axis) at the different effectontarget cells ratios (E:T, x-axis) is shown (See materials and methods for details).
  • Figure 4 Breadth and strength of BKPyV EVGR epitope-specific immune responses in healthy individuals
  • Figure 5 BKPyV viremia and HLA-matching in 118 pediatric kidney transplant recipients.
  • the percentage of viremic (left side) and non-viremic (right side) kidney transplant recipients according to HLA type is shown.
  • HLA type For each HLA type, the percentage of patients displaying matched (blank) or mismatched (dotted) allele with their kidney donor is shown.
  • the number of kidney transplant recipients with most common HLA-types is indicated on the left.
  • BKPyV viremia was analyzed for single HLA-types versus the whole population (p-value "P1 ") or by comparing viremia occurrence in matched versus mismatched patients (p-value "P2”) (Fisher's exact test).
  • Figure 6 BKPyV and JCPyV seroprevalence in viremic and non-viremic kidney transplant recipients.
  • Plasma samples from 98 patients harvested at the time of transplantation (TO), 6 months post-transplantation (T6) and 12 months post-transplantation (T12) were tested at 1 :200 dilution in a BKPyV (upper panel) or JCPyV (lower panel) IgG ELISA using virus-like particles.
  • the dotted and empty boxes display viremic patients and non-viremic patients, respectively.
  • the optical density was measured at 492nm and was normalized to an internal laboratory reference serum (nOD).
  • nOD internal laboratory reference serum
  • FIG. 7 Direct BKPyV IFN ⁇ y T-cell responses.
  • PBMCs from viremic (left, A) or non-viremic (right, B) kidney transplant patients were stimulated with BKPyV LTag 15mP or 9mP in a IFN- ⁇ ELISpot assay one day after thawing.
  • Data are expressed as Spot Forming Unit (SFU) per 10 6 cells. Each dot represents one sample and the black bar shows the mean SFU/10 6 cells.
  • SFU Spot Forming Unit
  • FIG. 8 In vitro expanded BKPyV IFN ⁇ y T-cell responses.
  • PBMCs from viremic (left, A) or non-viremic (right, B) kidney transplant patients were expanded in vitro with BKPyV LTag 15mP in the presence of cytokines. After two weeks, the cells were stimulated with BKPyV LTag 15mP or 9mP in a IFN- ⁇ ELISpot assay. Data are expressed as Spot Forming Unit (SFU) per 10 6 cells. Each dot represents one sample and the black bar shows the mean SFU/10 6 cells.
  • SFU Spot Forming Unit
  • PBMCs from viremic (panel A) and non-viremic (panel B) patients were stimulated with single BKPyV LTag-derived 9mers in a IFN- ⁇ ELISpot assay.
  • the number of patients (x-axis) displaying a positive response upon stimulation with the indicated peptides (y-axis) is shown. Epitopes that were not found frequently in healthy individuals are indicated by a star.
  • the invention relates to recombinant immunodominant peptide epitopes of polyomavirus and peptides comprising these.
  • the invention relates to a recombinant peptide consisting of 9 to 50 amino acids comprising
  • one epitope selected from the group of peptides of SEQ ID NO: 1 -3, 5-7, 9-1 1 , 13, 15-18, 20-33, 35, 37, 38, 40-43, 45-52, 54-56, 59, 61 -73, 75-97, and 121 -164, or
  • the invention relates to a recombinant peptide consisting of 15 to 50 amino acids comprising
  • the invention relates to such a recombinant peptide consisting of at least 24, at least 25, at least 26, at least 27, at least 28, at least 36, or at least 37 amino acids.
  • the invention relates to a recombinant peptide consisting of 15 to 50 amino acids comprising two, three, four, five or six optionally overlapping epitopes selected from the group of peptides of SEQ ID NO: 1 -3, 5-7, 9-1 1 , 13, 15-18, 20-33, 35, 37, 38, 40-43, 45-52, 54-56, 59, 61 -73, 75-97, and 121 -164.
  • Peptides of SEQ ID NO: 1 -3, 5-7, 9-1 1 , 13, 15-18, 20-33, 35, 37, 38, 40-43, 45-52, 54-56, 59, 61 -73, and 75-97 are novel immunodominant peptide epitopes of BK polyomavirus determined by the present inventors for the first time.
  • Table 1 Immunogenic BKPyV LTag epitopes
  • LTag Large Tumor antigen
  • 9m peptide consisting of 9 amino acids
  • LP longer peptide.
  • Epitopes for which a reference (1 ) to (4) is given, are already known in the state of the art. (1 ) Li J et al., J Gen Virol. 2006;87:2951 -60.
  • the invention relates to a recombinant peptide comprising two, three, four, five or six optionally overlapping peptides selected from the group of peptides of SEQ ID NO: 1 , 2, 4, 5, 8, 9, 12, 15, 21 , 29, 30, 34, 39, 40, 44, 48, 49, 53, 58, 66, 72, 74, 80, 81 and 97.
  • the invention relates to a recombinant peptide comprising two, three, four, five or six optionally overlapping peptides selected from the group of peptides of SEQ ID NO: 1 , 2, 5, 7, 9, 15, 21 , 29, 30-32, 40, 46-51 , 62, 65, 66, 74, 80, 81 and 97.
  • recombinant peptides were constructed comprising epitopes targeting a wide range of different HLA types.
  • the invention thus relates to recombinant peptides RP-14, RP- 21 , RP-34, RP-51 , RP-54 and RP-55 (Table 2).
  • Table 2 Preferred recombinant peptides and targeted HLA sites
  • Recombinant peptides RP are not present in this particular epitope combination within corresponding polyomaviruses, and are fully synthetic.
  • RP-14, -21 , -51 , -54 and -55 are especially useful for HLA-transgenic mice experiments, since some of the targeted HLA types match with the phenotype of the available HLA-transgenic mice (Taconic).
  • those RPs will allow to investigate BKPyV-specific immune responses in 6 different HLA- transgenic mice (A * 01 , A * 02, A * 1 1 , A * 24, B * 07 and B * 44).
  • Spacer and processing amino acids to improve cleavage, presentation and vaccine response are further considered within the peptides of the invention.
  • any 9mer-peptide listed above can be combined with L, A and D amino acids at their C- terminus, except for 9mer-peptides having L, F, W or Y at their C-terminus that will be combined with A and D only.
  • different combinations of 9mer-epitope sequences with or without spacers can be further considered for the synthesis of other immunogenic recombinant peptides.
