WO2017034234A1 - Hdac 억제제 내성을 갖는 암 치료용 복합제제 - Google Patents

Hdac 억제제 내성을 갖는 암 치료용 복합제제 Download PDF

Info

Publication number
WO2017034234A1
WO2017034234A1 PCT/KR2016/009177 KR2016009177W WO2017034234A1 WO 2017034234 A1 WO2017034234 A1 WO 2017034234A1 KR 2016009177 W KR2016009177 W KR 2016009177W WO 2017034234 A1 WO2017034234 A1 WO 2017034234A1
Authority
WO
WIPO (PCT)
Prior art keywords
igf2
vorinostat
cancer
inhibitor
stat3
Prior art date
Application number
PCT/KR2016/009177
Other languages
English (en)
French (fr)
Inventor
이호영
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020160104755A external-priority patent/KR20170022915A/ko
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Publication of WO2017034234A1 publication Critical patent/WO2017034234A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/167—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • A61K31/4045—Indole-alkylamines; Amides thereof, e.g. serotonin, melatonin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/07—Tetrapeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the present invention relates to a combination preparation for preventing or treating cancer having HDAC inhibitor resistance, which contains an Insulin-like growth factor 2 (IGF2) inhibitor and a Histone deacetylase (HDAC) inhibitor as an active ingredient.
  • IGF2 Insulin-like growth factor 2
  • HDAC Histone deacetylase
  • Histone deacetylase controls gene expression by regulating deacetylation of histone protein residues.
  • Epigenetic variation by histone or DNA modifications, rather than DNA mutations, is known to be important for gene expression control.
  • regulation of gene expression by acetylation of histones regulated by acetylases and deacetylases is known.
  • Histon deacetylases inhibit the expression of cytostatic factors by inhibiting acetylation of histones. Thereby promoting cell proliferation and regulating tumorigenesis and differentiation of cells.
  • inhibition of HDAC activity has received much attention as a target for the treatment of various diseases including cancer.
  • Histone deacetylase inhibitors selectively express the expression of tumor suppressor genes that are epigeneticly inhibited through transcription-dependent / independent mechanisms involved in the acetylation of histone and non-histone proteins. By inducing it exhibits anticancer efficacy.
  • verinostat Vorinostat; SAHA (suberoylanilide hydroxamic acid)
  • SAHA suberoylanilide hydroxamic acid
  • HDI resistance is a molecular mechanism causing HDI resistance as a basis for a combination therapy to enhance clinical efficacy.
  • DNA hypermethylation which causes resistance by interfering with the ability of HDI to restore transcriptional activity of inhibited tumor suppressors. Therefore, in order to solve this problem, there is an example of effectively using a combination of two drugs targeting DNA methyltransferase (DNMT) and HDAC, respectively, in the treatment of blood cancer, but the specific mechanism of how DNA hypermethylation mediates HDI resistance is still unknown. There is no bar.
  • IGF-1R Insulin-like growth factor 1 receptor
  • the zinc-finger protein CCCTC-binding factor binds to the imprinting control region (ICR) of H19 / IGF2 to isolate the enhancer downstream of H19, acting as an insulator that inhibits transcription of IGF2 upstream.
  • ICR imprinting control region
  • the binding of CTCF is inhibited, resulting in loss of imprinting (LOI), resulting in overexpression of IGF2 upstream.
  • the present inventors conducted a study to identify the factors and mechanisms that cause the resistance of histone deacetylase inhibitors (anticancer drugs), and as a result, the overexpression of IGF2 is a key mechanism that mediates (congenital / acquired) resistance to HDI.
  • the present invention has been completed by discovering that.
  • a combination preparation for preventing or treating cancer having HDAC inhibitor resistance comprising an IGF2 inhibitor and an HDAC inhibitor as an active ingredient.
  • an object of the present invention after measuring the degree of methylation of the H19 / IGF2 ICR (imprinting control region) site in cancer tissue samples, when the methylation increased compared to the normal control group cancer patients are less responsive to HDAC inhibitors It provides a method for predicting the reactivity of cancer patients to the HDAC inhibitor, comprising the step of determining.
  • the present invention provides a combination preparation for the prevention or treatment of cancer with HDAC inhibitor resistance, containing an IGF2 inhibitor and HDAC inhibitor as an active ingredient.
  • the present invention also provides a method for preventing or treating cancer with HDAC inhibitor resistance, comprising administering to the individual an IGF2 inhibitor and an HDAC inhibitor.
  • the present invention also provides a prophylactic or therapeutic use of cancer having HDAC inhibitor resistance of a combination formulation containing an IGF2 inhibitor and an HDAC inhibitor.
  • the HDAC inhibitor is a vorinostat (vorinostat), entinostat (entinostat), panobinostat (panobinostat), romidepsin, belinostat (belinostat), captinostat ( mocetinostat, givinostat (givinostat), psinostat (pracinostat), chidamide (chidamide), it is characterized in that the quisininostat (quisinostat) or Malawiinostat (abexinostat).
  • the IGF2 inhibitor is characterized in that the antibody or peptide that binds to the IGF2 protein and inhibits activity.
  • the IGF2 inhibitor is characterized in that siRNA, shRNA, miRNA or aptamer that binds to the mRNA of IGF2 and inhibits expression.
  • the cancer is characterized in that the lung cancer or lymphoma.
  • the HDAC inhibitor is characterized by increasing the expression of IGF2 and DNMT1 (DNA methyltransferase 1) by inducing acetylation of signal transducer and activator of transcription 3 (STAT3).
  • the acetylated STAT3 is characterized by binding to promoters P3 and P4 of IGF2 to increase the expression of IGF2.
  • the DNMT1 further increases the expression of IGF2 by inducing methylation of the H19 / IGF2 imprinting regulatory site (ICR).
  • the present invention (a) measuring the degree of methylation of the H19 / IGF2 ICR (imprinting control region) site in cancer tissue samples, and (b) HDAC inhibitors when methylation is increased in cancer tissue samples compared to the normal control group It provides a method for predicting the cancer patient's responsiveness to the HDAC inhibitor, comprising the step of determining that the cancer patient is less responsive to.
  • the degree of methylation is characterized by measuring by methylation-specific PCR.
  • the HDAC inhibitor in the method is vorinostat (vorinostat), entinostat (entinostat), panobinostat (panobinostat), romidepsin, belinostat (belinostat), Moses Tinostat (mocetinostat), gibinostat (givinostat), psinostat (pracinostat), chidamide (chidamide), it is characterized in that the quisininostat (quisinostat) or avesinostat (abexinostat).
  • the cancer is characterized in that the lung cancer or lymphoma.
  • the present invention also provides a kit for predicting the reactivity of cancer patients to HDAC inhibitors, including primer pairs specific for H19 / IGF2 imprinting control region (ICR) site.
  • ICR imprinting control region
  • the primer pair is characterized in that for measuring the degree of methylation by methylation-specific PCR.
  • the resistance of histone deacetylase inhibitors can be overcome through IGF2 or STAT3 blocking, it can be usefully used in combination therapy of anticancer drugs based on histone deacetylase inhibitors. .
  • the method for predicting reactivity of the HDAC inhibitor of the present invention it is possible to easily and effectively predict the anticancer drug resistance by a simple method of measuring methylation of the H19 / IGF2 imprinting regulatory region (ICR), thereby solving the problem of low treatment success rate due to the resistance.
  • the prognosis of anticancer drugs can be estimated and the future treatment policy can be determined.
  • FIG. 1 shows the results of evaluating the reactivity of vorinostat using anchorage independent colony formation assay in lung cancer cells.
  • H1944R a vorinostat-acquiring resistant cell
  • romidepsin another HDAC inhibitor
  • Figure 3 is a Western blot and RT-PCR results showing increased IGF2 expression and IGF-1R signaling activation in vorinostat acquisition resistant cells.
  • FIG. 4 is a Western blot showing that activation of IGF-1R signaling is induced by vorinostat treatment in vorinostat obtained resistant cells.
  • FIG. 5 is a real-time PCR result showing that the expression of IGF2 mRNA increased by the treatment of vorinostat in the vorinostat acquisition resistant cells.
  • FIG. 6 is a real-time PCR result showing that IGF2 mRNA expression is increased by vorinostat treatment in vorinostat primary resistant cells.
  • FIG. 7 is an ELISA result showing that IGF2 production and secretion are increased by vorinostat treatment in vorinostat resistant cell culture.
  • FIG. 8 is a Western blot showing that IGF-1R signaling activation by vorinostat is inhibited when IGF2 expression is inhibited in vorinostat resistant cells.
  • FIG. 10 is an RT-PCR result showing that the P3 and P4 promoters of IGF2 are activated by vorinostat treatment in vorinostat resistant cells.
  • FIG. 11 is a luciferase reporter assay showing the activation of the P3 and P4 promoters of IGF2 by vorinostat treatment in vorinostat resistant cells.
  • FIG. 12 is an RT-PCR result showing that IGF2 expression is increased and the P3 and P4 promoters of IGF2 are activated by treatment with other HDAC inhibitors in vorinostat resistant cells.
  • FIG. 13 shows DNA ELISA results showing that STAT3 binding is increased at potential STAT3 binding sites present in P3 and P4 promoters by vorinostat treatment in vorinostat resistant cells.
  • FIG. 15 shows ChIP (chromatin immunoprecipitation) results showing an increase in STAT3 binding at potential STAT3 binding sites present in P3 and P4 promoters by vorinostat treatment in vorinostat resistant cells.
  • 16 is a luciferase reporter assay result showing that STAT3 is essential in the action of increasing IGF2 expression through activation of P3 and P4 promoters by vorinostat.
  • Figure 17 is a real-time PCR results showing that the inhibition of IGF2 mRNA expression by the vorinostat when the expression of STAT3 is reduced by siRNA.
  • FIG. 18 is a real-time PCR result showing that induction of IGF2 mRNA expression by vorinostat is inhibited when STAT3 is inhibited by treating STAT3 inhibitor Stattic.
  • FIG. 19 is a luciferase reporter assay showing that activation of P3 and P4 promoters by vorinostat was significantly inhibited when Stattic, a STAT3 inhibitor, was treated with STAT3.
  • 21 is a Western blot showing that acetylation of STAT3 is increased by the treatment of vorinostat in vorinostat resistant cells.
  • FIG. 22 shows immunohistochemistry (IHC) results showing a significant increase in the expression of IGF2 and acetylated STAT3 in skin T-cell lymphoma (CTCL) patient tissues receiving vorinostat.
  • IHC immunohistochemistry
  • FIG. 23 shows immunofluorescence staining showing that IGF2 expression was inhibited by vorinostat when acetylation of STAT3 was inhibited.
  • FIG. 24 shows RT-PCR and Western blot results showing that apoptosis was promoted by inhibiting IGF2 expression by vorinostat when acetylation of STAT3 was inhibited.
  • 25 is a Western blot showing that the production and secretion of IGF2 by vorinostat is inhibited when acetylation of STAT3 is inhibited.
  • FIG. 26 shows the results of a luciferase reporter assay showing that activation of IGF2 P3 and P4 promoters by vorinostat is reduced when acetylation of STAT3 is inhibited.
  • FIG. 27 shows the results of an attachment dependent colony formation assay showing that the inhibition of colony production of vorinostat is enhanced when acetylation of STAT3 is inhibited.
  • 29 is xenograft results showing that the anti-cancer effect of vorinostat is enhanced when STAT3 is inhibited by Stattic treatment.
  • FIG. 30 shows RT-PCR and Western blot results showing increased expression of DNMT1 in vorinostat-acquired resistant cells.
  • 31 is a Western blot showing that DNMT1 expression is increased in the vorinostat primary resistant cells.
  • 32 is a luciferase reporter assay showing that the activity of the DNMT1 promoter is increased in vorinostat resistant cells.
  • 33 is a real-time PCR result showing that the expression of DNMT1 mRNA is increased by the treatment of vorinostat in vorinostat resistant cells.
  • 35 is a real-time PCR result showing that increased expression of DNMT1 mRNA by vorinostat treatment in vorinostat resistant cells was reduced by inhibiting acetylation of STAT3.
  • FIG. 36 is a methylation-specific PCR result showing that methylation of H19 / IGF2 imprinted regulatory region (ICR) is increased in vorinostat resistant cells.
  • FIG. 39 shows RT-PCR and Western blot results showing that IGF-1R activation and IGF2 expression induction were inhibited by vorinostat when DNMT1 expression was inhibited.
  • 40 is an MTT assay result showing that cancer cell survival inhibitory activity of vorinostat is restored when DNMT1 expression is inhibited.
  • FIG. 41 is a western blot showing that cancer cell death inducing activity of HDAC inhibitors was enhanced by DNMT1 inhibitor (decitabine) treatment.
  • FIG. 41 is a western blot showing that cancer cell death inducing activity of HDAC inhibitors was enhanced by DNMT1 inhibitor (decitabine) treatment.
  • HDAC inhibitors used as anticancer agents
  • HDI acetylated STAT3 induced by HDAC inhibitors
  • IGF2 and DNMT1 DNA methyltransferase 1
  • ICR imprinting control region
  • the present invention has revealed that the histone deacetylase reactivity is regulated according to the degree of methylation of H19 / IGF2 ICR in tissues of lung cancer and cutaneous T-cell lymphoma, so that methylation of H19 / IGF2 ICR is a histone deacetylase inhibitor. It is suggested that it can be a predictive marker that can predict the reactivity of
  • IGF-1R insulin-like growth factor receptor
  • the increase in IGF2 protein by vorinostat treatment is because STAT3 binds to the P3 and P4 promoters of IGF2 and the transcription of IGF2 is increased, and this action is a histone deacetylase inhibitor other than borinostat. It also suggests that they may appear in common.
  • the acetylation of STAT3 is increased by the treatment of borinostat, and the acetylated STAT3 is directly related to the increased expression of IGF2 mediated by the borinostat, and the acetylated STAT3 mediates the expression of DNMT1. It was confirmed.
  • the expression-increased DNMT1 induced methylation of the H19 / IGF2 ICR region to block CTCR ICR binding, thereby inactivating the insulator function of CTCF to induce the expression of IGF2 upstream.
  • the present inventors found that overexpression of IGF2 is a common mechanism that mediates (congenital / acquired) resistance to HDI.
  • HDAC inhibition induces stabilization by acetylation of STAT3 protein (Lys 685 ), which not only promotes transcription of IGF2 through the P3 and P4 promoters, but also chronically inhibits HDAC of DNMT1 (DNA methyltransferase 1). Since overexpression induces methylation of H19 / IGF2 ICR and inhibits CTCF's insulator activity, STAT3-induced IGF2 transcription is further increased.
  • the present invention confirmed that blocking STAT3 or DNMT1 in NSCLC (non-small cell lung cancer) cell lines and patient-derived xenograft tumors (PDX) resistant to HDI restored HDI responsiveness. Therefore, the expression of DNMT1 and the degree of H19 / IGF2 ICR methylation can not only predict reactivity to HDI, but also suggest that IGF2, STAT3, and DNMT1 can be used as new therapeutic targets in overcoming HDI resistance.
  • NSCLC non-small cell lung cancer
  • the present invention suggests that cancer cell death induction and anticancer activity of HDAC inhibitors containing vorinostats is enhanced by blocking STAT3, DNMT1, or IGF2 in vorinostat resistant cells, thereby enhancing the activity of HDAC inhibitors including vorinostats.
