WO2017035359A1 - Modified anthrax toxin protective antigen - Google Patents

Modified anthrax toxin protective antigen Download PDF

Info

Publication number
WO2017035359A1
WO2017035359A1 PCT/US2016/048706 US2016048706W WO2017035359A1 WO 2017035359 A1 WO2017035359 A1 WO 2017035359A1 US 2016048706 W US2016048706 W US 2016048706W WO 2017035359 A1 WO2017035359 A1 WO 2017035359A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
substituted
tumor
cells
mice
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/048706
Other languages
English (en)
French (fr)
Inventor
Shi-Hui Liu
Stephen H. Leppla
Thomas H. Bugge
Alexander N. WEIN
Diane E. PETERS
Jie Liu
Kuang-Hua Chen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Original Assignee
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Health and Human Services filed Critical US Department of Health and Human Services
Priority to EP16767065.2A priority Critical patent/EP3341393B1/en
Priority to CN201680062198.3A priority patent/CN108350041A/zh
Priority to US15/755,341 priority patent/US10835593B2/en
Priority to JP2018510419A priority patent/JP6865211B2/ja
Priority to CA2996767A priority patent/CA2996767C/en
Priority to KR1020187008131A priority patent/KR20180073555A/ko
Priority to AU2016311429A priority patent/AU2016311429C1/en
Publication of WO2017035359A1 publication Critical patent/WO2017035359A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/07Bacillus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C07K14/325Bacillus thuringiensis crystal peptides, i.e. delta-endotoxins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5158Antigen-pulsed cells, e.g. T-cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55522Cytokines; Lymphokines; Interferons

