WO2017060247A1 - Humanized anti psa (5a10) antibodies - Google Patents

Humanized anti psa (5a10) antibodies Download PDF

Info

Publication number
WO2017060247A1
WO2017060247A1 PCT/EP2016/073684 EP2016073684W WO2017060247A1 WO 2017060247 A1 WO2017060247 A1 WO 2017060247A1 EP 2016073684 W EP2016073684 W EP 2016073684W WO 2017060247 A1 WO2017060247 A1 WO 2017060247A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody polypeptide
polypeptide according
antibody
prostate cancer
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/073684
Other languages
English (en)
French (fr)
Inventor
Amanda Thuy TRAN
Anders Axelsson
Cecilia Ann-Christin Malmborg Hager
Kjell SJÖSTRÖM
Sven-Erik Strand
Urpo Juhani LAMMINMÄKI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
FREDAX AB
Original Assignee
FREDAX AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB1517550.8A external-priority patent/GB201517550D0/en
Priority claimed from GBGB1519105.9A external-priority patent/GB201519105D0/en
Priority to PL16778330T priority Critical patent/PL3359189T3/pl
Priority to CN201680059166.8A priority patent/CN108136013B/zh
Priority to JP2018536343A priority patent/JP6916797B2/ja
Priority to CA2998818A priority patent/CA2998818A1/en
Priority to EP16778330.7A priority patent/EP3359189B1/en
Priority to AU2016334715A priority patent/AU2016334715B2/en
Priority to RU2018115734A priority patent/RU2753677C2/ru
Priority to DK16778330.7T priority patent/DK3359189T3/da
Priority to BR112018006820-9A priority patent/BR112018006820B1/pt
Priority to MX2018004071A priority patent/MX2018004071A/es
Priority to ES16778330T priority patent/ES2880682T3/es
Application filed by FREDAX AB filed Critical FREDAX AB
Priority to HK19101041.6A priority patent/HK1258674B/en
Priority to IL258189A priority patent/IL258189B2/en
Priority to LTEPPCT/EP2016/073684T priority patent/LT3359189T/lt
Priority to US15/761,260 priority patent/US11332543B2/en
Priority to KR1020187012299A priority patent/KR102783861B1/ko
Priority to EP21173910.7A priority patent/EP3922265A1/en
Publication of WO2017060247A1 publication Critical patent/WO2017060247A1/en
Priority to ZA2018/02019A priority patent/ZA201802019B/en
Anticipated expiration legal-status Critical
Priority to US17/717,254 priority patent/US12441808B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069Reproductive system, e.g. ovaria, uterus, testes, prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A61K47/6869Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell the tumour determinant being from a cell of the reproductive system: ovaria, uterus, testes, prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/08Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/10Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
    • A61K51/1045Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against animal or human tumor cells or tumor cell determinants
    • A61K51/1072Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against animal or human tumor cells or tumor cell determinants the tumor cell being from the reproductive system, e.g. ovaria, uterus, testes or prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/08Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/10Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
    • A61K51/1093Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody conjugates with carriers being antibodies
    • A61K51/1096Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody conjugates with carriers being antibodies radioimmunotoxins, i.e. conjugates being structurally as defined in A61K51/1093, and including a radioactive nucleus for use in radiotherapeutic applications
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57555Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/54F(ab')2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/567Framework region [FR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/624Disulfide-stabilized antibody (dsFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94Stability, e.g. half-life, pH, temperature or enzyme-resistance