  • the most preferred epitope is 9m27 (SEQ ID NO:4) because it is highly immunodominant in HLA-B * 07 and -B * 08 individuals. Therefore the preferred long peptides contain 9m27.
  • a particularly preferred long peptide is the peptide of SEQ ID NO: 98 comprising 9m27 (SEQ ID NO:4), another published epitope (9m33, SEQ ID NO: 8) and 4 other newly identifed epitopes giving responses in a broad range of HLA types:
  • LP-LER LERAAWGNLPLMRKAYLRKCKEFHP (SEQ ID NO:98)
  • a likewise preferred long peptide is the peptide of SEQ ID NO: 106 comprising an immunogenic area going from position 283 to 293 within EGVR, giving responses in a broad range of HLA types:
  • SEQ ID NO 1 12 contains the best epitopes of each HLA type:
  • This 37 amino acid peptide targets the following HLA: A * 01 , A * 02, A * 03, A * 1 1 , A * 24, B * 07, B * 08
  • Some epitopes induced IFN- ⁇ ELISpot responses in more than 50% of tested healthy individuals. Proteins comprising such epitopes of SEQ ID NO: 1 , 2, 12, 39, 40, 48, 49, 72 and 97 are particularly preferred.
  • Proteins comprising the epitope of SEQ ID NO: 4 are particularly preferred. Also preferred are proteins comprising the epitope of SEQ ID NO: 39, or of SEQ ID NO: 72, or of SEQ ID NO: 34, or of SEQ ID NO: 48, or of SEQ ID NO: 2, or of SEQ ID NO: 12, or of SEQ ID NO: 97, or of SEQ ID NO: 19, or of SEQ ID NO: 49, or of SEQ ID NO: 44, or of SEQ ID NO: 47, or of SEQ ID NO: 59, or of SEQ ID NO: 1 , or of SEQ ID NO: 25, or of SEQ ID NO: 21 , or of SEQ ID NO: 15, or of SEQ ID NO: 32, or of SEQ ID NO: 40.
  • BKPyV LTag (SEQ ID NO: 1 18) is a non-structural protein playing a key role in viral replication.
  • BKPyV VP1 is a structural protein expressed at later time points and involved in capsid formation. It has been strongly suggested that LTag is involved in tumor formation as it contains some tumor suppressor-binding domains allowing interfering with p53 and retinoblastoma protein functions.
  • LTag Since LTag is produced early in the viral life cycle, immune responses against LTag are thought to be responsible for the maintenance of viral latency. In kidney transplant recipients, BKPyV VP1 elicits higher immune responses than BKPyV LTag in vitro (Binggeli S et al., Am J Transplant. 2007;7:1 131 -9). However, LTag is responsible for higher CD8-mediated responses compared to VP1.
  • BKPyV LTag is highly conserved among human polyoma viruses, e.g. BKPyV, JCPyV and MCPyV.
  • BKPyV LTag and JCPyV LTag (SEQ ID NO: 1 19) share more than 80% sequence homology. Therefore it is reasonable to assume that a vaccine directed to BKPyV will be effective against other human polyoma viruses.
  • epitopes 9m165 SEQ ID NO:15
  • 9m176 SEQ ID NO:21
  • 9m199 SEQ ID NO:29
  • 9m201 SEQ ID NO:30
  • 9m216 SEQ ID NO:34
  • 9m571 SEQ ID NO:66
  • 9m579 SEQ ID NO:72
  • Epitopes 9m145 SEQ ID NO:9
  • 9m227 SEQ ID NO:39
  • 9m230 SEQ ID NO:40
  • 9m436 SEQ ID NO:74
  • LP-AVY Long peptides LP-AVY (SEQ ID NO:101 ) and LP-LLE (SEQ ID NO:1 1 1 ) are likewise identical, and LP-NFC (SEQ ID NO:103) and LP-FLI (SEQ ID NO:104) differ only by one amino acid.
  • RP-14 SEQ ID NO:1 12 is expected to give a cross-reactive response to JCPyV because the epitopes contained in this RP have (not identical but) highly conserved sequences.
  • the invention further relates to those closely related immunogenic epitope peptide sequences of JC polyomavirus of SEQ ID NO: 121 to 139, and peptides of 10 to 50 amino acids comprising these.
  • Table 4 Immunogenic JCPyV LTag epitopes
  • BKPyV and MCPyV LTag (SEQ ID NO:120) sequences have been aligned, and it was found that epitope 9m222 (SEQ ID NO:36) is identical.
  • Epitopes 9m570 (SEQ ID NO:65) and 9m571 (SEQ ID NO:66) differ only by one amino acid.
  • the invention further relates to immunogenic epitope peptide sequences of MC polyomavirus of SEQ ID NO: 140 to 164, and peptides of 10 to 50 amino acids comprising these.
  • Table 5 Immunogenic MCPyV LTag epitopes
  • the invention further relates to a carrier comprising a recombinant peptide as described in the preceding paragraphs.
  • Carriers considered are recombinant virus-like particles, virosomes, virosomes that are surrounded by a lipid envelope, liposomes consisting of one or several phospholipid bilayers that can encapsulate antigens, immunostimulating complexes (ISCOMs) made of cholesterol, phospholipids and saponin that are able to form a complex of micelles wherein antigens can be contained, polymeric nanoparticles that are made of polymers like dextran or chitosan, or non-degradable nanoparticles made of gold or carbon that can accommodate antigens
  • ISCOMs immunostimulating complexes
  • the carrier according to the invention may further comprise other B- and/or T-cell epitopes, proteins selected from the group consisting of additional foreign antigenic sequences, cytokines, CpG motifs, g-CMSF, CD19, and CD40 ligand, and/or fluorescent proteins, proteins useful for purification purposes of the particles or for attaching a label, and/or proteinaceous structures required for transport processes.
  • the invention relates to a nucleic acid encoding the proteins as defined above, to a vector comprising such nucleic acid, for example a baculovirus vector, and a host cell comprising such a vector, and to methods of manufacturing virus-like particles according to the invention using a baculovirus vector.
  • a DNA of the invention encodes the amino acid sequences of SEQ ID NO:.
  • Preferred DNA is listed in the following table: Table 6: Preferred DNA of epitopes, long peptides and preferred recombinant peptides
  • KMDSVIFDFLHCIVF aaaatggatagcgtgatttttgattttctgcattgcattgtgtttaac
  • NVNLPMERLT gctgaacgtgaacctgccgatggaacgcctgacc
  • An example of a vector comprising a DNA of the invention is a baculovirus, for example a baculovirus of the Bac-to-BacTM system marketed by Invitrogen.
  • Host cells are those particularly suitable for the preferred vectors.
  • the corresponding host cell is an Sf9 insect cell.
  • the invention further relates to a vaccine against polyomavirus infection comprising a a carrier loaded with peptides of the invention as described above, and optionally further viscosity-regulating compounds, stabilizing compounds and/or an adjuvant increasing the immunogenicity, as it is known in the state of the art.