Definitions

  • Bacillus anthracis anthrax toxin is a bacterial toxin with cytotoxic activity that may be effective for destroying or inhibiting the growth of undesirable cells, e.g., cancer cells. Accordingly, one or more components of the anthrax toxin may be useful for treating or preventing diseases such as, e.g., cancer. However, anthrax toxin or components thereof may be toxic to normal cel ls. Accordingly, there exists a need for improved anthrax toxins.
  • An embodiment of the invention provides a Bacillus anthracis protective antigen (PA) comprising a PA amino acid sequence, wherein one or more of amino acid residues 1207, 1210, E654, 1656, R659, M662, Y681 , and 1.687, as defined by reference to SEQ ID NO: 1, are. independently, substituted, with the proviso that amino acid residue 1207 is not substituted with alanine and amino acid residue 1210 is not substituted with alanine.
  • PA Bacillus anthracis protective antigen
  • Another embodiment of the invention provides a Bacillus anthracis PA
  • amino acid residues 1207 and 1210 as defined by reference to SEQ ID NO: 1 , are, independently, substituted, with the proviso that amino acid residue 1207 is not substituted with alanine and amino acid residue 1210 is not substituted with alanine,
  • Bacillus anthracis PA comprising a PA amino acid sequence, wherein one or more of amino acid residues 1656, Y681, and L687, as defined by reference to SEQ ID NO: 1 , are, independently, substituted.
  • Another embodiment of the invention provides a Bacillus nihracis PA
  • Another embodiment of the invention provides a method of treating or preventing a solid tumor in a mammal, the method comprising administering to the mammal pentostau ' n and cyclophosphamide in an amount effective to treat or prevent the solid tumor in the mammal.
  • compositions for treating or preventing cancer.
  • Figure 1 is a schematic representation of PA oligomers, with each LF -binding site including three subsites (circles) located on adjacent PA monomers. While a heptamer is shown, the same interactions occur within octamers.
  • Figure 2 is a graph showing the cell viability (%) of RAW264.7 macrophage cells treated with the indicated PA variants at about 500 ng/mL in the presence of 100 ng/mL LF for 20 h.
  • Figure 3 A is a schematic representation of intermolecular complementation of the PA variants.
  • Figure 313 is a graph showing the cell viability (%) of RAW264.7 macrophage cells treated with the indicated PA variants at 500 ng/mL in the presence of 100 ng/mL LF (single protein, unshaded bars) or at 250 ng mL plus 250 ng/mL PA-R200A (shaded bars) or PA-R20GC (striped bars) in the presence of 100 ng/mL LF for 6 h.
  • Figure 4A is a graph showing the viability (%) of B16-BL6 cells treated with various concentrations (ng/mL) of PA variants PA-U2-R200A (closed circles), PA-L1-I207R (closed squares), PA-L1 -I210A (diamonds), PA-L1-I207R+PA-U2-R200A (open squares), PA-L1-I210A+PA-U2-R200A (open circles).
  • Figure 4B is a graph showing the survival of C57BL/6J mice injected
  • FIG. 5 is a graph showing the tumor weight (mg) in B16-BL6 tumor-bearing mice treated intraperitoneally with phosphate buffered saline (PBS) (squares), L1 210A/U2- R200A/LF (7.5 nig/7,5 mg 5 mg) (circles), L1 -I210A/U2-R200A LF (22.5 nig/22.5 mg/15 mg) (diamonds), L1-I207R U2-R200A LF (7.5 mg 7.5 mg/5 mg) (A), or L1-I207R/U2- R200A/LF (22.5 mg 22.5 mg 15 mg) (T). Doses were administered on each of the five days shown by the arrows.
  • PBS phosphate buffered saline
  • Figures 6A-6C are graphs showing the tumor volume (mm 3 ) (mean ⁇ SE) in Cmg2 + (squares), Cmg2 * ' ⁇ (diamonds), or Cmg2 ⁇ ' ⁇ (circles) mice bearing A549 (A), LL3 (B), or B.16 (C) tumors at various time points (days) after inoculation.
  • Figures 6D-6E are graphs showing the tumor volume (mm J ) (mean ⁇ SE) of Tem8 ⁇ '' ⁇ mice (circles) and littermate Tem8 + mice (squares) bearing LL3 (D) or B16 (E) tumors at various time points (days) alter inoculation.
  • Figures 6F-6H are graphs showing the body weight (g) (mean ⁇ SD) in Cmg2 +/+ (squares), Cmg2 ⁇ ' ⁇ (diamonds), or Cmgl' " (circles) mice bearing A549 (F), LL3 (G), or B16 (H) tumors at various time points (days) after inoculation.
  • Figures 61 is a graph showing the body weight (g) (mean ⁇ SD) of Tem8 ⁇ ' ' ⁇ mice (grey bars) and littermate Tem8 * ' * mice (black bars) hearing LL3 tumors the day when tumor cells were inoculated.
  • Figure 61 is a graph showing the body weight (g) (mean ⁇ SD) of Tem8 ⁇ ' ⁇ mice (circles) and littermate Tem8 +,+ mice (squares) bearing B16 tumors at various time points (days) after inoculation.
  • Figures 7 A and 7B are graphs showing the tumor volume (mm ' ') (mean ⁇ SE) of LL3 tumor-bearing mice treated with PBS (squares), PA-LI (circles) (A), or IC2-PA/LF (diamonds) (B) at various time points (days) after first treatment. The treatment was administered on the days indicted by arrows.
  • Figure 7C is a graph showing the tumor volume (rani") (mean ⁇ SE) of B16-BL6 tumor-bearing mice treated with PBS (squares), PA-Ll (circles), or IC2-PA/LF (diamonds) at various time points (days) after first treatment. The treatment was administered on the days indicted by arrows.
  • Figure 7D is a graph showing the cell viability (%) of LL3 cells treated with PA (open squares) or PA-Ll (closed squares) or B16-BL6 cells treated with PA (open circles) or PA-Ll (closed circles) in the presence of LP (mean ⁇ SD).
  • Figures 7E and 7F are graphs showing the tumor volume (mm 3 ) (mean ⁇ SE) (E) and body weight (g) (mean ⁇ SD) (F) of CmgF (squares), Cmg2 + ' (diamonds), and Cmg2 "' ⁇ (circles) mice treated with 15 x% PA-Ll pins 7,5 ⁇ g LF on days after the first treatment. The treatment was administered on the days indicted by arrows,
  • Figures 7G and 7H are graphs showing the tumor volume (mm J ) (mean ⁇ SE) (G) and body weight (g) (mean ⁇ SD) (H) of A549 tumor-bearing littermate Tem8 +/ ' (squares), Tem8 r/' (diamonds), and Tem8 ' ' ⁇ (circles) mice treated with 15 ⁇ PA-Ll plus 7.5 pg LF on days after the first treatment.
  • Figures 8A-8C are graphs showing the tumor volume (mm 5 ) (mean -.fc SE) of Bl 6- BL6 melanoma-bearing mice with the indicated CMG2 genotypes that were treated with 30xg PA-Ll plus 15 tig LF on days after the first treatment.
  • the treatment was administered on the days indicted by arrows.
  • Figure 8D is a graph showing the tumor volume (mm 3 ) (mean SE) of B16-BL6 melanoma-bearing endothelial cell-specific CMG2-niili mice and myeloid-specifie C G2- null mice (Cmg2(Mye) '/ ⁇ ) treated with 30 fig IC2-PA (15 ⁇ g PA-Ll -I207R + 15 ⁇ « PA-U2- R200A) plus 10 pg LF or PBS at the days indicated by the arrows.
  • fig IC2-PA 15 ⁇ g PA-Ll -I207R + 15 ⁇ « PA-U2- R200A
  • Figure 8E is a graph showing the survival (%) of WT mice and Cmg2 tC mice that were treated with PA-Ll /LF on the days indicated by arrows.
  • Figure 8F is a graph showing the number of blood vessels per 10 mm" 1 of mice treated with PBS (left bar) or 3 doses of 30 ⁇ PA-Ll plus 1 ⁇ xg LF (right bar) on days 0, 2, and 4.
  • Figure 9A is a graph showing the cell density (%) of tumor endothelial cells incubated with various concentrations of PA-Ll in the presence of LF (500 ng mL). Data are shown as mean ⁇ ⁇ ⁇ SD.
  • Figure 9C is a graph showing the OCR (pM/min) measured at various time points (min) under basal conditions or conditions following sequential additions of the
  • Figure 9D is a graph showing (i) the OCRATP obtained by subtracting the OCRs after addition of oligomyein from the basal OCRs of the endothelial cells, (ii) spare respiratory capacity (SRC), and (iii) the maximal respiration (MR) values of cells treated with (dark grey bars) or without (light grey bars) PA-L1/LF(1 3 ⁇ 41 ⁇ 2 ⁇ , each). Data are shown as mean ⁇ SD.
  • Figure 9E is a graph showing the relative cellular ATP levels of tumor endothelial cells treated with PA-L1/LF (0.5 ⁇ ig mL or 2 ng/mL each) for 24 h vs. untreated cells. Data are shown as mean ⁇ SD,
  • Figure 9F is a graph showing the change in expression (%) of the indicated genes in tumor endothelial cells treated with or without PA- LI /LP (1 ⁇ g mL each) for 24 h.
  • Eukaryotic translation initiation factor E1F35S was used as an internal normalization control, *, > ⁇ 0.05: ***, P ⁇ 0.01.
  • Figures 1 OA and 1 OB are graphs showing the tumor volume (mm") (A) and body weight (g) (B) in LL3 lung carcinomas-bearing immunocompetent C57BL/6 mice that were treated with PBS (closed squares), IC2-PA/LF (20 pg/6.7 ⁇ ) (* and open circles), PC regimen (1 mg pentostatin and 50 mg cyclophosphamide) (V), high (25 p.g 8.1 ⁇ ) ( ⁇ ), medium (20 ⁇ ig/6,7 ⁇ -g) (open squares), or low (15 ⁇ /5 ⁇ g) (diamonds and A) doses of IC2- PA/LF combined with PC regimen at various time points (days) after tumor inoculation.
  • Figure I OC is a graph showing the viability (%) of RAW264.7 cells that were incubated with IC2-PA/LF (100 ng ' mL each) for 5 h in the presence of various dilutions of sera obtained from representative mice in Figures 10A and 10B after the l Si (closed circles) or 2 nd (open circles) round of therapy. The viability of cells treated with PC and IC2-PA/LF after the 2 nd (diamonds) or 3 ?0 ( ⁇ ) round of therapy, PC ( ⁇ ), or PBS (squares) are also shown.
  • Figure 10D is a graph showing the viability (%) of RAW264.7 cells thai were incubated with IC2-PA/LF (100 ng/mL each) for 5 h in the presence of various dilutions of sera obtained from representative mice in Figures 10A and 10B after the 1 st round of therapy (circles). The viability of cells treated with PC and IC2-PA/LF after the 4 th round of therapy (squares) is also shown.
  • Figure 10E is a graph showing the viability (%) of cells treated as described in Figures 10A-10D using various concentrations of 14B7 anti-PA monoclonal antibodies as a positive control for neutralizing antibodies,
  • Figures 1 1 A-l ID are graphs showing the number of cells (millions) isolated from B16-RL6 melanoma-bearing mice that were positive for the indicated B-cell (A), T-ceSl (B and C), or granulocyte markers (D) after the 2 F]d cycle of therapy with PBS (grey bars), PC (black bars), 1C2-PA/LF (right striped bars), or the combined PC and the toxin (left striped bars) as measured by flow cytometry. Naive, untreated cells (white bars) were measured as a control.
  • Figure. 1 1 E is a graph showing the total spienocyte count (millions) of the mice treated in Figures 1 1 A ⁇ l ID.
  • Figure 12A is a graph showing the tumor volume (mm ' ') (mean ⁇ SE) of Tem8 ⁇ ' ⁇ mice (circles), Te 8 + " mice (diamonds), TemS*'* mice (squares) bearing A549 tumors at various time points (days) after inoculation.
  • Figure 12B is a graph showing the tumor volume (mm J ) (mean ⁇ SE) of T ' emS' ' mice (grey bars) and TernS*'* mice (black bars) bearing LL.3 tumors at various time points (days) after inoculation.
  • Figure 12C is a graph showing the body weight (g) (mean ⁇ SD) of Te 8 ' mice (circles), Tem8 ⁇ r ' ⁇ mice (diamonds), Tem8*' + mice (squares) bearing A549 tumors at various time points (days) after inoculation
  • Figure 12D is a graph showing the body weight (g) (mean ⁇ SD) of Tem8 ⁇ ' ⁇ mice (grey bars) and TemS +/+ mice (black bars) bearing LL3 tumors at various time points (days) after inoculation.
  • Figures 12F and 12G are graphs showing the body weight of female (F) and male (G) mice that were fed hard food and which had the following genotypes: TemS * ' " (squares); TemS * ' ' (diamonds); and TemS 1' (circles).
  • Figures 12H and 121 are graphs showing the body weight of female (H) and male (I) mice that were fed soft food and which had the following genotypes: TemS* ' ' '1 (squares); Tem8 + ' ⁇ (diamonds); and TemS' " (circles).
  • Figure 13 A is a graph showing the viability (%) of cells treated with LF and various concentrations of PA.
  • the cell types and treatments were as follows: A549 cells treated with PA/LF (open squares); A549 ceils treated with PA-L1/LF (closed squares); Colo205 cells treated with PA/LF (open circles); and Colo205 cells treated with PA-L1/LF (closed circles).
  • Figure 1 3B is a graph showing the viability (%) of cells treated with FP59 and various concentrations of PA.
  • the cell types and treatments were as follows: A549 cells treated with PA/FP59 (striped bars right of dotted line); A549 cells treated with PA-L1/FP59 (shaded bars right of dotted line); Colo205 cells treated with PA/FP59 (striped bars left of dotted line); and Colo205 cells treated with PA-L1/FP59 (shaded bars left of dotted line).
  • FIG 14 is a graph showing the Colo205 tumor volume (mnr) in mice at various time points (days) after first treatment. Treatments were administered on the days indicated by arrows. The genotypes and treatments were as follows: Cmg2 ⁇ v mice treated with PBS (open squares); CmgZ*''* mice treated with PA-Ll/LF (closed squares); Cmg2 ' ' ⁇ treated with PBS (open diamonds); and Cmg2 ' ' mice treated with PA-Ll/LF (closed diamonds).
  • Figures 15A and 15B are graphs showing the tumor volume (mm 3 ) (A) and body weight (g) (B) in mice bearing B16-BL6 melanoma tumors receiving the indicated treatments at various time points (days) after tumor inoculation, The treatments were given on the days indicated by arrows. The treatments were as follows: PBS (closed squares); IC2-PA/LF (circles); PC (triangles); and PC + IC2-PA/LF (open squares),
  • Figure 15C is a graph showing the viability ( ) of cells that were incubated with the indicated treatments in the presence of various dilutions of sera obtained from
  • mice in Figures 15A and 15B after the indicated round of therapy.
  • the treatments and the rounds of therapy were as follows: IC2-PA/LF (2nd) (circles): PC (T); PC+IC2-PA/LF (2nd) ( ⁇ ): PC+IC2-PA/LF (5th) ( A); PBS (closed squares); and naive (untreated) (open squares),
  • Figure 15D is a graph showing the viability of cells (%) that were treated with the LF and the indicated concentratio s of PA.
  • the EC50 of PA is 6 ng/mL
  • Figures 16A and 16B are graphs showing the viability (%) of LL3 (circles) and B16-BL cells (squares) that were treated with various concentrations of cyclophosphamide (A) or pentostatin (B).
  • Figure 16C is a graph showing the viability (%) of LL3 (circles) or B16-BL cells (squares) (%) that were treated with various concentrations of pentostatin and
  • Figure 16D is a graph showing the viability (%) of endothelial cells that were treated with various concentrations of pentostatin and cyclophosphamide.
  • Figure 17A is a graph showing the survival (percentage) of wild-type (WT) (squares), CMG2" ⁇ (circles), and TEM8 " ' “ (diamonds) mice at various time points (hours) following injection of native PA and FP59. Group sizes are indicated for each toxin,
  • Figure ⁇ 7 ⁇ is a graph showing the survival (percentage) of WT (squares), CMG2 “ (circles), and TEM8 " ' “ (diamonds) mice at various time points (hours) following injection of PA 1656Q and FP59. Group sizes are indicated for each toxin.
  • Figure 17C is a graph showing the survival (percentage) of WT (squares), CMG2 “ ' “ (circles), and TEM8 " ' “ (diamonds) mice at various time points (hours) following injection of PA 1656V and FP59. Group sizes are indicated for each toxin.
  • Figure 17D is a graph showing the survival (percentage) of (i) WT (open squares) and C G2 " ' " (open circles) mice at various time points (hours) following injection of the PA E654T/R659S/M662R protein (abbreviated PA TSR) and FP59 and (ii) WT (closed squares) and CMG2 " ' ⁇ (closed circles) mice at various time points (hours) after injection of native PA and FP59. Group sizes are indicated for each toxin.
  • PA TSR PA E654T/R659S/M662R protein
  • Figure I SA is a graph showing the body weight (g) of mice bearing a HeLa xenograft which were injected intraperitoneally with PBS ( ⁇ ), 15 p,g PA-L1 ⁇ 5 fig LF (A), 15 pg PA-LI I656Q + 5 ⁇ LF ( ⁇ ) or 30 ⁇ xg PA-LI TSR + 10 tig LF ( ⁇ ). Group sizes are indicated for each toxin,