Definitions

  • This invention pertains in general to the field of therapeutic and diagnostic agents and methods, particularly in field of prostate cancer.
  • Prostate cancer is at the present time the most common form of cancer among men.
  • the prostate is a walnut-sized gland in men that produces fluid that is a component in semen.
  • the prostate has two or more lobes, or sections, enclosed by an outer layer of tissue.
  • the prostate is located in front of the rectum and just below the urine bladder, and surrounds the urethra.
  • prostate cancer The occurrence of prostate cancer is highest in the northwestern part of Europe and in the United States. The growth of the tumour is usually a process that takes place during a long period of time. Prostate cancer is normally a mild form of cancer. In fact, the majority of men diagnosed with prostate cancer survive and recover, with only a minority of the men encountering a more aggressive form of prostate cancer, which metastasizes in an early stage. This aggressive form of prostate cancer may only be curable if it is diagnosed at an early stage, before the cancer has spread to extracapsular tissue.
  • PSA prostate specific antigen
  • Today, diagnosis and monitoring of prostate cancer is typically performed by measuring the concentration of a prostate specific antigen (PSA) in the blood of the patient. If the concentration of PSA is markedly high in several consecutive measurements, performed at different points of time, the assessment is that there is a probability of prostate cancer. At this point of time a biopsy may be performed to verify prostate cancer.
  • PSA also known as kallikrein III
  • PSA is a protein, constituted of a single chain of 237 amino acids, which is produced in the secretory cells of the prostate. These secretory cells may be found in the whole prostate gland. PSA is well established and thoroughly researched marker in respect of prostate cancer. By comparison with healthy cells the production of PSA is lower in malignant cells and higher in hyperplastic cells.
  • PSA serine protease suitable as a target for therapy of prostate cancer
  • Another important serine protease suitable as a target for therapy of prostate cancer is human glandular kallikrein 2 (hK2).
  • the gene coding hK2 is located on chromosome 19, together with the gene coding for PSA.
  • hK2 is expressed mainly in the prostate tissue, just as PSA.
  • PSA is present as an inactive pro-form and is activated through the peptidase action of hK2.
  • hK2 is expressed in relation to the level of differentiation. This means that hK2 is expressed in a higher yield in tissue of low differentiation, such as tissue subjected to prostate cancer, and in a lower yield in tissue of high differentiation, such as tissue subjected to benign prostatic hyperplasia (BPH) which is another common prostate problem.
  • tissue of low differentiation such as tissue subjected to prostate cancer
  • BPH benign prostatic hyperplasia
  • Today's therapies of prostate cancer are surgery (e.g., radical prostatectomy), radiation therapy (including, radium-223 chloride administration, brachytherapy and external beam radiation therapy), high-intensity focused ultrasound (HIFU), chemotherapy, oral chemotherapeutic drugs, cryosurgery (freezing the tumor), hormonal therapy (such as antiandrogen therapy), castration or combinations of the foregoing.
  • radiation therapy including, radium-223 chloride administration, brachytherapy and external beam radiation therapy
  • high-intensity focused ultrasound (HIFU) high-intensity focused ultrasound
  • chemotherapy e.g., oral chemotherapeutic drugs, cryosurgery (freezing the tumor)
  • hormonal therapy such as antiandrogen therapy
  • the present invention seeks to mitigate, alleviate or eliminate one or more of the above-identified deficiencies in the art and disadvantages singly or in any combination and solves at least the above mentioned problems by providing a therapeutic agents and methods according to the appended patent claims.
  • a first aspect of the present invention provides an antibody polypeptide with binding specificity for prostate specific antigen (PSA), wherein the antibody polypeptide comprises (a) a heavy chain variable region comprising the amino acid sequences of SEQ ID NO:1 and SEQ ID NO:2 and SEQ ID NO:3
  • CDRL1 RASQNVNTDVA SEQ ID NO: 4
  • CDRL2 STSYLQS SEQ ID NO: 5
  • CDRL3 QQYSNYPLT SEQ ID NO: 6 and wherein the heavy chain variable region and light chain variable region comprise framework amino acid sequences from one or more human antibodies.
  • antibody polypeptide we include substantially intact antibody molecules, single chain antibodies, diabodies, bispecific antibodies, antibody heavy chains, antibody light chains, homodimers and heterodimers of antibody heavy and/or light chains, as well as antigen binding fragments and derivatives of the same.
  • amino acid includes the standard twenty genetically-encoded amino acids and their corresponding stereoisomers in the 'D' form (as compared to the natural 'L' form), omega-amino acids other naturally-occurring amino acids, unconventional amino acids (e.g. ⁇ , ⁇ -disubstituted amino acids, N-alkyl amino acids, etc.) and chemically derivatised amino acids (see below).
  • amino acid When an amino acid is being specifically enumerated, such as “alanine” or “Ala” or “A”, the term refers to both L-alanine and D-alanine unless explicitly stated otherwise.
  • Other unconventional amino acids may also be suitable components for polypeptides of the present invention, as long as the desired functional property is retained by the polypeptide.
  • each encoded amino acid residue where appropriate, is represented by a single letter designation, corresponding to the trivial name of the conventional amino acid.
  • polypeptides as defined herein comprise or consist of L-amino acids.
  • the antibody polypeptides of the invention exhibit specificity for PSA, and preferably the mature, active form of human PSA.
  • amino acid sequence of human PSA is shown below
  • PSA protein C inhibitor
  • the antibody polypeptide has specificity for the free (that is, non- complexed) isoform of PSA compared to the complexed isoform of PSA.
  • Binding moieties with specificity for the free isoform of PSA may have binding specificity for an epitope that is exposed on the free isoform of PSA, but is unexposed on the complexed isoform of PSA, and this may be a linear or a conformational (that is, non-linear) epitope.
  • the antibody polypeptide may have specificity for an epitope that includes one or more amino acid residues that are part of the catalytic cleft of PSA that is exposed in free PSA and unexposed in a complexed isoform, such as the form present in seminal fluid when PSA is complexed to PCI.
  • the antibody polypeptide is capable of binding to PSA in vivo, i.e. under the physiological conditions in which PSA exists within the human body.
  • the antibody polypeptide does not bind to any other protein in vivo.
  • the antibody polypeptide is capable of binding selectively to PSA, i.e. it binds at least 10-fold more strongly to PSA than to another proteins (in particular, other kallikreins such as prostate specific antigen or PSA).
  • the antibody polypeptides of the present invention are based on a selected humanised version of the 5A10 antibody, which exhibits unexpected favourable properties.
  • the humanised antibodies of the invention exhibit an enhanced uptake into tumours compared to the parent murine 5A10 antibody (m5A10) from which their CDR sequences were derived (see Example 6).
  • tumours By “enhanced uptake into tumours” we mean that the antibody polypeptide of the invention (a humanised form of the 5A10 antibody), when administered to a patient with a prostate tumour can provide a higher tumour absorbed dose than the parent murine 5A10 antibody with less normal organ toxicity.
  • the unexpectedly better tumor accumulation provides a better therapeutic profile of the antibodies of the invention. It in turn permit higher radiation doses (absorbed doses) to be used, leading to greater efficacy in the treatment of prostate cancer without increasing side-effects or 'collateral damage' to healthy tissues and organs.
  • Humanisation also called reshaping or CDR-grafting is a technique for reducing the immunogenicity of monoclonal antibodies from xenogeneic sources (commonly, from rodents such as mice) and for improving their activation of the human immune system (see review by Almagro & Fransson, 2008, Frontiers in Bioscience 13:1619-1633; the disclosures of which are incorporated herein by reference).
  • xenogeneic sources commonly, from rodents such as mice
  • CDR-grafting Humanisation
  • the design of a humanised antibody includes several key choices, including the extents of the CDRs to be used and the human frameworks to be used. However, in order to retain the specificity of the parent antibody, it may also be critical to substitute one or more residues from the rodent mAb into the human framework regions (so-called backmutations). Identifying the position of the necessary backmutations requires a detailed sequence/structural analysis. Recently, phage libraries have been used to vary the amino acids at chosen positions. Similarly, many approaches have been used to choose the most appropriate human frameworks in which to graft the rodent CDRs.
  • the six CDR sequences represented above in SEQ ID NOS: 1 to 6 are derived from the murine anti-PSA antibody 5A10, but contain mutations in CDRH2 (SEQ ID NO: 2) and CDRL1 (SEQ ID NO: 4) relative to the parent murine antibody. These mutations in the CDRs were made in order to confer optimal specificity and stability on the humanised version of 5A10.
  • the antibody polypeptides of the invention bind PSA with a K D of greater than 0.1 x 10 "9 M.
  • the antibody polypeptide of the invention has an affinity (KD) for PSA of lower than 1.0 x10 "10 M, for example a K D lower than 9.0 x10 "11 M, 8.0 x10 "11 M, 7.0 x10 '11 M, 6.0 x10 "11 M, 5.0 x10 "11 M, 4.0 x10 "11 M, 3.0 x10 "11 M, 2.0 x10 "11 M or lower than 1.0 x10 " 1 M.
  • KD affinity for PSA of lower than 1.0 x10 "10 M
  • the antibody polypeptides of the invention may constitute antibody heavy chains, antibody light chains, homodimers and heterodimers of antibody heavy and/or light chains, and antigen binding fragments and derivatives of the same.
  • the antibody polypeptide comprises or consists of an intact (i.e. complete) antibody, such as an IgA, IgD, IgE, IgG or IgM molecule.
  • the antibody polypeptide comprises or consists of an intact IgG molecule, or an antigen-binding fragment or derivative of the same.
  • the IgG molecule may be of any known subtype, for example lgG1 , lgG2, lgG3 or lgG4.
  • antigen-binding fragments and derivatives of antibodies we include Fv fragments (e.g. single chain Fv and disulphide-bonded Fv), Fab-like fragments (e.g. Fab fragments, Fab' fragments and F(ab) 2 fragments) and domain antibodies (e.g. single VH variable domains or VL variable domains).
  • Fv fragments e.g. single chain Fv and disulphide-bonded Fv
  • Fab-like fragments e.g. Fab fragments, Fab' fragments and F(ab) 2 fragments
  • domain antibodies e.g. single VH variable domains or VL variable domains.
  • the antibody polypeptide may comprise or consist of an scFv or Fab fragment.
  • a further characterising feature of the antibody polypeptides of the present invention is the presence of framework amino acid sequences from one or more human antibodies in the heavy and light chain variable regions.
  • variable domains we include the regions of the heavy and light chain variable domains other than the CDRs.
  • each variable domain will comprise four framework regions, designated FR1 to FR4, within which the CDR sequences are located: FR1— - CDR1— - FR2— - CDR2— - FR3— - CDR3— - FR4
  • amino acid sequences of the framework regions may be fully human or may contain one or more backmutations (i.e. the amino acid sequence present in the human framework may be substituted with the amino acid found at the corresponding position within the parent rodent variable domain from which the CDRs are derived). Consequently, the sequences of FR1 , FR2, FR3 and/or FR4 of the heavy and/or light chain variable domain(s) of the antibody polypeptide of the invention may be non- naturally occurring.
  • the framework sequences of the antibody polypeptide share at least 70% sequence identity with framework regions from one or more human antibodies, for example at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more.
  • the antibody polypeptide may comprise a heavy chain FR1 region that shares least 70% sequence identity with an FR1 region of a human antibody. It will be appreciated, however, that the heavy and light chains of the antibody polypeptide may share sequence identity with the framework regions of different human antibodies.
  • Percent identity can be determined by, for example, the LALIGN program (Huang and Miller, Adv. Appl. Math. (1991 ) 12:337-357) at the Expasy facility site (http://www.ch.embnet.org/software/LALIGN_form.html) using as parameters the global alignment option, scoring matrix BLOSUM62, opening gap penalty -14, extending gap penalty -4.
  • the percent sequence identity between two polypeptides may be determined using suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally.
  • the alignment may alternatively be carried out using the Clustal W program (as described in Thompson et ai, 1994, Nucl. Acid Res. 22:4673-4680, which is incorporated herein by reference).
  • the parameters used may be as follows:
  • Fast pair-wise alignment parameters K-tuple(word) size; 1 , window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent.
  • the BESTFIT program may be used to determine local sequence alignments.
  • the framework sequences of the heavy variable domain of the antibody polypeptide of the invention are encoded by the human immunoglobulin VH4 gene family.
  • the framework sequences may be encoded, at least in part, by a VH4-28 germline gene (e.g. FR1, FR2 and FR3 may be encoded by VH4-28 and FR4 may be encoded by JH1).
  • the antibody polypeptide may comprise or consist of a heavy chain variable region which comprises or consists of the amino acid sequence of SEQ ID NO:8 (wherein the CDR sequences are underlined in bold):
  • the framework sequences of the light variable domain of the antibody polypeptide of the invention are encoded by the human immunoglobulin Kappa V4 gene family.