  • a vaccine may comprise an adjuvant selected from the group consisting of aluminium hydroxide, alum, AS01 , AS02, AS03, AS04, MF59, MPL, QS21 , ISCOMs, IC31 , unmethylated CpG, AD VAX, and
  • Cytokines such as GM-CSF, IL-2, IL-7, IL-12 or type-l IFNs could be used as additional adjuvants.
  • the invention further relates to methods of prophylaxis of polyomavirus infection and treatment of against polyomavirus infection using such vaccines.
  • Polyomavirus infections considered are (1 ) BKPyV reactivation in kidney transplant recipients causing nephropathy and/or graft loss, (2) BKPyV reactivation in hematopoietic stem cells recipients that can cause hemorrhagic cystitis, (3) JCPyV reactivation that is responsible for progressive multifocal leukoencephalopathy in some immunocompromised patients such as AIDS individuals, natalizumab-treated multiple sclerosis patients and transplant recipients, and (4) Merkel cell carcinoma.
  • the vaccines comprising VLPs of this invention are used in a method of prophylaxis.
  • a method for vaccinating a human uses a vaccine of the present invention comprising VLPs in the range of 1 ⁇ g to 100 mg/dose, in particular 10 ⁇ g to 10 mg/dose.
  • An average human of 70 kg is assumed to receive at least a single vaccination.
  • a dosage regimen comprising 3 doses applied at 0, 8 and 24 weeks, optionally followed by a second vaccination round 12-24 months after the last immunization is chosen.
  • Preferred routes of administration are subcutaneous and intramuscular administration, but intradermal and intranasal are also suitable administrations.
  • the vaccines of this invention are likewise used in a method of therapeutic treatment.
  • a method for vaccinating a human for treatment purposes uses a vaccine of the present invention comprising VLPs in the range of 1 ⁇ g to 100 mg/dose, in particular 10 ⁇ g to 10 mg/dose.
  • An average human of 70 kg is assumed to receive at least a single vaccination.
  • a dosage regimen comprising 3 doses applied at 0, 8 and 24 weeks, optionally followed by a second vaccination round 12-24 months after the last immunization is chosen.
  • the vaccines of the present invention comprises VLPs in the range of 1 ⁇ g to 100 mg/dose, in particular 5 ⁇ g to 10 mg/dose for adults and half this dose for children.
  • the method of treatment of the invention is particularly important for immunocompromised individuals, and especially for solid organ, bone marrow and/or stem cell transplant recipients. For these patients a fast and effective CD8+ and CD4+ T-cell response is crucial.
  • the vaccine of the present invention is in the range of 1 ⁇ g to 100 mg/dose.
  • An average human of 70 kg is assumed to receive at least once a vaccination.
  • Preferably a dosage regimen comprising 3 doses applied at 0, 2 and 4 weeks before transplantation, optionally followed by a second vaccination round 1 , 4, 8 weeks after the transplantation is chosen.
  • the invention further relates to a diagnostic method using these peptide epitopes or nucleic acids encoding these.
  • the polyoma EVGR epitopes herein described can be used in a diagnostic assay for detecting BKPyV-specific immune responses in patients at risk for BKPyV disease. This includes patients undergoing kidney transplantation or other immunocompromised patients. Furthermore, such an assay can be used to identify patients regaining BKPyV- specific T-cell control and aid in the tailoring of immunosuppression reduction, which currently is the only recommended treatment option for patients with BKPyV viremia and nephropathy.
  • An assay according to the invention relies on a standardized collection of patient's blood either in specialized tubes coated with the BKPyV 9mer-peptides to stimulate CD8+T-cells, or uses an ELISpot format in microtiter plates.
  • the immunogenic 9mer peptides induce IFN- ⁇ production and the amount of released IFN- ⁇ is subsequently measured by ELISA, or the number of IFN-v-secreting cells is determined by ELISpot, or the number of IFN- ⁇ producing cells is enumerated by flow-cytometry, or are captured by magnetic beads coated with monoclonal antibodies or streptamers.
  • the lack of polyomavirus-specific immunity allows identifying patients at risk of polyomavirus replication and disease, which helps for individualized therapy, allows following recovery of individual patients, and/or allows selecting and enriching BKPyV- specific T-cells for adoptive cell therapy.
  • the invention relates to an immunological test of BKPyV-specific T-cell response using the BKVyP peptide epitopes and measure cytokine production, such as production of interferon-gamma, tumor necrosis factor alpha, interleukin-2, interleukin-4, interleukin-33, interleukin-15, interleukin-17, and the like.
  • the invention relates to capture and adoptive T-cell transfer of peptide responsive T-cells for immunotherapy of patients with disease or at risk of disease.
  • PBMCs were obtained from 42 healthy individuals (HI, median age was 46 years old; see Table 7) being BKPyV-lgG seropositive as defined by the normalized OD 4 92n m of >0.1 at 200-fold dilution (Figure 2), which was previously shown to be very high sensitive and specific (Kardas P et al., J Clin Virology 2015;71 :28-33). Because of the low BKPyV- specific T-cell frequency in PBMCs, an in vitro expansion protocol was adopted (Binggeli S et al., Am J Transplant.
  • 15mP is a pool of 180 overlapping 15mer-peptides spanning EVGR sequence.
  • 9mP is a pool of 9mer-peptides corresponding to the BKPyV EVGR 9mer-epitopes predicted by two computer algorithms (Syfpeithy and Immune Epitope Data Base (IEDB)).
  • LPP is a pool of long peptides (15-27aa) covering those BKPyV EVGR 9mer-epitopes.
  • 9msP are sub- pools containing 8-10 9mer-peptides, each one being contained in two sub-pools in order to be cross-identified (Table 8).
  • Line 3 shows the number of healthy individuals in each HLA group
  • PBMCs were stained with CFSE before expansion, and labeled for CD8 and HLA-B * 0702-positive 9m127-streptamer after expansion.