  • Figures 19A and 19C are graphs showing oral melanoma tumor size (cm J ) in Dog 1 (A) and Dog 2 (C) treated with 750 p.g IC2-PA (PA-LI -I207R+PA-U2-R200A) plus 250 fig LF at various time points (days) after first treatment.
  • the rightmost arrow indicates surgical removal of the tumor, The remainder of the arrows indicate the days on which the dogs were treated with 1C2-PA plus LF.
  • Figures 19B and 19D are graphs showing the body weight (kg) of Dog 1 (B) and Dog 2 (D) at various time points after first treatment with IC2-PA plus LF.
  • Anthrax toxin is a protein toxin produced by Bacillus anthracis.
  • Anthrax toxin includes three components: the protective antigen (PrAg or PA), the lethal factor (LF), and the edema factor (EF).
  • PA binds to a cell surface receptor for PA.
  • the native, wild-type PA is cleaved after the sequence R KR (SEQ ID NO: 4) by cell-surface furin or furin-like proteases into two fragments: PrAg63 and PrAg20.
  • PrAg63 is a 63 kDa, C-terrainal fragment which remains receptor-bound and forms a homo-oligomeric heptamer.
  • PrAg20 is a 20 kDa, N-terminal fragment which is released into the ceil medium.
  • the PrAg63 homo- oligomeric heptamer forms the binding site for effector components LF and/or EF.
  • Each LF/EF binding site is comprised of three subsites on two adjacent PA monomers.
  • the premature native, wild-type PA amino acid sequence is set forth in Genbank Accession No. ⁇ 352806 (SEQ ID NO: 2).
  • a coding sequence for the premature native, wild-type PA amino acid sequence is the nucleotide sequence of SEQ ID NO: 33 .
  • Another premature PA amino acid sequence is set forth in SEQ ID NO: 5.
  • Premature PA contains an N-terminal signal peptide (SEQ ID NO: 3, which corresponds to amino acid residues 1 -29 of SEQ ID NO: 2) which is removed in the mature form of PA.
  • the mature, wild-type PA amino acid sequence (without the N-terminal signal peptide) is set forth in SEQ ID NO: I , [0070] Unless specified otherwise, amino acid residue position numbers of PA are defined herein by reference to the amino acid sequence of the mature, wild-type PA amino acid sequence of SEQ ID NO: 1. Thus, substitutions of PA are described herein by reference to the amino acid residue present at a particular position, followed by the amino acid with which that residue has been replaced in the particular substitution under discussion. In this regard, the positions of the amino acid sequence of a particular embodimeni of a PA are referred to herein as the positions as defined by SEQ ID NO: 1 .
  • the actual positions of the amino acid sequence of a particular embodiment of a PA are defined relative to the corresponding positions of SEQ ID NO: 1 and may represent different residue position numbers than the residue position numbers of SEQ ID NO: 1.
  • substitutions refer to a replacement of an amino acid residue in the amino acid sequence of a particular embodiment of a PA corresponding to the indicated position of the 735-arnino acid sequence of SEQ ID NO: 1 with the understanding tha the actual positions in the respective amino acid sequences may be different.
  • R200 refers to the arginine normally present at position 200 of SEQ) ID NO: 1
  • R200A indicates that the arginine nonnally present at position 200 of SEQ ID NO: 1 is replaced by an alanine
  • I207R indicates that the isoleucine normally present at position 207 of SEQ ID NO; .1 has been replaced with an arginine.
  • the two or more substitutions may be the same or different, i.e. , each amino acid residue of the two or more amino acid residues being substituted can be substituted with the same or different amino acid residue unless explicitly indicated otherwise,
  • Variants of PA may provide cancer-cell specific cytotoxicity.
  • the PA variant PA-U2-R2QGA is a urokinase plasminogen activator-activated PA variant with LF-binding subsite II residue R200 mutated to Ala
  • the PA variant PA-L1 -I210A is a matrix metalloproteinase-activated PA variant with LF- binding subsite III residue 121 0 mutated to Ala.
  • PA-U2-R200A and PA-L 1 -121 OA provide reduced cytotoxicity when used singly, However, when combined, PA-U2-R200A and PA- LI -121 OA (collectively referred to as IC-PA) form LF -binding competent heterogeneous oligomers by intermoleeular complementation, and achieve high specificity in tumor targeting. Nevertheless, IC-PA may provide undesirable non-specific toxicity to normal tissues.
  • an embodiment of the invention provides & Bacillus anthracis PA comprising a PA amino acid sequence, wherein one or both of amino acid residues 1207 and 1210, as defined by reference to SEQ ID NO: 1 , are, independently, substituted, with the proviso that amino acid residue 1207 is not substituted with alanine and amino acid residue 1210 is not substituted with alanine.
  • the PA comprises a PA amino acid sequence, wherein amino acid residue 1207, as defined by reference to SEQ ID NO: 1 , is substituted, with the proviso that amino acid residue ⁇ 207 is not substituted with alanine.
  • Amino acid residues 1207 and 1210 may be independently substituted with any amino acid residue other than alanine.
  • amino acid residue 1210 is substituted with aspartic acid, glutamic acid, lysine, glutamine, arginine, or serine.
  • amino acid residue 1207 is substituted with arginine, tryptophan, or tyrosine. In an especially preferred embodiment, amino acid residue 1207 is substituted with arginine.
  • an embodiment of the invention provides a Bacillus anthracis PA comprising a PA amino acid sequence, wherein one or more of amino acid residues 1656, Y68I . and L687, as defined by reference to SEQ ID NO: 1 , are, independently, substituted,
  • Amino acid residues 1656, Y681 , and L687 may be independently substituted with any amino acid residue.
  • amino acid residue 1656 is substituted with glutamine, valine, alanine, cysteine, or glutamic acid.
  • amino acid residue Y681 is substituted with alanine.
  • amino acid residue L687 is substituted with alanine.
  • an embodiment of the invention provides a Bacillus anth acis PA comprising a PA amino acid sequence, wherein one or more of amino acid residues E654, R659, and M662, as defined by reference to SEQ ID NO: 1 , are,
  • a PA wherein one or more of amino acid residues E654, R659, and 662 is substituted may be useful as, for example, a research tool and/or may provide anti-tumor activity for tumors that have a high expression of TEM8.
  • Amino acid residues E654, R659, and M662 may be independently substituted with any amino acid residue.
  • amino acid residue E654 is substituted with threonine.
  • amino acid residue R659 is substituted with serine.
  • amino acid residue M662 is substituted with arginine,
  • the inventive PA may comprise any of the amino acid residue substitutions described herein in any combination. Accordingly, an embodiment of the invention provides a Bacillus anthracis PA comprising a PA amino acid sequence, wherein one or more of amino acid residues 1207, 1210, E654, 1656, R659, M662, Y681, and L687, as defined by reference to SEQ ID NO: 1, are, independently, substituted, with the proviso that amino acid residue 1207 is not substituted with alanine and amino acid residue 1210 is not substituted with alanine.
  • PA protective antigen
  • PrAg include PA that includes any one or more of the following modifications: (a) substitution of a native cell- recognition domain for a non-native cell-recognition domain; (b) substitution of a native proteolytic activation site for a non-native proteolytic activation site; (c) modification of a first PA to generate a first modified PA, whereby the first modified PA can pair only with a second PA; or (d) modification of the first PA and the second PA, whereby an effector component (e.g., LF and/or EF) can bind only at a site formed by the interaction of the first PA and the second PA,
  • an effector component e.g., LF and/or EF
  • the PA may be modified by substitution of the native cell recognition domain for a non-native cell recognition domain as described in, e.g., U.S. Patent 7,947,289, which is incorporated herein by reference.
  • the non-native cell recognition domain recognizes and/or binds to a molecule on the surface of a target ceil population (e.g., a cancer cell), thus specifically targeting the modified PA to the target cells.
  • Substitution of a native ceil recognition domain may comprise, e.g., substitution of the native cell recognition domain with a recognition domain for another cell surface molecule.
  • the PA may be modified such that it no longer binds to the PA receptors, but binds to other cell surface molecules (e.g...
  • non-native ceil recognition domains include, e.g., an antibody, a cytokine, or a cell surface receptor ligand.
  • Suitable non-native cell recognition domains include, e.g., V ' EGF, C-CSF, GM-CSF, EPO, EGF, IL-1, IL-2, IL-4, IL-5, IL-6, interferon a, interferon ⁇ , growth hormone, prolactin, thrombopoietin, and TGF- ⁇ .
  • Exemplary antibodies may include, e.g., an antibody that specifically binds a protein that is overexpressed on cancer cells such as, for example, Her2/Neu, CD19, CD276, CD25, CD30, CA19-9, CA-125, VEGF receptors, C-CSF receptors, GM-CSF receptors, EPO receptors, EGF receptors, interleukin receptors (e.g., IL- 1R, IL-2R, IL-4R, IL-5 , or IL-6R), interferon receptors (e.g., interferon a or interferon ⁇ ), growth hormone receptors, prolactin receptors, thrombopoietin receptors, and TGF- ⁇ receptors.
  • a protein that is overexpressed on cancer cells such as, for example, Her2/Neu, CD19, CD276, CD25, CD30, CA19-9, CA-125, VEGF receptors, C-CSF receptors, GM-CSF receptors, EPO receptors,
  • the PAs may he modified by substitution of the native proteolytic cleavage site(s) with normative proteolytic cleavage site(s) as described in, e.g., U.S. Patent 7,947,289, which is incorporated herein by reference.
  • the PA can be activated via cleavage by proteases present on the surface of specific target ceil types (e.g., cancer cells).
  • proteolytic cleavage sites that can be substituted for native cleavage sites on the PA include cleavage sites for any proteases known in the art including, e.g., metalloproteinase, a cysteine protease, an aspartic acid protease, a plasminogen activator, a kallikrein, a type 1 transmembrane serine protease, a type 2 transmembrane serine protease, or a GPI anchored serine protease.
  • proteases include, e.g.., metalloproteinase, a cysteine protease, an aspartic acid protease, a plasminogen activator, a kallikrein, a type 1 transmembrane serine protease, a type 2 transmembrane serine protease, or a GPI anchored serine protease.
  • proteases include, e.g.
  • plasminogen activators uPA and tPA
  • matrix metalloproteinases e.g., MMP-1 ; MMP-2; MMP-3; MMP-7; MMP- 8; MMP-9; MMP-10; MMP-1 1 ; MMP 2; MMP-13; MMP-14; MMP-15; MMP-16; MMP- 17; MMP- 19; MMP-20; MMP-21 ; MMP-23A; MMP-23B; MMP-24; MMP-25; MMP-26; MMP-27; MMP-28; and MT2-MMP); metalloproteases (e.g., Meprin a; Meprin b; Decysin; AD AMI a; ADAM2; ADAMS B; ADAM4; ADAM4B; ADAMS; ADAM6; ADAM7;
  • ADAMTS19 ADAMTS20
  • serine proteases e.g., Kallikrein liKi ; Kallikrein hK2;
  • Kallikrein hK3/PSA Kallikrein hK4; Kallikrein hK5; Kallikrein hK6; Kallikrein hK7; allikreln h .8; Kallikrein h 9; allikrein h 10; Kallikrein h l 1 ; allikrein hK12;
  • the PA is modified by substitution of the native proteolytic cleavage site(s) with an MMP cleavage site or a plasminogen activator cleavage site.
  • MMP and plasminogen activator proteases are overproduced by tumor tissues and are implicated in cancer cell growth and metastasis (Dano el al., APMIS, 107: 120-127 (1999)),
  • the native furin cleavage site (e.g., SEQ ID NO: 4) of the PA is replaced with an MMP cleavage site or a plasminogen activator cleavage site.
  • MMP cleavage sites that may be useful in the inventive PAs include
  • the PA may comprise an MMP cleavage site.
  • MMP cleavage site examples include PCPGRVVGG (SEQ ID NO: 8), PGSGRSA (SEQ ID NO: 9), PGSGKSA (SEQ ID NO: 10), PQRGRSA (SEQ ID NO: 1 1),
  • the PA may comprise a plasminogen activator cleavage site
  • the PA may be modified so that each individual PA molecule (PA monomer) can only form hetero-ollgomers (i.e., each PA monomer can pair only with a PA monomer of a different type (i.e., having a different amino acid sequence)) as described in, e.g., U.S. Patent 7,947,289, which is incorporated herein by reference.
  • the modified PA monomers may comprise PA monomer binding sites which have been modified such that the PA monomer can bind only to a PA monomer of a different type, In some embodiments, the PA monomer binding sites have been modified such that the PA monomer can bind two P A monomers of two different types.
  • a PA monomer that forms a heptameric complex can be modified so that each PA monomer can bind only to two different, but complementary PA monomers, each of which has a modified PA monomer binding site.
  • one or more of the following amino acid substitutions may provide a PA monomer that can only form a hetero-oligomeric heptamer: aspartic acid at position 512 for alanine; aspartic acid at position 512 for lysine: lysine at position 199 for glutamic acid; argimne at position 468 for alanine, and arginine at position 470 for aspartic acid.
  • a modified PA monomer comprising an alanine at position 512 is unable to homo-oligomerize, but can form functional hetero-oligomers with a modified PA with a glutamic acid at position 199, an alanine at position 468, and an aspartic acid at position 470, as defined by reference to SEQ ID NO: 1 .
  • the PA may be modified so that at least two PA monomers (each having a different amino acid sequence) are needed to bind an effector component (e.g., LF and/or EF) so that the effector component can be delivered to a target- cell and exert a biological effect (e.g., target cell killing or inhibition of target cel l proliferation) as described in, e.g., U.S. Patent 7,947,289, which is incorporated herein by reference.
  • the portion of a first PA monomer that binds to the effector component may be modified so thai a second PA monomer of a different type (i.e., having a different aminoa cid sequence) is required to effectively bind the effector molecule.
  • the native lethal factor (LF) binding site of the PA may be mutated so that at least two different FA monomer types are required to bind LF.
  • a substitution of the native amino acid residue at one or more of the following positions may provide a PA monomer that cannot homo-oligomerize to form a functional LF binding site: 178, 197, 200, 207, 210, and 214, as defined by reference to SEQ ID NO: I .
  • the combination of (i) a PA monomer comprising a substitution of the native amino acid residue at position 200 and (si) a PA monomer comprising a substitution of the amino acid residue at position 207 may form functional PA heptamers that bind LF.
  • the combination of (i) a PA monomer comprising a substitution of the native amino acid residue at position 200 and (ii) a PA monomer comprising a substitution of the amino acid residue at position 210 may forrri functional PA heptamers thai bind LF.
  • substitutions may provide a PA monomer that cannot homo-oligomerize to form a functional LF binding site: arginine at position 178 tor alanine; lysine at position 197 for alanine; arginine at position 200 for alanine; isoleueine at position 207 for arginine;
  • Modified PA monomers comprising alanine at position 200 e.g., R.200A
  • modified PA monomers comprising alanine at position 210 e.g., 121 OA
  • modified PA monomers comprising arginine at position 21 0 e.g., I207R
  • modified PA monomers comprising alanine at position 214 are unable to homo-oligomerize and form a functional PA heptamer that binds LF.
  • any one or more of (i) a PA monomer having the substitution of R200A or R200C with (ii) any one or more of a PA monomer having the substitution of 1207 R, 1207 W, I210D, 1210E, 121 OK. 1210Q, 121 OR, or 121 OS may form functional PA heptamers that bind LF.