  • An anticancer combination agent and combination therapy that can overcome resistance are provided.
  • the present invention demonstrates that the reactivity of vorinostat varies according to the degree of methylation of the H19 / IGF2 imprinting regulatory region in tissues of lung cancer and cutaneous T-cell lymphoma, thereby histone deacetylation in lung cancer and cutaneous T-cell lymphoma. It provides a new method for predicting the reactivity of an enzyme inhibitor.
  • HDAC inhibitors in the present invention is not limited, but vorinostat (vorinostat), entinostat (entinostat), panobinostat (panobinostat), romidepsin, belinostat (belinostat), captinostat (mocetinostat), Givinostat, pracinostat, chidamide, quisininostat or abexinostat, and the like, and are preferably borinostats.
  • the vorinostat has the chemical formula of N-Hydroxy-N'-phenyloctanediamide and the compound name of suberanilohydroxamic acid (SAHA), Zolinza Marketed and approved for the treatment of cutaneous T-cell lymphoma (CTCL).
  • SAHA suberanilohydroxamic acid
  • CTCL cutaneous T-cell lymphoma
  • Entinostat also known as MS-275, has the chemical formula Pyridin-3-ylmethyl N-[[4-[(2-aminophenyl) carbamoyl] phenyl] methyl] carbamate and is currently in clinical trials for various cancer treatments.
  • Panobinostat has the formula (2E) -N-hydroxy-3- [4-([2- (2-methyl-1H-indol-3-yl) ethyl] aminomethyl) phenyl] acrylamide, trade name Farydak Marketed and approved for the treatment of multiple myeloma.
  • Lomidepsin is (1S, 4S, 7Z, 10S, 16E, 21R) -7-ethylidene-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23-tetrazabicyclo [8.7.6 ] tricos-16-ene-3,6,9,19,22-pentone with the chemical formula Istodax Marketed and approved for the treatment of cutaneous T-cell lymphoma (CTCL).
  • CTCL cutaneous T-cell lymphoma
  • Bellinostat is currently in clinical trial as a hydroxamic acid-based HDAC inhibitor with the formula (2E) -N-Hydroxy-3- [3- (phenylsulfamoyl) phenyl] prop-2-enamide.
  • Capintinostat is a benzamide-based HDAC inhibitor with the formula N- (2-Aminophenyl) -4-[[(4-pyridin-3-ylpyrimidin-2-yl) amino] methyl] benzamide In the process.
  • Gibinostat is currently in clinical trials as a hydroxamic acid-based HDAC inhibitor with the formula 6-[(diethylamino) methyl] naphthalen-2-ylmethyl [4- (hydroxycarbamoyl) phenyl] carbamate.
  • Psinostat is a hydroxamic acid having the formula (E) -3- (2-Butyl-1- (2- (diethylamino) ethyl) -1H-benzo [d] imidazol-5-yl) -N-hydroxyacrylamide ( hydroxamic acid) HDAC inhibitors are currently in clinical trials.
  • Chidamide has a chemical formula of N- (2-Amino-5-fluorophenyl) -4-[[[1-oxo-3- (3-pyridinyl) -2-propen-l-yl] amino] methyl] -benzamide
  • Benzamide-based HDAC inhibitors are currently in clinical trials.
  • the quininostat is hydroxamic acid having the chemical formula of N-Hydroxy-2- [4-([(1-methyl-1H-indol-3-yl) methyl] aminomethyl) -1-piperidinyl] -5-pyrimidinecarboxamide acid-based HDAC inhibitors are currently in clinical trials.
  • Avesinostat is a hydroxamic acid-based HDAC inhibitor with the formula 3-[(Dimethylamino) methyl] -N-2- [4- (hydroxycarbamoyl) phenoxy] ethyl-1-benzofuran-2-carboxamide. In clinical trials.
  • the IGF2 inhibitor is not limited as long as it is a substance that inhibits the activity or expression of the IGF2 protein, but is preferably an antibody or peptide that binds to the IGF2 protein and inhibits the activity as an activity inhibitor, and binds to the IGF2 mRNA as an expression inhibitor. It is preferred that it is siRNA, shRNA, miRNA or aptamer that inhibits.
  • Administration of the IGF2 inhibitor and the HDAC inhibitor in the present invention may occur simultaneously or sequentially by the same or different routes of administration.
  • cancer means primary cancer, recurrence cancer, resistant cancer, or metastatic cancer, and the like
  • primary cancer refers to a conventional cancer
  • recurrence cancer refers to a cancer regenerated after conventional cancer treatment
  • Resistant cancer refers to a cancer that is resistant to the cancer treatment
  • metastatic cancer refers to a cancer in which a primary cancer or a relapse cancer that has developed at a specific site has spread to another site.
  • carcinomas that can be prevented, ameliorated or treated by the combination preparation according to the present invention include, but are not limited to, lung cancer, lymphoma, and the like, preferably non-small cell lung cancer (NSCLC) or cutaneous T-cell lymphoma (CTCL). .
  • NSCLC non-small cell lung cancer
  • CTCL cutaneous T-cell lymphoma
  • chemoresistant cancer refers to a type of cancer in which a cancer that has responded to treatment suddenly starts to grow because cancer cells do not immediately respond to the effects of chemotherapy.
  • the co-formulations of the present invention may further comprise ingredients such as existing therapeutically active ingredients, other adjuvants, pharmaceutically acceptable carriers, and the like.
  • pharmaceutically acceptable carriers include saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and the like.
  • “individual” means a subject in need of treatment of a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses and cattle, etc. Mean mammal.
  • the "pharmaceutically effective amount” means the type and severity of the disease to be administered, the age and sex of the patient, the sensitivity to the drug, the time of administration, the route of administration and the rate of administration, the duration of treatment, the factors including the concurrent drug and other It is determined according to factors well known in the medical field and can be easily determined by those skilled in the art in such an amount that the maximum effect can be obtained without any side effects in consideration of all the above factors.
  • the co-formulation of the present invention is not limited in the "administration method" as long as it can reach the target tissue.
  • Examples include oral administration, arterial injection, intravenous injection, transdermal injection, intranasal administration, coronary administration or intramuscular administration.
  • the daily dosage is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, preferably administered once to several times a day.
  • Human NSCLC lines H226B, H226Br, H292, H322, H358, A427, H460, H596, H1299, H1944, H1993, H2126, A549, A549M cell lines are purchased from the American Type Culture Collection (ATCC) or MD Anderson Cancer Center (USA) Provided by A427 cell line was cultured in DMEM / F12 medium containing 10% FBS and antibiotics, and other cell lines were cultured in 37%, 5% CO 2 conditions in RPMI 1640 medium containing 10% FBS and antibiotics.
  • Borinostat was purchased from Merck or Cayman, and other compounds were purchased from Sigma unless otherwise noted.
  • Cells were seeded and attached to 96 well plates at a number of 2-2.5 ⁇ 10 3 cells per well, and then treated with control (0.1% DMSO) or vorinostat for each paddy and incubated for 3 days. Cell proliferation was measured by a known MTT assay, wherein the drug concentration that inhibits cell growth by 50% was determined from the dose-response curve.
  • H1944 cells were treated with 0.2 uM vorinostat for 48 hours in RPMI 1640 medium containing 10% FBS, and then cultured in drug-free medium until the viable cells were 80% saturated. This procedure was repeated for two months with the concentration of vorinostat increased to 0.5-5 uM and the established resistant cell line H1944R was maintained in 5 uM vorinostat containing medium.
  • H358, H322 cells were treated with vorinostat while increasing the concentration to 2uM for more than 6 months. Drug resistance was assessed by MTT assay, and for in vitro studies, resistant cells were cultured in drug-free medium for at least 1 week to eliminate the effects of vorinostat.
  • Western blotting was performed by methods known in the art.
  • Anti-pIGF-1R (Y1131, Y1135 / 6), IGF-1R, CTCF, Akt, pAkt (S473), pERK1 / 2, ERK, DNMT1, pSTAT3 (Y705), acetyl-STAT3, STAT3, PARP, cleaved caspase
  • the -3 antibody was purchased from Cell Signaling Technology (USA), and anti-IGF-1R, ERK, actin, IGF1, IGF2, STAT3, ubiquitin, DNMT3A, DNMT3B antibodies and secondary antibodies were purchased from Santa Cruz Biotechnology (USA).
  • anti-cleaved PARP antibodies were purchased from BD Biosciences and anti-IGF2 antibodies were purchased from EMD Millipore (USA).
  • cells were transfected with empty vector (EV; pcDNA3) or pcDNA3-Myc-DNMT1 (Addgene Inc) using Lipofectamine 2000 (Invitrogen).
  • WT or mutant STAT3 containing expression vectors were prepared by subcloning of the rAAV-3xFlag WT or mutant STAT3 knock-in targeting vector (City of Hope Comprehensive Cancer Center).
  • Promoter (P1-P4) specific transcripts of the IGF2 gene were analyzed by known methods, and the sequences of the primer pairs are shown in Table 2 below. At this time, the PCR product was separated by 2% agarose gel electrophoresis and observed by Gel Doc EZ System (Bio-Rad Laboratories). Relative amount of mRNA was performed by comparative CT (cycle threshold) method.
  • Kinase protein activity was analyzed using Proteome Profiler Human Phospho-Kinase Array or Phospho-RTK Array Kits (R & D Systems), and activity levels were quantified by densitometric analysis using Image J software.
  • IGF2 ELISA was performed using an IGF2 ELISA kit (catalog # DSL-10-2600, Beckman Coulter).
  • reporter gene assays were performed using the Luciferase Assay System (Promega). Specifically, the luciferase vector or pGL3-basic containing the IGF2 P3, P4 promoter sequence and pSV- ⁇ -Gal were cotransfected into the cells. Cells were then lysed after treatment with vorinostat, and luciferase activity was monitored with an amicroplate luminometer (Berthold Technologies). ⁇ -galactosidase activity was measured using the ⁇ -galactosidase enzyme assay system (Promega) and used as a control to normalize transfection efficiency.
  • ChIP assay was performed using SimpleChIP enzymatic chromatin IP kit (Cell Signaling Technology) to confirm that STAT3 and CTCF bind to STAT3 binding sites in IGF2 promoter and H19 / ICF2 ICR, respectively.
  • the chromatin crosslinked to the protein was digested with micrococcal nuclease, and the digested chromatin was immunoprecipitated with control IgG, anti-STAT3 (Santa Cruz), and anti-CTCF (Cell Signaling) antibodies.
  • control IgG, anti-STAT3 Santa Cruz
  • anti-CTCF Cell Signaling
  • PCR products were separated by 2% agarose gel electrophoresis and observed by Gel Doc EZ System (Bio-Rad Laboratories).
  • DNA extracted from the cells was treated with sodium bisulfite, and methylation in the H19 / IGF2 ICR region was analyzed by nested PCR using DNA methylation specific primers shown in Table 4 below.
  • the bisulfite treated DNA was cloned and sequenced using primer pairs (5'-TGTTGAAGGTTGGGGAGATGGGA-3 '; 5'-CCCAAACCATAACACTAAAACCCTC-3').
  • TMB 3,3 ', 5,5-tetramethylbenzidine
  • H1299 cells expressing wild-type or mutant STAT3 were treated with cycloheximide (CHX; 50 ug / ml) for 3, 6, and 9 hours and then totaled by Western blotting. The levels of STAT3 and acetylated STAT3 were confirmed.
  • CHX cycloheximide
  • H1299, H226B, H1944, H1944R cells (4-10 ⁇ 10 6 cells / spot) were injected subcutaneously into the flanks of 5-6 week old nude mice or NOD / SCID mice.
  • H1299, H226B, H1944, H1944R cells (4-10 ⁇ 10 6 cells / spot) were injected subcutaneously into the flanks of 5-6 week old nude mice or NOD / SCID mice.
  • tumor tissue from NSCLC patients was injected subcutaneously into the flanks of 5-6 week old NOD / SCID mice, and then 3-6 times a week for 15-28 days when the tumor volume reached 50-150 mm 3 . Controls or drugs were treated alone or in combination.
  • Tumor growth was determined by measuring the short / long diameter of the tumor with a caliper, and body weight was measured twice a week to assess toxicity.
  • Tumor volume (mm 3 ) was determined by the formula (short diameter) 2 ⁇ (long diameter) ⁇ 0.5.
  • Immunofluorescence and immunohistochemical staining were performed by conventionally known methods using antibodies to IGF2, DNMT1, pSTAT3, Ac-STAT3, pIGF-1R.
  • FFPE paraffin-embedded
  • Primer sequences for confirming methylation at the H19 / IGF2 ICR position include forward 5′-ACGCTTCCCCTTCTGTCTC-3 ′; Reverse 5'-GGAATGTTAATGTCTGGCCACT-3 '. The percent methylation in each sample was determined by the formula [1/2 (Ct (Digest) -Ct (Non-digest)) ].
  • H1944R is a vorinostat resistant cell line
  • romidepsin histone deacetylase inhibitors
  • Example 3 In the verinostat In acquired resistant cells Borinostat By treatment IGF Activation of -1R signaling
  • ELISA was performed to investigate whether IGF2 protein secretion was increased by vorinostat treatment in vorinostat resistant cell culture, and as a result, primary resistant cells (H226B) and acquired resistant cells ( H1944R) showed an increase in IGF2 secretion.
  • MTT assay was performed after silencing by siRNA to investigate whether the reactivity to vorinostat was increased when the expression of IGF2 was inhibited in the vorinostat primary and acquired resistant cells (H1944R, H226Br, H226B, H1299). As a result, as shown in FIG. 9, it was confirmed that cancer cell survival rate was significantly decreased by increased reactivity.
  • promoters activated in four promoters (P1 to P4) of IGF2 by vorinostat treatment in vorinostat primary and acquired resistant cells H1944R, H460, H226B, H1299, H226Br
  • RT-PCR was performed on the transcripts, and as a result, it was confirmed that promoters P3 and P4 are involved in IGF2 transcription.
  • DNA ELISA assay was performed to investigate whether STAT3 binds to the STAT3 binding site present in the IGF2 P3 and P4 promoters by vorinostat treatment in vorinostat primary and acquired resistant cells (H1299, H1944R). .
  • Stattic also known as a STAT3 inhibitor
  • STAT3 siRNA silencing the treatment of Stattic, also inhibited the expression of IGF2 mRNA by vorinostat as well as the STAT3 siRNA silencing, and it was confirmed that the activation of the P3 and P4 promoters was significantly inhibited (FIGS. 18 to FIG. 20).
  • the luciferase reporter assay was performed. As shown in FIG. 26, the mutation was performed. It was confirmed that the activity of the P3 and P4 promoters was decreased at (STAT3 K / R).
  • RT-PCR and Western blot in the primary and acquired resistant cells of Borinostat showed that the expression of CTCF, DNMT3A, DNMT3B was not changed, whereas mRNA and protein of DNMT1 were increased as shown in FIGS. 30 and 31. Confirmed. In addition, through the luciferase reporter assay, it was confirmed that the promoter of DNMT1 also increased the activity (Fig. 32).
  • xenograft tumor (PDX) in vivo from NSCLC patients In seven models, to further confirm the correlation between methylation of the H19 / IGF2 ICR region and DNMT1 expression, methylation was examined by real-time PCR. As shown in FIG. 42, in vivo, On There was a close relationship between them.
  • the acetylated STAT3 induced by histone deacetylase inhibitor increases the expression of IGF2 and DNMT1 (DNA methyltransferase 1), and the H19 / IGF2 imprinting regulatory site by increased DNMT1 ( As the methylation of the Imprinting Control Region (ICR) was promoted, the expression of IGF2 was further induced, and eventually the mechanism of HDI resistance was elucidated.
  • ICR Imprinting Control Region
  • Example 12 Evaluation of efficacy in paclitaxel resistant cells
  • the resistance of histone deacetylase inhibitors can be overcome through IGF2 or STAT3 blocking, it can be usefully used in combination therapy of anticancer drugs based on histone deacetylase inhibitors. .
  • the method for predicting reactivity of the HDAC inhibitor of the present invention it is possible to easily and effectively predict the anticancer drug resistance by a simple method of measuring methylation of the H19 / IGF2 imprinting regulatory region (ICR), thereby solving the problem of low treatment success rate due to the resistance.
  • the prognosis of anticancer drugs can be estimated and the future treatment policy can be determined.