  • the framework sequences may be encoded, at least in part, by an lgkV4-B3 germline gene (e.g. FR1 , FR2 and FR3 may be encoded by lgkV4-B3 and FR4 may be encoded by JK2).
  • an lgkV4-B3 germline gene e.g. FR1 , FR2 and FR3 may be encoded by lgkV4-B3 and FR4 may be encoded by JK2).
  • the antibody polypeptide may comprise or consist of a light chain variable region which comprises or consists of the amino acid sequence of SEQ ID NO: 9 (wherein the CDR sequences are underlined in bold):
  • the framework sequences comprise at least ten contiguous amino acids encoded by the reference gene, for example at least 20 contiguous amino acids.
  • the FR regions are encoded by the reference gene (for example, FR1 and FR2 may be encoded by the reference gene, but not FR3).
  • the antibody polypeptide comprises a heavy chain variable region which comprises or consists of the amino acid sequence of SEQ ID NO:8 and a light chain variable region which comprises or consists of the amino acid sequence of SEQ ID NO: 9.
  • the antibody polypeptide of the invention further comprises a heavy chain constant region, or part thereof.
  • the antibody polypeptide comprises a CH1 , CH2 and/or CH3 region of an IgG heavy chain (such as an lgG1 , lgG2, lgG3 or lgG4 heavy chain).
  • the antibody polypeptide may comprise part or all of the constant regions from an lgG1 heavy chain.
  • the antibody polypeptide may be a Fab fragment comprising CH1 and CL constant regions.
  • the antibody polypeptide may comprise an antibody Fc-region. It will be appreciated by a skilled person that the Fc portion may be from an IgG antibody, or from a different class of antibody (such as IgM, IgA, IgD or IgE).
  • the Fc region is from an lgG1 , lgG2, lgG3 or lgG4 antibody.
  • the Fc region may be naturally-occurring (e.g. part of an endogenously produced antibody) or may be artificial (e.g. comprising one or more point mutations relative to a naturally-occurring Fc region and/or modifications to the carbohydrate moieties within the CH2 domain).
  • Fc-regions with point mutations improving their ability to bind FcR may be advantageous, e.g. by altering serum half-life or by modulating (i.e. enhancing or reducing) binding to Fey receptors (FcyR) involved in ADCC and CDC.
  • the antibody polypeptide may comprise the amino acid sequence of SEQ ID NO: 10, or part thereof:
  • the antibody polypeptide of the invention further comprises a light chain constant region, or part thereof.
  • the antibody polypeptide comprises a CL region of an IgG light chain (such as a kappa or lambda light chain)
  • the antibody polypeptide may comprise the amino acid sequence of SEQ ID NO: 11 , or part thereof:
  • the antibody polypeptide comprises a heavy chain constant region which comprises or consists of the amino acid sequence of SEQ ID NO: 10 and a light chain constant region which comprises or consists of the amino acid sequence of SEQ ID NO: 11.
  • the antibody polypeptide of the invention comprises: a heavy chain which comprises or consists of the amino acid sequence of SEQ ID NO: 12 (wherein the variable region is in bold and the CDR sequences are underlined)
  • the antibody polypeptide may comprise or consist of two heavy chains of SEQ ID NO: 12 and two light chains of SEQ ID NO: 13, joined together by disulphide bridges to form a typical IgG antibody structure.
  • the antibody polypeptides of the invention may comprise or consist of one or more amino acids which have been modified or derivatised. Chemical derivatives of one or more amino acids may be achieved by reaction with a functional side group.
  • derivatised molecules include, for example, those molecules in which free amino groups have been derivatised to form amine hydrochlorides, p-toluene sulphonyl groups, carboxybenzoxy groups, i-butyloxycarbonyl groups, chloroacetyl groups or formyl groups.
  • Free carboxyl groups may be derivatised to form salts, methyl and ethyl esters or other types of esters and hydrazides.
  • Free hydroxyl groups may be derivatised to form O-acyl or O-alkyl derivatives.
  • chemical derivatives those peptides which contain naturally occurring amino acid derivatives of the twenty standard amino acids. For example: 4-hydroxyproline may be substituted for proline; 5- hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine and ornithine for lysine.
  • Derivatives also include peptides containing one or more additions or deletions as long as the requisite activity is maintained. Other included modifications are amidation, amino terminal acylation (e.g. acetylation or thioglycolic acid amidation), terminal carboxylamidation (e.g. with ammonia or methylamine), and the like terminal modifications.
  • peptidomimetic compounds may also be useful.
  • the term 'peptidomimetic' refers to a compound that mimics the conformation and desirable features of a particular peptide as a therapeutic agent.
  • the said polypeptide includes not only molecules in which amino acid residues are joined by peptide (-CO-NH-) linkages but also molecules in which the peptide bond is reversed.
  • Such retro-inverso peptidomimetics may be made using methods known in the art, for example such as those described in Meziere ef a/. (1997) J. Immunol. 159, 3230-3237, which is incorporated herein by reference.
  • Retro-inverse peptides which contain NH-CO bonds instead of CO-NH peptide bonds, are much more resistant to proteolysis.
  • the said polypeptide may be a peptidomimetic compound wherein one or more of the amino acid residues are linked by a -y(CH2NH)- bond in place of the conventional amide linkage.
  • the peptide bond may be dispensed with altogether provided that an appropriate linker moiety which retains the spacing between the carbon atoms of the amino acid residues is used; it may be advantageous for the linker moiety to have substantially the same charge distribution and substantially the same planarity as a peptide bond. It will be appreciated that the said polypeptide may conveniently be blocked at its N- or C- terminus so as to help reduce susceptibility to exo-proteolytic digestion.
  • a presumed bioactive conformation may be stabilised by a covalent modification, such as cyclisation or by incorporation of lactam or other types of bridges, for example see Veber et a/., 1978, Proc. Natl. Acad. Sci. USA 75:2636 and Thursell et al., 1983, Biochem. Biophys. Res. Comm. 111 :166, which are incorporated herein by reference.
  • the antibody polypeptides of the invention may be augmented with a functional moiety to facilitate their intended use, for example as an in vivo imaging agent or therapeutic agent.
  • the antibody polypeptide is linked, directly or indirectly, to a therapeutic moiety.
  • a suitable therapeutic moiety is one that is capable of reducing or inhibiting the growth, or in particular killing, a prostatic cancer cell.
  • the therapeutic agent may be a cytotoxic moiety.
  • a cytotoxic moiety may comprise or consist of one or more radioisotopes.
  • the one or more radioisotopes may each be independently selected from the group consisting of beta- emitters, Auger-emitters, conversion electron-emitters, alpha-emitters, and low photon energy-emitters. It may be desired that the one or more radioisotopes each independently has an emission pattern of locally absorbed energy that creates a high absorbed dose in the vicinity of the agent.
  • Exemplary radioisotopes may include long-range beta-emitters, such as 90 Y, 32 P, 186 Re/ 188 Re; 166 Ho, 76 As/ 77 As, 89 Sr, 153 Sm; medium range beta-emitters, such as 131 1, 177 Lu, 67 Cu, 161 Tb, 105 Rh; low-energy beta-emitters, such as 45 Ca or 35 S; conversion or Auger-emitters, such as 51 Cr, 67 Ga, "Tc m , 111 ln, 1 4m ln, 123 l, 125 l, 201 TI; and alpha-emitters, such as 212 Bi, 213 Bi, 223 Ac, 225 Ac, 212 Pb, 2 5 Fm, 223 Ra, 1 9 Tb and 221 At.
  • long-range beta-emitters such as 90 Y, 32 P, 186 Re/ 188 Re; 166 Ho, 76 As/ 77 As, 89 Sr, 153 S
  • the therapeutic moiety or cytotoxic moiety is not a moiety as disclosed as a "tracer” in WO 2006/087374 A1 , in particular at page 11 , lines 7-15 thereof.
  • the antibody polypeptide is linked to (or otherwise labelled with) the radioisotope 177 Lu.
  • the therapeutic moiety may comprise or consist of one or more therapeutic (such as cytotoxic) drugs, for example, a cytostatic drug; an anti-androgen drug; cortisone and derivatives thereof; a phosphonate; a testosterone-5-a-reductase inhibitor; a boron addend; a cytokine; thapsigargin and its metabolites; a toxin (such as saporin or calicheamicin); a chemotherapeutic agent (such as an antimetabolite); or any other therapeutic or cytotoxic drug useful in the treatment of prostatic carcinoma.
  • cytotoxic drugs for example, include:
  • Cytostatics in particular those with dose-limiting side-effects, including but not limited to cyclophosamide, chlorambucil, ifosfamide, busulphane, lomustine, taxanes, estramustine phosphate and other nitrogen mustards, antibiotics (including doxorubicine, calicheamicines and esperamicine), vinca alkaloids, azaridines, platinum-containing compounds, endostatin, alkyl sulfonates, nitrosoureas, triazenes, folic acid analoges, pyrimidine analoges, purine analogs, enzymes, substituted urea, methyl-hydrazine derivatives, daunorubicin, amphipathic amines,
  • Anti-androgens such as flutamide and bikalutamide and metabolites thereof;
  • Phosphonates such as diphophonate and buphosphonate
  • the cytotoxic moiety may comprise or consist of one or more moieties suitable for use in activation therapy, such as photon activation therapy, neutron activation therapy, neutron induced Auger electron therapy, synchrotron irradiation therapy or low energy X-ray photon activation therapy.
  • synchrotron radiation or low energy X-rays
  • PAT photo-activation radiotherapy
  • the PAT treatment modality utilises monochromatic X-rays from a synchrotron source, such as provided by the ID17 biomedical beamline at the European Synchrotron Radiation Facility (ESRF) in Grenoble, and as anticipated to be available at other facilities in the future such as the new Swedish synchrotron facility, Max-IV.
  • ESRF European Synchrotron Radiation Facility
  • Antibodies or peptides can for instance be labelled with stable Gadolinium ( 157 Gd) and act as the target molecule for the neutrons that are captured by the Gd-nucleus, so called Gadolinium Neutron Capture Therapy (GdNCT).
  • Gadolinium Neutron Capture Therapy GdNCT
  • Monte Carlo techniques the dose distribution in the tumour and the surrounding tissues is calculated as it results from ⁇ -photons, neutrons, nuclear recoils, as well as characteristic x-rays, internal conversion and Auger-electrons from gadolinium or other potential elements.
  • the therapeutic moiety (such as a radioisotope, cytotoxic moiety or the like) may be linked directly, or indirectly, to the binding moiety (such as an antibody or fragment thereof).
  • Suitable linkers include, for example, prosthetic groups, non-phenolic linkers (derivatives of N-succimidyl- benzoates; dodecaborate), chelating moieties of both macrocyclics and acyclic chelators, such as derivatives of 1 ,4,7,10-tetraazacyclododecane-1 ,4,7,10,tetraacetic acid (DOT A), deferoxamine (DFO), derivatives of diethylenetriaminepentaacetic avid (DTPA), derivatives of S-2-(4- lsothiocyanatobenzyl)-1 ,4,7-triazacyclononane-1 ,4,7-triacetic acid (NOTA) and derivatives of 1 ,4,8,11-tetraazacyclo
  • DOT A defer
  • One preferred linker is DTPA, for example as used in 177 Lu-DTPA-[antibody polypeptide of the invention].
  • a further preferred linker is deferoxamine, DFO, for example as used in 89 Zr-DFO-[antibody polypeptide of the invention], preferably for diagnostic use.
  • the antibody polypeptide of the invention may (or may not) further comprises a detectable moiety.
  • a detectable moiety may comprise or consist of a radioisotope, such as a radioisotope selected from the group consisting of 99m Tc, 111 ln, 67 Ga, 68 Ga, 72 As, 89 Zr, 123 l and 20 TI
  • the agent may comprise a pair of detectable and cytotoxic radionuclides, such as ⁇ / ⁇ or 124 l/ 211 At.
  • the agent may comprise a radioisotope that is capable of simultaneously acting in a multi-modal manner as a detectable moiety and also as a cytotoxic moiety to provide so-called "Multimodality theragnostics".
  • the binding moieties may thus be coupled to nanoparticles that have the capability of multi-imaging (for example, SPECT, PET, MRI, Optical, or Ultrasound) together with therapeutic capability using cytotoxic drugs, such as radionuclides or chemotherapy agents.
  • cytotoxic drugs such as radionuclides or chemotherapy agents.
  • hyperthermia using high frequency alternating magnetic fields and accompanied ultrasound imaging.
  • the detectable moiety may comprise or consist of a paramagnetic isotope, such as a paramagnetic isotope is selected from the group consisting of 157 Gd, 55 Mn, 62 Dy, 52 Cr and 56 Fe.
  • the detectable moiety may be detectable by an imaging technique such as SPECT, PET, MRI, optical or ultrasound imaging.
  • Therapeutic and detectable moieties may be conjugated or otherwise combined with the antibody polypeptide using methods well known in the art (for example, the existing immunoconjugate therapy, gemtuzumab ozogamicin [tradename: Mylotarg®], comprises a monoclonal antibody linked to the cytotoxin calicheamicin).
  • the antibody polypeptide of the invention is used to treat prostate cancer in the form of a formulation comprising a population of antibody polypeptide molecules.
  • all (or substantially all, such as greater than 90%, 95%, 99%, 99.9% or more, by weight) of the antibody polypeptide molecules in the population comprise the same therapeutic moiety.
  • the population comprises a mixture of other agents with different therapeutic moieties. This option will give possibilities to enhance the effects of targeted radionuclide therapy using various agents such chemotherapy agents, hormonal therapy agents or other combination of therapies in which the targeting agent not only delivers therapeutically active radionuclides to tumor associated antigens but also simultaneously radiosensitizes the targeted tumor cells by modulating (e.g.
  • triggering or blocking an intracellular signaling cascade.
  • This option is also useful in treating the prostate cancer with a mixture of cytotoxic agents, for example, using a cocktail of alpha- and different ranges of beta-emitters, or a cocktail of radionuclides with different range, LET (linear energy transfer) and RBE (relative biological effect), for combined treatment of large tumors, micrometastases, and single tumor cells.