  • CSFE dilution indicated the presence of at least 9 divisions of the CD8+T-cell population ( Figure 3E, left panel).
  • HLA-B * 0702-positive 9m127-specific CD8+T-cells showed the lowest CSFE signals indicating that these cells had divided close to once per 1 -2 days during the expansion period (Figure 3E, right panel).
  • T-cells functionality was also investigated in a killing assay where lytic activity of expanded T-cells against autologous 51 Cr-labelled PHA-blasts pulsed with the single 9m127 or with 9mP was assessed (Figure 3G).
  • the results show that 9m127 mediates a mean specific lysis of 48% at an effector:target ratio of 20:1. This single 9m127 response was comparable to the one mediated by 9mP, in line with an immunodominant BKPyV epitope.
  • this experimental approach permitted to functionally identify candidate 9mer- epitopes from BKPyV recognized by CD8+T-cells in BKPyV-seropositive healthy individuals (HI), even if cells were present at a low frequency among PBMCs.
  • the responses induced by 15mP (15mer peptide pool) and 9mP (9mer peptide pool) did not correlate, suggesting the presence of independent populations among BKPyV-specific T-cells.
  • Table 9 HLA-A and -B specificity of BKPyV EVGR CD8+T-cell responses in healthy individuals
  • T-cells presenting 9m127 via HLA-A * 02 molecule could not be detected, despite high 9m127-specific IFN- ⁇ T-cell responses among HLA-A * 02 positive healthy individuals ( Figure 4A), suggesting that those responses were not HLA-A * 02 restricted or that HLA-A * 02 9m127-streptamers were not efficiently presented or binding.
  • HLA-A * 02-positive T-cells specific for 9m679 could be detected in 50% of tested HLA-A * 02 individuals despite a low amount of responsive donors in IFN- ⁇ ELISpot assay (18%).
  • HLA-A * 03-positive 9m327-specific T-cells could be detected in 40% HLA-A * 03 HI (9m327 elicited IFN- ⁇ responses in HLA-A * 03, -A * 1 1 and -B * 07 donors); - HLA-A * 24-positive 9m389-specific T-cells could be detected in 14% healthy individuals (9m389 elicited IFN- ⁇ responses in HLA-A * 02, -A * 1 1 and -A * 24 donors);
  • HLA-B * 07-positive 9m301 -specific T-cells could be detected in the only tested HLA-B * 07 individual (9m301 elicited IFN- ⁇ responses in HLA-A * 02, - * A24 and -B * 07 donors);
  • HLA-B * 40-positive 9m1 19-specific T-cells could be detected in 50% HLA-B 0 healthy individuals (9m1 19 elicited IFN- ⁇ responses in HLA-B * 07, -B * 40, and -B * 44 donors).
  • T-cell activating 9mers were presented by more than one HLA molecule, namely 9m121 (HLA-B * 35 and -B * 39), 9m127 (HLA-B * 07 and -B * 08) and 9m240 (HLA- B * 35 and -B * 39) (Table 9).
  • BKPyV-specific T-cell responses were investigated in 19 pediatric kidney transplant recipients who had been protected or recovered from BKPyV viremia. Several epitopes identified in healthy individuals could be confirmed in these 19 kidney transplant recipients (Table 10).
  • KTRs kidney transplant recipients; SFU, spot forming unit 9m389 was recognized in 67% HLA-A * 02 patients with a mean value of 312 SFU/10 6 cells, but HLA-A * 02 restriction could not be confirmed.
  • This epitope induced T-cell responses in 33%, 50%, 50% and 40% H LA- A * 1 1 , -A * 24, -B * 07 and -B * 51 patients respectively, with HLA-specificity confirmed for HLA-A * 24 and -B * 51 molecules.
  • 9m679 was found to be immunogenic in 8 of 9 tested HLA-A * 02 patients, and specific CD8+T- cells were detectable in 36% of HLA-A * 02 patients.
  • 9m327 could be confirmed by ELISpot assays and MHC-streptamer staining in kidney transplant recipients positive for HLA- A * 01 , -A * 03, and -A * 1 1.
  • 9m 127 elicited T-cell responses in 100% HLA- B * 07 and -B * 08 patients, and MHC-streptamer staining identified CD8+T-cells for one HLA-B * 07 patient.
  • Plasma samples were used for BKPyV and JCPyV serology using a virus-like particles (VLPs)-based ELISA.
  • VLPs virus-like particles
  • BKPyV-specific IgG levels increase over time in patients undergoing viral reactivation.
  • PBMCs were thawed and tested in an "ex vivo" IFN- ⁇ ELISpot upon stimulation with BKPyV LTag-derived peptides, namely a pool of 180 overlapping 15mers (15mP) spanning the whole BKPyV LTag sequence and a pool of 97 9mers (9mP) predicted to be immunogenic in a wide range of individuals (Cioni M, Leboeuf C et al., Am J Transplant. 2016;4:1 193-1206).
  • PBMCs were cultured in vitro for 2 weeks in the presence of BKPyV LTag 15mP and cytokines in order to expand BKPyV LTag-specific T-cells.
  • the cells were tested again by IFN- ⁇ ELISpot ("expanded" IFN- ⁇ ELISpot) upon stimulation with 15mP, 9mP and single 9mers allowing the identification of immunodominant BKPyV LTag epitopes.
  • IFN- ⁇ ELISpot expanded IFN- ⁇ ELISpot
  • BKPyV LTag 15mP responses at the time of transplantation and 6 months after transplantation are significantly higher in non-viremic patients than in viremic patients.
  • the described expansion protocol allows a dramatic increase of the frequency of BKPyV-specific T-cells in both viremic and non-viremic patients (Figure 8).
  • Cellular immune responses to individual BKPyV LTag epitopes in both viremic and non- viremic patients were detected, as shown by Figure 9.
  • a high diversity of the response was observed, since 53 and 67 epitopes were identified in viremic patients and non- viremic patients, respectively.
  • Some epitopes were frequently detected in healthy individuals (Cioni M, Leboeuf C et al., Am J Transplant. 2016;4:1 193-1206), whereas others were not.
  • Group 1 contains patients with viremia starting and resolving between TO and T6; group 2 contains patients viremia starting between TO and T6 and resolving between T6 and T12; group 3 contains patients viremia starting between TO and T6 and resolving after T12; group 4 contains patients viremia starting and resolving between T6 and T12; group 5 contains patients viremia starting between T6 and T12 and resolving after T12; group 6 contains patients without any viremia episode (non-viremic patients).
  • BKPyV-associated nephropathy is now widely recognized as an emerging complication in kidney transplant recipients.