Abstract

본 발명은, IGF2(Insulin-like growth factor 2) 억제제 및 HDAC(Histone deacetylase) 억제제를 유효성분으로 함유하는, HDAC 억제제 내성을 갖는 암의 예방 또는 치료용 복합제제에 관한 것이다. 또한, 본 발명은, (a) 암조직 샘플에서 H19/IGF2 ICR(imprinting control region) 부위의 메틸화 정도를 측정하는 단계, 및 (b) 정상대조군에 비하여 암조직 샘플에서 메틸화가 증가하였을 경우 HDAC 억제제에 대하여 암환자의 반응성이 낮은 것으로 판단하는 단계를 포함하는, HDAC 억제제에 대하여 암환자의 반응성을 예측하는 방법에 관한 것이다. 본 발명에 의하면, IGF2 또는 STAT3 차단을 통하여 히스톤 탈아세틸화효소 억제제의 내성을 극복할 수 있기 때문에, 히스톤 탈아세틸화 효소 억제제를 기반으로 하는 항암제의 병용 요법에 유용하게 이용될 수 있으며, H19/IGF2 각인 조절 부위(ICR)의 메틸화 측정이라는 간단한 방법으로 항암제 내성 여부를 쉽고 효과적으로 예측할 수 있다.

Description

HDAC 억제제 내성을 갖는 암 치료용 복합제제
본 발명은, IGF2(Insulin-like growth factor 2) 억제제 및 HDAC(Histone deacetylase) 억제제를 유효성분으로 함유하는, HDAC 억제제 내성을 갖는 암의 예방 또는 치료용 복합제제에 관한 것이다.
히스톤 탈아세틸화효소(HDAC, Histone deacetylase)는 히스톤 단백질 잔기의 탈아세틸화를 조절함으로써 유전자의 발현을 제어하는 역할을 한다. DNA 변이가 아닌 히스톤 또는 DNA의 수식(modification)에 의한 후생유전학적 변이가 유전자 발현 조절에 중요하다고 알려지고 있다. 일례로, 아세틸화효소 및 탈아세틸화효소에 의하여 조절되는 히스톤의 아세틸화에 의한 유전자 발현 조절이 알려지고 있는데, 히스톤 탈아세틸화효소는 히스톤의 아세틸화를 억제하여 세포증식 억제인자의 발현을 저해함으로써 세포증식을 촉진시키고 세포의 종양화 및 분화를 조절하는 것으로 알려졌다. 따라서, HDAC 활성 억제는 암을 비롯한 여러 질병 치료를 위한 표적으로 많은 주목을 받아 왔다.
히스톤 탈아세틸화효소 억제제(HDI)는 히스톤 및 비-히스톤 단백질의 아세틸화에 관여하는 전사-의존적/비의존적 메커니즘을 통하여, 후성적으로 발현이 저해된 암억제(tumor suppressor) 유전자의 발현을 선택적으로 유도함으로서 항암 효능을 나타낸다. 실제, HDI로서는 최초로 임상승인을 받은 보리노스탯(Vorinostat; SAHA(suberoylanilide hydroxamic acid))이 일부 고형암 또는 혈액암 환자들에서 긍정적인 임상결과를 보이고 있다.
그러나, HDI의 항암 효능이 획기적이지 못하고 부작용이 있으며, 약물에 대한 저항성(내성)이 문제가 되고 있기 때문에, 임상효능을 높이기 위한 복합 치료의 기초로서 HDI 저항성을 일으키는 분자기전을 밝히는 것이 필요하다. HDI 저항성과 관련된 다양한 메커니즘 중에서 대표적인 것이 DNA 과메틸화인데, 이는 저해된 암억제 유전자(tumor suppressor)의 전사활성을 회복시키는 HDI의 기능을 방해함으로써 저항성을 일으킨다. 따라서, 이러한 문제를 해결하고자, DNMT(DNA methyltransferase)와 HDAC을 각각 타겟팅하는 2가지 약물을 조합하여 혈액암 치료에 효과적으로 이용한 예가 있으나, 아직 DNA 과메틸화가 어떻게 HDI 저항성을 매개하는지 구체적인 메커니즘은 거의 밝혀진 바가 없다.
한편, IGF-1R(insulin-like growth factor 1 receptor) 시그널링은 세포 증식/생존에 있어서 중요한 역할을 하며, 화학항암제 및 표적 항암제의 저항성을 매개하는 것으로 알려졌다. 비소세포폐암(NSCLC)을 포함하는 다양한 암 종에서, IGF, IGF-1R, IGFBP(IGF-binding protein)의 발현 변화로 인하여 IGF-1R 신호전달의 이상 조절이 보고된 바 있다.
또한, 징크핑거 단백질인 CTCF(CCCTC-binding factor)는 H19/IGF2의 ICR(imprinting control region)에 결합하여 H19의 다운스트림에 있는 인핸서를 격리시킴으로써 업스트림에 있는 IGF2의 전사를 억제하는 insulator로 작용하는데, 상기 ICR 영역에 메틸화가 될 경우 이러한 CTCF의 결합이 저해됨으로써 LOI(loss of imprinting)이 발생하고, 그 결과 업스트림에 있는 IGF2가 과발현된다.
이에, 본 발명자들은 히스톤 탈아세틸화효소 억제제(항암제)의 내성을 유발하는 인자 및 메커니즘을 규명하기 위하여 연구를 거듭한 결과, IGF2의 과발현이 HDI에 대한 (선천/후천성) 저항성을 매개하는 핵심 기전이라는 점을 발견함으로써 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은, IGF2 억제제 및 HDAC 억제제를 유효성분으로 함유하는, HDAC 억제제 내성을 갖는 암의 예방 또는 치료용 복합제제를 제공하는 데 있다.
또한, 본 발명의 목적은, 암조직 샘플에서 H19/IGF2 ICR(imprinting control region) 부위의 메틸화 정도를 측정한 후, 정상대조군에 비하여 메틸화가 증가하였을 경우 HDAC 억제제에 대하여 암환자의 반응성이 낮은 것으로 판단하는 단계를 포함하는, HDAC 억제제에 대하여 암환자의 반응성을 예측하는 방법을 제공한다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 과제를 해결하기 위하여, 본 발명은 IGF2 억제제 및 HDAC 억제제를 유효성분으로 함유하는, HDAC 억제제 내성을 갖는 암의 예방 또는 치료용 복합제제를 제공한다.
또한, 본 발명은 IGF2 억제제 및 HDAC 억제제를 개체에 투여하는 단계를 포함하는, HDAC 억제제 내성을 갖는 암의 예방 또는 치료방법을 제공한다.
또한, 본 발명은 IGF2 억제제 및 HDAC 억제제를 함유하는 복합제제의 HDAC 억제제 내성을 갖는 암의 예방 또는 치료용도를 제공한다.
본 발명의 일 구체예로, 상기 HDAC 억제제는 보리노스탯(vorinostat), 엔티노스탯(entinostat), 파노비노스탯(panobinostat), 로미뎁신(romidepsin), 벨리노스탯(belinostat), 모세티노스탯(mocetinostat), 기비노스탯(givinostat), 프래시노스탯(pracinostat), 치다마이드(chidamide), 퀴시노스탯(quisinostat) 또는 아베시노스탯(abexinostat)인 것을 특징으로 한다.
본 발명의 다른 구체예로, 상기 IGF2 억제제는 IGF2 단백질에 결합하여 활성을 억제하는 항체 또는 펩티드인 것을 특징으로 한다.
본 발명의 또 다른 구체예로, 상기 IGF2 억제제는 IGF2의 mRNA에 결합하여 발현을 억제하는 siRNA, shRNA, miRNA 또는 압타머인 것을 특징으로 한다.
본 발명의 또 다른 구체예로, 상기 암은 폐암 또는 림프종인 것을 특징으로 한다.
본 발명의 또 다른 구체예로, 상기 HDAC 억제제는 STAT3(signal transducer and activator of transcription 3)의 아세틸화를 유도함으로써 IGF2 및 DNMT1(DNA methyltransferase 1)의 발현을 증가시키는 것을 특징으로 한다.
본 발명의 또 다른 구체예로, 상기 아세틸화된 STAT3는 IGF2의 프로모터 P3 및 P4에 결합하여 IGF2의 발현을 증가시키는 것을 특징으로 한다.
본 발명의 또 다른 구체예로, 상기 DNMT1는 H19/IGF2 각인조절부위(ICR)의 메틸화를 유도함으로써 IGF2의 발현을 더욱 증가시키는 것을 특징으로 한다.
또한, 본 발명은 (a) 암조직 샘플에서 H19/IGF2 ICR(imprinting control region) 부위의 메틸화 정도를 측정하는 단계, 및 (b) 정상대조군에 비하여 암조직 샘플에서 메틸화가 증가하였을 경우 HDAC 억제제에 대하여 암환자의 반응성이 낮은 것으로 판단하는 단계를 포함하는, HDAC 억제제에 대하여 암환자의 반응성을 예측하는 방법을 제공한다.
본 발명의 일 구체예로, 상기 메틸화 정도는 메틸화-특이 PCR에 의해 측정하는 것을 특징으로 한다.
본 발명의 일 구체예로, 상기 방법에 있어서 HDAC 억제제는 보리노스탯(vorinostat), 엔티노스탯(entinostat), 파노비노스탯(panobinostat), 로미뎁신(romidepsin), 벨리노스탯(belinostat), 모세티노스탯(mocetinostat), 기비노스탯(givinostat), 프래시노스탯(pracinostat), 치다마이드(chidamide), 퀴시노스탯(quisinostat) 또는 아베시노스탯(abexinostat)인 것을 특징으로 한다.
본 발명의 다른 구체예로, 상기 방법에 있어서 암은 폐암 또는 림프종인 것을 특징으로 한다.
또한, 본 발명은 H19/IGF2 ICR(imprinting control region) 부위에 특이적인 프라이머쌍을 포함하는, HDAC 억제제에 대한 암환자의 반응성 예측용 키트를 제공한다.
본 발명의 일 구체예로, 상기 프라이머쌍은 메틸화-특이 PCR에 의해 메틸화 정도를 측정하기 위한 것임을 특징으로 한다.
본 발명의 복합제제에 의하면, IGF2 또는 STAT3 차단을 통하여 히스톤 탈아세틸화효소 억제제의 내성을 극복할 수 있기 때문에, 히스톤 탈아세틸화 효소 억제제를 기반으로 하는 항암제의 병용 요법에 유용하게 이용될 수 있다.
본 발명의 HDAC 억제제에 대한 반응성 예측방법에 의하면, H19/IGF2 각인 조절 부위(ICR)의 메틸화 측정이라는 간단한 방법으로 항암제 내성 여부를 쉽고 효과적으로 예측할 수 있기 때문에, 내성으로 인한 낮은 치료 성공율 문제를 해결할 수 있고, 항암제 예후를 추정하고 향후의 치료방침을 정할 수 있다.
도 1은 폐암 세포에서 부착 비의존성 콜로니 형성 어세이(anchorage independent colony formation assay)를 이용하여 보리노스탯의 반응성을 평가한 결과이다.
도 2는 보리노스탯 획득 내성세포인 H1944R이 다른 HDAC 억제제인 로미뎁신(romidepsin)에 대해서도 저항성을 나타냄을 보여주는 MTT 어세이 결과이다.
도 3은 보리노스탯 획득 내성세포에서 IGF2 발현 증가 및 IGF-1R 신호전달 활성화를 나타낸 웨스턴 블랏 및 RT-PCR 결과이다.
도 4는 보리노스탯 획득 내성세포에서 보리노스탯 처리에 의하여 IGF-1R 신호전달의 활성화가 유도됨을 나타낸 웨스턴 블랏 결과이다.
도 5는 보리노스탯 획득 내성세포에서 보리노스탯 처리에 의하여 IGF2 mRNA 발현이 증가됨을 나타낸 real-time PCR 결과이다.
도 6은 보리노스탯 1차 내성세포에서 보리노스탯 처리에 의하여 IGF2 mRNA 발현이 증가됨을 나타낸 real-time PCR 결과이다.
도 7은 보리노스탯 내성세포 배양액에서 보리노스탯 처리에 의하여 IGF2 생성 및 분비가 증가됨을 나타낸 ELISA 결과이다.
도 8은 보리노스탯 내성세포에서 IGF2의 발현을 저해하였을 때 보리노스탯에 의한 IGF-1R 신호전달 활성화가 억제됨을 나타낸 웨스턴 블랏 결과이다.
도 9는 보리노스탯 내성세포에서 IGF2의 발현을 저해하였을 때 보리노스탯의 암세포 생존 억제 작용이 유의적으로 개선됨을 나타낸, MTT 어세이 결과이다.
도 10은 보리노스탯 내성세포에서 보리노스탯 처리에 의하여 IGF2의 P3 및 P4 프로모터가 활성화됨을 나타낸 RT-PCR 결과이다.
도 11은 보리노스탯 내성세포에서 보리노스탯 처리에 의하여 IGF2의 P3 및 P4 프로모터가 활성화됨을 나타낸 루시퍼라제 리포터 어세이(luciferase reporter assay) 결과이다.
도 12는 보리노스탯 내성세포에서 다른 HDAC 억제제 처리에 의하여 IGF2 발현 증가 및 IGF2의 P3 및 P4 프로모터가 활성화됨을 나타낸 RT-PCR 결과이다.
도 13은 보리노스탯 내성세포에서 보리노스탯 처리에 의하여 P3 및 P4 프로모터에 존재하는 잠재적 STAT3 결합 부위에서 STAT3 결합이 증가됨을 나타낸 DNA ELISA 결과이다.
도 14는 STAT3의 DNA 결합이 서열 특이적임을 나타낸 DNA ELISA 결과이다.
도 15은 보리노스탯 내성세포에서 보리노스탯 처리에 의하여 P3 및 P4 프로모터에 존재하는 잠재적 STAT3 결합 부위에서 STAT3 결합이 증가됨을 나타낸 ChIP(chromatin immunoprecipitation) 결과이다.
도 16은 보리노스탯에 의한 P3 및 P4 프로모터 활성화를 통한 IGF2 발현 증가 작용에서 STAT3가 필수적임을 나타낸 루시퍼라제 리포터 어세이 결과이다.
도 17은 siRNA를 이용하여 STAT3의 발현을 저하시켰을 때 보리노스탯에 의한 IGF2 mRNA 발현 유도가 억제됨을 나타낸 real-time PCR 결과이다.
도 18은 STAT3 억제제인 Stattic을 처리하여 STAT3를 억제하였을 때 보리노스탯에 의한 IGF2 mRNA 발현 유도가 억제됨을 나타낸 real-time PCR 결과이다.
도 19는 STAT3 억제제인 Stattic을 처리하여 STAT3를 억제하였을 때 보리노스탯에 의한 P3 및 P4 프로모터의 활성화가 유의적으로 억제됨을 나타낸 루시퍼라제 리포터 어세이 결과이다.
도 20은 STAT3 억제제인 Stattic을 처리하여 STAT3를 억제하였을 때 보리노스탯에 의한 P3 및 P4 프로모터의 활성화가 유의적으로 억제됨을 나타낸 RT-PCR 결과이다.
도 21은 보리노스탯 내성세포에서 보리노스탯 처리에 의하여 STAT3의 아세틸화가 증가됨을 나타낸 웨스턴 블랏 결과이다.
도 22는 보리노스탯을 투여받은 피부 T-세포 림프종(CTCL) 환자 조직에서 IGF2 및 아세틸화된 STAT3의 발현이 유의적으로 증가됨을 나타낸 면역조직화학(IHC) 결과이다.
도 23은 STAT3의 아세틸화를 억제하였을 때 보리노스탯에 의한 IGF2 발현 유도가 억제됨을 나타낸 면역형광염색 결과이다.
도 24는 STAT3의 아세틸화를 억제하였을 때 보리노스탯에 의한 IGF2 발현이 억제되어 아폽토시스가 촉진됨을 나타낸 RT-PCR 및 웨스턴블랏 결과이다.
도 25는 STAT3의 아세틸화를 억제하였을 때 보리노스탯에 의한 IGF2의 생성 및 분비가 억제됨을 나타낸 웨스턴블랏 결과이다.
도 26은 STAT3의 아세틸화를 억제하였을 때 보리노스탯에 의한 IGF2 P3 및 P4 프로모터의 활성화가 감소됨을 나타낸 루시퍼라제 리포터 어세이 결과이다.
도 27은 STAT3의 아세틸화를 억제하였을 때 보리노스탯의 콜로니 생성 억제 작용이 강화됨을 나타낸 부착 의존성 콜로니 형성 어세이 결과이다.
도 28은 shRNA 처리에 의해 STAT3를 억제하였을 때 보리노스탯의 항암 효과가 강화됨을 나타낸 xenograft 결과이다.
도 29는 Stattic 처리에 의하여 STAT3를 억제하였을 때 보리노스탯의 항암 효과가 강화됨을 나타낸 xenograft 결과이다.
도 30은 보리노스탯 획득 내성세포에서 DNMT1 발현이 증가됨을 나타낸 RT-PCR 및 웨스턴블랏 결과이다.
도 31은 보리노스탯 1차 내성세포에서 DNMT1 발현이 증가됨을 나타낸 웨스턴블랏 결과이다.
도 32는 보리노스탯 내성세포에서 DNMT1 프로모터의 활성이 증가되어 있음을 나타낸 루시퍼라제 리포터 어세이 결과이다.
도 33은 보리노스탯 내성세포에서 보리노스탯 처리에 의하여 DNMT1 mRNA의 발현이 증가됨을 나타낸 real-time PCR 결과이다.