  • cytotoxic agents for example, using a cocktail of alpha- and different ranges of beta-emitters, or a cocktail of radionuclides with different range, LET (linear energy transfer) and RBE (relative biological effect), for combined treatment of large tumors, micrometastases, and single tumor cells.
  • long-range emitters may be used for treatment of large tumors
  • short-range emitters may be used for the treatment of smaller tumours such as micrometastases, and single tumor cells.
  • the antibody polypeptide of the present invention may (or may not) further comprises a moiety for increasing the in vivo half-life of the agent.
  • exemplary moieties for increasing the in vivo half-life of the agent may include polyethylene glycol (PEG), human serum albumin, glycosylation groups, fatty acids and dextran. PEG may be particularly contemplated.
  • polypeptides of the invention may be lyophilised for storage and reconstituted in a suitable carrier prior to use, e.g. through freeze drying, spray drying, spray cooling, or through use of particle formation (precipitation) from supercritical carbon dioxide.
  • a suitable carrier e.g. through freeze drying, spray drying, spray cooling, or through use of particle formation (precipitation) from supercritical carbon dioxide.
  • Any suitable lyophilisation method e.g. freeze-drying, spray drying, cake drying
  • reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilisation and reconstitution can lead to varying degrees of activity loss and that use levels may have to be adjusted upward to compensate.
  • the lyophilised (freeze dried) polypeptide loses no more than about 1 % of its activity (prior to lyophilisation) when rehydrated, or no more than about 5%, 10%, 20%, 25%, 30%, 35%, 40%, 45%, or no more than about 50% of its activity (prior to lyophilisation) when re hyd rated.
  • the polypeptide is or comprises a recombinant polypeptide.
  • Suitable methods for the production of such recombinant polypeptides are well known in the art, such as expression in prokaryotic or eukaryotic hosts cells (for example, see Sambrook & Russell, 2000, Molecular Cloning, A Laboratory Manual, Third Edition, Cold Spring Harbor, New York, the relevant disclosures in which document are hereby incorporated by reference).
  • Antibody polypeptides of the invention can also be produced using a commercially available in vitro translation system, such as rabbit reticulocyte lysate or wheatgerm lysate (available from Promega).
  • the translation system is rabbit reticulocyte lysate.
  • the translation system may be coupled to a transcription system, such as the TNT transcription-translation system (Promega). This system has the advantage of producing suitable mRNA transcript from an encoding DNA polynucleotide in the same reaction as the translation.
  • nucleic acid molecule encoding an antibody polypeptide of the invention, or a component polypeptide chain thereof.
  • nucleic acid molecule we include DNA (e.g. genomic DNA or complementary DNA) and mRNA molecules, which may be single- or double-stranded.
  • the nucleic acid molecule is a cDNA molecule.
  • nucleic acid molecule may be codon-optimised for expression of the antibody polypeptide in a particular host cell, e.g. for expression in human cells (for example, see Angov, 201 1 , Biotechnol. J. 6(6):650-659).
  • the nucleic acid molecule of the invention comprises (a) the nucleotide sequence of SEQ ID NO: 14 CAGGTCACACTGAAGGAATCTGGGCCTGCTTTGGTGAAGCCCACTCAGACTCTGACACTCA CATGCACCTTCTCCGGGTTTAGCCTGTCAACCACCGGTATGGGCGTGAGTTGGATTCGCCA ACCACCGGGTAAAGCGCTTGAGTGGCTTGCACACATCTATTGGGACGATGACAAGCGGTAC AGTACTAGCCTGAAAACGAGACTGACCATAAGCGAGGACTCATCCAAGAATCAGGTGGTAC TGACGATGACCAACATGGATCCCGTTGATACCGCCACATACTACTGTGCCAGGAAAGGCTA CTATGGCTATTTCGACTATTGGGGACAGGGAACACTCGTCACTGTGTCCTCTCT
  • nucleic acid molecule of the invention may comprise
  • a third aspect of the invention provides a vector (such as an expression vector) comprising a nucleic acid molecule according to the second aspect of the invention
  • a fourth aspect of the invention provides a host cell (such as a mammalian cell, e.g. human cell) comprising a nucleic acid molecule according to the second aspect of the invention or a vector according to the third aspect of the invention; and (c) a fifth aspect of the invention provides a method of making an antibody polypeptide according to the first aspect of the invention comprising culturing a population of host cells according to the fourth aspect of the invention under conditions in which said polypeptide is expressed, and isolating the polypeptide therefrom.
  • a host cell such as a mammalian cell, e.g. human cell
  • a fifth aspect of the invention provides a method of making an antibody polypeptide according to the first aspect of the invention comprising culturing a population of host cells according to the fourth aspect of the invention under conditions in which said polypeptide is expressed, and isolating the polypeptide therefrom.
  • a sixth aspect of the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically effective amount of an antibody polypeptide of the first aspect of the invention and a pharmaceutically-acceptable diluent, carrier or excipient. Additional compounds may also be included in the pharmaceutical compositions, including, chelating agents such as EDTA, citrate, EGTA or glutathione.
  • the pharmaceutical compositions may be prepared in a manner known in the art that is sufficiently storage stable and suitable for administration to humans and animals.
  • the pharmaceutical compositions may be lyophilised, e.g., through freeze drying, spray drying, spray cooling, or through use of particle formation from supercritical particle formation.
  • pharmaceutically acceptable we mean a non-toxic material that does not decrease the effectiveness of the kallikrein protein-binding activity of the agent of the invention.
  • Such pharmaceutically acceptable buffers, carriers or excipients are well-known in the art (see Remington's Pharmaceutical Sciences, 18th edition, A.R Gennaro, Ed., Mack Publishing Company (1990) and Handbook of Pharmaceutical Excipients, 3rd edition, A. Kibbe, Ed ., Pharmaceutical Press (2000), the disclosures of which are incorporated herein by reference).
  • the term “buffer” is intended to mean an aqueous solution containing an acid-base mixture with the purpose of stabilising pH.
  • buffers are Trizma, Bicine, Tricine, MOPS, MOPSO, MOBS, Tris, Hepes, HEPBS, MES, phosphate, carbonate, acetate, citrate, glycolate, lactate, borate, ACES, ADA, tartrate, AMP, AMPD, AMPSO, BES, CABS, cacodylate, CHES, DIPSO, EPPS, ethanolamine, glycine, HEPPSO, imidazole, imidazolelactic acid, PIPES, SSC, SSPE, POPSO, TAPS, TABS, TAPSO and TES.
  • diluent is intended to mean an aqueous or non-aqueous solution with the purpose of diluting the agent in the pharmaceutical preparation.
  • the diluent may be one or more of saline, water, polyethylene glycol, propylene glycol, ethanol or oils (such as safflower oil, corn oil, peanut oil, cottonseed oil or sesame oil).
  • adjuvant is intended to mean any compound added to the formulation to increase the biological effect of the agent of the invention.
  • the adjuvant may be one or more of zinc, copper or silver salts with different anions, for example, but not limited to fluoride, chloride, bromide, iodide, tiocyanate, sulfite, hydroxide, phosphate, carbonate, lactate, glycolate, citrate, borate, tartrate, and acetates of different acyl composition.
  • the adjuvant may also be cationic polymers such as cationic cellulose ethers, cationic cellulose esters, deacetylated hyaluronic acid, chitosan, cationic dendrimers, cationic synthetic polymers such as polyvinyl imidazole), and cationic polypeptides such as polyhistidine, polylysine, polyarginine, and peptides containing these amino acids.
  • cationic polymers such as cationic cellulose ethers, cationic cellulose esters, deacetylated hyaluronic acid, chitosan, cationic dendrimers, cationic synthetic polymers such as polyvinyl imidazole
  • cationic polypeptides such as polyhistidine, polylysine, polyarginine, and peptides containing these amino acids.
  • the excipient may be one or more of carbohydrates, polymers, lipids and minerals.
  • carbohydrates include lactose, glucose, sucrose, mannitol, and cyclodextrines, which are added to the composition, e.g., for facilitating lyophilisation.
  • polymers are starch, cellulose ethers, cellulose carboxymethylcellulose, hydroxypropylmethyl cellulose, hydroxyethyl cellulose, ethylhydroxyethyl cellulose, alginates, carageenans, hyaluronic acid and derivatives thereof, polyacrylic acid, polysulphonate, polyethylenglycol/polyethylene oxide, polyethyleneoxide/polypropylene oxide copolymers, polyvinylalcohol/polyvinylacetate of different degree of hydrolysis, and polyvinylpyrrolidone, all of different molecular weight, which are added to the composition, e.g., for viscosity control, for achieving bioadhesion, or for protecting the lipid from chemical and proteolytic degradation.
  • lipids are fatty acids, phospholipids, mono-, di-, and triglycerides, ceramides, sphingolipids and glycolipids, all of different acyl chain length and saturation, egg lecithin, soy lecithin, hydrogenated egg and soy lecithin, which are added to the composition for reasons similar to those for polymers.
  • minerals are talc, magnesium oxide, zinc oxide and titanium oxide, which are added to the composition to obtain benefits such as reduction of liquid accumulation or advantageous pigment properties.
  • the antibody polypeptides of the invention may be formulated into any type of pharmaceutical composition known in the art to be suitable for the delivery thereof.
  • the pharmaceutical compositions of the invention may be in the form of a liposome, in which the antibody polypeptide is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids, which exist in aggregated forms as micelles, insoluble monolayers and liquid crystals.
  • Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like.
  • Suitable lipids also include the lipids above modified by poly(ethylene glycol) in the polar headgroup for prolonging bloodstream circulation time. Preparation of such liposomal formulations is can be found in for example US 4,235,871, the disclosures of which are incorporated herein by reference.
  • compositions of the invention may also be in the form of biodegradable microspheres.
  • Aliphatic polyesters such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), copolymers of PLA and PGA (PLGA) or poly(carprolactone) (PCL), and polyanhydrides have been widely used as biodegradable polymers in the production of microspheres. Preparations of such microspheres can be found in US 5,851 ,451 and in EP 0 213 303, the disclosures of which are incorporated herein by reference.
  • compositions of the invention are provided in the form of polymer gels, where polymers such as starch, cellulose ethers, cellulose carboxymethylcellulose, hydroxypropylmethyl cellulose, hydroxyethyl cellulose, ethylhydroxyethyl cellulose, alginates, carageenans, hyaluronic acid and derivatives thereof, polyacrylic acid, polyvinyl imidazole, polysulphonate, polyethylenglycol/polyethylene oxide, polyethyleneoxide/polypropylene oxide copolymers, polyvinylalcohol/polyvinylacetate of different degree of hydrolysis, and polyvinylpyrrolidone are used for thickening of the solution containing the agent.
  • polymers such as starch, cellulose ethers, cellulose carboxymethylcellulose, hydroxypropylmethyl cellulose, hydroxyethyl cellulose, ethylhydroxyethyl cellulose, alginates, carageenans, hyaluronic acid and
  • the polymers may also comprise gelatin or collagen.
  • the antibody polypeptides may simply be dissolved in saline, water, polyethylene glycol, propylene glycol, ethanol or oils (such as safflower oil, corn oil, peanut oil, cottonseed oil or sesame oil), tragacanth gum, and/or various buffers.
  • the pharmaceutical compositions of the invention may include ions and a defined pH for potentiation of action of the active antibody polypeptide.
  • the compositions may be subjected to conventional pharmaceutical operations such as sterilisation and/or may contain conventional adjuvants such as preservatives, stabilisers, wetting agents, emulsifiers, buffers, fillers, etc.
  • compositions according to the invention may be administered via any suitable route known to those skilled in the art.
  • routes of administration include parenteral (intravenous, subcutaneous, and intramuscular), topical, ocular, nasal, pulmonar, buccal, oral, parenteral, and rectal.
  • administration from implants is possible. Infusion may be a desired route because of the potentially high cytotoxicity of the administered agent.
  • the pharmaceutical compositions are administered parenterally, for example, intravenously, intracerebroventricularly, intraarticularly, intra-arterially, intraperitoneally, intrathecal ⁇ , intraventricularly, intrasternally, intracranially, intramuscularly or subcutaneously, or they may be administered by infusion techniques. They are conveniently used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood. The aqueous solutions should be suitably buffered (for example, to a pH of from 3 to 9), if necessary. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
  • compositions of the invention are particularly suitable for parenteral, e.g., intravenous administration or local administration to a tumour in a patient (for example, intra-tumourally or peri-tumourally).
  • compositions will be administered to a patient in a pharmaceutically effective dose, i.e. a therapeutically effective absorbed dose of the therapeutic radionuclide.
  • a 'pharmaceutically effective amount', or 'effective amount', or 'therapeutically effective' refers to that amount which provides a therapeutic effect for a given condition and administration regimen. This is a predetermined quantity of active material calculated to produce a desired therapeutic effect in association with the required additive and diluent, i.e., a carrier or administration vehicle. Further, it is intended to mean an amount sufficient to reduce and/or prevent, a clinically significant deficit in the activity, function and response of the host. Alternatively, a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in a host.