  • Insufficient BKPyV-specific T-cell control of the recipient over viral replication in donor allograft is suspected as the common denominator and key mechanism.
  • HLA-types that belong to the cross-reacting group (CREG)-1 C e.g. HLA-A * 01 , -A * 03, and -A * 1 1 , or CREG-7C e.g. HLA-B * 07 and -B * 08 (Wade J.A. et al., Blood. 2007;109:4064-70).
  • CREG cross-reacting group
  • PBMCs Peripheral blood mononuclear cells
  • Kidney transplant recipients from the Swiss Transplant Cohort Study (STCS) (Project ID FUP056) will be included and tested within a retrospective study.
  • STCS Swiss Transplant Cohort Study
  • Plasma and PBMCs samples were isolated from patient's blood at different timepoints (time of transplantation, 6 months and 12 months post-transplantation) and were cryopreserved in each transplant center. Cryo-preserved samples from 98 kidney transplant recipients from the Basel transplant center were analysed and the results presented here.
  • BKPyV IgG serology was performed using BKPyV VP1 -derived virus-like particles as described previously (Kardas P et al., J Clin Virology 2015;71 :28-33).
  • Syfpeithy database http://www.syfpeithi.de/bin/MHCServer.dll/EpitopePrediction.htm
  • Immune Epitope Data Base http://www.iedb.org/; IEDB 2.0
  • the predictions were limited to HLA-A and -B types present in more than 5% of the population within Europe or North America (http://www.allelefrequencies.net/). For each HLA allele, the 20 epitopes within BKPyV EVGR sequence displaying the best scores in both algorithms were considered.
  • a pool of 180 overlapping 15mer-peptides (15mP) spanning BKPyV EVGR (Dunlop strain) or a pool of 1 1 longer peptides LPm1 -1 1 (LPP) covering immunodominant clusters of predicted BKPyV 9mer-epitopes were used for in vitro T-cell expansion. Cells were re- stimulated after expansion as reported (Binggeli S et al., Am J Transplant. 2007;7:1 131 -9) using 15mP or a pool of 73 predicted 9mer-peptides (9mP).
  • the 9mer-peptides were also resuspended in different sub-pools according to a checkerboard matrix approach, from A to H and from 1 to 9 (called 9msA to H and 9ms1 to 9). Each one of the 73 peptides was present in two sub-pools.
  • An additional set of 24 9mer-peptides that were initially not predicted by computer algorithms and 3 longer peptides were later synthesized and used to assess "prediction gaps" in EVGR sequence. All peptides were >70% pure and resuspended in DMSO (10mg/ml; Eurogentec GmbH, Koln, Germany).
  • Freshly isolated or thawed PBMCs were stimulated with LPP or 15mP (200ng/ml) in 24 well-plate and incubated for 7-14 days at 37°C 5% C0 2 before performing phenotypic and functional assays.
  • Recombinant human IL-2 (20U/ml, Peprotech, Rocky Hill, NJ, USA) and recombinant IL-7 (5ng/ml, Peprotech) were added once a week.
  • PDVF multiscreen filter 96 well plates (MSIPS4W10, Millipore Bedford, MA) are coated with 10 ⁇ of anti-IFN- ⁇ mAb 1 -D1 K (Mabtech, Nacka, Sweden) at 10Mg/ml and incubated overnight at 4°C. After three washing steps using PBS, freshly isolated PBMCs
  • Staphylococcus enterotoxin B (SEB) (2 g/m ⁇ ; Sigma, Saint Louis, Missouri, USA) or Phytohemagglutinin-L (PHA) (2 g/m ⁇ ; Roche Diagnostics GmbH, Mannheim, Germany) served as positive control.
  • SEB Staphylococcus enterotoxin B
  • PHA Phytohemagglutinin-L
  • the plates are washed five times with PBS 0.05% Tween-20 and anti-IFNy mAb 7-B6-1 -Biotin (Mabtech) is added at 1 ⁇ g ml for 3h at RT.
  • Streptavidin ALP (Mabtech) is added at 1 ⁇ g ml for 1 h at RT.
  • the plates are washed five times with PBS 0.05% Tween-20 and tap water before incubation with SigmaFast BCIP/NBT (Sigma-Aldrich Chemie GmbH Buchs SG, Switzerland) for 20 minutes at room temperature in the dark. Plates are rinsed with water, dried and spots counted with an ELISpot reader (Cellular Technology Ltd Europe, Bonn, Germany). ELISpot data are averaged duplicate or triplicate wells with background wells subtracted. MHC-streptamer staining
  • MHC- streptamers obtained from custom service (IBA GmbH, Gottingen, Germany). Peptide- loaded MHC molecules are incubated with PE- or APC-coupled Strep Tactin for 45 minutes on ice before being incubated with 2-10x10 5 cells for 45 minutes on ice. After washing with immunostaining IS buffer (IBA), cells are incubated with CD8-PE-Cy7 antibody (BD Biosciences, San Jose, CA, USA) for 15min on ice, washed with IS buffer and acquired on a flow cytometer (FACSCanto; BD Biosciences) using the FACSDiva software. Gating is performed on live cells using forward scatter and side scatter profiles, and doublets are excluded. Data are reported as percentage of specific populations after subtracting the negative control (PE or APC-coupled Strep Tactin alone).
  • PBMCs were resuspended at a concentration of 5x10 6 /ml in PBS containing 5 ⁇ carboxyfluorescein diacetate succinimidyl ester (CFSE; eBioscience, Vienna, Austria). After 15min incubation at RT on a shaker, cells were washed twice with culture medium and resuspended in fresh medium for BKPyV-specific T-cell expansion described above. Cells were stained with specific MHC-streptamers and CD8 as described above and their CFSE content was analysed by flow cytometry. CD 707a degranulation assay
  • Expanded T-cells were resuspended in fresh medium (2x10 6 /ml) and seeded in a 96-well plate (2x10 5 cells per well).
  • the BKPyV 9mer-peptide of interest was added to the cultures ( ⁇ g/ml) for 5h-stimulation at 37°C.
  • Phorbol 12-myristate 13-acetate (PMA; 100ng/ml; Sigma) and ionomycin ( ⁇ g/ml; Sigma) were used as positive control, and a BKPyV 9mer- peptide of another HLA specificity was used as negative control.
  • PE-Cy7-labelled CD107a antibody (BD Biosciences) or PE-Cy7-labelled isotype control (BD Biosciences) was added during the whole period of stimulation, whereas monensin (0.3 ⁇ per well; BD Biosciences) and brefeldin A (1 C ⁇ g/ml; Sigma) were added for the last 4h only. Cells were then labeled for specific MHC-streptamers and CD8 as described above and analysed by flow cytometry.