도 34는 보리노스탯 내성세포에서 보리노스탯 처리에 의한 DNMT1 mRNA의 발현 증가가 STAT3 발현을 억제함으로서 감소됨을 나타낸 real-time PCR 결과이다.
도 35는 보리노스탯 내성세포에서 보리노스탯 처리에 의한 DNMT1 mRNA의 발현 증가가 STAT3의 아세틸화를 억제함으로서 감소됨을 나타낸 real-time PCR 결과이다.
도 36은 보리노스탯 내성세포에서 H19/IGF2 각인 조절부위(ICR)의 메틸화가 증가되어 있음을 나타낸 메틸화-특이 PCR 결과이다.
도 37은 보리노스탯 내성세포에서 H19/IGF2 각인 조절부위(ICR)에서의 CTCF 결합이 소실됨을 나타낸 ChIP 어세이 결과이다.
도 38은 DNMT1 발현 저해시 H19/IGF2 각인 조절부위(ICR)의 메틸화가 감소됨을 나타낸 메틸화-특이 PCR 결과이다.
도 39는 DNMT1 발현 저해시 보리노스탯에 의한 IGF-1R 활성화 및 IGF2 발현 유도가 억제됨을 나타낸 RT-PCR 및 웨스턴블랏 결과이다.
도 40은 DNMT1 발현 저해시 보리노스탯의 암세포 생존 억제 활성이 회복됨을 나타낸 MTT 어세이 결과이다.
도 41은 DNMT1 억제제(decitabine) 처리에 의하여 HDAC 억제제의 암세포 사멸 유도 활성이 강화됨을 나타낸 웨스턴블랏 결과이다.
도 42는 PDX 모델에 사용된 사람 폐암 조직에서 H19/IGF2 각인 조절부위(ICR)의 메틸화 정도를 평가한 real-time PCR 결과이다.
도 43은 H19/IGF2 각인 조절부위(ICR)의 메틸화 정도에 따라 보리노스탯의 반응성의 차이를 확인하고, DNMT1 억제제의 병용 처리에 의하여 보리노스탯의 항암 활성이 증강되는 것을 확인한 xenograft 결과이다.
도 44는 피부 T-세포 림프종(CTCL) 환자 조직에서 H19/IGF2 각인 조절부위(ICR)의 메틸화 정도 및 약물 반응성과의 관련성을 평가한 real-time PCR 결과이다.
도 45는 본 발명에서 밝힌 HDAC 억제제의 내성 기전을 나타낸 모식도이다.
도 46은 본 발명의 복합 항암 요법의 유효성을 paclitaxel 저항성 세포에서 평가한 MTT 결과이다.
본 발명자는 항암제로 사용되고 있는 HDAC 억제제의 내성 기전에 관하여 예의 연구한 결과, HDAC 억제제(HDI)에 의하여 유도되는 아세틸화된 STAT3가 IGF2 및 DNMT1(DNA methyltransferase 1)의 발현을 증가시키고, 증가된 DNMT1에 의하여 H19/IGF2 각인 조절 부위(ICR; Imprinting Control Region)의 메틸화가 촉진되면서 더욱 IGF2의 발현이 유도되어, 결국에는 히스톤 탈아세틸화효소 억제제의 내성이 발생된다는 것을 규명하였다. 따라서, 본 기전에 관여하는 인자들이 히스톤 탈아세틸화효소 억제제를 기반으로 하는 항암요법의 내성극복을 위한 신규 표적이 될 수 있음을 제시하였다.
또한, 본 발명에서는 폐암과 피부 T-세포 림프종 환자 조직에서 H19/IGF2 ICR의 메틸화 정도에 따라 히스톤 탈아세틸화효소의 반응성이 조절됨을 밝힘으로써, H19/IGF2 ICR의 메틸화가 히스톤 탈아세틸화효소 억제제의 반응성을 예측할 수 있는 예측마커(predictive marker)가 될 수 있음을 제시하였다.
구체적으로, 본 발명에서는 대표적인 히스톤 탈아세틸화효소 억제제인 보리노스탯(vorinostat) 약물을 대상으로 실험한 결과, 보리노스탯 내성 세포에서 기저 및 약물 처리에 의하여 인슐린유사성장인자 수용체(IGF-1R) 신호전달이 활성화됨을 확인하였다. 즉, 보리노스탯 저항성 세포에서 인슐린유사성장인자 2(IGF2; Insulin-like Growth Factor 2)의 생성이 약물 처리에 의하여 유도되며, 이러한 작용이 인슐린유사성장인자 수용체 신호전달의 활성화에 따른 보리노스탯 내성 획득과 관련됨을 확인하였다.
또한, 본 발명에서는 보리노스탯 처리에 의한 IGF2 단백질 증가가, IGF2의 P3 및 P4 프로모터에 STAT3가 결합하여 IGF2의 전사가 증가하였기 때문이며, 이러한 작용이 보리노스탯 이외의 다른 히스톤 탈아세틸화효소 억제제에서도 공통적으로 나타날 수 있음을 제시한다.
또한, 본 발명에서는 보리노스탯 처리에 의해 STAT3의 아세틸화가 증가되며, 아세틸화된 STAT3가 보리노스탯이 매개하는 IGF2 발현 증가와 직접적인 관련성이 있고, 나아가 아세틸화된 STAT3가 DNMT1의 발현을 매개함을 확인하였다.
또한, 본 발명에서는 상기 발현증가된 DNMT1이 H19/IGF2 ICR 부위의 메틸화를 일으켜 CTCF의 ICR 결합을 차단함으로써, CTCF의 insulator 기능을 무력화시켜 업스트림의 IGF2의 발현을 유도함을 확인하였다.
결론적으로, 본 발명에서는 IGF2의 과발현이 HDI에 대한 (선천/후천성) 저항성을 매개하는 일반적인 메커니즘이라는 것을 발견하였다. 즉, HDAC 억제가 STAT3 단백질의 아세틸화(Lys685)에 의한 안정화를 유도하고, 이것이 P3 및 P4 프로모터를 통하여 IGF2의 전사를 촉진할 뿐만 아니라, 만성적으로 HDAC이 억제되면 DNMT1(DNA methyltransferase 1)의 과발현이 H19/ IGF2 ICR의 메틸화를 유도하여 CTCF의 insulator 활성을 저해하기 때문에, STAT3-유도성 IGF2 전사가 더욱 증가되는 것이다.
실제, 본 발명에서는 HDI에 대한 내성을 갖는 NSCLC(비소세포폐암) 세포주 및 환자 유래 이종이식암(PDX; patient-derived xenograft tumor)에서 STAT3 또는 DNMT1를 차단하면 HDI에 대한 반응성이 회복됨을 확인하였다. 따라서, DNMT1 발현과 H19/ IGF2 ICR 메틸화 정도를 확인하면 HDI에 대한 반응성을 예측할 수 있을 뿐만 아니라, HDI 저항성을 극복하는데 있어서 IGF2, STAT3, DNMT1가 새로운 치료표적으로 이용될 수 있음을 알 수 있다.
따라서, 본 발명은 보리노스탯 저항성 세포에서 STAT3, DNMT1, 또는 IGF2 차단에 의하여 보리노스탯을 포함하는 HDAC 억제제의 암세포 사멸 유도 및 항암 활성이 강화됨을 제시함으로써, 보리노스탯을 포함하는 HDAC 억제제의 내성을 극복할 수 있는 항암제 복합제제 및 병용 요법을 제공한다.
또한, 본 발명은 폐암 및 피부 T-세포 림프종 환자 조직에서의 H19/IGF2 각인 조절 부위의 메틸화 정도에 따라 보리노스탯의 반응성이 달라짐을 증명함으로서, 폐암 및 피부 T-세포 림프종에서 히스톤 탈아세틸화효소 억제제의 반응성을 예측할 수 있는 새로운 방법을 제공한다.
본 발명에서 HDAC 억제제는 제한이 없으나 보리노스탯(vorinostat), 엔티노스탯(entinostat), 파노비노스탯(panobinostat), 로미뎁신(romidepsin), 벨리노스탯(belinostat), 모세티노스탯(mocetinostat), 기비노스탯(givinostat), 프래시노스탯(pracinostat), 치다마이드(chidamide), 퀴시노스탯(quisinostat) 또는 아베시노스탯(abexinostat) 등을 포함하며, 바람직하게는 보리노스탯이다.
이때, 보리노스탯은 N-Hydroxy-N'-phenyloctanediamide의 화학식과, suberanilohydroxamic acid(SAHA)의 화합물명을 가지며, 상품명 Zolinza　으로 판매되고, 피부 T-세포 림프종(CTCL) 치료용으로 승인되었다.
엔티노스탯은 MS-275라고도 하고, Pyridin-3-ylmethyl N-[[4-[(2-aminophenyl)carbamoyl]phenyl]methyl]carbamate의 화학식을 가지며, 다양한 암종치료에 대하여 임상시험중에 있다.
파노비노스탯은 (2E)-N-hydroxy-3-[4-([2-(2-methyl-1H-indol-3-yl)ethyl]aminomethyl)phenyl]acrylamide의 화학식을 가지며, 상품명 Farydak　으로 판매되고, 다발성 골수종(multiple myeloma) 치료용으로 승인되었다.
로미뎁신은 (1S,4S,7Z,10S,16E,21R)-7-ethylidene-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23-tetrazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone의 화학식을 가지며, 상품명 Istodax　으로 판매되고, 피부 T-세포 림프종(CTCL) 치료용으로 승인되었다.
벨리노스탯은 (2E)-N-Hydroxy-3-[3-(phenylsulfamoyl)phenyl]prop-2-enamide의 화학식을 가지는 히드록사믹산(hydroxamic acid)계 HDAC 억제제로 현재 임상 시험 중이다.
모세티노스탯은 N-(2-Aminophenyl)-4-[[(4-pyridin-3-ylpyrimidin-2-yl)amino]methyl] benzamide의 화학식을 가지는 벤즈아미드(benzamide)계 HDAC 억제제로 현재 임상 시험 중이다.
기비노스탯은 6-[(diethylamino)methyl]naphthalen-2-ylmethyl [4-(hydroxycarbamoyl)phenyl]carbamate의 화학식을 가지는 히드록사믹산(hydroxamic acid)계 HDAC 억제제로 현재 임상 시험 중이다.
프래시노스탯은 (E)-3-(2-Butyl-1-(2-(diethylamino)ethyl)-1H-benzo[d]imidazol-5-yl)-N-hydroxyacrylamide의 화학식을 가지는 히드록사믹산(hydroxamic acid)계 HDAC 억제제로 현재 임상 시험 중이다.
치다마이드는 N-(2-Amino-5-fluorophenyl)-4-[[[1-oxo-3-(3-pyridinyl)-2-propen-1-yl]amino]methyl]-benzamide의 화학식을 가지는 벤즈아미드(benzamide)계 HDAC 억제제로 현재 임상 시험 중이다.
퀴시노스탯은 N-Hydroxy-2-[4-([(1-methyl-1H-indol-3-yl)methyl]aminomethyl)-1-piperidinyl]-5-pyrimidinecarboxamide의 화학식을 가지는 히드록사믹산(hydroxamic acid)계 HDAC 억제제로 현재 임상 시험 중이다.
아베시노스탯은 3-[(Dimethylamino)methyl]-N-2-[4-(hydroxycarbamoyl)phenoxy]ethyl-1-benzofuran-2-carboxamide의 화학식을 가지는 히드록사믹산(hydroxamic acid)계 HDAC 억제제로 현재 임상 시험 중이다.
본 발명에서 IGF2 억제제는 IGF2 단백질의 활성 또는 발현을 억제하는 물질이면 제한이 없으나, 활성 억제제로서 IGF2 단백질에 결합하여 활성을 억제하는 항체 또는 펩티드인 것이 바람직하고, 발현 억제제로서 IGF2 mRNA에 결합하여 발현을 억제하는 siRNA, shRNA, miRNA 또는 압타머인 것이 바람직하다.
본 발명에서 IGF2 억제제와 HDAC 억제제의 투여는 동일하거나 상이한 투여 경로에 의해 동시에 또는 순차적으로 발생할 수 있다.
본 발명에서 "암"이란, 원발암, 재발암, 내성암 또는 전이암 등을 의미하며, "원발암"은 통상의 암을, "재발암"은 통상의 암 치료 후 재발생된 암을, "내성암"은 상기 암 치료에 내성을 갖는 암을, "전이암"은 특정 부위에서 발생한 원발암 또는 재발암이 다른 부위로 전이된 암을 일컫는 말이다.
또한, 본 발명에 따른 복합제제에 의해 예방, 개선 또는 치료될 수 있는 암종에는 제한이 없으나 폐암, 림프종 등을 포함하며, 바람직하게는 비소세포폐암(NSCLC) 또는 피부 T-세포 림프종(CTCL)이다.
본 발명에서 "화학요법 내성암(chemoresistant cancer)"이란, 암세포가 화학요법의 효과에 즉각 반응하지 않기 때문에 치료에 반응해 오던 암이 갑자기 성장하기 시작하는 암의 유형을 의미한다.
본 발명의 복합제제는 기존 치료 활성 성분, 기타 보조제, 약제학적으로 허용가능한 담체 등의 성분을 추가로 포함할 수 있다. 상기 약제학적으로 허용가능한 담체는 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로스 용액, 말토 덱스트린 용액, 글리세롤, 및 에탄올 등을 포함한다.
본 발명에서 "개체"란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
또한, 본 발명에서 "약학적 유효량"은 투여되는 질환 종류 및 중증도, 환자의 연령 및 성별, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정되며 상기 요소를 모두 고려하여 부작용 없이 최대 효과를 얻을 수 있는 양으로, 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 복합제제는 목적 조직에 도달할 수 있는 한 "투여방법"에는 제한이 없다. 예를 들면, 경구 투여, 동맥 주사, 정맥 주사, 경피 주사, 비강 내 투여, 경기관지 투여 또는 근육 내 투여 등이 포함된다. 일일 투여량은 약 0.0001 내지 100mg/kg이고, 바람직하게는 0.001 내지 10mg/kg이며, 하루 일회 내지 수회 나누어 투여하는 것이 바람직하다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1: 실험방법
1-1. 세포배양 및 시약
인간 NSCLC lines H226B, H226Br, H292, H322, H358, A427, H460, H596, H1299, H1944, H1993, H2126, A549, A549M 세포주들은 American Type Culture Collection (ATCC)에서 구입하거나, MD Anderson Cancer Center(USA)에서 제공받았다. A427 세포주는 10% FBS 및 항생제 함유 DMEM/F12 배지에서, 다른 세포주는 10% FBS 및 항생제 함유 RPMI 1640 배지에서 37℃, 5% CO2 조건하에서 배양하였다.
보리노스탯은 Merck사 또는 Cayman사에서 구입하였으며, 이외의 화합물은 특별한 언급이 없는 한 Sigma사에서 구입하였다.
1-2. MTT 어세이
세포를 well당 2-2.5×103 cells의 개수로 96 well plate에 씨딩하여 부착시킨 후, 대조군(0.1% DMSO) 또는 보리노스탯을 농노별로 처리하여 3일 동안 배양하였다. 세포증식은 공지의 MTT 어세이법으로 측정하였으며, 이때 세포성장을 50% 억제하는 약물농도는 dose-response 커브로부터 결정하였다.
1-3. Anchorage independent colony formation assay
1% 한천 배지를 24 well에 코팅한 후(bottom agar), 0.4 % 한천 배지에 well당 2-7.5×103 cells의 개수로 세포를 희석하여, 각 well의 bottom agar위에 도포한 뒤(top agar), 화합물(보리노스탯)을 농도별로 함유한 배지에서 10-15일간 배양하였다. 화합물 처리후 형성된 colony는 MTT 용액으로 염색하고, Image J software를 통해 colony 개수를 카운팅하였다.
1-4. 보리노스탯 내성 세포주 확립
H1944 세포를 10% FBS 함유 RPMI 1640 배지에서 48시간 0.2uM 보리노스탯 처리한 후, 생존세포가 80% 포화될때까지 무약물 배지에서 배양하였다. 이 과정을 2달동안 보리노스탯의 농도를 0.5-5uM까지 높여가며 반복하고, 확립된 내성 세포주 H1944R를 5uM 보리노스탯 함유 배지에서 유지시켰다. 또한, H358, H322 세포는 6개월 이상동안 2uM 까지 농도를 높여가며 보리노스탯을 처리하였다. 약물내성 획득 여부는 MTT 어세이로 평가하였으며, in vitro 연구를 위하여 내성세포들은 보리노스탯의 효과를 없애기 위하여 적어도 1주일동안 무약물 배지에서 배양하였다.