  • a PA monomer comprising R200A and a PA monomer comprising I2Q7R may form functional PA heptamers that bind LF.
  • an embodiment of the invention also provides compositions comprising combinations of any of the PA monomers described herein which, when employed singly, are unable to homo-oligomerize and form a functional PA heptamer that binds LF, but when combined, may form functional PA heptamers that bind LF.
  • an embodiment of the invention provides a composition comprising a first.
  • P A comprising a first PA amino acid sequence and a second PA comprising a second PA amino acid sequence.
  • the first PA comprises a first PA amino acid sequence, wherein (i) one or both of amino acid residues ⁇ 207 and 1210, as defined by reference to SEQ I D NO: 1 , are, independently, substituted, with the proviso that amino acid residue 1207 is not substituted with alanine and amino acid residue 1210 is not substituted with alanine; (ii) one or more of amino acid residues 1207, 1210, E654, 1656, R659, M662, Y68L and L687, as defined by reference to SEQ ID NO: I , are, independently, substituted, with the proviso that amino acid residue 1207 is not substituted with alanine and amino acid residue 1210 is not substituted with alanine; (iii) one or more of amino acid residues 1656, Y681 , and L
  • the second PA comprises a second PA ammo acid sequence, wherein amino acid residue R200 of the second PA ammo acid sequence, as defined by reference to SEQ ID NO: 1 , is substituted.
  • the second PA amino acid sequence is different from the first PA amino acid sequence.
  • Amino acid residue 11200 of the second PA amino acid sequence may be substituted with any amino acid residue.
  • amino acid residue R200 of the second P A amino acid sequence is substituted with alanine, cysteine, aspartic acid, glutamic acid, glycine, isoleucine, methionine, proline, serine, valine, or tryptophan.
  • amino acid residue R200 of the second PA amino acid sequence is substituted with alanine.
  • the first PA and the second PA may include any of the modifications described herein with respect to other aspects of the invention.
  • the second PA amino acid sequence is modified by substitution of the native proteolytic cleavage site(s) with any of the normative proteolytic cleavage site(s) described herein.
  • the first PA comprises an MMP cleavage site and the second PA comprises a plasminogen activator cleavage site.
  • the plasminogen activator cleavage site may be selected from the group consisting of SEQ ID NOs: 8-15.
  • the inventive compositions may further comprise an effector component which binds to a heptamer formed by the modified PAs and exerts a biological effect (e.g., killing of a target cell or inhibition of target cell proliferation).
  • Suitable effector components include, e.g., anthrax lethal factor, anthrax edema factor, truncated anthrax lethal factor (e.g., LFn or amino acids 1 -254 of anthrax lethal factor), FP59 (LFn fused to the ADP-ribosylation domain of Pseudomonas exotoxin A as described in, e.g., Arora et al., J. Biol.
  • CdtB cytolethal distending toxin subunit B
  • Toxin proteins such as, for example, the PAs described herein, may be highly immunogenic upon administration to a mammal. Such immunogenicity may reduce the amount of PA that can be given to a mammal which may, in turn, reduce the effectiveness of the PA for treating or preventing the disease, e.g., cancer, it has been discovered that the combination of pentostatin and cyclophosphamide advantageously reduces or prevents the induction of antibodies against the inventive PAs described herein. Accordingly, an embodiment of the invention provides any of the compositions described herein, wherein the composition further comprises an immunosuppressive agent. In an embodiment of the 75 invention, the immunosuppressive agent is the combination of peniostatin and
  • An embodiment of the invention provides a nucleic acid comprising a nucleotide sequence encoding any of the inventive PAs described herein.
  • the nucleic acid comprises a nucleotide sequence encoding a PA amino acid sequence including the I207R substitution, wherein the nucleotide sequence comprises SEQ ID NO: 29.
  • nucleic acid includes “polynucleotide,”
  • oligonucleotide and “nucleic acid molecule,” and generally means a polymer of DNA or RNA, which can he single-stranded or double-stranded, which can be synthesized or obtained (e.g., isolated, purified, or both isolated and purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural, or altered intemucleotide linkage, such as a phosphoroaxnidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide.
  • nucleic acid does not comprise any insertions, deletions, inversions, substitutions, or combinations thereof, However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, substitutions, or combinations thereof.
  • the nucleic acids of the invention are recombinant.
  • the term “recombinant” refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments, or (ii) molecules that result from the replication of those described in (i) above.
  • the replication can be in vitro replication or in vivo replication.
  • the nucleic acids can be constructed based on chemical synthesis, enzymatic ligation reactions, or combinations thereof using procedures known in the art. See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 4th Ed. (2012).
  • a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides).
  • modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5 ⁇ chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosme, 5 -(carboxyhydroxymethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxvmethylamir!omethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N 6 -isopentenyladenine, 1 -methyl guanine, I-methylinosine, 2,2-dimeihylguanine, 2 -methyl adenine, 2 -methyl guanine, 3 -niethylcytosine, 5-meihylcytosme, N & -substituted adenine, 7-methylguanine, 5 -methyl amm
  • nucleic acids of the invention can be purchased from companies, such as Macromolecnlar Resources (Fort Collins, CO) and Synthegen (Houston, TX),
  • the invention also provides a nucleic acid comprising a nucleotide sequence which i s complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hyhridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein,
  • the nucleotide sequence which hybridizes under stringent conditions preferably hybridizes under high stringency conditions.
  • high stringency conditions is meant that the nucleotide sequence specifically hybridizes to a target, sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is deteetably stronger than non-specific hybridization, High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches, from a random sequence that happened to have only a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence.
  • Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases, and high stringency hybridization makes them easily distinguishable,
  • Relatively high stringency conditions would include, for example, low salt conditions, high temperature conditions, or combinations thereof, such as provided by about 0.02-0.1 NaCI or the equivalent, at temperatures of about 50-70 °C.
  • Such high stringency conditions tolerate little, if any, mismatch between the nucleotide sequence and the template or target strand, and are particularly suitable for detecting expression of any of the inventive proteins or chimeric molecules. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide,
  • the invention also provides a nucleic acid comprising a nucleotide sequence that is about 70% or more, e.g., about 80% or more, about 90% or more, about 91 % or more. about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more identical to any of the nucleic acids described herein.
  • nucleic acids of the invention can be incorporated into a recombinant expression vector.
  • the invention provides recombinant expression vectors comprising any of the nucleic acids of the invention.
  • “recombinant expression vector' means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted, with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell,
  • the vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring.
  • the inventive recombinant expression vectors can comprise any type of nucleotides, including, but not limited to DNA and R A, which can be single-stranded or double-stranded, which can be synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides.
  • the recombinant expression vectors can comprise naturally-occurring, non-naturally-occurring internucleotide linkages, or both types of linkages.
  • the noti-naturally occurring or altered nucleotides or internucleotide linkages do not hinder the transcription or replication of the vector.
  • the recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host cell.
  • Suitable vectors include those designed for propagation and expansion or for expression or for both, such as piasmids and viruses.
  • the vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pRmeseript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, Wl), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA), Bacteriophage vectors, such as ⁇ ⁇ , GTl l, ZapIl (Stratagene), ⁇ and ⁇ ⁇ 149, also can be used.
  • plant expression vectors include pB Oi . pBilOL2, pBilOl .3. ⁇ 21 and ⁇ 19 (Clontech).
  • animal expression vectors include pEU -C , MAM, and pMAMneo (Clontech).
  • the recombinant expression vector is a viral vector, e.g., a retroviral vector.
  • the recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques described in, for example, Green and Sambrook, supra. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system fimctional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from ColEl, 2 ⁇ plasmid, ⁇ , SV40. bovine papilloma virus, and the like.
  • the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g.. bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.
  • regulatory sequences such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g.. bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.
  • the recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts.
  • Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like.
  • Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
  • the recombinant expression vector can comprise a native or nonnative promoter operably linked to the nucleotide sequence encoding the inventive protein or chimeric molecule (including functional portions and functional variants), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the protein or chimeric molecule.
  • promoters e.g., strong, weak, inducible, tissue-specific, and developmental-specific, is within the ordinary skill of the artisan.
  • the combining of a nucleotide sequence with a promoter is also within the ordinary skill of the artisan.
  • the promoter can be a non- viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, or a promoter found in the long-terminal repeat of the murine stem cell virus.
  • a viral promoter e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, or a promoter found in the long-terminal repeat of the murine stem cell virus.
  • CMV cytomegalovirus
  • inventive recombinant expression vectors can he designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression.
  • Another embodiment of the invention further provides a host cell comprising any of the recombinant expression vectors described herein.
  • the term "host cell” refers to any type of cell that can contain the inventive recombinant expression vector.
  • the host cell can he a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa.
  • the host cell can be a cultured cell, an adherent cell or a suspended cell, i.e., a cell that grows in suspension.
  • the host cell is preferably a prokaryotic cell, e.g., an E, coli cell.
  • the population of cells can be a heterogeneous population comprising the host cell comprising any of the recomhinant expression vectors described, in addition to at least one other cell, e.g., a host cell which does not comprise any of the recombinant expression vectors.
  • the population of cells can be a substantially homogeneous population, in which the population comprises mainly (e.g., consisting essentially of) host cells comprising the recombinant expression vector.
  • the population also ca be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all ceils of the population comprise the recombinant expression vector.
  • the population of cells is a clonal population of host cells comprising a recombinant expression vector as described herein,
  • inventive proteins include functional portions and functional variants), nucleic acids, recombinant expression vectors, host ceils, and
  • populations of ceils can be isolated, purified, or both isolated or purified.
  • isolated as used herein means having been removed from its natural environment, The term
  • purified as used herein means having been increased in purity, wherein “purity” is a relative term, and not to he necessarily construed as absolute purity.
  • the purity can be about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100%.
  • the purity preferably is about 90% or more (e.g., about 90% to about 95%) and more preferably about 98% or more (e.g., about 98% to about 99%).
  • inventive PAs, nucleic acids, recombinant expression vectors, host cells, populations of cells, and compositions, all of which are collectively referred to as "inventive P A materials" hereinafter, can be formulated into a pharmaceutical composition.
  • the invention provides a pharmaceutical composition comprising any of the PAs, nucleic acids, recombinant expression vectors, host cells, populations of cells, or
  • compositions described herein, and a pharmaceutically acceptable carrier are a pharmaceutically acceptable carrier
  • the carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration.
  • the pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.
  • the choice of carrier will be determined in part by the particular inventive PA material, as well as by the particular method used to administer the inventive PA material. Accordingly, there are a variety of suitable formulations of the pharmaceutical composition of the invention.
  • suitable formulations for parenteral e.g., subcutaneous, intravenous, intraarterial, intramuscular, intradermal, interperitoneal, intratumoral, and intrathecal
  • oral admin stration are exemplary and are in no way limiting. More than one route can be used to administer the inventive PA materials, and in certain instances, a particular route can provide a more immediate and more effective response than another route.
  • Formulations suitable for oral administration can include (a) liquid solutions, such as an effective amount of the inventive PA material dissolved in diluents, such as water or saline; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions.
  • Liquid formulations may include diluents, such as water and alcohols, for example, ethanoL benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant.
  • Capsule forms can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and com starch.
  • Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, eroscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate.
  • Lozenge forms can comprise the inventive PA material in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the inventive PA material in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like additionally containing such excipients as are known in the art,
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thicken
  • the inventive PA material can he administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, dimethylsulfoxide, glycerol, ketals such as 2,2- dimethyl-] ,3-dioxolane-4-methanol, ethers, poiy(ethyleneglycoi) 400, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylceilulose, hydroxypropylmethylcellulose, or