  • the amount of a compound may vary depending on its specific activity. Suitable dosage amounts may contain a predetermined quantity of active composition calculated to produce the desired therapeutic effect in association with the required diluent.
  • a therapeutically effective amount of the active component is provided.
  • a therapeutically effective amount can be determined by the ordinary skilled medical worker based on patient characteristics, such as age, weight, sex, condition, complications, other diseases, etc., as is well known in the art (see Example 6 below).
  • the administration of the pharmaceutically effective dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administrations of subdivided doses at specific intervals. Alternatively, the does may be provided as a continuous infusion over a prolonged period.
  • a 'pharmaceutically effective amount', or 'effective amount', or 'diagnostically effective' refers to that amount which provides a detectable signal for in vivo imaging purposes.
  • the antibody polypeptides of the invention can be formulated at various concentrations, depending on the efficacy/toxicity of the compound being used.
  • the formulation may comprises the polypeptide at a concentration of between 0.1 ⁇ and 1 mM, between 1 ⁇ and 500 ⁇ , between 500 ⁇ and 1 mM, between 300 ⁇ and 700 ⁇ , between 1 ⁇ and 100 ⁇ , between 100 ⁇ and 200 ⁇ , between 200 ⁇ and 300 ⁇ , between 300 ⁇ and 400 ⁇ , between 400 ⁇ and 500 ⁇ and about 500 ⁇ .
  • the therapeutic dose of the antibody polypeptide (with or without a therapeutic moiety) in a human patient will be in the range of 100 pg to 700 mg per administration (based on a body weight of 70kg).
  • the maximum therapeutic dose may be in the range of 0.1 to 10 mg/kg per administration, e.g. between 0.1 and 5 mg/kg or between 1 and 5 mg/kg or between 0.1 and 2 mg/kg. It will be appreciated that such a dose may be administered at different intervals, as determined by the oncologist/physician; for example, a dose may be administered daily, twice-weekly, weekly, bi-weekly or monthly.
  • compositions of the invention may be administered alone or in combination with other therapeutic agents used in the treatment of a prostate cancer, or before, after or at the same time as the treatment of the patient with other therapeutic modalities for the treatment of prostate cancer, such as other therapeutic antibodies, surgery (e.g., radical prostatectomy), radionuclide therapy, brachytherapy, external beam radiation therapy, high-intensity focused ultrasound (HIFU), chemotherapy, oral chemotherapeutic drugs, cryosurgery (freezing the tumour), hormonal therapy (such as antiandrogen therapy), castration or combinations of the foregoing.
  • other therapeutic agents used in the treatment of a prostate cancer
  • other therapeutic modalities for the treatment of prostate cancer such as other therapeutic antibodies, surgery (e.g., radical prostatectomy), radionuclide therapy, brachytherapy, external beam radiation therapy, high-intensity focused ultrasound (HIFU), chemotherapy, oral chemotherapeutic drugs, cryosurgery (freezing the tumour), hormonal therapy (such as antiandrogen therapy), castration or combinations of
  • a seventh aspect of the invention provides a kit comprising an antibody polypeptide according to the first aspect of the invention or a pharmaceutical composition according to the sixth aspect of the invention, together with instructions for use of the same as described herein.
  • An eighth aspect of the invention provides an antibody polypeptide according to the first aspect of the invention for use in medicine.
  • a ninth aspect of the invention provides an antibody polypeptide according to the first aspect of the invention for use in the treatment and/or diagnosis of prostate cancer.
  • a tenth aspect of the invention provides a method of treatment of prostate cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a antibody polypeptide according to the first aspect of the invention.
  • 'treatment' we include both therapeutic and prophylactic treatment of the patient.
  • the term 'prophylactic' is used to encompass the use of an agent, or formulation thereof, as described herein which either prevents or reduces the likelihood of prostate cancer, or the spread, dissemination, or metastasis of localised prostate cancer in a patient or subject.
  • the term 'prophylactic' also encompasses the use of an agent, or formulation thereof, as described herein to prevent recurrence of prostate cancer in a patient who has previously been treated for prostate cancer.
  • An eleventh aspect of the invention provides a method of diagnosis of prostate cancer in a subject, the method comprising administering to the subject a diagnostically effective amount of a antibody polypeptide according to the first aspect of the invention.
  • diagnosis we include the detection of prostate cancer cells, either in vivo (i.e. within the body of a patient) or ex vivo (i.e. within a tissue or cell sample removed from the body of a patient).
  • the prostate cancer to be treated or diagnosed may be localised to the prostate, or may be a non-localised (that is, disseminated) prostate cancer.
  • Prostate cancer localised to the prostate may, for example, be classified as clinical T1 or T2 cancers according to the TNM system (abbreviated from Tumor/Nodes/Metastases) whereas non-localised / disseminated prostate cancer may, for example, be classified as clinical T3 or T4 cancers.
  • the prostate cancer to be treated or diagnosed may be a metastatic prostate cancer.
  • Metastasis refers to the spread of a cancer from its original location to other sites in the body.
  • the metastatic prostate cancer to be treated or diagnosed may be a metastases present in the lymphatic system; in bone (including spine, vertebrae, pelvis, ribs); metastasis within pelvis, rectum, bladder, or urethra. Metastases present at other less common locations can also be treated with the present invention.
  • the metastases may be micrometastases. Micrometastase is a form of metastases in which the newly formed tumors are generally too small to be detected, or detected with difficulty.
  • the present invention provides the skilled person with means to treat single cancer cells or cell clusters, even if the presence of such cells or clusters are not possible to diagnose but exist, for example as occult disseminated disease.
  • a particularly important technical advantage of the treatment provided by the present invention compared to the prior art treatments of prostate cancer is the enhanced efficacy in treatment of disseminated and/or metastatic (including micrometastatic) prostate cancer.
  • the invention provides antibody polypeptides and methods for preventing or treatment metastasis of a primary prostate tumour.
  • Prostate cancer tends to develop in men over the age of fifty, more commonly in men over 60, 65 or 70, and although it is one of the most prevalent types of cancer in men, many never have symptoms, undergo no therapy, and eventually die of other causes. This is because cancer of the prostate is, in most cases, slow-growing, symptom-free, and since men with the condition are older they often die of causes unrelated to the prostate cancer, such as heart/circulatory disease, pneumonia, other unconnected cancers, or old age. About two-thirds of prostate cancer cases are slow growing, the other third more aggressive and fast developing.
  • the invention relates to the treatment or diagnosis of prostate cancer in a patient who is less than 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40 or less years old at the time of diagnosis of prostate cancer and/or at the time of treatment.
  • the invention may relate to the treatment or diagnose of prostate cancer in a patient that is characterised in that one, two, or more, family members, in particular first-degree family members (such as a father or brother), has been previously been diagnosed with prostate cancer.
  • the invention also relates to the treatment or diagnosis of prostate cancer in a patient, wherein the prostate cancer to be treated has castration-resistant prostate cancer (CRPC).
  • CRPC may be characterised by typically becoming refractory to hormone treatment after one to three years, and resuming growth despite hormone therapy.
  • the antibody polypeptide is typically injected or infused into the body of the patient. In vivo, the antibody polypeptide then binds to tissues that produce the target antigen, PSA; primarily, prostate cancer cells and metastases thereof. Upon binding, the antibody polypeptide may directly exert a therapeutic effect (e.g. inducing cell death via ADCC, CDC or by virtue of carrying a radioisotope or other cytotoxic moiety). Alternatively, the bound antibody polypeptide may serve as a diagnostic (imaging) tool, which may guide the choice of therapy or aid surgical removal of the cancer cells.
  • a diagnostic (imaging) tool which may guide the choice of therapy or aid surgical removal of the cancer cells.
  • antibody polypeptides of the invention may be used in combination with other therapeutic and/or diagnostic agents/treatment, such as external radiotherapy, surgery, cytostatic and androgen treatments.
  • RadioGuided Surgery or Image-Guided Surgery (IGS) may be used to identify tracer-labeled antibody polypeptides of the invention during and/or before surgery.
  • an antibody polypeptide comprising a detectable moiety as discussed above may be administered during and/or before surgery.
  • the antibody polypeptides may first be infused. Thereafter, RGS/IGS may be used to identify PSA-producing tissue with a detection instrument sensitive to the detectable moiety, during or before surgery.
  • the detectable moiety may, for example, be a radiation emitting or magnetic-sensitive detectable moiety; it may, for example, be an emitter of Cerenkov radiation and/or Bremsstrahlung; it may be a fluorescent label and/or a magnetic or magnetizable label.
  • the RGS/IGS according to the present invention may, for example, be a method that is based on the detection of optical, Cerenkov, Bremsstrahlung, or beta radiation; the detection of a radionuclide label, and/or may involve magnetometry.
  • RGS is well known to the person skilled in the art as a surgical technique that enables the surgeon to identify tissue "marked" by the detectable moiety.
  • the visualisations obtained according to the above m et h o d s may be combined with other radiological visualisation methods, such as SPECT/PET, computed tomography (CT), ultrasound (US), and magnetic resonance imaging (MRI).
  • the present invention also provides antibody polypeptides for use in medicine by administration to a patient with prostate cancer before or during the surgery, such as RadioGuided or Image-Guided Surgery.
  • a still further aspect of the invention provides an in vitro method for the detection of prostate tumour cells in the blood of a subject, the method comprising:
  • the method comprises performing an assay to determine whether the blood sample contains free PSA; the presence of free PSA being indicative of the presence of prostate tumour cells in the blood of a subject.
  • the immunoassay could be either homogeneous or, more preferably, heterogenous.
  • the assay could also performed in either a competitive or, more preferably, a non-competitive format.
  • an exemplary protocol could be:
  • An additional aspect of the invention provides an in vitro method for the detection of prostate tumour cells in the tissue of a subject, the method comprising
  • tissue such an a histological sample
  • step (d) is performed by ELISA.
  • any assay suitable for detecting antibody-antigen interactions in vitro may be used.
  • the method further comprises quantification of the prostate tumour cells in the sample.
  • the method is for the diagnosis of prostate cancer in a subject.
  • Figure 1 Representative SPECT/CT images of LNCaP xenografts scanned up to 7 days post-injection of 1 ln-DTPA-h5A10.
  • Figure 2 Representative SPECT/CT images of LNCaP xenografts scanned up to 7 days post-injection of 111 ln-DTPA-m5A10.
  • Figure 3 Analysis of the tumour-to-contralateral ratios of m5A10 and h5A10 in the LNCaP xenograft mouse.
  • Figure 4 Analysis of the liver-to-tumour ratios of m5A10 and h5A10 in the LNCaP xenograft mouse.
  • FIG. 5 Biodistribution analysis of 111 ln-DTPA-m5A10 and 111 ln-DTPA-h5A10 in the LNCaP xenograft mouse.
  • the following examples are included to demonstrate particular embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute specific modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
  • Restriction enzymes were from Fermentas and Promega, alkaline phosphatase from Amersham Pharmacia Biotech and dNTP's and T4 DNA ligase from Fermentas. Primers were from the University of Turku, Department of Biotechnology and from Eurogentec. Qiagen kits were used for DNA purifications. mRNA extraction and cDNA synthesis mRNA was extracted from 5A10 MAb producing hybridoma cells (2E6 cells; Lilja et al, 1991 ) with Dynal poly-dT magnetic beads according to procedure described by the manufacturer in "Biomagnetic Techniques in Molecular Biology: Technical handbook"(Dynal A.S, 2nd edition, 1995).
  • cDNA synthesis from the mRNA was performed with Super Script enzyme (Gibco BRL): First, the magnetic particles bound with mRNA were incubated at 42 °C for 2 min in a reaction containing 1x reaction buffer, 0.1 M DTT, 2 mM dNTP's and RNase inhibitor (1.5 ⁇ in a 50 ⁇ total reaction volume). Then, 1 ⁇ of Super Script (200 U) was added and the reaction was proceeded 1 hour in 42 °C. After cDNA synthesis, the particles and the reaction mixture were separated by magnetic particle collector, the liquid removed, the particles suspended in TE buffer and incubated at 95 °C for 1 min to release the mRNA. After incubation, particle-bound cDNA was collected, mRNA-containing buffer removed, particles washed with TE and finally suspended in 50 ⁇ of TE for storage.
  • Super Script enzyme Gibco BRL
  • N-terminal amino acid sequences of the light and heavy chains were determined by Edman degradation method in the University of Turku, Center of Biotechnology sequencing service.
  • the sequences obtained from the light and heavy chain were DIVMTQS [SEQ ID NO: 18] and EVQLVESG [SEQ ID NO: 19], respectively.
  • a database search was performed to identify corresponding nucleotide sequences among the immunoglobulin germline V- genes of mouse.