1-5. 웨스턴 블랏팅
웨스턴 블랏팅은 당업계에 알려진 공지의 방법으로 수행하였다. 이때 사용한 항 pIGF-1R (Y1131, Y1135/6), IGF-1R, CTCF, Akt, pAkt (S473), pERK1/2, ERK, DNMT1, pSTAT3 (Y705), acetyl-STAT3, STAT3, PARP, cleaved caspase-3 항체는 Cell Signaling Technology(USA)에서 구입하였으며, 항 IGF-1R, ERK, actin, IGF1, IGF2, STAT3, ubiquitin, DNMT3A, DNMT3B 항체 및 2차 항체는 Santa Cruz Biotechnology(USA)에서 구입하였다. 또한, 항 cleaved PARP 항체는 BD Biosciences에서, 항 IGF2 항체는 EMD Millipore(USA)에서 구입하였다.
1-6. 트랜스펙션
IGF-1R, IGF2, STAT3의 발현을 넉다운시키기 위하여, Lipofectamine RNAiMAX (Invitrogen)를 이용하여 scrambled siRNA(Shanghai GenePharma) 또는 IGF-1R, IGF2, STAT3에 결합하는 siRNA(Dharmacon 또는 Shanghai GenePharma)로 세포를 트랜스펙션시켰다.
DNMT1를 과발현하는 H1944 세포를 얻기 위하여, Lipofectamine 2000 (Invitrogen)를 이용하여 empty vector(EV; pcDNA3) 또는 pcDNA3-Myc-DNMT1(Addgene Inc)로 세포를 트랜스펙션시켰다.
DNMT1, STAT3의 발현이 감소된 안정한 넉다운 세포주를 얻기 위하여, DNMT1, STAT3에 대한 shRNA를 갖는 렌티바이러스 입자로 H1944R, H1299, H226Br 세포를 트랜스덕션시킨 후, 퓨로마이신 항생제 선택을 실시하였다.
야생형(WT) 또는 acetylation-null 돌연변이(mutant) STAT3를 과발현하는 H1299 세포를 얻기 위하여, Lipofectamine 2000(Invitrogen)를 이용하여 empty vector(EV; pEGFP-N3), pEGFP-STAT3, pEGFP-STAT3 K685R로 세포를 트랜스펙션시켰다.
WT 또는 mutant STAT3 함유 발현벡터는, rAAV-3xFlag WT 또는 mutant STAT3 knock-in 타겟팅 벡터(City of Hope Comprehensive Cancer Center)의 서브클로닝으로 제조하였다.
1-7. RT-PCR
총 RNA는 페놀-클로로포름 추출법으로 세포에서 분리한 후, RT-PCR 또는 SYBR Green-based real-time PCR (LightCycler 480 real-time PCR system, Roche)로 역전사 및 분석을 실시하였다. 이때, RT-PCR 조건은 94℃ 5분; 94℃ 30초, 55-60℃ 30초, 72℃ 30초로 28-35 cycles; 72℃ 5-7분이며, 프라이머쌍의 서열은 하기 표 1에 나타내었다.
Gene 프라이머 서열 (5'->3')
RT-PCR IGF1 Forward TCTTGAAGGTGAAGATGCACACCA
Reverse AGCGAGCTGACTTGGCAGGCTTGA
IGF2 Forward TCGTGCTGCATTGCTGCTTACCG
Reverse GCTCACTTCCGATTGCTGGCCAT
DNMT1 Forward GTATCGCCTCTCTCCGTTTG
Reverse TACGGGCTTCACTTCTTGCT
DNMT3A Forward CACACAGAAGCATATCCAGGAGTG
Reverse AGTGGACTGGGAAACCAAATACCC
DNMT3B Forward AATGTGAATCCAGCCAGGAAAGGC
Reverse ACTGGATTACACTCCAGGAACCGT
CTCF Forward GAACCCATTCAGGGGAAAAGC
Reverse TCGCAAGTGGACACCCAAATC
ACTB Forward ACTACCTCATGAAGATC
Reverse GATCCACATCTGCTGGAA
real-time PCR IGF1 Forward ATGTATTGCGCACCCCTCAA
Reverse GGGCACGGACAGAGCG
IGF2 Forward GCGGCTTCTACTTCAGCAG
Reverse CAGGTGTCATATTGGAACAAC
DNMT1 Forward GTATCGCCTCTCTCCGTTTG
Reverse TACGGGCTTCACTTCTTGCT
ACTB Forward GCGAGAAGATGACCCAGATC
Reverse GGATAGCACAGCCTGGATAG
IGF2 유전자의 프로모터(P1-P4) 특이적 전사체는 공지의 방법으로 분석하였으며, 프라이머쌍의 서열은 하기 표 2에 나타내었다. 이때, PCR 산물은 2% 아가로오스겔 전기영동으로 분리하고, Gel Doc EZ System (Bio-Rad Laboratories)으로 관찰하였다. mRNA의 상대량은 comparative CT (cycle threshold) 방법으로 수행하였다.
Promoter Forward (5’->3’) Reverse (5’->3’)
P1 CAGTCCTGAGGTGAGCTGCTGTGGC CAGCAATGCAGCACGAGGCGAAGGC
P2 ACCGGGCATTGCCCCCAGTCTCC
P3 CGTCGCACATTCGGCCCCCGCGACT
P4 TCCTCCTCCTCCTGCCCCAGCG
1-8. 키나아제 단백질 활성 프로파일링
키나아제 단백질 활성은, Proteome Profiler Human Phospho-Kinase Array 또는 Phospho-RTK Array Kits(R&D Systems)를 이용하여 분석하였으며, 활성수준은 Image J software를 이용하여 densitometric analysis로 정량하였다.
1-9. IGF2 ELISA
보리노스탯 내성 세포에서 IGF2의 수준을 정량하기 위하여, IGF2 ELISA kit (catalog # DSL-10-2600, Beckman Coulter)를 이용하여 ELISA를 수행하였다.
1-10. Reporter Gene Assay
IGF2 P3 및 P4 프로모터의 전사활성을 분석하기 위하여, 루시퍼라제 어세이 시스템(Promega)을 이용하여 리포터 유전자 어세이를 수행하였다. 구체적으로, IGF2 P3, P4 프로모터 서열을 함유하는 루시퍼라제 벡터 또는 pGL3-basic과, pSV-β-Gal을 세포에 공동으로 트랜스펙션시켰다. 그 다음, 보리노스탯으로 처리 후 세포를 용해시켜, amicroplate luminometer(Berthold Technologies)로 루시퍼라제 활성을 모니터링하였다. β-갈락토시다제 활성은 β-갈락토시다제 효소 어세이 시스템(Promega)을 이용하여 측정하고, 트랜스펙션 효율을 노멀화하기 위한 대조군으로 사용하였다.
1-11. Chromatin Immunoprecipitation (ChIP) Assay
STAT3와 CTCF가 IGF2 프로모터 및 H19/ ICF2ICR에 있는 STAT3 결합부위에 각각 결합하는지 확인하기 위하여, SimpleChIP enzymatic chromatin IP kit(Cell Signaling Technology)를 이용하여 ChIP 어세이를 수행하였다. 구체적으로, 단백질에 크로스링크된 크로마틴을 micrococcal 뉴클레아제로 분해한 후, 분해된 크로마틴을 대조군 IgG, 항-STAT3(Santa Cruz), 항-CTCF(Cell Signaling) 항체로 면역침강시켰다. IGF2 P3 및 P4 프로모터내의 STAT3 결합부위는 JASPAR 데이터베이스로 확인한 후, STAT3와 상기 결합부위간의 실제 결합여부는 PCR로 분석하였으며, 이때 사용된 프라이머쌍의 서열은 하기 표 3에 나타내었다.
Transcription factor Forward (5’->3’) Reverse (5’->3’)
STAT3(P3) CATCTGCACTCAGACGGGG CATGCTGAATGCCCGTTCTA
STAT3(P4 S1) AGGAGGAGGACGGACGG GCAAGGCACGAATCACACAT
STAT3(P4 S2) GTGCTGGGTAACGAGGAG CCATGACTCCTGCCAACT
STAT3(P4 S3/4) CACATTCGCGACATCTCCCC TCGAAGGCTCTGCCCTTCTT
STAT3(P4 S5/6) CTGAGGCTAAGAAGGGCAGA GACCATCCCGTAGCGAAGT
CTCF(ICR) CTCCTTCGGTCTCACCGCCTGGAT CCTTAGACGGAGTCGGAGCTG
PCR 산물은 2% 아가로오스겔 전기영동으로 분리하고, Gel Doc EZ System (Bio-Rad Laboratories)으로 관찰하였다.
1-12. Methylation-Specific PCR
세포에서 추출한 1-5ug DNA를 sodium bisulfite로 처리하고, H19/ IGF2 ICR 영역에서의 메틸화는 하기 표 4에 나타낸 DNA 메틸화 특이 프라이머를 이용하여 nested PCR로 분석하였다.
Primer set Forward (5’->3’) Reverse (5’->3’)
Set #1 Outer (normal): TGTTGAAGGTTGGGGAGATGGGA Outer (normal):CCCAAACCATAACACTAAAACCCTC
Methylation:GGTTTTATCGTTTGGATGGTAC Methylation:GACGCGTAACTTAAATAACCCG
Unmethylation: GGTTTTATTGTTTGGATGGTATG Unmethylation:CAACACATAACTTAAATAACCCAAA
Set #2 GGAGATGGGAGGAGATATTAG Methylation:CCTACACTACCGCCGCGCG
Unmethylation:CCTACACTACCACCACACA
또한, bisulfite 처리된 DNA를 클로닝한 후, 프라이머쌍(5'-TGTTGAAGGTTGGGGAGATGGGA-3' ; 5'-CCCAAACCATAACACTAAAACCCTC-3')을 이용하여 서열분석하였다.
1-13. DNA ELISA
세포를 이틀간 보리노스탯으로 처리한 후, RPMI 1640로 희석한 보리노스탯으로 세포수거 2시간전에 더욱 자극하였다. 핵추출물을 준비한 후, STAT3 결합영역에 해당하는 올리고뉴클레오티드로 사전코팅된 ELISA 플레이트에 웰당 5ug씩 배양하였다. TBST로 세척후, 1차 항체(200ng/ml 항-STAT3 항체 in 4% BSA in PBS)를 가하여 실온에서 1시간 배양하였다. TBST로 세척후, 2차 항체(항-래빗-HRP, 1:20,000 희석)를 가하여 실온에서 30분간 배양하였다. TBST로 세척후, 50ul의 3,3',5,5-tetramethylbenzidine (TMB) 용액을 각 웰에 가하여 실온에서 20분간 배양하였다. 반응종결 용액(50ul, 0.1N HCl)을 가한 후, 450nm에서 흡광도를 측정하였다.
1-14. 단백질 안정성 결정 및 유비퀴틴-매개 프로테오좀 분해
STAT3 아세틸화가 STAT3 단백질 안정성에 미치는 영향을 평가하기 위하여, 야생형 또는 돌연변이형 STAT3를 발현하는 H1299 세포를 cycloheximide(CHX; 50 ug/ml)으로 3, 6, 9시간 처리한 후, 웨스턴 블랏팅으로 총 STAT3 및 아세틸화된 STAT3의 수준을 확인하였다.
또한, 유비퀴틴-매개 프로테오좀이 STAT3 단백질 안정성에 미치는 영향을 평가하기 위하여, 세포를 MG132(10uM)에 6시간 노출시켰다. 총 STAT3의 발현은 웨스턴 블랏팅으로 확인하였다. 세포 용해물을 항-STAT3 항체로 면역침강시키고, 항-유비퀴틴 항체를 이용하여 유비퀴틴의 양을 웨스턴 블랏팅으로 확인하였다.
1-15. 종양 동물모델(xenograft)
모든 동물실험은 서울대 동물실험윤리위원회(IACUC)가 승인한 프로토콜에 맞추어 수행되었다. H1299, H226B, H1944, H1944R 세포(4-10×106 cells/spot)를 5-6주령의 누드마우스 또는 NOD/SCID 마우스의 옆구리에 피하주사하였다. PDX를 위하여, NSCLC 환자의 종양조직을 5-6주령의 NOD/SCID 마우스의 옆구리에 피하주입한 후, 종양의 볼륨이 50-150 mm3에 이르면 15-28일 동안 1주일에 3-6번 대조군(vehicle) 또는 약물을 단독 또는 조합으로 처리하였다.
종양의 성장은 캘리퍼로 종양의 단직경/장직경을 측정하여 결정하였고, 체중은 독성을 평가하기 위해 1주일에 2번 측정하였다. 종양의 볼륨(mm3)은 (단직경)2　×　(장직경)　×　0.5의 공식으로 구하였다.
1-16. 면역형광 및 면역조직화학(IHC)
면역형광 및 면역조직화학 염색은, IGF2, DNMT1, pSTAT3, Ac-STAT3, pIGF-1R에 대한 항체를 이용하여 종래 알려진 방법으로 실시하였다.
1-17. CTCL 환자 조직샘플에서 메틸화 상태를 분석하기 위한 Real-Time PCR
CTCL 환자의 조직샘플에서 DNA를 추출하기 위하여, IHC 염색 대상이었던 포르말린-고정 및 파라핀-포매(FFPE) CTCL 절편 조직을 수집하여, 공지의 방법으로 DNA를 추출하였다. 100ng의 DNA를 메틸화-민감 효소 HpaII로 37℃에서 8시간 처리하였다. 이후, LightCycler 480 real-time PCR system(Roche)을 이용하여, 절편 및 비절편화된 2ng의 DNA에 대하여 real-time PCR을 수행하였다. 이때, PCR 조건은 95℃ 5분; 95℃ 10초, 60℃ 10초, 72℃ 10초로 50 cycles; 72℃ 10초이며, 반응특이성을 조사하기 위하여 melting curve 분석을 하였다.
H19/ IGF2 ICR 위치에서의 메틸화 여부를 확인하기 위한 프라이머 서열은, 정방향 5'-ACGCTTCCCCTTCTGTCTC-3' ; 역방향 5'-GGAATGTTAATGTCTGGCCACT-3' 이다. 각 샘플에서 메틸화 퍼센트는 [1/2(Ct(Digest)-Ct(Non-digest))] 의 공식으로 구하였다.
실시예 2: 폐암 세포에서 보리노스탯 반응성 평가
폐암 세포에서 보리노스탯의 반응성을 평가하기 위하여, 12종의 인간 NSCLC lines H226B, H226Br, H322, H358, A427, H460, H596, H1299, H1944, H1993, A549, A549M에 대하여 anchorage independent colony formation assay를 수행하였다. 그 결과, 도 1에 나타낸 바와 같이, A549, H322, A549M, H1944, A427, H1993, H358 세포주에서 콜로니 형성정도가 40% 미만이었기 때문에 이들 세포주가 보리노스탯에 대한 반응성이 높음을 알 수 있었다.
또한, 상기의 비교적 반응성이 높은 세포주를 선택하여 보리노스탯 내성세포주(H1944R)를 확립한 후 대조군(H1944)과 함께 MTT 어세이를 수행한 결과, 도 2에 나타낸 바와 같이, H1944R는 보리노스탯 이외의 다른 히스톤 탈아세틸화효소 억제제(로미뎁신(romidepsin))에 대해서도 저항성을 나타냄을 확인하였다.
실시예 3: 보리노스탯에 대한 획득 내성세포에서 보리노스탯 처리에 의하여 IGF -1R 신호전달의 활성화 확인
보리노스탯에 대한 내성 기전을 밝히기 위하여, 획득 내성세포에서 보리노스탯 처리에 의하여 IGF-1R 신호전달이 활성화되는지 조사하였다. 즉, 보리노스탯 내성세포주(H1944R, H358R, H322R)를 확립한 후 대조군(H1944, H358, H322; P(Parental))과 함께, IGF-1R 신호전달 인자들의 발현 변화여부를 웨스턴 블랏팅으로 확인하였다.