  • Effector T-cells were incubated with 2x10 3 target cells at different effector:target (E:T) cell ratios for 4h at 37°C 5%C0 2 . Then 50 ⁇ of the supernatant was transferred to a lumaplate (Perkin Elmer, Waltham, Massachusetts, USA) and dried. Counts per minutes (cpm) were counted in a ⁇ -counter (TopCount, Perking Elmer).
  • Killing data are the average of duplicate wells and calculated as percentage of lysis according to following formula: (Sample cpm-Spontaneous Release cpm)/(Maximum Release cpm/Spontaneous Release cpm)X100, where Spontaneous Release corresponds to 51 Cr release by target cells alone and Maximum Release corresponds to 51 Cr release by target cells mechanically lysed. Data were considered reliable when Minimum release was less than 50% of Maximum Release. Statistical analysis
  • BKPyV viruria and viremia were measured at predefined time points (1 , 3, 6, 9, 12, 18, 24 months after transplantation and yearly thereafter) by the Transplantation & Clinical Virology laboratory in Basel using a quantitative real-time polymerase chain reaction (PCR).
  • BKPyV viruria was defined by a urine viral load of >2500 genome equivalents (GEq)/mL, high-level BKPyV viruria by >7 Iog10 GEq/mL and BKPyV viremia by >1000 GEq/mL. Based on protection and recovery from BKPyV viruria and viremia, PBMCs samples of 19 kidney transplant recipients were selected and analysed.
  • BKPyV VP1 -derived virus-like particles were used as antigen to detect BKPyV IgG as described (Binggeli S. et al., Am J Transplant. 2007;7:1 131 -9). Each serum sample was serially diluted 1 :100, 1 :200 and 1 :400 and the optical density (OD) was measured at 492nm. The OD 4 92nm values were normalized to the OD 49 2n m of an internal reference serum, sera with a normalized OO at the 1 :200 dilution were defined as IgG positive.
  • PBMCs from anticoagulated blood or from buffy coat preparations were diluted 1 :2 in D- PBS w/o Ca 2+ and Mg 2+ , and overlaid on Ficoll (Lymphoprep, Axis-Shield PoC AS, Oslo, Norway). After centrifugation (room temperature, 800g; 25 minutes (min)), PBMCs were recovered, and washed twice i.e. resuspended in D-PBS w/o Ca 2+ and Mg 2 , and centrifuged (RT, 300g, 10min). The cells were counted and resuspended in culture medium RPMI-1640 supplemented with 5% Human Serum AB and 2mM of L-Ala-
  • PBMCs Freshly isolated or thawed PBMCs were seeded at a concentration of 2x10 6 /ml in culture medium in 24 well-plate after the number of viable cells was counted using Trypan Blue exclusion. PBMCs were stimulated with LPP or 15mP (200ng/ml), and incubated for 9-14 days at 37°C 5% C0 2 before phenotypic and functional assays were carried out.
  • PBMCs obtained from cryopreserved samples from pediatric KTRs were first thawed and resuspended in pre-warmed culture medium. The number of viable cells was counted using Trypan Blue solution. The cells were resuspended at the concentration of 2x10 6 /ml in culture medium, seeded in 24 well-plate and incubated with 200ng/ml 15mP at 37°C 5%C0 2 . Recombinant IL-2 (20U/ml) and recombinant IL-7 (5ng/ml) were added at day 3, before performing phenotypical and functional assays at day 7. Determination of IFN-y
  • the protocol is adapted from QuantiFERON-TB Gold PlusTM (Qiagen).
  • At least three tubes have to be used in that assay, a negative control tube, a tube coated with the BKPyV antigen and a positive control tube containing a mitogen.
  • Each QTF-PlusTM blood collection tube is filled up with 1 ml of patient blood and shaked 10 times so the entire inner surface of the tube is coated with blood. After 16-24 hours incubation at 37°C, the tubes are centrifugated for 15 minutes at 2000 to 3000g and plasma is harvested. The plasma samples (150 ⁇ ) can be run directly or stored for up to 28 days at 2-8°C or at -20°C for extended periods. The plasma samples are loaded into a QFT-PlusTM ELISA plate coated with anti-human IFN- ⁇ monoclonal antibody, and mixed with an anti-human IFN- ⁇ HRP. After 2 hours incubation at room temperature, the wells are washed 6 times and Enzyme Substrate is added for 30 minutes at room temperature in the dark. The reaction is stopped with Enzyme Stopping Solution and the optical density is read at 450nm with a microplate reader.
  • a standard curve allows calculating the IFN- ⁇ concentration (Ul/ml) for each of the tested plasma samples, using the OD values of each sample.
  • HLA-transgenic mice from Taconic will be used for the in vivo proof-of-concept of the use of BKPyV-derived long peptides as a vaccine as follows: Three intraperitonal injection of BKPyV LTag-derived long peptides, in combination with an adjuvant compound, are performed at one week-intervals. Blood samples are collected before each immunization, and splenocytes are harvested 7 days after the last immunization. Cellular immune responses to BKPyV induced by vaccination are assessed ex vivo by stimulating splenocytes with different BKPyV LTag peptides in an IFN- ⁇ ELISpot assay.
  • BKPyV-specific T-cells are investigated by cell surface staining with MHC multimers and FACS analysis. In vitro expansion of splenocytes with BKPyV-derived peptides are considered as well before doing functional and phenotypical analysis.
  • mice per group Five mice per group will be included in order to ensure robust statistics. Mice injected with adjuvant alone will serve as negative controls.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne des épitopes de peptide immunodominants de polyomavirus BK, JC et MC ; des supports, tels que des particules pseudovirales, des virosomes ou des nanoparticules, comprenant de tels épitopes peptidiques ; des vaccins contre une infection à polyomavirus comprenant de tels épitopes peptidiques et/ou supports chargés ; et des acides nucléiques codant pour ces épitopes peptidiques. L'invention concerne en outre des procédés diagnostiques et thérapeutiques utilisant ces épitopes peptidiques dans des maladies associées à un polyomavirus telles qu'une néphropathie ou une cystite hémorragique d'importance pour les receveurs de greffe.
PCT/EP2016/073760 2015-10-06 2016-10-05 Épitopes peptidiques immunodominants spécifiques pour vaccin contre polyomavirus WO2017060283A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15188578 2015-10-06
EP15188578.7 2015-10-06