  • the complementary regions of the forward PCR primers to clone the heavy and light chains were designed based on the search.
  • Reverse primers were designed to bind CH1 and CL, respectively.
  • Primers also contain the restriction enzyme recognition sites needed for cloning (later underlined).
  • PCR reactions were done in the following conditions (except changing the primers and templates): 125 ⁇ dNTP's, 0.5 ⁇ forward and reverse primers, 1x Pfu reaction buffer and 2.5U Pfu DNA polymerase (Stratagene). Amplification was done by 30 cycles of 95° C 30 s, 55 °C 1 min and 72 °C 1 min 30 s.
  • Light chain was amplified from cDNA with the following primers:
  • W0252 (5'-GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA-3', Xbal [SEQ ID NO:21]).
  • the light chain and the vector pComb3 containing the genes of an unrelated Fab (Barbas et al., 1991 ) were digested with Ncol and Xbal (for the vector, partial digestion with Ncol), purified from agarose gel and ligated.
  • the ligation product was transformed into E. coli XL1-Blue to obtain plasmid p5A10-L.
  • Fd (VH+CH1 ) chain was amplified with the following primer pair: 5A10-H (5'- CCAG CC ATG GCTG AG GTG CAATTG GTG G AGTCTGG -3', Ncol [SEQ ID NO:22]) and W0267 (5'-CTAGACTAGTACAATCCCTGGGCACAATTTTC-3 ⁇ Spel [SEQ ID NO:23]).
  • Fd chain was cloned into the vector pComb3 to replace the Fd gene of an another Fab carried by the vector.
  • PCR products and vector were digested with Ncol (partial digestion with Ncol for both the vector and the insert) and Spel (New England Biolabs), purified from agarose gel and ligated. The ligation product was transformed into E. coli XL1-Blue to produce vector p5A10-H.
  • the 5A10 light chain was digested from the plasmid p5A10-L with Spel and Xbal and, after gel purification, ligated with the gel purified plasmid p5A10-H also digested with the corresponding enzymes.
  • the ligation product was transformed E. coli XL1-Blueto obtain plasmid pComb3-5A10 containing both the light and Fd chain of the Fab 5A10.
  • the pComb3-5A10 was further digested with Spel and Nhel, self-ligated and transformed into E. coli XL1 -Blue.
  • the plasmid pComb3-5A10DIII enabled expression of soluble functional Fab 5A10.
  • HEK293 cells were expanded in to a 2L suspension culture in FreeStyle 293 Expression Medium (Life Technologies). The cell density was on the day for transfection 1 x 10 6 cells/ml.
  • the nucleotide sequences encoding the component heavy or light chains i.e. SEQ ID NOs: 16 and 17, respectively
  • the plasmid DNA (expression vector) containing the nucleotide sequences for the heavy and light chains was then mixed with the transfection agent and incubated for 10 min in RT.
  • the DNA-transfection agent-mix was slowly added to cell culture while slowly swirling the flask.
  • the transfected cell culture was then incubated at 37°C, 8% CO2 on an orbital shaker platform rotating at approx. 135 rpm, for seven days.
  • Culture medium was harvest by centrifugation and filtered through 5 ⁇ , 0.6 pm and 0.22 ⁇ filter systems.
  • Antibodies were purified by Protein G chromatography and the buffer was changed to PBS pH 7.4 by dialysis; subsequently, the antibodies were concentrated by ultrafiltration.
  • Heavy chain p5A10VHhDhlgG1 (4900 bp) amount: 0.60 mg
  • the DNA amounts were not optimized.
  • Transfection agent proprietary (however, suitable commercially-available transfection agents are readily available, such as XfectTM Transfection Reagent (Clontech), Lipofectamine (Life Technologies), FuGENE® HD Transfection Reagent (Promega), FreeStyleTM Max Reagent (Invitrogen), DEAE-dextran, polyethylenimine and calcium phosphate).
  • the aim of the study was to investigate the binding kinetics between eight variants of the antibody 5A10 and the antigen PSA by using the technique of Surface Plasmon Resonance (SPR) on a Biacore instrument.
  • SPR Surface Plasmon Resonance
  • the reagents provided by Diaprost AB were run on a TRIS-Tricine 10-20% acrylamide gel from Novex according to the guidelines from the manufacturer.
  • Each sample in the native series contained: 1 -1.3pg of the protein, TRIS-buffer pH 7.4, SDS and loading buffer.
  • Each sample in the reduced series contained: 1-1.3 ig of the protein, TRIS-buffer pH 7.4, SDS, loading buffer and 0.04% v/v beta2-merkaptoethanol (the reducing agent).
  • the staining of the gel was performed in commasie brilliant blue solution of acetic acid, ethanol and water with the corresponding proportions of 0.7, 3.0, 6.3.
  • the destaining of the gel was performed in the solution of acetic acid, ethanol and water with the corresponding proportions of 0.7, 3.0, 6.3.
  • Activation of the chip CM4-1 was performed according to manufacturer's guidelines for amine coupling using EDC and NHS mixture.
  • a solution containing 3.00 g/ml of the antigen PSA (stock solution of PSA diluted in 10 mM NaAc-buffert pH 3.8) was flown over channels fc2-4 on the chip CM4-1 in order to immobilize the antigen to the chip. Flow rate: 5 ⁇ /min, volume: 200 ⁇ .
  • the signal from the blank, fc1 is subtracted in all the data used in the calculations of the dissociation rate constant. The data indicate that the dissociation processes are very slow.
  • the dissociation phase data was fitted and the dissociation rate constants (k 0 ff) were estimated (see Table 1 ).
  • the dissociation constants (KD) are in the 10 "11 M range for all eight antibodies.
  • the dissociation constant for the humanised antibody appears to be higher than that of the parent murine antibody.
  • association processes are very fast for all antibodies and the association rate constants (k on ) are all in the 10 5 M “1 s "1 range based on 3-9 experiments for each antibody.
  • the dissociation processes are very slow and almost in the range of technical limitations of Biacore.
  • the dissociation rate constants (k 0 ff) are all in the 10 "6 s "1 range based on 3-9 experiments for each antibody.
  • Dynamic light scattering was measured at 20 °C in duplicate samples using the Malvern Zetasizer APS equipment. Each sample was measured three times.
  • the HBS-EP buffer (from the customer) was used as control to make sure that the buffer was reasonably free from dust and aggregates. No reliable measurements of aggregates in the HBS-EP buffer could be made, which is good, since the buffer should be free from aggregates. All samples could be reliably measured using the number distribution function.
  • the average radius of the most abundant species was calculated along with the polydispersity of the species. The average mass distribution of this species was also calculated, see Table 2.
  • Polydispersity Standard deviation of radius / Average radius x 100 %
  • a radius of 5.7 nm corresponds to a molecular weight of about 200 kDa for a protein having a perfect spherical shape.
  • a radius of 6.1 nm corresponds to a molecular weight of about 230 kDa for a protein having a perfect spherical shape.
  • This is reasonably close to the molecular weight of 150 kDa for IgG molecules, which means that most of the samples primarily consist of monomeric and/or dimeric IgG molecules.
  • the reason for not excluding dimers is that light scattering give a rough size estimate based on molecular shape and this makes it difficult to separate monomers and dimers but easy to separate large aggregates from monomers.
  • Small particles below 1 kDa were found in all mouse IgG samples. These particles have been disregarded in table 1 , since it is assumed that they belong to a component found in the buffer due to their small size. On the contrary a small fraction of larger aggregates is found in all human IgG but not in the
  • a humanised counterpart antibody, h5A10 was produced as described below.
  • the exemplary humanised monoclonal antibody 5A10 (lgG1/kappa, transient expressed in HEK 293 cells; see Example 2), comprising a heavy chain according to SEQ ID NO: 12 and a light chain according to SEQ ID NO: 13, was provided by Innovagen AB, Lund (lot no 90475.33, cone 1.0 mg/ml in PBS, pH 7.4).
  • a non-specific IgG antibody was utilised as an isotype control (IgG antibody from mouse serum, Sigma I-8765).
  • Radiolabeling of DTPA-5A10 Murine and humanised DTPA-5A10, in ammonium acetate buffer pH 5.5 was mixed with a predetermined amount of 11 lnC (Mallinkrodt Medical, Dublin, Ireland). After incubation at room temperature for 2h, the labeling was terminated and purified on a NAP-5 column, equilibrated with PBS (Thermo Scientific, USA). Labelling efficiency and kinetics were monitored by instant thin-layer chromatography (ITLC) (Biodex, Shirley, NY, USA) eluted with 0.2 M citric acid (Sigma Aldrich). In this system, the radiolabeled conjugate remains at the origin line, while free 111 In. The radioactive distribution was determined using a Cyclone Storage Phosphor System with Optiquant quantification software (Perkin Elmer; Waltham, MA, USA) Animal studies
  • the prostate carcinoma cell lines LNCaP expressing hK2 (ATCC, Manassas, VA, USA) was used.
  • Cells were cultured in RPMI 1640 medium (Thermo Scientific) supplemented with 10% fetal bovine serum and PEST (penicillin 100 lU/ml and 100 pg/ml streptomycin) from Thermo Scientific.
  • the cells were maintained at 37 °C in a humidified incubator with 5 % CO2 and were detached with trypsin-EDTA solution (0.25% trypsin, 0.02%EDTA buffer, Thermo Scientific).
  • Matrigel matrix (BD-Biosciences, San- Jose, California, USA) was used when xenografting LNCaP cells.
  • mice Male immunodeficient nude mice, NMRI-Nu, 6-8 wk old (Janvier Labs, France), were used for this study. All mice were s.c. xenografted with LNCaP cells on their left flank, 5-6 million cells, in 100 ⁇ growth medium and 100 ⁇ Matrigel. The xenografts were allowed to grow for 6-8 weeks.
  • Biodistribution studies were performed on both 11 ln-DTPA-h5A10 and 1 1 ln-DTPA-m5A10.
  • the animals were sacrificed 7 days p.i.
  • tissue uptake value expressed as percent injected dose per gram tissue (% lA/g), was calculated as:
  • %IA/g (tissue radioactivity/injected radioactivity)/organ weight x 100 wherein for iv injections:
  • FIG. 1 Representative SPECT/CT images of LNCaP xenografts scanned up to 7 days post- injection of 111 ln-DTPA-h5A10 and 111 ln-DTPA-m5A10 are shown in Figures 1 and 2.
  • the activity rapidly accumulates in the LNCaP tumour within by 24 hours, and the radioactivity remains high at 7 days post-injection. High accumulation of activity was also detected in the liver.
  • the ROI analysis showed that the ratio of tumour to soft tissue of the contralateral leg was 5.2 ⁇ 0.84 for 111 ln-DTPA-m5A10 and 6.4 ⁇ 1.3 for 11 ln-DTPA-h5A10 at 7 days p.i.
  • Tumour to contralateral ratios of 111 ln-DTPA-m5A10 and 11 ln-DTPA-h5A10 over time are shown in Figure 3. Unexpectedly, this ratio was observed to be markedly higher for the humanised antibody than for the 'parent' murine antibody.
  • Tumour to liver ratios of 11 ln-DTPA-m5A10 and 11 ln-DTPA-h5A10 over time are shown in Figure 4. Again, unexpectedly, this ratio was observed to be markedly higher for the humanised antibody than for the 'parent' murine antibody.
  • Example 6 Radionuclide therapy dosimetry planning and treatment of prostate cancer in a patient
  • Radionuclide therapy the radiation source is distributed in the whole and the radioactivity is normally administered systemically as a radiopharmaceutical.
  • the radioactivity distribution depends on the amount of radiopharmaceutical that accumulates over time in different tissues, something which varies between patients (1 ).
  • RNT treatment should be based on a prescribed absorbed dose (2). Then first one should perform a pre-therapy study using a tracer amount of the radiopharmaceutical, and determine the tumor and organ absorbed doses. Usually, this information is expressed as a factor describing the organ absorbed dose per unit administered activity, in units of mGy/MBq ; D p -r(organ). If the therapeutic administration is then given under similar conditions, this factor can be used to determine the activity that needs to be administered in order to deliver a prescribed absorbed dose to a given organ, tissue or tumor (4,6).
  • a pre-therapy study should be based on 111 In imaging with 111 ln-h5A10.
  • 111 In is best suitable for quantitative (planar/SPECT) imaging when then 177 Lu is to be the therapeutic radionuclide.
  • the therapy can be given with a therapy activity AT giving a prescribed therapy effect.
  • the activity distribution and corresponding dose rate should be calculated based on imaging to get the actual therapy absorbed dose given to tumor and normal organs, necessary for evaluation of treatment.
  • the cumulated activity is the number of decays that occur in a given region over a period of time.
  • the unit is Bq s, or Bq h.
  • the energy imparted is the sum of all energy deposits in a given volume.
  • the absorbed dose is the ratio of the energy imparted and the mass of the volume.
  • the unit of absorbed dose is Gray (Gy), 1 Gy equals 1 J/kg.
  • the cumulated activity is determined by integration, and the absorbed dose can be determined.
  • Activity measurements are made using planar imaging for whole-organ dosimetry. Quantitative SPECT/CT allows for dosimetry in smaller volumes using voxel-based methods.
  • the absorbed dose rate distribution can be calculated using so-called point dose kernels or voxel S values, describing the energy deposition pattern around a point source located in tissue.
  • This method assumes that the anatomical region is homogeneous in terms of density, such as soft tissues within the trunk. For body regions where the density is heterogeneous, as in the lungs, a direct Monte Carlo calculation is preferable.
  • the activity distribution from SPECT or PET is used as input to a Monte Carlo dose calculation code.
  • 177Lu-[DOTA0,Tyr3] octreotate therapy in patients with disseminated neuroendocrine tumors Analysis of dosimetry with impact on future therapeutic strategy.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Reproductive Health (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Optics & Photonics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pregnancy & Childbirth (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gynecology & Obstetrics (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
PCT/EP2016/073684 2015-10-05 2016-10-04 Humanized anti psa (5a10) antibodies Ceased WO2017060247A1 (en)