  • a pharmaceutically acceptable surfactant such as a
  • carboxymethylcellulose or emulsifying agents and other pharmaceutical adjuvants.
  • Oils which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils, Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, oli ve, petrolatum, and mineral.
  • Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid, Ethyl oleate and isopropyl myrisiate are examples of suitable fatty acid esters.
  • Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolarmne salts, and suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, tatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-P-aminopropionates, and 2-alkyl-imidazohne quaternary ammonium salts, and (e) mixtures thereof.
  • the parenteral formulations will typically contain from about 0.5% to about 2% by weight per volume of the inventive PA material in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile 2 balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adduets of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
  • HLB hydrophile-lipophile 2 balance
  • parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeza-dried (iyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
  • sterile liquid excipient for example, water
  • Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • the requirements for effective pharmaceutical carriers for parenteral compositions are well-known to those of ordinary skill in the art (see, e.g., Lloyd et al. (Eds.) Remington: The Science and Practice of Pharmacy, Pharmaceutical Press, 22 nd Ed. (2012)).
  • the amount or dose of the inventive PA material administered should be sufficient to effect a desired response, e.g., a therapeutic or prophylactic response, in the mammal over a reasonable time frame.
  • the dose of the inventive PA material should be sufficient to inliibit growth of a target, cell or treat or prevent cancer in a period of from about 2 hours or longer, e.g., 12 to 24 or more hours, from the time of administration. In certain embodiments, the time period could be even longer.
  • the dose will be determined by the efficacy of the particular inventive PA material and the condition of the mammal (e.g., human), as well as the body weight of the mammal (e.g., human) to be treated.
  • An administered dose may be determined in vitro (e.g., cell cultures) or in vivo (e.g., animal studies). For example, an administered dose may be determined by determining the ICJO (the dose that achieves a half-maximal inhibition of symptoms), LD 50 (the dose lethal to 50% of the population), the EDso (the dose therapeutically effective in 50% of the population), and the therapeutic index in cell culture, animal studies, or combinations thereof.
  • the therapeutic index is the ratio of LD 5 o to ED5 0 (i.e., LDso ED j).
  • the dose of the inventive PA material also may be determined by the existence, nature, and ex tent of any adverse side effects thai might accompany the administration of a particular inventive PA material.
  • the attending physician will decide the dosage of the inventive PA. material with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, inventive PA material to be administered, route of administration, and the severity of the condition being treated.
  • the dose of the inventive PA material can be about 0.001 to about 1000 mg kg body weight of the subject being treated/day, from about 0.01 to about 10 mg/kg body weight/day, about 0,01 mg to about 1 mg kg body weight/day, from about I to about to about 1000 mg/kg body weight/day, from about 5 to about 500 mg kg body weight/day, from about 10 to about 250 mg/kg body weight day, about 25 to about 150 mg/kg body weight/day, about 10 mg/kg body weight/day, about 2 mg/kg body weight/day io about 5 mg/kg body weight/day, or about 4 mg/kg body weight/day.
  • the inventive PA materials may be assayed for cytotoxicity by assays known in the art.
  • cytotoxicity assays include a MTT (3-(4,5-dimethyl-2-thiazolyl)-2,5- diphenyl-2H-tetrazolium bromide) assay, as described in Liu et aL J. Biol Chem., 278; 5227- 5234 (2003).
  • inventive PA materials can be used in methods of treating or preventing a condition such as, for example, cancer.
  • a condition such as, for example, cancer.
  • compositions comprising a combination of the first PA and the second PA as described herein form LF-binding competent
  • the invention provides a method of treating or preventing cancer in a mammal, the method comprising administering to the mammal any of the inventive PA materials described herein in an amount effective to treat or prevent cancer in the mammal.
  • the method further comprises administering to the mammal one or more of any of the effector components described herein.
  • the first PA, the second PA, and the effector component may be administered simultaneously or in any suitable sequence.
  • the method may comprise administering th first PA prior to administering the second PA and administering the effector component after administering the second PA.
  • the method may comprise administering the first PA and the second PA simultaneously and prior to administering the effector component.
  • the method comprises administering the first PA, the second PA, and the effector component simultaneously.
  • the method further comprises administering one or more immunosuppressive agents to the mammal in an amount effective to decrease the immune response to the inventive PA material.
  • Administering one or more immunosuppressi e agents to the mammal may, advantageously, eliminate or reduce an anti-PA material immune response including, for example, the production of anti-PA material antibodies and/or T-cells, that may otherwise undesirably neutralize the cytotoxic activity of the inventive PA material, in this regard, administering one or more immunosuppressive agents to the mammal may, advantageously, increase the amount of inventive PA material that can be given to the mammal which may, in turn, increase the effectiveness of the inventive PA material for treating or preventing a condition, such as, for example, cancer.
  • the method may comprise administering the inventive PA material and die one or more immunosuppressive agents simultaneously or sequentially to the mammal. While the method may comprise administering the one or more immunosuppressive agents to the mamma! after administering the inventive PA material, preferably the method comprises administering the one or more immunosuppressive agents to the mammal prior to
  • administering the inventive PA material advantageously may eliminate or reduce an undesirable immune response to the inventive PA material before the immune system is exposed to the inventive PA material.
  • the method may comprise administering the one or more immunosuppressive agents to the mammal about one to about seven days prior to administering the inventive PA material to the mammal.
  • the one or more immunosuppressive agents may comprise any agent suitable for suppressing an immune response to the inventive PA material.
  • the one or more immunosuppressive agents are selected from the group consisting of pentostatin, cyclophosphamide, and tofacitinib (Hassan et al., Sci. Trans ⁇ Med,, 5(208):208ral47 (2013); Mossoba et al, Clin. Cancer Res., 17: 3697-3705 (201 1); and Onda et ah, J Immunol. , 193(1): 48-55 (2014), in an embodiment of the invention, the one or more
  • immunosuppressive agents comprise a combination of pentostatin and cyclophosphamide, Pentostatin and cyclophosphamide may be administered simultaneously or in sequence. For example, pentostatin may be administered before administering cyclophosphamide.
  • cyclophosphamide may be administered prior to administering pentostatin.
  • pentostatin and cyclophosphamide provides anti-solid tumor effects when used in the absence of any other pharmaceutically active agents.
  • an embodiment of the invention provides a method of treating or preventing a solid tumor in a mammal, the method comprising administering to the mammal pentostatin and cyclophosphamide in an amount effective to treat or prevent the solid tumor in the mammal.
  • the method comprises administering pentostatin and cyclophosphamide in the absence of any other pharmaceutically active agents (e.g., in the absence of any other anti-cancer agents).
  • the method comprises administering pentostatin and cyclophosphamide in the absence of any of the inventive PA materials described herein.
  • the method comprises administering pentostatin and cyclophosphamide (and a pharmaceutically inactive carrier) alone.
  • Pentostatin and cyclophosphamide may be administered simultaneously or in sequence as described herein with respect to other aspects of the invention,
  • inventive methods can provide any amount or any level of treatment or prevention of cancer in a mammal.
  • the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented.
  • prevention can encompass delaying the onset of the disease, or a symptom or condition thereof.
  • the cancer can be any cancer, including any of adrenal gland cancer, sarcomas (e.g., synovial sarcoma, osteogenic sarcoma, leiomyosarcoma uteri, angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma, myxoma, rhabdomyoma, fibroma, lipoma, and teratoma), lymphomas (e.g., small, synovial sarcoma, osteogenic sarcoma, leiomyosarcoma uteri, angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma, myxoma, rhabdomyoma, fibroma, lipoma, and teratoma), lymphomas (e.g., small cells, fibroma, lipoma, and teratoma), lymphomas (e
  • lymphocytic lymphoma Hodgkin lymphoma, and non-Hodgkin lymphoma
  • hepatocellular carcinoma glioma
  • head cancers e.g., squamous cell carcinoma, e.g., oral squamous cell carcinoma
  • neck cancers e.g., squamous ceil carcinoma
  • acute lymphocytic cancer leukemias (e.g., hairy cell leukemia, myeloid leukemia (acute and chronic), lymphatic leukemia (acute and chronic), proh iphocytic leukemia (PLL), myelomonocytie leukemia (acute and chronic), and lymphocytic leukemia (acute and chronic)), bone cancer (osteogenic sarcoma, fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma.
  • leukemias e.g., hairy cell leukemia, mye
  • Swing's sarcoma malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor, chordoma, osteochondroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxoid fibroma, osteoid osteoma, and giant cell tumors), brain cancer (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma (pinealoma), glioblastoma multiforme, oligodendroglioma, schwannoma, and retinoblastoma), fallopian tube cancer, breast cancer, cancer of the anus, anal canal, or anorectum, cancer of the eye, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the
  • lung adenocarcinoma malignant mesothelioma, skin cancer (e.g., melanoma, basal cell carcinoma, squamous cell carcinoma, Kaposi's sarcoma, nevi, dysplastic nevi, lipoma, angioma, dermatofibroma, and keloids), multiple myeloma, nasopharynx cancer, ovarian cancer (e.g..
  • ovarian carcinoma (serous cystadenocarcinoma, mucinous cystadenocarcinoma, endometrioid carcinoma, and clear cell adenocarcinoma), granulosa-theca cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, and malignant teratoma), pancreatic cancer (e.g., ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, and ViPoma), peritoneum, omentum, mesentery cancer, pharynx cancer, prostate cancer (e.g., adenocarcinoma and sarcoma), rectal cancer, kidney cancer (e.g., adenocarcinoma, Wilms tumor (nephroblastoma), and renal cell carcinoma), small intestine cancer (adenocarcinoma, lymphoma, carcinoid tumors, Kaposi
  • testicular cancer e.g., seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, Leydig cell tumor, fibroma, fibroadenoma, adenomatoid tumors, and lipoma
  • cancer of the uterus e.g., endometrial carcinoma
  • thyroid cancer e.g., endometrial carcinoma
  • urothelial cancers e.g., squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma, ureter cancer, and urinary bladder cancer.
  • the cancer is a solid tumor.
  • the solid tumor is an oral squamous carcinoma tumor, a melanoma tumor, a lung tumor, or an ovarian tumor.
  • inventive PA materials wherein one or more of amino acid residues 1207, 1210, 1656, Y681 , and L687 are substituted as described herein, are toxic to tumor endothelial cells that express CMG2. Accordingly, in an embodiment of the invention, the endothelial cells of the solid tumor express CMG2.
  • inventive PA materials wherein one or more of amino acid residues E654, R659, and M662 are substituted as described herein, are toxic to cells that express TEM8. Accordingly, in an embodiment of the in vention, the cells of the tumor express TEMS.
  • the term "mammal” refers to any mammal, including, but not limited to, mammals of the orders Rodentia, such as mice and hamsters; Logomorpha, such as rabbits; Carnivora, including Felines (cats) and Canines (dogs); Artiodactyla, including Bovir.ies (cows) and S wines (pigs): Perssodactyla, including Equines (horses); Primates, Ceboids, or Simoids (monkeys) or Anthropoids (humans and apes), In a preferred, rodentia, such as mice and hamsters; Logomorpha, such as rabbits; Carnivora, including Felines (cats) and Canines (dogs); Artiodactyla, including Bovir.ies (cows) and S wines (pigs): Perssodactyla, including Equines (horses); Primates, Ceboids, or Simoids (monkeys) or Anthropoids (humans and
  • the mammal is a human, mouse, cat or dog.
  • a method of inhibiting the growth of a target cell comprising contacting the ceil with any of the inventive PA materials described herein, in an amount effective to inhibit growth of the target cell.
  • the growth of the target cell may be inhibited by any amount, e.g., by about 10% or more, about 1 5% or more, about 20% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80%) or more, about 85% or more, about 90% or more, about 95% or more, or about 100%.
  • the target cell may be provided in a biological sample.
  • a biological sample may be obtained from a mammal in any suitable manner and from any suitable source.
  • the biological sample may, for example, be obtained by a blood draw, leukapheresis, tumor biopsy necropsy, or combinations thereof.
  • the contacting step can take place in vitro or in vivo with respect to the mammal.
  • the contacting is in [0131]
  • the target cell is a cancer ceil.
  • the target cell is a cancer cell.
  • the target ceil may be a cancer cell of any of the cancers described herein, in an embodiment of the invention, the target may express a ceil surface molecule.
  • the cell surface marker may be any cell surface molecule described herein with respect to other aspects of the invention.
  • the method may comprise contacting the cell with the mventive PA material and the effector component simultaneously or sequentially, in an embodiment of the invention, the method comprises contacting the cell with the inventive PA materia! prior to contacting the cell with the effector component, In another embodiment, the method comprises contacting the cell with the effector component prior to administering the inventive PA material Preferably, the method comprises contacting the cell with the effector component and the inventive PA simultaneously.
  • the products were gel-purified and the complementary PCR fragments were extended to full length by 10 cycles of PCR before addition of PA-250 and PA-Swal-rev and an additional 35 cycles.
  • These mutagenic inserts were gel-purified and the inserts, along with pYS52, were digested with Psti and HindllL
  • the digestion products were ligated overnight and transformed into chemically competent E. coli MCI 061, which were plated on lysogeny broth (LB)-agar plates containing 100 ampicillin.
  • Colony PGR using PA-250 and PA-Swal-Rev primers was performed to identify positive clones. Colonies were screened using primer PA-250 to sequence the piasmid and identify clones having all possible substitutions. Selected clones were then grown overnight in LB containing 100 ⁇ -g/mL ampicillin and the plasmids were extracted by mini-scale preparation.