Publications (1)

Publication Number Publication Date
WO2017060283A1 true WO2017060283A1 (fr) 2017-04-13

Family

ID=54293079

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/073760 WO2017060283A1 (fr) 2015-10-06 2016-10-05 Épitopes peptidiques immunodominants spécifiques pour vaccin contre polyomavirus

Country Status (1)

Country Link
WO (1) WO2017060283A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111801111A (zh) * 2018-01-19 2020-10-20 威斯塔解剖学和生物学研究所 梅克尔多元癌细胞病毒的大和小t抗原、核酸构建体和由此制造的疫苗及其使用方法
WO2021014213A1 (fr) * 2019-07-24 2021-01-28 The Council Of The Queensland Institute Of Medical Research Immunothérapie pour polyomavirus
US20210301344A1 (en) * 2018-06-18 2021-09-30 Universite Paris-Saclay Method for stratifying the risk of bk virus nephropathy after a kidney transplant

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070026503A1 (en) 2005-07-22 2007-02-01 City Of Hope Polyomavirus cellular epitopes and uses therefor
WO2008116468A2 (fr) 2007-03-26 2008-10-02 Dako Denmark A/S Complexes peptidiques du cmh et leurs utilisations dans des maladies infectieuses
WO2013087601A2 (fr) * 2011-12-12 2013-06-20 Janssen Diagnostics Bvba Séquences peptidiques de polyomavirus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070026503A1 (en) 2005-07-22 2007-02-01 City Of Hope Polyomavirus cellular epitopes and uses therefor
WO2008116468A2 (fr) 2007-03-26 2008-10-02 Dako Denmark A/S Complexes peptidiques du cmh et leurs utilisations dans des maladies infectieuses
WO2013087601A2 (fr) * 2011-12-12 2013-06-20 Janssen Diagnostics Bvba Séquences peptidiques de polyomavirus

Non-Patent Citations (31)

* Cited by examiner, † Cited by third party
Title
BINGGELI S ET AL., AM J TRANSPLANT, vol. 7, 2007, pages 1131 - 1139
BINGGELI S ET AL., TRANSPLANTATION, 2006, pages 94
BINGGELI S. ET AL., AM J TRANSPLANT., vol. 7, 2007, pages 1131 - 1139
CIONI M; LEBOEUF C ET AL., AM J TRANSPLANT, vol. 4, 2016, pages 1193 - 1206
DATABASE Geneseq [online] 2 April 2009 (2009-04-02), "BK virus antigen class I peptide SEQ ID NO:13744.", XP002764319, retrieved from EBI accession no. GSP:AWC21683 Database accession no. AWC21683 *
DATABASE Geneseq [online] 2 April 2009 (2009-04-02), "BK virus antigen class II peptide SEQ ID NO:43058.", XP002764318, retrieved from EBI accession no. GSP:AWC50997 Database accession no. AWC50997 *
FOURNILLIER A ET AL: "Primary and memory T cell responses induced by hepatitis C virus multiepitope long peptides", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 24, no. 16, 12 April 2006 (2006-04-12), pages 3153 - 3164, XP028010603, ISSN: 0264-410X, [retrieved on 20060412], DOI: 10.1016/J.VACCINE.2006.01.039 *
GINEVRI F ET AL., AM J TRANSPLANT., vol. 7, 2007, pages 2727 - 2735
GOSERT R ET AL., J EXP MED., vol. 205, 2008, pages 841 - 852
JONGMING LI ET AL: "T-cell responses to peptide fragments of the BK virus T antigen: implications for cross-reactivity of immune response to JC virus", JOURNAL OF GENERAL VIROLOGY, SOCIETY FOR GENERAL MICROBIOLOGY, SPENCERS WOOD, GB, vol. 87, no. 10, 1 October 2006 (2006-10-01), pages 2951 - 2960, XP002665598, ISSN: 0022-1317, DOI: 10.1099/VIR.0.82094-0 *
KARDAS P ET AL., J CLIN VIROLOGY, vol. 71, 2015, pages 28 - 33
LI J ET AL., J GEN VIROL., vol. 87, 2006, pages 2951 - 2960
MASUTANI K ET AL., NEPHROL DIAL TRANSPLANT, vol. 28, 2013, pages 3119 - 3126
MATAS A.J. ET AL., AM J TRANSPLANT., vol. 15, no. 2, 2015, pages 1 - 34
PROVENZANO M ET AL., J TRANSL MED., vol. 4, 2006, pages 47
PROVENZANO M. ET AL., J TRANSL MED., vol. 4, 2006, pages 47
RAMASWAMI B ET AL., HUM IMMUNOL., vol. 70, 2009, pages 722 - 728
RAMASWAMI B ET AL: "HLA-A01-, -A03-, and -A024-binding nanomeric epitopes in polyomavirus BK large T antigen", HUMAN IMMUNOLOGY, NEW YORK, NY, US, vol. 70, no. 9, 1 September 2009 (2009-09-01), pages 722 - 728, XP026494477, ISSN: 0198-8859, [retrieved on 20090514], DOI: 10.1016/J.HUMIMM.2009.05.003 *
RANDHAWA P S ET AL: "Detection of CD8<+> T Cells Sensitized to BK Virus Large T Antigen in Healthy Volunteers and Kidney Transplant Recipients", HUMAN IMMUNOLOGY, NEW YORK, NY, US, vol. 67, no. 4-5, 1 April 2006 (2006-04-01), pages 298 - 302, XP024993257, ISSN: 0198-8859, [retrieved on 20060401], DOI: 10.1016/J.HUMIMM.2006.02.031 *
RANDHAWA P.S. ET AL., HUM IMMUNOL., vol. 67, 2006, pages 298 - 302
RINALDO C.H.; HIRSCH H. H., APMIS, vol. 121, 2013, pages 681 - 684
SCHACHTNER T ET AL., AM J TRANSPLANT., vol. 11, 2011, pages 2443 - 52
SCHACHTNER T. ET AL., AM J TRANSPLANT, vol. 15, 2015, pages 2159 - 2169
SCHMIDT T ET AL., AM J TRANSPLANT, vol. 14, 2014, pages 1334 - 1345
SCHOLLER J ET AL: "BK virus antigen class I peptide SEQ ID NO:13742", GENESEQ,, 2 October 2008 (2008-10-02), XP002755323 *
THOMSON S A ET AL: "RECOMBINANT POLYEPITOPE VACCINES FOR THE DELIVERY OF MULTIPLE CD8 CYTOTOXIC T CELL EPITOPES", THE JOURNAL OF IMMUNOLOGY, THE AMERICAN ASSOCIATION OF IMMUNOLOGISTS, US, vol. 157, 1 January 1996 (1996-01-01), pages 822 - 826, XP002039433, ISSN: 0022-1767 *
TORRESI JOSEPH ET AL: "A self-adjuvanting multiepitope immunogen that induces a broadly cross-reactive antibody to hepatitis C virus", HEPATOLOGY,, vol. 45, no. 4, 1 April 2007 (2007-04-01), pages 911 - 920, XP009090063, ISSN: 0270-9139, DOI: 10.1002/HEP.21538 *
TRYDZENSKAYA H. ET AL., TRANSPLANTATION, vol. 92, 2011, pages 1269 - 1277
TRYDZENSKAYA HANNA ET AL: "Novel Approach for Improved Assessment of Phenotypic and Functional Characteristics of BKV-Specific T-Cell Immunity", TRANSPLANTATION (HAGERSTOWN), vol. 92, no. 11, December 2011 (2011-12-01), pages 1269 - 1277, XP002755324, ISSN: 0041-1337 *
WADE J.A. ET AL., BLOOD, vol. 109, 2007, pages 4064 - 4070
WEIST B.J. ET AL., MED MICROBIOL IMMUNOL., vol. 203, 2014, pages 395 - 408