그 결과, 도 3에 나타낸 바와 같이, 인산화된 IGF-1R, Akt, ERK1/2의 발현이 내성세포에서 증가하였으므로, IGF-1R 신호전달이 활성화되었음을 확인하였고, 내성세포에서 IGF2 mRNA 발현이 증가됨을 RT-PCR로 확인하였다.
또한, 도 4에 나타낸 바와 같이, 보리노스탯 내성세포주와 대조군에서 보리노스탯을 농도별(1, 5uM)로 처리하였을 경우, 인산화된 IGF-1R(pIGF-1R)의 발현이 보리노스탯 비처리군(0uM)에 비하여 농도의존적으로 증가하였음을 확인하였다.
실시예 4: 보리노스탯 내성세포에서 보리노스탯 처리에 의한 IGF2 유도확인
보리노스탯 획득 내성세포(H1944R, H358R, H322R)에서 보리노스탯 처리에 의하여 IGF2 발현이 증가되었는지 조사하기 위하여 real-time PCR을 수행하였다. 그 결과, 도 5에 나타낸 바와 같이, 대조군에 비하여 내성세포에서 IGF2 전사(mRNA)가 훨씬 증가하였으나 IGF1에는 변화가 거의 없음을 확인하였으며, 도 6에 나타낸 바와 같이, 보리노스탯 1차 내성세포(H226B, H1299, H460, H226Br)에서도 보리노스탯 처리에 의하여 IGF2 mRNA 발현이 유도됨을 확인하였다.
또한, 보리노스탯 내성세포 배양액에서 보리노스탯 처리에 의하여 IGF2 단백질 분비가 증가하였는지 조사하기 위하여 ELISA를 실시하였으며, 그 결과 도 7에 나타낸 바와 같이, 1차 내성세포(H226B) 및 획득 내성세포(H1944R) 모두에서 IGF2 분비 증가를 확인하였다.
또한, 보리노스탯 1차 및 획득 내성세포(H1944R, H226B, H1299, H226Br)에서 IGF2의 발현을 저해하였을 때 보리노스탯에 의한 IGF-1R 신호전달 활성화가 억제되는지 조사하기 위하여 siRNA에 의한 silencing 실험을 실시하였으며, 그 결과 도 8에 나타낸 바와 같이, 보리노스탯(Vo)에 의해 유도된 IGF-1R 인산화(활성화)가 저해됨을 확인하였다.
또한, 보리노스탯 1차 및 획득 내성세포(H1944R, H226Br, H226B, H1299)에서 IGF2의 발현을 저해하였을 때 보리노스탯에 대한 반응성이 증가되었는지 조사하기 위하여 siRNA에 의한 silencing 후 MTT 어세이를 실시하였으며, 그 결과 도 9에 나타낸 바와 같이, 반응성 증가에 의하여 암세포 생존율이 유의적으로 감소됨을 확인하였다.
실시예 5: 보리노스탯 내성세포에서 HDI 처리에 의한 IGF2 프로모터 활성화 확인
보리노스탯 1차 및 획득 내성세포(H1944R, H460, H226B, H1299, H226Br)에서 보리노스탯 처리에 의하여 IGF2의 4종 프로모터(P1 내지 P4) 중 활성화되는 프로모터를 조사하기 위하여, 각 프로모터에서 유래된 전사체에 대하여 RT-PCR을 수행하였으며, 그 결과 도 10에 나타낸 바와 같이, 프로모터 P3 및 P4가 IGF2 전사에 관여함을 확인하였다.
또한, 보리노스탯 1차 및 획득 내성세포(H1944R, H1299, H226B, H226Br)에서 보리노스탯 처리에 의한 IGF2 프로모터 P3 및 P4의 활성을 더욱 평가하기 위하여, 루시퍼라제 리포터 어세이를 수행하였으며, 그 결과 도 11에 나타낸 바와 같이, 역시 보리노스탯이 P3 및 P4의 활성을 유도함을 확인하였다.
또한, 보리노스탯 1차 및 획득 내성세포(H1944R, H226B)에서 보리노스탯 이외에 다른 HDAC 억제제로서 entinostat(Entino), panobinostat(Pano), romidepsin(Romi)를 처리하였을 경우에도 보리스탯과 유사한 효과가 생기는지 조사하기 위하여, RT-PCR을 수행하였으며, 그 결과 도 12에 나타낸 바와 같이, 이들 HDI 역시 IGF2 발현 증가 및 IGF2의 P3 및 P4 프로모터가 활성화됨을 확인하였다.
실시예 6: IGF2와 STAT3의 관련성 분석
이전 연구를 통하여 myoblast에서 IGF2의 전사에 STAT3가 관여한다는 보고가 있었기 때문에, HDAC 억제시에도 IGF2의 발현증가에 STAT3가 관련있는지 확인하였다.
구체적으로, 보리노스탯 1차 및 획득 내성세포(H1299, H1944R)에서 보리노스탯 처리에 의하여 IGF2 P3 및 P4 프로모터에 존재하는 STAT3 결합 부위에 STAT3이 결합하는지 조사하기 위하여 DNA ELISA 어세이를 실시하였다.
그 결과, 도 13에 나타낸 바와 같이, 보리노스탯이 STAT3의 결합을 증가시킴을 확인하였다. 또한, 도 14에 나타낸 바와 같이, DNA ELISA에서 과량의 STAT3 결합 부위에 대해 과량의 야생형(WT) 올리고뉴클레오티드와 배양시에는 STAT3의 결합이 소실되나, 변이된(M) 올리고뉴클레오티드와 배양시에는 결합이 소실되지 않음을 확인하였는 바, STAT3의 결합이 DNA 서열 특이적임을 알 수 있었다.
또한, 상기의 결과를 더욱 증명하기 위하여 ChIP(chromatin immunoprecipitation) 어세이를 수행한 결과, 도 15에 나타낸 바와 같이, 상기 DNA ELISA 어세이 결과와 동일하게 P3 및 P4 프로모터에 STAT3 결합이 증가됨을 확인하였다.
또한, P3 및 P4 프로모터에 존재하는 STAT3 결합 부위에 변이를 일으킬 경우 보리노스탯 처리에 의한 P3 및 P4 프로모터의 활성화가 소실되는지 조사하기 위하여, 루시퍼라제 리포터 어세이를 실시한 결과, 도 16에 나타낸 바와 같이, 활성화 소실을 확인하였기 때문에 보리노스탯에 의한 IGF2 발현에서 STAT3가 필수적임을 알 수 있었다.
또한, siRNA silencing을 통하여 STAT3의 발현을 저하시켰을때 보리노스탯에 의한 IGF2 발현유도가 억제되는지 확인하기 위하여 real-time PCR을 실시한 결과, 도 17에 나타낸 바와 같이, STAT3 siRNA에 의해 IGF2 mRNA 역시 감소됨을 확인하였다.
또한, STAT3 억제제로 알려진 Stattic을 처리한 경우에도 상기 STAT3 siRNA silencing과 마찬가지로 보리노스탯에 의한 IGF2 mRNA 발현유도가 억제되었으며, P3 및 P4 프로모터의 활성화가 유의적으로 억제됨을 확인하였다(도 18 내지 도 20).
실시예 7: 보리노스탯 내성세포에서 보리노스탯 처리에 의한 STAT3의 아세틸화 유도
보리노스탯에 의해 유도되는 IGF2 전사를 STAT3가 어떻게 매개하는지 구체적인 메커니즘을 확인하기 위하여 다음과 같은 실험을 수행하였다.
우선, 보리노스탯 내성세포에 보리노스탯을 처리한 후 STAT3의 아세틸화, 인산화를 웨스턴 블랏으로 조사한 결과, 도 21에 나타낸 바와 같이, STAT3의 아세틸화(Ac-STAT3)가 증가됨을 확인하였다.
또한, 앞선 in vitro cell line 실험에 더하여, 보리노스탯 투여전과 투여후의 피부 T-세포 림프종(CTCL) 환자 조직에서 IGF2 및 아세틸화된 STAT3의 발현여부를 IHC(면역조직화학) 염색법으로 재확인하였다. 그 결과, 도 22에 나타낸 바와 같이 보리노스탯 투여후의 환자 조직에서 IGF2 및 아세틸화된 STAT3가 유의적으로 증가됨을 확인하였다.
또한, STAT3 mutation에 의해 아세틸화를 억제하였을 때 보리노스탯에 의해 유도되는 IGF2의 발현이 변화하는지 조사하기 위하여, 면역형광염색, RT-PCR/웨스턴 블랏을 실시한 결과, 각각 도 23 및 도 24에 나타낸 바와 같이, 돌연변이(STAT3 K/R)시 Ac-STAT3와 IGF2의 발현이 모두 현저히 감소하고, 아폽토시스와 관련된 인자들(cleaved-PARP;cl-PARP)의 발현이 증가하여 세포사멸이 촉진됨을 확인하였다. 또한, 도 25에 나타낸 바와 같이, 배양액으로 분비된 IGF2의 양 역시 현저히 감소하였다.
또한, STAT3 mutation에 의해 아세틸화를 억제하였을 때 보리노스탯에 의해 유도되는 IGF2 P3, P4 프로모터의 활성이 변화하는지 조사하기 위하여, 루시퍼라제 리포터 어세이를 실시한 결과, 도 26에 나타낸 바와 같이, 돌연변이(STAT3 K/R)시 P3, P4 프로모터의 활성이 감소됨을 확인하였다.
또한, STAT3 mutation에 의해 아세틸화를 억제하였을 때 보리노스탯에 의한 콜로니 생성억제가 변화하는지 조사하기 위하여, 부착 의존성 콜로니 형성 어세이(anchorage dependent colony formation assay)를 실시한 결과, 도 27에 나타낸 바와 같이, 돌연변이(STAT3 K/R)시 콜로니 생성억제 작용이 강화되었다.
또한, STAT3에 특이적인 shRNA로 STAT3를 silencing시키거나 STAT3의 억제제인 Stattic로 STAT3를 저해하였을 때 보리노스탯에 의한 항암활성이 변화하는지 조사하기 위하여, xenograft 동물 실험을 실시한 결과, 도 28 및 29에 나타낸 바와 같이, 다른 대조군들에 비하여, shSTAT3/Stattic과 보리노스탯을 함께 처리한 군에서 종양 부피가 현저히 감소하였는 바, 항암활성이 강화되었음을 확인하였다.
실시예 8: 아세틸화된 STAT3에 의한 DNMT1 발현 유도
STAT3 이외에도, 보리노스탯 내성세포에서 IGF2의 발현에 관여하는 인자를 더욱 조사하고자, 하기와 같은 실험을 수행하였다.
보리노스탯 1차 및 획득 내성세포에서 RT-PCR과 웨스턴 블랏을 실시한 결과, 도 30 및 31에 나타낸 바와 같이, CTCF, DNMT3A, DNMT3B의 발현변화는 없는 반면 DNMT1의 mRNA 및 단백질은 발현이 증가되었음을 확인하였다. 또한, 루시퍼라제 리포터 어세이를 통하여, DNMT1의 프로모터 역시 활성이 증가되었음을 확인하였다(도 32).
또한, 보리노스탯 내성세포에서 보리노스탯 처리에 의하여 DNMT1 mRNA의 발현이 증가됨을 확인하였고(도 33), 이러한 작용이 STAT3 발현 억제(도 34) 또는 STAT3 아세틸화 억제(도 35)에 의하여 소실되는 것을 통하여, 아세틸화된 STAT3가 DNMT1 발현 유도에 관여함을 알 수 있다.
실시예 9: DNMT1에 의한 H19/IGF2 ICR 부위의 과메틸화
보리노스탯 1차 및 획득 내성세포에서 H19/IGF2 각인 조절부위(ICR)에 있는 CTCF 결합부위가 메틸화되는지 조사하기 위하여, CTCF 결합부위에 특이적인 2세트의 프라이머(Primer 1, 2)를 이용하여 메틸화-특이 PCR을 실시한 결과, 도 36에 나타낸 바와 같이, 비내성세포에 비하여 과메틸화가 현저함을 확인하였다.
또한, 보리노스탯 1차 및 획득 내성세포에서 H19/IGF2 각인 조절부위에 있는 CTCF 결합부위에 CTCF가 결합하는지 조사하기 위하여, ChIP 어세이를 실시한 결과, 도 37에 나타낸 바와 같이, CTCF의 결합이 소실됨을 확인하였다.
또한, 상기 H19/IGF2 각인 조절부위의 메틸화에 있어서 DNMT1의 역할을 규명하기 위하여, DNMT1에 특이적인 shRNA로 silencing시킨 후 메틸화-특이 PCR을 실시한 결과, 도 38에 나타낸 바와 같이, DNMT1의 발현이 저해될 경우 H19/IGF2 각인 조절부위의 메틸화가 감소됨을 확인하였다.
실시예 10: DNMT1에 의한 IGF-1R 활성화 및 IGF2 발현 유도
DNMT1과 IGF-1R 신호경로의 관련성을 확인하기 위하여, shRNA로 DNMT1을 silencing시킨 후 RT-PCR 및 웨스턴 블랏을 실시한 결과, 도 39에 나타낸 바와 같이, DNMT1 발현 저해에 의하여 보리노스탯에 의한 IGF-1R의 인산화(활성화) 및 IGF2 발현 유도가 억제됨을 확인하였다.
이러한 결과는, DNMT1에 의한 H19/IGF2 ICR 부위의 과메틸화가 보리노스탯에 의해 유도되는 IGF2 과발현 및 IGF-1R을 유발하고, 이것이 결국 약물 내성을 일으킨다는 것을 의미하는 것이다.
실제, 보리노스탯 내성세포에서 shRNA로 DNMT1을 silencing시켜 발현을 억제할 경우, 보리노스탯의 암세포 생존 억제활성이 회복됨을 MTT 어세이를 통하여 확인하였다(도 40).
또한, 보리노스탯 내성세포에서 DNMT1 억제제인 decitabine(Deci)와 HDAC 억제제인 romidepsin(romi)을 함께 처리할 경우, 아폽토시스 관련 인자인 cleaved caspase-3(cl-Cas-3), cleaved PARP(cl-PARP)가 증가하였음을 웨스턴 블랏으로 확인하였는 바(도 41), 암세포 사멸 유도 활성이 강화되었음을 의미하는 것이다.
실시예 11: H19/IGF2 ICR 부위의 메틸화와 보리노스탯 반응성과의 관련성
상기 in vitro 실험결과에 더하여, NSCLC 환자 유래의 xenograft tumor(PDX) in vivo 모델 7개에서, H19/IGF2 ICR 부위의 메틸화와 DNMT1 발현과의 상관관계를 더욱 확인하기 위하여, real-time PCR을 수행하여 메틸화를 조사한 결과, 도 42에 나타낸 바와 같이, in vivo 에서도 이들 간에 밀접한 관련이 있음을 알 수 있었다.
또한, H19/IGF2 ICR 부위의 메틸화 정도에 따라 보리노스탯의 반응성의 차이를 확인하고, DNMT1 억제제(decitabine; Deci)와 보리스노탯의 병용처리(combo)에 의하여 종양성장이 현저히 감소하였는 바 DNMT1 억제에 의해 보리노스탯의 항암 활성이 증강되는 것을 확인하였다(도 43).
또한, 보리노스탯의 임상 시험에 적용하였던 피부 T-세포 림프종(CTCL) 환자 조직에서 H19/IGF2 ICR 부위의 메틸화 정도 및 약물 반응성과의 관련성을 real-time PCR로 평가한 결과, 도 44에 나타낸 바와 같이, progressive disease(PD) 유래의 종양은 partial respose(PD) 또는 stable disease(SD)에 비하여 메틸화 정도가 현저히 높았음을 확인하였다.
이러한 결과는, H19/IGF2 ICR의 메틸화 정도에 따라 HDAC 억제제의 반응성이 조절되기 때문에, H19/IGF2 ICR의 메틸화 정도를 측정함으로써 항암제(HDAC 억제제) 약물에 대한 반응성을 미리 예측하는데 이용할 수 있을 것이다.
이상의 실시예들을 통하여, 히스톤 탈아세틸화효소 억제제(HDI)에 의하여 유도되는 아세틸화된 STAT3가 IGF2 및 DNMT1(DNA methyltransferase 1)의 발현을 증가시키고, 증가된 DNMT1에 의하여 H19/IGF2 각인 조절 부위(ICR; Imprinting Control Region)의 메틸화가 촉진되면서 더욱 IGF2의 발현이 유도되어, 결국에는 HDI의 내성이 발생된다는 기전을 규명하였는 바, 구체적인 기전 모식도를 도 45에 나타내었다.
실시예 12: paclitaxel 저항성 세포에서의 유효성 평가
HDAC 억제제를 이용한 항암 요법이 기존 항암 요법에 대한 재발 환자에 적용될 수 있음을 고려하여, 본 발명에서 제안하는 복합 항암 요법의 유효성을 paclitaxel 저항성 세포에서 평가한 결과, 도 46에 나타낸 바와 같이, paclitaxel 저항성 세포에서도 유의적으로 암세포 성장을 감소시킴을 확인하였다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 복합제제에 의하면, IGF2 또는 STAT3 차단을 통하여 히스톤 탈아세틸화효소 억제제의 내성을 극복할 수 있기 때문에, 히스톤 탈아세틸화 효소 억제제를 기반으로 하는 항암제의 병용 요법에 유용하게 이용될 수 있다.
본 발명의 HDAC 억제제에 대한 반응성 예측방법에 의하면, H19/IGF2 각인 조절 부위(ICR)의 메틸화 측정이라는 간단한 방법으로 항암제 내성 여부를 쉽고 효과적으로 예측할 수 있기 때문에, 내성으로 인한 낮은 치료 성공율 문제를 해결할 수 있고, 항암제 예후를 추정하고 향후의 치료방침을 정할 수 있다.