  • Mini-prepared plasmids from E, coli MCI 061 were transformed into chemically competent E. coli SCSI 10, which is dam " and dcrn " .
  • the purified, non-methylated plasmids from SCSI 10 were then transformed into an eiectrocompetent B. anihr cis BH480 strain, which was plated on LB-agar containing 20 p.g/mL kanamycin.
  • BH 80 is an avirulent large plasmids-cured, sporalation-defeetive B. anihracis strain with eight proteases deleted, serving as an efficient host for recombinant protein expression (Pomerantsev et al., Protein Expr.
  • RAW264.7 macrophages and murine melanoma B16-BL6 cells were grown in Dulbecco's Modified Eagle Medium (Life Technologies, Grand Island, NY) supplemented with fetal bovine serum to 10% (Invitrogen) and gentamycin at 50 Lig/mL (invitrogen) at 37 °C in a tissue culture incubator with 5% C0 2 ,
  • PA variants that showed less toxicity than the original constructs PA-R200A and PA-I210A were subjected to a double-agent gain-of-funetion test.
  • RAW 264.7 macrophages were seeded as above and respective PA variants (250 ng raL) combined with PA-R200A or PA-I210A (250 ng mL) and 100 ng mL LF were added. The cells were incubated for 6 h and viability was measured as above.
  • Site-directed mutagenesis was used to introduce mutation I207R into pYS5-Ll ft, an overexpression plasmid for PA-LI, in which the furin cleavage sequence RKKR (SEQ ID NO: 4) (residues 164-167) was replaced with a MMP substrate sequence GPLGMLSQ (SEQ ID NO; 6) (Liu et al., Cancer Res., 60: 6061-6067 (2000)).
  • Primers used were SEQ ID NO: 27 (I207R sense), SEQ ID NO: 28 (I207R antisense).
  • Sense and anti-sense primers were used with the QUIKCHANGE LIGHTNING Kit (Agilent, Santa Clara, CA) according to manufacturer's recommendations and transformed into chemically competent E. coli XL- 10 GOLD cells.
  • the plasmids were mini-prepared, sequenced, and transformed into E. coli SCSI 10 before transformation into BH480 for expression and purification.
  • the coding sequence for PA-L1-1207R was the nucleotide sequence of SEQ ID NO: 29. Cytotoxicities of PA-L1-J207R and PA ⁇ L1 ⁇ I2I0A were tested singly and in combination with PA-U2- R200A (with the furin cleavage sequence replaced with an uPA substrate sequence
  • PGSGRSA SEQ ID NO: 9 (Liu et al, J. Biol Chem., 276, 17976-17984 (2001) ⁇ in the presence of 30 ng/mL FP59.
  • B16-BL.6 cells were incubated with the indicated toxins in 96- well plates for 48 h, and cell viabilities were determined by MTT assay as described above.
  • PA-L1 -I210A, PA-L1 -I207R, PA-U2-R200A, LF and FP59 were expressed using pYS5-based expression plasmids from B, anthracis BH480 strain.
  • the recombinant proteins secreted into culture supematants were purified as described previously (Pomerantsev et al,, supra Liu et al,, Cell. Microbiol., 9: 977-987 (2007)).
  • the expression plasmid transformed BH480 strains were grown in FA medium with 1 0 pg rnl kanamycin for 12 h at 37 °C.
  • the proteins secreted into the culture supematants were precipitated on PHENYL- SEPHAROSE 6 FAST FLOW resin (low substitution. GE Healthcare Life Sciences, Pittsburg, PA) (30 ml per liter supernatant) in the presence of 2 M ammonium sulfate in rotating bottles, The resin was collected on a porous plastic funnel and washed with wash buffer (1 .5 M ammonium sulfate, 10 mM Tris-HCI (pH 8.0), 1 m EDTA) and the proteins were eluted using elution buffer (0.3 M ammonium sulfate, 10 mM Tris-HCI (pH 8.0), 1 mM EDTA).
  • the eluted proteins were precipitated by adding 2 M ammonium sulfate, The precipitate was collected by cenirifugation, resuspended and dialyzed in 1 0 mM Tris-HCI (pH 8,0), 1 mM EDTA, The toxin proteins were further purified by chromatography on Q- SEPHAROSE FAST FLOW column (GE Healthcare Life Sciences) and eluted with a 0-0.5 M NaCI gradient in 20 mM Tris-HCI, 0.5 mM EDTA (pH 8.0). The toxin proteins were further purified by SEPHACRYL S-200 high resolution gel filtration (GE Healthcare Life Sciences) using 1 0 mM Tris-HCI (pH 8.0), 100 mM NaCI , and 0.5 mM
  • EDTA ethylenediaminetetraacetic acid
  • Tumor-bearing mice were randomized into groups and injected intraperitoneally on study days 0 (eight days after tumor cell injection), 2, 4, 7, and 9 with a 200 pL PBS solution containing the FA variant proteins and LF, at doses shown in Figure 5. Mice were weighed and the tumors were measured before each injection. The study was ended on day 10 when tumors in the PBS alone control group reached 10% of the body weights, a condition requiring euthanasia according to the animal study protocol.
  • PA proteins were usually expressed at high levels by the correspondingly transformed BH480 strains, often reaching levels above 50% of the total protein in the culture supernatant.
  • 2I4 lies at the end of an ct-helix and the side chain makes no close contact with any other residues on PA. it is not clear why so many mutants at this position could not be expressed.
  • PA-I207R is an improved clockwise-side monomer variant.
  • PA-R200C was slightly less toxic than PA-R200A, it was also slightly less effective in complementing with PA-I210A to promote killing of RAW264.7 cells. Therefore, none of the counterclockwise-side monomer PA variants were found to he significantly superior to the original PA-R200A.
  • RAW264.7 macrophages were identified: I207R, I207W, 121 OD, 1210E, 121 OK, I210Q, 121 OR, and 121 OS (Figure 2), These were tested in combination with R200A and R200C for their ability in intermoleeular complementation (Figure 3B). All of these clockwise-side mutants could he complemented by PA-R200A and to a lesser extent by PA-R200C. Among these PA variants, PA-1207R behaved the best in complementing with both PA-R200A and PA-R200C to achieve killing of RAW264.7 cells. Therefore, PA-I207R was identified as an improved clockwise-side monomer variant for the intermoleeular complementation PA system, displaying very low cytotoxicity when used singly.
  • PA-I207R the MMP-activated variant, i.e., PA-L1-I207R (SEQ ID NO: 30) was generated and the protein purified.
  • the new combination of PA-L1 - I207R. and PA-U2-R200A was compared with the original combination of PA- LI -121 OA and PA-U2-R200A for cytotoxicity towards mouse melanoma B16-BL6 cells, which express high levels of both MMPs and uPA.
  • PA-L1-I2Q7R showed similar activity as PA-LM207A in complementing with PA--U2--R200A to kill B16-BL6 cells in the presence of FP59, a LF fission effector protein that kills cells in a PA-dependent manner (Arora et ah, Infect. Immun., 62: 4955-4961 ( 1994)) (Figure 4A).
  • PA-U2-R200A also showed no cytotoxicity when used singly in these settings ( Figure 4A).
  • PA-U2- R200A was encoded by the nucleotide sequence of SEQ ID NO: 31 .
  • the tumor-bearing mice were treated with either PBS, low doses of the new combination or the original combination of the PA variants plus LF (7.5 pg/7.5 ⁇ /5 ⁇ g), or high doses of each combination plus LF (22.5 ⁇ /22.5 ⁇ ⁇ 5 ⁇ ig). All of the toxin-treated groups showed significant anti-tumor activities compared to the PBS control group ( Figure 5) (P ⁇ 0.0003 for all toxin-treated groups. Student's t test).
  • FP59 is a fusion pro ein of LF amino acids 1-254 and the catalytic domain of Pseudomonas aeruginosa exotoxin A that kills cells by ADP-ribosylation of eukaryotic elongation factor-2 after delivery to cytosol by PA,
  • the LF and FP59 used here contain the native ammo- terminal sequence AGG (Gupta et al, supra).
  • MTT 3-[4,5-din ethylihiazol-2-yi]-2,5- diphenyltetrazolium bromide
  • pentosiaiin SML0508-25 mg
  • Cyclophosphamide DC 10019-957-01.
  • Baxter Healthcare Baxter Healthcare (Deerfield, IL).
  • mice lungs and B16-BL6 tumors were digested with type I eollagenase and plated on gelatin and collagen-coated flasks.
  • the cells were then subjected to sequential negative sorting by magnetic beads coated with a sheep anti-rat antibody using a Fc Blocker (rat anti- mouse CD16/CD32, Cat. 553142, BD Pharmingen, San Diego, CA) to remove macrophages and positive sorting by magnetic beads using an anti-intermoleeular adhesion molecule 2 (ICAM2 or CD] 02) antibody (Cat. 553326, rat anti-mouse CD102, BD Pharmingen) to isolate endothelial cells.
  • Fc Blocker rat anti- mouse CD16/CD32, Cat. 553142, BD Pharmingen, San Diego, CA
  • IAM2 or CD] 02 anti-intermoleeular adhesion molecule 2
  • Endothelial cells were cultured in DMEM supplemented with 20% fetal bovine serum, endothelial cell growth supplement (30 mg in 500 mL DMEM) (E2759- 15 mg, Sigma), heparin (50 mg in 500 mL DMEM) (H3149-100 KU, Sigma).
  • DMEM fetal bovine serum
  • endothelial cell growth supplement (30 mg in 500 mL DMEM) (E2759- 15 mg, Sigma), heparin (50 mg in 500 mL DMEM) (H3149-100 KU, Sigma).
  • heparin 50 mg in 500 mL DMEM
  • H3149-100 KU Sigma.
  • cytotoxicity assays cells grown in 96-well plates (50% confluence) were incubated with various concentrations of PA or PA variant proteins combined with 500 ng/mL LF for 72 h. In some experiments, cells were incubated with various concentrations of pentostatin or cyclophospham
  • Tumor endothelial cells grown in 12-well plate were incubated with indicated concentrations of PA-LI plus LF for 3 h at 37 °C, then washed three times with Hank's Balanced Salt Solution (Biofiuids, Rockville, MD) to remove unbound toxins. Cells were then lysed in modified radioimmunoprecipitation assay (RIP A) lysis buffer containing protease inhibitors (Liu et al,, J. Biol.
  • Endothelial cells cultured in 12-well plates were treated with or without PALI /LF for 24 h, total RNA was then prepared using TRIZOL reagent (Invitrogen, Carlsbad, CA). Single-strand cDNA was synthesized using reverse transcriptase reaction kit following the manufacturer's manual (invitrogen). Expression changes of the selected key genes involved in glucose uptake, glycolysis, tricarboxylic acid cycle, glutarninolysis, and lipid synthesis were analyzed by real-time quantitative PGR using a SYBR Cireen PGR Mastermix kit.
  • Extracellular Flux analyzer (Seahorse Bioscience, North Billerica, MA). Tumor cells and tumor endothelial cells grown to confluence in 24-well XF24 tissue culture plates were incubated with or without PA-L1/LF (1 p.g/mL each) in pentapiieates for 24 h. Cells were changed into fresh unbuffered serum-free DMEM with 200 mM GLUTAMAX--1 medium, 25 mM D-glucose, pH 7,4, and equilibrated in the medium for 1 h.
  • ECARs real-time extracellular acidification rates
  • OCR.s oxygen consumption rates
  • Adenosine triphosphate (ATP) production-coupled OCR is calculated as the difference between basal OCR and OCR after addition of oligomycin.
  • Spare respiratory capacity (SRC) is defined as the difference between the OCR following FCCP addition and the OCR under basal condition.
  • Maximal respiration (MR) is defined as the difference between the OCR following FCCP addition and the OCR following oligomycin addition, Cellular ATP levels were measure using ATPLITE I STEP kit (PerkinElmer, Boston. MA).
  • TEM8- and CMG2-null mice were generated previously (Liu et al., Proc. Natl Acad. Sci. USA, .106: 12424-12429 (2009)). TEM8- and CMG2-null mice were also crossed with athymic nude ⁇ Foxn.!* wnu ) mice (Jackson Laboratory, Bar Harbor, Maine) to generate athymic nude TEM8- and CMG2-nu.ll mice, which were used to establish human tumor xenografts.
  • tissue-specific CMG2-n ll mice including Cmg2(ECJ' Cmg2(SMf ⁇ , Cmg2(Mye) " ' ⁇ mice, and the tissue-specific CMG2-expressing mice, including Cmg2 bC and Cmg2 :>M mice were generated as described previously (Liu et al., Proc. Nail. Acad. Sci. USA, 106: 12424-12429 (2009); Liu et al, Cell Host Microbe, 8: 455-462 (2010); Liu et al., Nature, 501 : 63-68 (2013)). (Full descriptions of the genotypes are provided in the legends of Figures SA-8E.
  • mice 10-14-week-old male and female mice were used.
  • 5 xlO 5 cells/mouse B16-BL6 melanoma cells or LL3 lung carcinoma cells were injected in the mid-scapular subcutis of the pre-shaved mice with indicated genotypes.
  • 1 x 10' ceils/mouse Colo205 colorectal carcinoma cells or A549 lung carcinoma cells were injected irttradermally into athymic nude mice having the indicated ⁇ 8 or CMG2 genotypes. Tumors were measured with digital calipers (FV Fowler Company.
  • tumor weight (mg) 1 ⁇ 2(length in mm ⁇ width in mm") or 1 ⁇ 2(length in mm x width in mm height in mm).
  • Tumor-bearing mice were randomized into groups and injected intraperitoneal! ⁇ ' following schedules indicated in the figures, with PBS, the engineered toxins, a PC regimen, or a combined therapy. Mice were weighed and the tumors measured before each injection. Ail animal studies were carried out in accordance with protocols approved by the National Institute of Allergy and infectious Diseases Animal Care and Use Committee.
  • B16-BL6 or LL3 tumor-bearing mice from various treatment groups were terminally bled and sera prepared.
  • RAW264.7 cells grown in 96-weIl plates were incubated with 100 ng mL PA plus 100 ng/niL LF (amounts that kill >95 of the cells) in the presence of various dilutions of the sera for 5 h, followed by MTT assay to determine cell viabilities as described above.
  • BD Pharmingen anti-CD 1 l b PerCP-Cy5 ⁇ Cat. 550993, BD Pharmingen), and anti-Gr-1 FITC (Cat. 553127, BD Pharmingen), or anti-IgD FiTC (Cat. 553439, BD Pharmingen), anti-IgM PE (Cat. 553409, BD Pharmingen), and anti- CD27 PerCP-Cy5 (Cat. 563603, BD Pharmingen).
  • the cells were analyzed using a BD FACSCanto Flow Cytorneter and percentages of each cell population positive for indicated immune ceil markers were obtained. Ceil numbers positive for each immune cell marker were obtained by: total splenocytes * % of the marker positive cells.
  • mice Because both CMG2- and TEM8-null mice are able to support normal tumor growth, these mice provide powerful genetic tools to dissect the mechanisms by which the engineered anthrax toxins control tumor growth. To determine the role of stromal compartments in the potent anti-tumor acti vities of the engineered anthrax lethal toxins. A549 tumor-bearing Cmg2 '/' and TernS' " mice and their Iitterniate control mice were treated with PA-L1/LF after tumors had grown to about one gram.
  • A549 cells contain wild-type BRAF and are resistant to PA-L1/LF in in vitro cytotoxicity assays ( Figures 13A and 13B), While A549 tumors in Cmg2*'* and Cmg2*' ⁇ mice were very sensitive to the toxin, the tumors growing in Cmg2 ⁇ ⁇ mice were much less sensitive ( Figures 7E and 7F). n contrast, the A549 tumors growing in Tem.8 ' ' ' mice, as well as in their littermate control mice, all were sensitive to the toxin treatments (Figures 7G and 7H). These results clearly demonstrate that the antitumor activities of the engineered toxin involve targeting certain tumor stromal
  • B16-BL6 tumors were inoculated into three types of mice: Crng2 ⁇ '' ⁇ mice, Cmgl' ' mice with a CMG2-transgene expressed only in endoihelial cells (named Cmg2 & ' ⁇ hereafter, see Liu et ah, Nature, 501 : 63-68 (2013) for detailed description), and Cmgl 1' mice with a CMG2-transgene expressed only in vascular smooth muscle cells (C g2 SM ) (see Lin et ah, Nature, 501 : 63-68 (2013) for detailed description).
  • Cmg2 SM vascular smooth muscle cells
  • B16-BL6 cells are insensitive to PA-L1/LF in in vitro cytotoxicity assays (Figure 7D).
  • Figure 7E B16-BL6 melanomas in Cmgl' " mice were insensitive to PALI /LF, whereas the same tumors in Cmg2 +/ ⁇ mice were extraordinarly sensitive ( Figures 8A and 8B).
  • Figures 8A and 8B While the B16-BL6 tumors in Cmg2 SM mice were, like in Cmgl ' ' mice, insensitive to the toxin, the tumors in Cmg2 £ ' " mice were fully sensitive ( Figures 8A and 8B).
  • CMG2 endothelial expression is sufficient to mediate the anti-tumor activities of the toxin.