Priority Applications (19)

Application Number Priority Date Filing Date Title
KR1020187012299A KR102783861B1 (ko) 2015-10-05 2016-10-04 인간화 항 psa(5a10) 항체
EP21173910.7A EP3922265A1 (en) 2015-10-05 2016-10-04 Humanized anti psa (5a10) antibodies
ES16778330T ES2880682T3 (es) 2015-10-05 2016-10-04 Anticuerpos anti PSA (5A10) humanizados
JP2018536343A JP6916797B2 (ja) 2015-10-05 2016-10-04 抗体ポリペプチド及びそれらの使用
CA2998818A CA2998818A1 (en) 2015-10-05 2016-10-04 Humanized anti psa (5a10) antibodies
EP16778330.7A EP3359189B1 (en) 2015-10-05 2016-10-04 Humanized anti psa (5a10) antibodies
AU2016334715A AU2016334715B2 (en) 2015-10-05 2016-10-04 Humanized anti PSA (5A10) antibodies
RU2018115734A RU2753677C2 (ru) 2015-10-05 2016-10-04 Полипептиды антител и их применение
HK19101041.6A HK1258674B (en) 2015-10-05 2016-10-04 Humanized anti psa (5a10) antibodies
CN201680059166.8A CN108136013B (zh) 2015-10-05 2016-10-04 抗体多肽及其用途
MX2018004071A MX2018004071A (es) 2015-10-05 2016-10-04 Polipeptidos como anticuerpos y usos de los mismos.
PL16778330T PL3359189T3 (pl) 2015-10-05 2016-10-04 Humanizowane przeciwciała anty-psa (5a10)
BR112018006820-9A BR112018006820B1 (pt) 2015-10-05 2016-10-04 Anticorpos anti-psa (5a10) humanizados
DK16778330.7T DK3359189T3 (da) 2015-10-05 2016-10-04 Humanized anti psa (5a10) antibodies
IL258189A IL258189B2 (en) 2015-10-05 2016-10-04 Antibodies from humans against prostate-specific antigen (5I.10)
LTEPPCT/EP2016/073684T LT3359189T (lt) 2015-10-05 2016-10-04 Humanizuoti anti-psa (5a10) antikūnai
US15/761,260 US11332543B2 (en) 2015-10-05 2016-10-04 Antibody polypeptides and uses thereof
ZA2018/02019A ZA201802019B (en) 2015-10-05 2018-03-27 Humanized anti psa (5a10) antibodies
US17/717,254 US12441808B2 (en) 2015-10-05 2022-04-11 Antibody polypeptides and uses thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB1517550.8 2015-10-05
GBGB1517550.8A GB201517550D0 (en) 2015-10-05 2015-10-05 Antibody polypeptides and uses thereof
GBGB1519105.9A GB201519105D0 (en) 2015-10-29 2015-10-29 Antibody polypeptides and uses thereof
GB1519105.9 2015-10-29