Claims (18)

  1. IGF2(Insulin-like growth factor 2) 억제제 및 HDAC(Histone deacetylase) 억제제를 유효성분으로 함유하는, HDAC 억제제 내성을 갖는 암의 예방 또는 치료용 복합제제.
  2. 제1항에 있어서,
    상기 HDAC 억제제는 보리노스탯(vorinostat), 엔티노스탯(entinostat), 파노비노스탯(panobinostat), 로미뎁신(romidepsin), 벨리노스탯(belinostat), 모세티노스탯(mocetinostat), 기비노스탯(givinostat), 프래시노스탯(pracinostat), 치다마이드(chidamide), 퀴시노스탯(quisinostat) 및 아베시노스탯(abexinostat)으로 이루어지는 군으로부터 선택된 어느 하나인 것을 특징으로 하는, 복합제제.
  3. 제1항에 있어서,
    상기 IGF2 억제제는 IGF2 단백질에 결합하여 활성을 억제하는 항체 또는 펩티드인 것을 특징으로 하는, 복합제제.
  4. 제1항에 있어서,
    상기 IGF2 억제제는 IGF2의 mRNA에 결합하여 발현을 억제하는 siRNA, shRNA, miRNA 또는 압타머인 것을 특징으로 하는, 복합제제.
  5. 제1항에 있어서,
    상기 암은 폐암 또는 림프종인 것을 특징으로 하는, 복합제제.
  6. 제1항에 있어서,
    상기 HDAC 억제제는 STAT3(signal transducer and activator of transcription 3)의 아세틸화를 유도함으로써 IGF2 및 DNMT1(DNA methyltransferase 1)의 발현을 증가시키는 것을 특징으로 하는, 복합제제.
  7. 제6항에 있어서,
    상기 아세틸화된 STAT3는 IGF2의 프로모터 P3 및 P4에 결합하여 IGF2의 발현을 증가시키는 것을 특징으로 하는, 복합제제.
  8. 제6항에 있어서,
    상기 DNMT1는 H19/IGF2 각인조절부위(ICR)의 메틸화를 유도함으로써 IGF2의 발현을 더욱 증가시키는 것을 특징으로 하는, 복합제제.
  9. 하기의 단계를 포함하는, HDAC 억제제에 대하여 암환자의 반응성을 예측하는 방법:
    (a) 암조직 샘플에서 H19/IGF2 ICR(imprinting control region) 부위의 메틸화 정도를 측정하는 단계, 및
    (b) 정상대조군에 비하여 암조직 샘플에서 메틸화가 증가하였을 경우 HDAC 억제제에 대하여 암환자의 반응성이 낮은 것으로 판단하는 단계.
  10. 제9항에 있어서,
    상기 메틸화 정도는 메틸화-특이 PCR에 의해 측정하는 것을 특징으로 하는 방법.
  11. 제9항에 있어서,
    상기 HDAC 억제제는 보리노스탯(vorinostat), 엔티노스탯(entinostat), 파노비노스탯(panobinostat), 로미뎁신(romidepsin), 벨리노스탯(belinostat), 모세티노스탯(mocetinostat), 기비노스탯(givinostat), 프래시노스탯(pracinostat), 치다마이드(chidamide), 퀴시노스탯(quisinostat) 및 아베시노스탯(abexinostat)으로 이루어지는 군으로부터 선택된 어느 하나인 것을 특징으로 하는 방법.
  12. 제9항에 있어서,
    상기 암은 폐암 또는 림프종인 것을 특징으로 하는 방법.
  13. H19/IGF2 ICR(imprinting control region) 부위에 특이적인 프라이머쌍을 포함하는, HDAC 억제제에 대한 암환자의 반응성 예측용 키트.
  14. 제13항에 있어서,
    상기 프라이머쌍은 메틸화-특이 PCR에 의해 메틸화 정도를 측정하기 위한 것임을 특징으로 하는, 키트.
  15. 제13항에 있어서,
    상기 HDAC 억제제는 보리노스탯(vorinostat), 엔티노스탯(entinostat), 파노비노스탯(panobinostat), 로미뎁신(romidepsin), 벨리노스탯(belinostat), 모세티노스탯(mocetinostat), 기비노스탯(givinostat), 프래시노스탯(pracinostat), 치다마이드(chidamide), 퀴시노스탯(quisinostat) 및 아베시노스탯(abexinostat)으로 이루어지는 군으로부터 선택된 어느 하나인 것을 특징으로 하는, 키트.
  16. 제13항에 있어서,
    상기 암은 폐암 또는 림프종인 것을 특징으로 하는, 키트.
  17. IGF2 억제제 및 HDAC 억제제를 개체에 투여하는 단계를 포함하는, HDAC 억제제 내성을 갖는 암의 예방 또는 치료방법.
  18. IGF2 억제제 및 HDAC 억제제를 함유하는 복합제제의 HDAC 억제제 내성을 갖는 암의 예방 또는 치료용도.
PCT/KR2016/009177 2015-08-21 2016-08-19 Hdac 억제제 내성을 갖는 암 치료용 복합제제 WO2017034234A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2015-0117709 2015-08-21
KR20150117709 2015-08-21
KR1020160104755A KR20170022915A (ko) 2015-08-21 2016-08-18 Hdac 억제제 내성을 갖는 암 치료용 복합제제
KR10-2016-0104755 2016-08-18