  • B16- BL6 tumors were grown in endothelial cell-specific CMG2-null (termed Cmg2(EC) ' ' ⁇ hereafter, see Liu et ah, Nature, 501 ; 63-68 (2013) for detailed description) mice, The tumors in Cmg2(EC) ⁇ ' ⁇ mice completely lost sensitivity to PA-L1/LF as well as to PA-IC2/LF ( Figures 8C and 8D), whereas the tumors in myeloid CMG2-specific CMG2-null
  • mice remained sensitive to PA-IC2/LF ( Figure 8D). No antitumor activity was observed when PA-LI was used alone, confirming that the antitumor activity of these toxins requires the action of LF, the enzymatic moiety of the toxins.
  • carbocyanine dye Dil by cardiac perfusion (Li et ah, Nat. Proioc, 3: 1703-1708 (2008)).
  • Dil directly incorporates into endothelial cell membranes upon contact, al lowing visualization by fluorescence microcopy of vasculature structures within tumors and normal tissues.
  • no differences were detected in vasculature structures of various normal tissues, including the spleens, kidneys, livers, and hearts of the B16-BL6 tumor- bearing mice treated with PBS and the toxin.
  • blood vessels were abundant in the tumors treated with PBS. vessels in the tumors treated with PA-Ll/LF were rarely detected (Figure 8F).
  • B16-BL6 melanomas and LLC carcinomas were also sectioned and histologically analyzed after the tumor-bearing mice were treated with PA-L1 /LF or PBS.
  • Extensive tumor necrosis (H&E staining) and decreases in cell proliferation ( i67 staining) accompanied by loss of tumor vascular structures were readily detected in the toxintreated B16-BL6 and LLC tumors.
  • Tumor endothelial cells were isolated from B.16-BL6 tumors through i termoiecular adhesion molecule 2 (ICAM2) sorting to investigate the toxic effects of the engineered toxins on tumor endothelial cells. The purity of the isolated endothelial cells was confirmed by another endothelial marker, CD 31.
  • IAM2 i termoiecular adhesion molecule 2
  • FP59 is a fusion protein of LF amino acids 1-254 and the catalytic domain of Pseudomonas aeruginosa exotoxin A that kills all cells by ADP ribosylation of eEF2 after delivery to cytosol by PA.
  • the cells were treated with PA-L l/LF for 48 h and 72 h, respectively, followed by annexin V plus propidium iodide (PI) staining to identify apoptotic cells by flow cytometry.
  • PA-LI plus FP59 could induce dramatic apoptotic cell death 24 h after incubation, PA -LI. plus LF could not do so even after 72 h incubation.
  • the engineered lethal toxin did not directly kill endothelial ceils, the toxin displayed potent inhibitoiy effects on endothelial cell proliferation.
  • Ki67 staining revealed that tumor endothelial cell proliferation nearly completely ceased after 72 h incubation with the toxin.
  • the toxin's effects on endothelial cells could be folly replicated by trametinib (although much higher molar concentrations were required), a small molecule inhibitor of MEKI 12 approved by the Food and Drug Administration for treating patients having metastatic melanoma with BRAF V60 E mutation.
  • the tumor-associated protease-activated anthrax lethal toxins exhibit potent anti-tumor activities even for the tumors composed of cancer cells that are insensitive to the toxins.
  • a subset of human cancer cells have oncogenic BR AF mutations such as BRAF V6 0E that make the tumor cells dependent on the RAF-MEK-ERK pathway for survival while also making themakily sensitive to anthrax lethal toxin (Abi-Habib et al., MoL Cancer Ther., 4: 1303- 1.310 (2005)). It was hypothesized that engineered anthrax lethal toxins would have additional benefit in treatment of solid tumors having the ⁇ ⁇ 00 ⁇ mutation.
  • Colo205 tumors in Cmg2"' ⁇ mice were sensitive to the toxin treatment, although the response to the toxin treatment was lower than the strong response of the tumors growing in Cmg2 v/V mice ( Figure 14), These results suggest that in the 'toxin-sensitive' tumors, the anti-tumor activity of the toxin depends on targeting both tumor endothelial cells as well as the cancer cells.
  • Tumor endothelial cells were isolated from B16-BL6 tumors to investigate the underlying mechanisms of the toxic effects of the engineered toxins on tumor endothelial cells. Notably, proliferation of the endothelial cells cultured in endothelial cell growth media was decreased significantly after the cells were incubated with PA-LI/LF for 72 h ( Figure 9A). The delivery of LF into the eytosof of endothelial cells by PA-LI was evidenced by the cleavage of MEK2 after a 3-h incubation with the toxin. Images were taken of the live.
  • ECARs extracellular acidification rates
  • OCRs oxygen consumption rates
  • the tumor-associated protease-activated anthrax toxins provide high tumor specificity and high a ti-tumor efficacy.
  • these bacterial proteins are foreign antigens to mammalian hosts and may induce neutralizing antibodies that prevent long-term use. Therefore, strategies for preventing an immune response may be useful.
  • Antibodies were detected as early as 10 days after the first treatment, the time at which the tumors began to show decreases in response to the toxin (only) treatment. Strikingly, no neutralizing antibodies were detected in the tumor-bearing mice of the combined therapy group even after the 4 th round of therapy ( Figures IOC, 10D, and 10E).
  • the ECD of TEM8 (amino acids 35-227) with a C-terminal His6 sequence was expressed in CHO cells.
  • the latter protein was concentrated and purified from the culture medium with a nickel- nitrilotriaceiic acid column (Qiagen, Valencia, CA) and further purified by ONOQ column chromatography (GE Healthcare, Pittsburgh, PA).
  • Minimum essential medium alpha, HEPES buffer, hygromycin B, Hanks' balanced salt solution (HBSS), and fetal bovine serum (FBS) were from Invitrogen.
  • mutagenic nucleoside triphosphates 8 ⁇ oxo-2'- deoxyguanosine triphosphate (8-Oxo-dGTP) and 6-(2-deoxy-P-D-ribofuranosyS)-3,4-dihydro- 8H-pyrimido-[4,5-c][l,2]oxazm-7-one triphosphate (dPTP) were purchased from Trilink Biotechnologies (San Diego, CA). Other chemical reagents were obtained from Sigma (St. Louis, MO).
  • Random mutagenesis of PAD4 was accomplished by PGR amplification with 10 ng of pYS5 template DNA and nucleotide analogues 8-oxo-dGTP and dPTP (Chen et al., J. Biol. Chem,, 282: 9834-9846 (2007); Zaccoio et al., J. Mol Biol, 255: 589-603 (1996)).
  • the PGR reaction (a total volume of 25 ⁇ ) contained 2.5 units of Takara Ex TaqDNA polymerase (Clontech, Mountain View, CA), 1 ⁇ each of forward primer
  • SOC1TGAATTCATTTCATTATGATAGAAATAAC3' SEQ ID NO: 34
  • reverse primer 5'AATTCAAGCTTTCCTATCTCATAGCCTTTTTT 3' SEQ ID NO: 35
  • 2 raM MgCh 0 mM Tris- HC1, pH 8.3, 50 mM KCL 400 ⁇ each of dATP, dCTP, dGTP, dTTP, 50 ⁇ of 8-oxo- dGTP and 10 ⁇ of dPTP.
  • Bacteriophage (1 x 10 :' particles) were then added to the mixture and incubated at 4 °C for 90 min, The beads were washed five times with the same buffer over total time periods of 10 min, 2 h, 5 h and 20 h in the four successive panning cycles.
  • bacteriophage were eluted from the beads with 100 ⁇ of TALON elution buffer (150 mM imidazole, 50 mM Na Phosphate, pl-I 8.0, 300 mM NaCL 5 mM MgCl 2, 0.01% Tween-20, and 100 ⁇ g/ml of bovine serum albumin) by incubating the mixture on a roller for 10 min at 4° CI Phage were amplified by growth in E, coli BLT5403 and used in the next cycle of panning.
  • TALON elution buffer 150 mM imidazole, 50 mM Na Phosphate, pl-I 8.0, 300 mM NaCL 5 mM MgCl 2, 0.01% Tween-20, and 100 ⁇ g/ml of bovine serum albumin
  • Bacteriophage from the fourth round of panning were picked from individual bacteriophage plaques, suspended in M9LB broth (Novagen, Madison, WI) and set at room temperature for 2 h to allow bacteriophage particles to diffuse from the agar. EDTA was then added to the bacteriophage suspension to give a final concentration of 10 mM, and the suspension was heated at 65 °C for 10 min.
  • One microliter of the sample was used for PGR amplification in reactions containing 2.5 units of Takara Ex TaqDNA polymerase, forward primer 5'TA AGTACGCAATGGGCC ACG3 ' (SEQ ID NO: 36), and reverse primer
  • oligonucleotides were synthesized having the sense strand sequence of SEQ ID NO: 38 and antisense strand sequence of SEQ ID NO: 39, where either (but not both) the E654 codon gaa or the 1656 codon ata in the sense strand and the corresponding codons in the antisense strands were fully randomized. Additionally, mutants having R659S/M662R substitutions p is all 19 amino acid substitutions of E654 were made in a similar way by including the 659S and 662R codons in the oligonucleotides described above.
  • double strand cassettes were obtained by heating the mixture of sense and antisense strands at 100 °C for 10 min and allowing the mixture to cool slowly to room temperature.
  • the resulting products were digested with Stul and Xhol and J. gated into pYS54 digested with the same restriction endormcl eases, and the ligation mixtures were transformed into E. coli XL-1 Blue. Plasmid DNAs isolated from individual clones were sequenced to select all 20 amino acids substitutions.
  • PA TSR PA E654T/R659S/M662R protein
  • furin site sequences used included those from PA-U7 (as above) and PA-LI , the latter being one cleaved by matrix metalloproteases (Liu et ai., Cancer Res., 60: 6061 -6067 (2000)),
  • the doubly-mutated PA proteins derived from PA TSR were accordingly named as PA-U7 TSR and PA-LI TSR.
  • Plasmids encoding individual constructs described above were transformed into the nonvirulent B. anthracis strains BH450 or BH460 and transformants were grown in FA medium with 10 ⁇ ⁇ 1 kanamycin for 15 h at 37 °C (Pomerantsev et al.. Protein Expr. Purif, 80: 80-90 (2011)). PA proteins were concentrated from culture supematanis and purified by chromatography on a MONOQ column (GE Healthcare) by methods described previously (Pomerantsev et al, Protein Expr, Purif, 80: 80-90 (201 1); Park et ai.. Protein Expr. Purif. 18, 293-302 (2000)).
  • MEF cells were passaged at 85-90% confluence by splitting 1 :4 and used within the first six passages.
  • Athymic nude mice were injected intraderraally with 1 x10' HeLa cells/mouse, and tumor xenografts were allowed to grow to 0,05% of body mass.
  • Tumor-bearing mice were randomized into groups and injected intraperitoneall at intervals of 2 or 3 days, as indicated in the figures, with six doses of PBS or the engineered toxins. Body weights and tumor masses were measured at 2 or 3 day intervals.
  • Table 2 Experimental procedures were the same as described in Table 1 , except the magnetic beads were washed for 10 min, 2 h, 5 h, and 20 h in I s ', 2 m , 3 1 and 4 i!l rounds of panning, respectively.
  • a total of 104 phage clones were sequenced over the 420-base pair (bp) region corresponding to PA amino acids 596-735. These DNA sequences were aligned. The resulting amino acid sequences of the clones were determined, Among the resulting total of 43,680 bp examined, a total of 616 changes were found, for a mutation rate of 1.4%.
  • Ile656 was mutated to all other 19 amino acids. Substitutions of I1e656 with Leu, Met, Gin, Ser, Thr, Val, and Tyr were well tolerated, because these proteins retained cytotoxicity to the wild-type CHO WTP4 cells (Table 3). While these Ile656 mutants also retained activity to CHO C G2-C4 cells, the CHO cell line that over-expresses only CMG2, all these PA variants displayed greatly decreased cytotoxicity to CHO TEM8-T4 cells, which over-express only ⁇ 8.
  • FA I656Q and I656S showed no cytotoxicity to CHO TEM8-T4 cells at the highest concentrations tested, 80 ng/ ' ml. Therefore, PA I656Q and 1656S are highly selective for CMG2. All other variants showed decreased cytotoxicity to all three types of CHO cells. PA I656W showed no cytotoxicity to the cell lines even at the highest concentration (80 ng/ml) tested (Table 3). Nearly all the 1656 substitution variants showed a much greater loss of cytotoxicity toward the CHO TEM8-T4 cells than toward CHO CMG2- C4 and CHO WTP4 cells,
  • nc is for not able to be calculated.
  • Table 4 PA E654 variants containing all 20 amino acids at position 654 were tested for toxicity to CHO cells. Values in the table are EC50, the concentrations of the PA proteins that killed 50% of cells when combined with 100 ng/ml of FP59. The analyses were performed three times, and the averages are listed.
  • PA variants were selected combining all 19 amino acids replacing E654 with the R659S/M662R. substitutions. All 19 substitution mutants showed decreased toxicity toward CHO-CMG2-C4 cells (Table 5). Particularly, the PA variants KSR, PSR and RSR were nontoxic to CHQ-CMG2-C4 cells when added at 80 ng/ml, the highest concentration tested. In contrast, variants PA ASR, GSR, HSR, MSR, NSR, QSR, SSR, TSR and WSR. had potencies equal or slightly greater than that of native PA toward CHO-TEM8-T4 cells (Table 5).
  • PA TSR was 2- fold-more toxic to CHO-TE 8-T4 cells than native PA but 23-fold less toxic to CHO- CMG2-C4 cells.
  • the PA QSR, MSR and GSR variants were similar to PA TSR, being only slightly less selective, Based on these data, PA MSR, QSR and TSR were selected for further study.
  • Table 5 PA variants having R659S and M662R substitutions along with substitution of each of the other 19 amino acids at position 654 were tested for toxicity to CHO cells.
  • the 3-letter designation identifies the non-native substitutions at positions 654, 659, and 662, Values in the table are EC 50 , the concentration of the PA protein that produces 50% killing when combined with 100 ng/ml of FP59. The analyses were performed three times, and the averages are listed.
  • Nontoxic variants of the PA I656Q, PA I656V, and PA TSR proteins were constructed by replacing their furin cleavage sites, lb4 R. K.R 167 (SEQ ID NO: 4), with the uneleavable sequence PGG of the previously characterized PA-U7 protein (Liu et al, J. Biol. Chem., 276: 17976-17984 (2001)).
  • the resulting PA-U7 I656Q, PA-U7 I656V, and PA-U7 TSR were used as nontoxic receptor binding competitors.
  • Table 7 Analyses were performed as described in the Methods section. PA-U7, PA-U7 I656V, and PA-U7 1656Q, and PA-U7 TSR were used as competitors for PA in cytotoxicity assays with the two cell lines listed. Schild plot analyses determined the apparent affinities of the competitors for the receptors on the two cell lines.
  • PA variants were tested against HeLa cell xenografts in mice, in comparison to the previously described PA-LI variant.
  • the PA variants used here contained the MMP-speci!le LI sequence at the fiirin site so as to achieve tumor specificity, and the effector used was LF rather than FP59, Mice bearing solid intradermal tumor nodules constituting -0.05% of the total body mass were challenged by intraperitoneal injection of six doses of the toxins at 2- or 3 -day intervals. At the doses used, mouse body weights did not differ between the groups (Fig, 18 A). In addition, the mice showed no outward sign of illness or gross abnormalities.
  • This example demonstrates a method of treating oral melanoma in cats by administering IC2-PA and LF.
  • phase I/II dose dose- finding and efficacy trial was initiated.
  • the first and second cohorts of this trial received six injections of a dose 5x or 25x greater than in the phase 0 trial, respectively, A reduction in tumor volume has been observed in three of the five cats with no adverse effects.
  • the trial is currently ongoing,
  • EXAMPLE 20 0233 This example demonstrates a method of treating oral melanoma in dogs by administering IC2-PA and LF.
  • IC2-PA and LF a method of treating oral melanoma in dogs by administering IC2-PA and LF.
  • two dogs with oral melanoma were enrolled and treated with 375 iig PA-U2-R20GA + 375 ⁇ g PA-L1-I207R + 250 ⁇ g LF, three times a week for two weeks by intratumoral injection, followed by surgical removal of the tumors.
  • the two dogs tolerated the treatments well with no significant side effects.
  • the dogs' bod - weight and tumor sizes were measured throughout the study. The results are shown in Figures 19A-I9D.
  • the trial is currently ongoing,