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/761,260 A-371-Of-International US11332543B2 (en) 2015-10-05 2016-10-04 Antibody polypeptides and uses thereof
US17/717,254 Division US12441808B2 (en) 2015-10-05 2022-04-11 Antibody polypeptides and uses thereof

Publications (1)

Publication Number Publication Date
WO2017060247A1 true WO2017060247A1 (en) 2017-04-13

Family

ID=57113327

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/073684 Ceased WO2017060247A1 (en) 2015-10-05 2016-10-04 Humanized anti psa (5a10) antibodies

Country Status (17)

Country Link
US (2) US11332543B2 (cg-RX-API-DMAC7.html)
EP (2) EP3359189B1 (cg-RX-API-DMAC7.html)
JP (1) JP6916797B2 (cg-RX-API-DMAC7.html)
KR (1) KR102783861B1 (cg-RX-API-DMAC7.html)
CN (1) CN108136013B (cg-RX-API-DMAC7.html)
AU (1) AU2016334715B2 (cg-RX-API-DMAC7.html)
CA (1) CA2998818A1 (cg-RX-API-DMAC7.html)
DK (1) DK3359189T3 (cg-RX-API-DMAC7.html)
ES (1) ES2880682T3 (cg-RX-API-DMAC7.html)
IL (1) IL258189B2 (cg-RX-API-DMAC7.html)
LT (1) LT3359189T (cg-RX-API-DMAC7.html)
MX (1) MX2018004071A (cg-RX-API-DMAC7.html)
PL (1) PL3359189T3 (cg-RX-API-DMAC7.html)
PT (1) PT3359189T (cg-RX-API-DMAC7.html)
RU (1) RU2753677C2 (cg-RX-API-DMAC7.html)
WO (1) WO2017060247A1 (cg-RX-API-DMAC7.html)
ZA (1) ZA201802019B (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11185570B2 (en) 2017-02-08 2021-11-30 Bristol-Myers Squibb Company Method of treating cardiovascular disease and heart failure with modified relaxin polypeptides

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108136013B (zh) * 2015-10-05 2023-04-18 弗雷达克斯有限责任公司 抗体多肽及其用途
JP2023512214A (ja) 2020-01-28 2023-03-24 リフレクション メディカル, インコーポレイテッド 放射性核種および外部ビーム放射線療法の共同最適化

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013061083A2 (en) * 2011-10-28 2013-05-02 Fredax Ab Therapeutic agents and uses thereof
WO2015148979A1 (en) * 2014-03-28 2015-10-01 Opko Diagnostics, Llc Compositons and methods related to diagnosis of prostate cancer

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
SE459005B (sv) 1985-07-12 1989-05-29 Aake Rikard Lindahl Saett att framstaella sfaeriska polymerpartiklar
CA2192782C (en) 1995-12-15 2008-10-14 Nobuyuki Takechi Production of microspheres
FI20002127A0 (fi) * 2000-09-27 2000-09-27 Artic Partners Oy Ab Uusi vasta-aine, immunomääritys ja menetelmä eturauhassyövän havaitsemiseksi
EP1699826B1 (en) * 2005-01-05 2009-03-11 f-star Biotechnologische Forschungs- und Entwicklungsges.m.b.H. Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions
US8663600B2 (en) 2005-02-17 2014-03-04 Diaprost Ab Diagnosis of prostate cancer
AU2009270988A1 (en) 2008-07-15 2010-01-21 Genentech, Inc. Anthracycline derivative conjugates, process for their preparation and their use as antitumor compounds
JP2010004895A (ja) 2009-10-13 2010-01-14 Hiroshima Univ ヒト化ニワトリ抗体の製造方法
RU2537263C2 (ru) 2012-10-22 2014-12-27 Федеральное Государственное Бюджетное Образовательное Учреждение Высшего Профессионального Образования "Нижегородский Государственный Университет Им. Н.И. Лобачевского" Способ скрининга и мониторинга онкологических заболеваний и набор для его осуществления (варианты)
GB2520353A (en) 2013-11-19 2015-05-20 Fredax Ab Antibody polypeptides and uses thereof
CN108136013B (zh) * 2015-10-05 2023-04-18 弗雷达克斯有限责任公司 抗体多肽及其用途

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013061083A2 (en) * 2011-10-28 2013-05-02 Fredax Ab Therapeutic agents and uses thereof
WO2015148979A1 (en) * 2014-03-28 2015-10-01 Opko Diagnostics, Llc Compositons and methods related to diagnosis of prostate cancer

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11185570B2 (en) 2017-02-08 2021-11-30 Bristol-Myers Squibb Company Method of treating cardiovascular disease and heart failure with modified relaxin polypeptides
US11364281B2 (en) 2017-02-08 2022-06-21 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and pharmaceutical compositions thereof
US12097242B2 (en) 2017-02-08 2024-09-24 Bristol-Myers Squibb Company Treatment of fibrosis, cardiovascular disease and heart failure with modified relaxin polypeptides
US12097241B2 (en) 2017-02-08 2024-09-24 Bristol-Myers Squibb Company Methods of treating kidney failure, and/or improving or stablizing renal function using modified relaxin polypeptides

Also Published As

Publication number Publication date
US20180273634A1 (en) 2018-09-27
BR112018006820A2 (en) 2018-10-23
LT3359189T (lt) 2021-07-26
AU2016334715A1 (en) 2018-04-12
JP6916797B2 (ja) 2021-08-11
IL258189A (en) 2018-05-31
JP2018531045A (ja) 2018-10-25
PL3359189T3 (pl) 2021-12-20
ES2880682T3 (es) 2021-11-25
EP3359189B1 (en) 2021-06-23
EP3922265A1 (en) 2021-12-15
KR20180053756A (ko) 2018-05-23
CA2998818A1 (en) 2017-04-13
CN108136013A (zh) 2018-06-08
EP3359189A1 (en) 2018-08-15
RU2018115734A3 (cg-RX-API-DMAC7.html) 2020-03-27
PT3359189T (pt) 2021-07-19
RU2753677C2 (ru) 2021-08-19
US20220242969A1 (en) 2022-08-04
RU2018115734A (ru) 2019-11-07
IL258189B (en) 2022-11-01
IL258189B2 (en) 2023-03-01
KR102783861B1 (ko) 2025-03-21
AU2016334715B2 (en) 2023-02-02
CN108136013B (zh) 2023-04-18
MX2018004071A (es) 2018-11-09
US12441808B2 (en) 2025-10-14
DK3359189T3 (da) 2021-07-05
ZA201802019B (en) 2021-09-29
US11332543B2 (en) 2022-05-17
HK1258674A1 (en) 2019-11-15

Similar Documents

Publication Publication Date Title
US12404343B2 (en) Humanised anti kallikrein-2 antibody
US12441808B2 (en) Antibody polypeptides and uses thereof
GB2520353A (en) Antibody polypeptides and uses thereof
JP2018531045A6 (ja) 抗体ポリペプチド及びそれらの使用
HK1258674B (en) Humanized anti psa (5a10) antibodies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16778330

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2998818

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 258189

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 15761260

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: MX/A/2018/004071

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2018536343

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016334715

Country of ref document: AU

Date of ref document: 20161004

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018006820

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20187012299

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2018115734

Country of ref document: RU

Ref document number: 2016778330

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 112018006820

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20180404