Publications (1)

Publication Number Publication Date
WO2017034234A1 true WO2017034234A1 (ko) 2017-03-02

Family

ID=58100195

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/009177 WO2017034234A1 (ko) 2015-08-21 2016-08-19 Hdac 억제제 내성을 갖는 암 치료용 복합제제

Country Status (1)

Country Link
WO (1) WO2017034234A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10287353B2 (en) 2016-05-11 2019-05-14 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US10385131B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009108857A2 (en) * 2008-02-27 2009-09-03 Combithera, Inc. Combination therapy for prostate cancer
KR20110101124A (ko) * 2006-07-05 2011-09-15 주식회사 오리엔트바이오 암의 예측, 암의 진단, 암의 전이 정도 또는 예후 확인에 필요한 정보를 제공하기 위하여 데이터를 수집하는 방법 및 그 키트
KR20140069271A (ko) * 2011-09-26 2014-06-09 셀진 코포레이션 화학요법 내성 암에 대한 병용 요법
US20140286961A1 (en) * 1997-09-18 2014-09-25 Ivan Bergstein Novel Methods Of Cancer Therapy Targeted Against A Cancer Stem Line
WO2014187894A1 (en) * 2013-05-24 2014-11-27 4Sc Ag Gene expression biomarkers and their use for diagnostic and prognostic application in patients potentially in need of hdac inhibitor treatment

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140286961A1 (en) * 1997-09-18 2014-09-25 Ivan Bergstein Novel Methods Of Cancer Therapy Targeted Against A Cancer Stem Line
KR20110101124A (ko) * 2006-07-05 2011-09-15 주식회사 오리엔트바이오 암의 예측, 암의 진단, 암의 전이 정도 또는 예후 확인에 필요한 정보를 제공하기 위하여 데이터를 수집하는 방법 및 그 키트
WO2009108857A2 (en) * 2008-02-27 2009-09-03 Combithera, Inc. Combination therapy for prostate cancer
KR20140069271A (ko) * 2011-09-26 2014-06-09 셀진 코포레이션 화학요법 내성 암에 대한 병용 요법
WO2014187894A1 (en) * 2013-05-24 2014-11-27 4Sc Ag Gene expression biomarkers and their use for diagnostic and prognostic application in patients potentially in need of hdac inhibitor treatment

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10287353B2 (en) 2016-05-11 2019-05-14 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US10385131B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors
US10385130B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US11535670B2 (en) 2016-05-11 2022-12-27 Huyabio International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors

Similar Documents

Publication Publication Date Title
WO2017022962A1 (ko) Ripk 억제제를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
WO2017034234A1 (ko) Hdac 억제제 내성을 갖는 암 치료용 복합제제
WO2021167389A1 (ko) 엠토르 신호전달 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약제학적 조성물
WO2023096126A1 (ko) Mdsc 활성 저해 약물의 선별 방법
WO2021230600A1 (ko) 대사항암제를 포함하는 항암용 조성물
WO2012053768A2 (en) Aryloxyphenoxyacetyl-based compound having hif-1 inhibition activity, preparation method thereof and pharmaceutical composition containing the same as an active ingredient
Adamik et al. Epigenetic‐based mechanisms of osteoblast suppression in multiple myeloma bone disease
Fu et al. Mechanisms and importance of histone modification enzymes in targeted therapy for hepatobiliary cancers
WO2020141828A2 (en) Anticancer compositions comprising immune checkpoint inhibitors
WO2019194586A1 (en) Novel target for anti-cancer and immune-enhancing
WO2017023047A1 (ko) 아리피프라졸을 유효성분으로 함유하는 염증성 질환 또는 암 예방 또는 치료용 조성물
WO2016167605A2 (ko) 고혈압 치료제를 이용한 흡연 및 비흡연자의 폐암 억제 방법
WO2020055129A1 (ko) 베르베논 유도체를 포함하는 암 치료 또는 예방용 조성물
WO2022055334A1 (ko) 폐 섬유화 질환의 예방 또는 치료용 조성물
WO2014157965A1 (ko) P34의 발현 억제제 또는 활성 억제제를 유효성분으로 포함하는 암의 치료 또는 전이 억제용 조성물
WO2021033973A1 (ko) Mitf 억제제를 유효성분으로 함유하는 골수-유래 억제세포 저해용 조성물
WO2017048069A1 (ko) 신규한 피라졸린 유도체 및 이의 용도
WO2023055076A1 (ko) 암 전이 억제용 조성물
WO2023163301A1 (ko) Kitenin의 이량체 형성을 저해하는 펩타이드 및 이의 용도
WO2021054510A1 (ko) 셀레노사마필린 a를 유효성분으로 포함하는 유방암 예방 및 치료용 조성물
WO2022119349A1 (ko) Kras 억제제에 대한 내성 억제용 조성물
WO2024071935A1 (ko) 히스톤 탈아세틸화효소 억제제를 포함하는 암 치료용 조성물, 및 암 면역치료용 항암 보조제
WO2018012889A1 (ko) Itac의 억제제를 포함하는 조성물
WO2023038416A1 (ko) 폐 섬유증의 바이오마커 및 치료 표적으로서 csf3r
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16839523

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16839523

Country of ref document: EP

Kind code of ref document: A1