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
PCT/US2016/048706 2015-08-27 2016-08-25 Modified anthrax toxin protective antigen Ceased WO2017035359A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP16767065.2A EP3341393B1 (en) 2015-08-27 2016-08-25 Modified anthrax toxin protective antigen
CN201680062198.3A CN108350041A (zh) 2015-08-27 2016-08-25 修饰的炭疽毒素保护性抗原
US15/755,341 US10835593B2 (en) 2015-08-27 2016-08-25 Modified anthrax toxin protective antigen
JP2018510419A JP6865211B2 (ja) 2015-08-27 2016-08-25 改変された炭疽毒素保護抗原
CA2996767A CA2996767C (en) 2015-08-27 2016-08-25 Modified anthrax toxin protective antigen
KR1020187008131A KR20180073555A (ko) 2015-08-27 2016-08-25 변형된 탄저균 독소 방어 항원
AU2016311429A AU2016311429C1 (en) 2015-08-27 2016-08-25 Modified anthrax toxin protective antigen

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562210771P 2015-08-27 2015-08-27
US62/210,771 2015-08-27
US201662323218P 2016-04-15 2016-04-15
US62/323,218 2016-04-15

Publications (1)

Publication Number Publication Date
WO2017035359A1 true WO2017035359A1 (en) 2017-03-02

Family

ID=56943920

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/048706 Ceased WO2017035359A1 (en) 2015-08-27 2016-08-25 Modified anthrax toxin protective antigen

Country Status (7)

Country Link
US (1) US10835593B2 (https=)
EP (1) EP3341393B1 (https=)
JP (1) JP6865211B2 (https=)
KR (1) KR20180073555A (https=)
CN (1) CN108350041A (https=)
AU (1) AU2016311429C1 (https=)
WO (1) WO2017035359A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10835593B2 (en) 2015-08-27 2020-11-17 The United States Of America As Represented By The Secretary Department Of Health And Human Services Modified anthrax toxin protective antigen
CN117343942A (zh) * 2023-12-06 2024-01-05 南京市食品药品监督检验院 一种pagA重组蛋白及其制备方法
RU2821917C1 (ru) * 2023-03-07 2024-06-27 Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В.Ломоносова" (МГУ) Рекомбинантная вакцина против сибирской язвы на основе вирусов растений

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2019379604B2 (en) 2018-11-16 2026-04-23 Rapa Therapeutics, Llc Als treatment using induced regulatory T (iTREG) cells
EP4150060A4 (en) * 2020-05-13 2024-06-19 Rapa Therapeutics, LLC TREATMENT OR PREVENTION OF PRO-INFLAMMATORY DISEASES OR CONDITIONS USING INDUCED REGULATORY T CELLS (IT)
JP7648075B2 (ja) * 2020-11-27 2025-03-18 株式会社ダイセル 融合タンパク質

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001021656A2 (en) 1999-09-24 2001-03-29 The Government Of The United State Of America, As Represented By The Secretary, Department Of Health And Human Services Mutated anthrax toxin protective antigen proteins that specifically target cells containing high amounts of cell-surface metalloproteinases or plasminogen activator receptors
WO2005090393A2 (en) * 2004-02-09 2005-09-29 The Government Of The United States, As Represented By The Secretary Of Health And Human Services Multimeric protein toxins to target cells having multiple identifying characteristics
WO2014134187A1 (en) * 2013-02-26 2014-09-04 The Regents Of The University Of California Compositions and methods for the treatment of cancer
WO2014205187A1 (en) 2013-06-20 2014-12-24 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Cytolethal distending toxin subunit b conjugated or fused to bacillus anthracis toxin lethal factor

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7601351B1 (en) * 2002-06-26 2009-10-13 Human Genome Sciences, Inc. Antibodies against protective antigen
US20100168012A1 (en) 2006-12-14 2010-07-01 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Human cancer therapy using engineered matrix metalloproteinase-activated anthrax lethal toxin that targets tumor vasculatuture
CN101215568B (zh) * 2008-01-18 2010-06-23 畿晋庆三联(北京)生物技术有限公司 抗炭疽多肽及其应用与制备方法
RU2016110800A (ru) * 2013-09-25 2017-10-30 Пронутриа Биосайенсис, Инк. Составы и композиции для поддержания и увеличения мышечной массы, силы и результативности, и способы их производства и использования
US10835593B2 (en) 2015-08-27 2020-11-17 The United States Of America As Represented By The Secretary Department Of Health And Human Services Modified anthrax toxin protective antigen

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001021656A2 (en) 1999-09-24 2001-03-29 The Government Of The United State Of America, As Represented By The Secretary, Department Of Health And Human Services Mutated anthrax toxin protective antigen proteins that specifically target cells containing high amounts of cell-surface metalloproteinases or plasminogen activator receptors
WO2005090393A2 (en) * 2004-02-09 2005-09-29 The Government Of The United States, As Represented By The Secretary Of Health And Human Services Multimeric protein toxins to target cells having multiple identifying characteristics
US7947289B2 (en) 2004-02-09 2011-05-24 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Multimeric protein toxins to target cells having multiple identifying characteristics
WO2014134187A1 (en) * 2013-02-26 2014-09-04 The Regents Of The University Of California Compositions and methods for the treatment of cancer
WO2014205187A1 (en) 2013-06-20 2014-12-24 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Cytolethal distending toxin subunit b conjugated or fused to bacillus anthracis toxin lethal factor

Non-Patent Citations (41)

* Cited by examiner, † Cited by third party
Title
"Remington: The Science and Practice of Pharmacy", 2012, PHARMACEUTICAL PRESS
ABI-HABIB ET AL., MOL. CANCER THER., vol. 4, 2005, pages 1303 - 1310
ARORA ET AL., INFECT. IMMUN., vol. 62, 1994, pages 4955 - 4961
ARORA ET AL., J. BIOL. CHEM., vol. 268, 1993, pages 3334 - 3341
CHEN ET AL., J. BIOI. CHEM., vol. 282, 2007, pages 9834 - 9846
CHEN ET AL., J. BIOL. CHEM., vol. 282, 2007, pages 9834 - 9846
DANO ET AL., APMIS, vol. 107, 1999, pages 120 - 127
GERAN ET AL., CANCER CHEMOTHER. REP., vol. 3, 1972, pages 1 - 103
GREEN; SAMBROOK: "Molecular Cloning: A Laboratory Manual", 2012, COLD SPRING HARBOR LABORATORY PRESS
GUPTA ET AL., PLOS ONE, vol. 3, 2008, pages E3130
HASSAN ET AL., SCI. TRANSL. MED., vol. 5, no. 208, 2013, pages 208RAL47
ITTELSON ET AL., NATURE, vol. 242, 1973, pages 330 - 332
LI ET AL., NAT. PROTOC., vol. 3, 2008, pages 1703 - 1708
LIU ET AL., CANCER RES., vol. 60, 2000, pages 6061 - 6067
LIU ET AL., CELL HOST MICROBE, vol. 8, 2010, pages 455 - 462
LIU ET AL., CELL. MICROBIAL., vol. 9, 2007, pages 977 - 987
LIU ET AL., CELL. MICROBIOL., vol. 9, 2007, pages 977 - 987
LIU ET AL., CELL.MICROBIOL., vol. 9, 2007, pages 977 - 987
LIU ET AL., J. BIOI. CHEM., vol. 276, 2001, pages 17976 - 17984
LIU ET AL., J. BIOI. CHEM., vol. 278, 2003, pages 5227 - 5234
LIU ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 17976 - 17984
LIU ET AL., J. BIOL. CHEM., vol. 278, 2003, pages 5227 - 5234
LIU ET AL., NATURE, vol. 501, 2013, pages 63 - 68
LIU ET AL., PROC. NATL. A CAD. SCI. USA, vol. 106, 2009, pages 12424 - 12429
LIU ET AL., PROC. NATL. ACAD. SCI. U S. A., vol. 106, 2009, pages 12424 - 12429
LIU ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 106, 2009, pages 12424 - 12429
LIU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 106, 2009, pages 12424 - 12429
LIU ET AL., TOXINS, vol. 5, 2012, pages 1 - 8
LIU, NATURE, vol. 501, 2013, pages 63 - 68
LIU, TOXINS, vol. 5, 2012, pages 1 - 8
M. A. WEISS ET AL: "Pentostatin and Cyclophosphamide: An Effective New Regimen in Previously Treated Patients With Chronic Lymphocytic Leukemia", JOURNAL OF CLINICAL ONCOLOGY, vol. 21, no. 7, 1 April 2003 (2003-04-01), US, pages 1278 - 1284, XP055318469, ISSN: 0732-183X, DOI: 10.1200/JCO.2003.08.100 *
MOSSOBA ET AL., CLIN. CANCER RES., vol. 17, 2011, pages 3697 - 3705
ONDA ET AL., J. IMMUNOL, vol. 193, no. 1, 2014, pages 48 - 55
PARK ET AL., PROTEIN EXPR. PURIF., vol. 18, 2000, pages 293 - 302
POMERANTSEV ET AL., PROTEIN EXPR. PURIF, vol. 80, 2011, pages 80 - 90
POMERANTSEV ET AL., PROTEIN EXPR. PURIF., vol. 80, 2011, pages 80 - 90
REYNOLDS ET AL., METHODS MOL. MED., vol. 120, 2006, pages 503 - 509
SANTELLI ET AL., NATURE, vol. 430, 2004, pages 905 - 908
SINGH ET AL., J. BIOI. CHEM., vol. 264, 1989, pages 19103 - 19107
ZACCOLO ET AL., J. MOL. BIOL., vol. 255, 1996, pages 589 - 603
ZACCOLO ET AL., LMOL.BIOL., vol. 255, 1996, pages 589 - 603

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10835593B2 (en) 2015-08-27 2020-11-17 The United States Of America As Represented By The Secretary Department Of Health And Human Services Modified anthrax toxin protective antigen
RU2821917C1 (ru) * 2023-03-07 2024-06-27 Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В.Ломоносова" (МГУ) Рекомбинантная вакцина против сибирской язвы на основе вирусов растений
CN117343942A (zh) * 2023-12-06 2024-01-05 南京市食品药品监督检验院 一种pagA重组蛋白及其制备方法
CN117343942B (zh) * 2023-12-06 2024-02-13 南京市食品药品监督检验院 一种pagA重组蛋白及其制备方法

Also Published As

Publication number Publication date
KR20180073555A (ko) 2018-07-02
AU2016311429A1 (en) 2018-04-19
US20180250376A1 (en) 2018-09-06
JP2018527926A (ja) 2018-09-27
EP3341393B1 (en) 2021-03-03
US10835593B2 (en) 2020-11-17
CN108350041A (zh) 2018-07-31
AU2016311429B2 (en) 2021-07-08
CA2996767A1 (en) 2017-03-02
AU2016311429C1 (en) 2021-10-07
JP6865211B2 (ja) 2021-04-28
EP3341393A1 (en) 2018-07-04

Similar Documents

Publication Publication Date Title
AU2020275877B2 (en) Separation moieties and methods and use thereof
US10835593B2 (en) Modified anthrax toxin protective antigen
AU2017313405B2 (en) Anti-TIGIT antibodies, anti-PVRIG antibodies and combinations thereof
JP2025028963A (ja) 系統特異的抗原の阻害のための組成物および方法
EP3160498B1 (en) Il-15-based molecules and methods of use thereof
CN111432831B (zh) Il-2突变蛋白及其用途
ES2785206T3 (es) Anticuerpos humanos anti-CD40 humano
ES2734889T3 (es) Receptores de células T anti-SSX-2 y materiales relacionados y métodos de uso
AU2019379325B2 (en) Method of treating a tumor with a combination of IL-7 protein and an immune checkpoint inhibitor
KR20150035587A (ko) 그람 양성 박테리아에 대한 박테리오파지 리신과 항생제의 병용물
EP3682000B1 (en) A grna targeting hpk1 and a method for editing hpk1 gene
WO2008014612A1 (en) Fusion proteins and methods for modulation of immune response
KR20160048971A (ko) 종양 치료를 위한 키누레닌 고갈 효소의 투여
Wang et al. Diphtheria-toxin based anti-human CCR4 immunotoxin for targeting human CCR4+ cells in vivo
JP7744621B2 (ja) 切断されたモルモットl-アスパラギナーゼバリアントおよび使用の方法
WO2019110832A1 (en) Combinations of ripk1- and ikk-inhibitors for the prevention or treatment of immune diseases
WO2023118608A1 (en) Discernible cell surface protein variants of cd45 for use in cell therapy
CA2996767C (en) Modified anthrax toxin protective antigen
JP2015522532A (ja) TNF−α阻害剤としてのTACEプロドメインの変異体およびその医学的使用
WO2022098797A1 (en) Therapeutic targeting of mesothelin in acute myeloid leukemia with chimeric antigen receptor t cell therapy
US20250263496A1 (en) Neutrophil-Activating Therapy for the Treatment of Cancer
WO2004087917A1 (ja) チオレドキシン改変体
CN121152635A (zh) 用于增强细胞疫苗的免疫原性的方法
JP2015137247A (ja) ポリペプチド及び抗腫瘍剤
HK1033956A1 (en) Genetically modified tumor-targeted bacteria with reduced virulence

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16767065

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018510419

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15755341

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2996767

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20187008131

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2016767065

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016311429

Country of ref document: AU

Date of ref document: 20160825

Kind code of ref document: A