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111801111A (zh) * 2018-01-19 2020-10-20 威斯塔解剖学和生物学研究所 梅克尔多元癌细胞病毒的大和小t抗原、核酸构建体和由此制造的疫苗及其使用方法
EP3740226A4 (fr) * 2018-01-19 2021-10-13 The Wistar Institute Of Anatomy And Biology Grands et petits antigènes t de polyomavirus de cellules de merkel, produits de recombinaison d'acides nucléiques et vaccins fabriqués à partir de ceux-ci, et leurs procédés d'utilisation
US11524065B2 (en) 2018-01-19 2022-12-13 The Wistar Institute Of Anatomy And Biology Large and small T antigens of merkel cell polyomavirus, nucleic acid constructs and vaccines made therefrom, and methods of using same
US20210301344A1 (en) * 2018-06-18 2021-09-30 Universite Paris-Saclay Method for stratifying the risk of bk virus nephropathy after a kidney transplant
WO2021014213A1 (fr) * 2019-07-24 2021-01-28 The Council Of The Queensland Institute Of Medical Research Immunothérapie pour polyomavirus
CN114341164A (zh) * 2019-07-24 2022-04-12 昆士兰医学研究所理事会 用于多瘤病毒的免疫疗法

Similar Documents

Publication Publication Date Title
Zhou et al. Acute SARS-CoV-2 infection impairs dendritic cell and T cell responses
Arunachalam et al. T cell-inducing vaccine durably prevents mucosal SHIV infection even with lower neutralizing antibody titers
Agrati et al. Immunological signature in human cases of monkeypox infection in 2022 outbreak: an observational study
Neidleman et al. mRNA vaccine-induced T cells respond identically to SARS-CoV-2 variants of concern but differ in longevity and homing properties depending on prior infection status
Thakur et al. Immune markers and correlates of protection for vaccine induced immune responses
Kohler et al. The early cellular signatures of protective immunity induced by live viral vaccination
Eggenhuizen et al. BCG vaccine derived peptides induce SARS-CoV-2 T cell cross-reactivity
Ricciardi et al. Ontogeny of the B-and T-cell response in a primary Zika virus infection of a dengue-naive individual during the 2016 outbreak in Miami, FL
Manigold et al. Highly differentiated, resting gn-specific memory CD8+ T cells persist years after infection by andes hantavirus
Nielsen et al. Protein/AS01B vaccination elicits stronger, more Th2-skewed antigen-specific human T follicular helper cell responses than heterologous viral vectors
Grabowska et al. Identification of promiscuous HPV16‐derived T helper cell epitopes for therapeutic HPV vaccine design
Parra et al. Circulating human rotavirus specific CD4 T cells identified with a class II tetramer express the intestinal homing receptors α4β7 and CCR9
JP5776684B2 (ja) 促進された共培養樹状細胞を使用して抗原特異的ｔ細胞応答を刺激するための方法
Ramaswami et al. The polyomavirus BK large T-antigen-derived peptide elicits an HLA-DR promiscuous and polyfunctional CD4+ T-cell response
Saggau et al. The pre-exposure SARS-CoV-2-specific T cell repertoire determines the quality of the immune response to vaccination
Lineburg et al. Rapid detection of SARS‐CoV‐2‐specific memory T‐cell immunity in recovered COVID‐19 cases
WO2017060283A1 (fr) Épitopes peptidiques immunodominants spécifiques pour vaccin contre polyomavirus
Juno et al. Immunogenic profile of SARS-CoV-2 spike in individuals recovered from COVID-19
Fahrner et al. The polarity and specificity of antiviral T lymphocyte responses determine susceptibility to SARS-CoV-2 infection in patients with cancer and healthy individuals
KR101968452B1 (ko) 면역요법 효능의 임상적 상관물
Neidleman et al. mRNA vaccine-induced SARS-CoV-2-specific T cells recognize B. 1.1. 7 and B. 1.351 variants but differ in longevity and homing properties depending on prior infection status
Sulbaran et al. Immunization with synthetic SARS-CoV-2 S glycoprotein virus-like particles protects macaques from infection
TW201245224A (en) Cytotoxic t cell inducing composition
JP6474788B2 (ja) 抗原特異的ｔ細胞応答を刺激するための方法
Liu et al. Cytotoxic T-lymphocyte responses to human papillomavirus type 16 E5 and E7 proteins and HLA-A* 0201-restricted T-cell peptides in cervical cancer patients

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16779047

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16779047

Country of ref document: EP

Kind code of ref document: A1