WO2017023782A1 - Methods of analyzing virus-derived therapeutics - Google Patents
Methods of analyzing virus-derived therapeutics Download PDFInfo
- Publication number
- WO2017023782A1 WO2017023782A1 PCT/US2016/044788 US2016044788W WO2017023782A1 WO 2017023782 A1 WO2017023782 A1 WO 2017023782A1 US 2016044788 W US2016044788 W US 2016044788W WO 2017023782 A1 WO2017023782 A1 WO 2017023782A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- viral
- sequence
- sequencing
- polio
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2521/00—Reaction characterised by the enzymatic activity
- C12Q2521/30—Phosphoric diester hydrolysing, i.e. nuclease
- C12Q2521/301—Endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2521/00—Reaction characterised by the enzymatic activity
- C12Q2521/30—Phosphoric diester hydrolysing, i.e. nuclease
- C12Q2521/319—Exonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2535/00—Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
- C12Q2535/122—Massive parallel sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present disclosure is related to library-based deep sequencing methods to analyze batches of virus-derived therapeutics, such as live attenuated poliovirus vaccines.
- PVS-RIPO is a chimeric poliovirus (PV), consisting of the live attenuated, oral type-1 Sabin vaccine strain carrying a foreign internal ribosome entry site (IRES) from human rhinovirus type 2 (HRV2) (Brown et al, (2014) Cancer 120:3277-86; Goetz et al, (2011) Future Virol. 9:1045-1058; Goetz & Gromeier (2010) Cytokine & Growth Fact Rev; 21:197-203). Poliovirus is the causative agent of Poliomyelitis, a severe neuro-degenerative disease. PVS-RIPO was engineered to be a non-pathogenic therapeutic virus for the treatment of Glioblastoma Multiforme (GBM) and other CD155 + cancers (WO 2014/081937).
- GBM Glioblastoma Multiforme
- the IRES is a critical non-coding sequence element within the 5 ' untranslated region of picornaviral genomic RNA, as it mediates translation initiation in a 5' end-, 7-methyl-guanosine ('cap')-independent fashion (Dobrikova et al, (2003) PNAS USA 100:15125-15130; Dobrikova et al, (2003) Virology 311:241-253; Dufresne et al, (2002) J Virol 76:8966-8972).
- the IRES is the principal determinant of the neuro-attenuated phenotype of all three PV Sabin vaccine strains and of PVSRIPO (Campbell et al (2005) J Virol 79:6281-6290; Dobrikova et al (2006) J Virol 80:3310-3321; Brown & Gromeier (2015) Curr Opinion Virol 13:81-85).
- neuro- attenuation results from formation of neuron-specific (IRES) ribonucleoprotein complexes that preclude ribosome recruitment.
- IRS neuron-specific
- the genetic footprint for neuronal incompetence in the HRV2 IRES spans at least the upper parts of stem loop domain 5 (-40 nt) and domain 6 (-25 nt) (Brown et al, (2014) Cancer 120:3277-86; Dobrikova et al, (2003) PNAS USA 100:15125-15130; Dobrikova et al, (2003) Virology 311:241-253; Dufresne et al, (2002) J Virol 76:8966-8972). Because the consensus HRV2 IRES sequence likely resulted from thousands of years of evolution in humans, it may represent an idealized version of a translation initiation mediator in HRV2 target cells (mitotically active cells in respiratory tract epithelium).
- polioviruses and PVS-RIPO are single- stranded RNA (ssRNA) viruses
- ssRNA single- stranded RNA
- the natural frequency of mutation during viral replication is higher than observed with dsDNA viruses and organisms with DNA genomes.
- each clinical lot of live or inactivated poliovirus virus must be validated prior to clinical release by in vivo primate neurotoxicity safety testing and in vitro plaque-sequencing methods to verify that the lot does not contain rare genetic reversion mutations that can regenerate a neurotoxic phenotype leading to poliomyelitis.
- Primate neurotoxicity testing of vaccine lots typically requires several months to complete and in vitro plaque-sequencing methods have relatively poor sensitivity.
- Sanger sequencing only two polymorphic sites were noted in the HTB-15 xenograft study as positions 97 and 1824 (Dobrikova et al, (2008) Mol Ther 16:1865-1872; Cello J et al, (2008) J Med Virol 80:352-359.).
- neither of these two sites were identified as polymorphic in the Illumina deep sequencing with PVSRIPO, indicating they were the result of de novo base mutations following passaging in HTB-15 cells.
- PVSRIPO does not exhibit a neuropathic phenotype in primates and, using both direct and plaque-based Sanger sequencing methods, PVSRIPO exhibits a low level of sequence heterogeneity.
- Other less sensitive methods that make a gross assessment of viral genetic stability and uniformity were also employed such as temperature sensitivity (i.e. , RCT40) and general safety testing (e.g., in vivo adventitious agent testing and RT-qPCR).
- NGS Next Generation Sequencing'
- virus-derived therapeutics that can be analyzed using the disclosed methods include, but are not limited to: a virus, a viral template plasmid, or a vaccine, such as one derived from, a polio virus (such as PVS-RIPO), measles virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, adenovirus, herpes virus, mumps virus, influenza virus, rubella virus, HIV, or HTLV.
- a virus such as PVS-RIPO
- measles virus such as PVS-RIPO
- measles virus such as PVS-RIPO
- measles virus such as PVS-RIPO
- measles virus such as PVS-RIPO
- measles virus such as PVS-RIPO
- measles virus such as PVS-RIPO
- measles virus such as PVS-RIPO
- measles virus such as PVS-RIPO
- measles virus such
- the disclosed methods include extracting (e.g., isolating) nucleic acid molecules from a viral seed bank, harvest, and/or purified drug product lots (such as a master viral bank or a working cell bank), wherein the viral seed bank, harvest, and/or purified drug product lots (such as a master viral bank or a working cell bank) includes host cells containing the virus-derived therapeutic.
- the extracted nucleic acid molecules are incubated (e.g., contacted) with DNase under conditions that substantially digest host cell genomic DNA and host cell mitochondrial DNA, but do not substantially digest the desired viral nucleic acid molecule (such as a viral genomic RNA or DNA, or a viral template plasmid).
- a viral genomic RNA or DNA or a viral template plasmid
- An examples of such a condition is 30 minutes at 37°C.
- the resulting enriched viral nucleic acid molecules can be DNA or RNA.
- the method includes producing double- stranded (ds) DNA (e.g., dscDNA) from the enriched viral RNA, for example using reverse transcription and generating a second viral nucleic acid strand.
- ds DNA e.g., dscDNA
- Viral ds DNA is amplified (e.g., using PCR), and the amplified viral ds DNA quantified.
- a sequencing library is then generated from at least 500 pg the amplified viral ds DNA.
- the sequencing library includes 5' -adaptors and 3 '-adaptors attached to the viral ds DNA (e.g., the viral ds DNA fragments include 5 ' adaptors and 3 ' adaptors ligated thereto).
- the resulting sequencing library is sequenced using next generation sequencing (for example using parallel single-end or paired-end sequencing) to produce a raw sequence dataset that includes a plurality of sequence reads.
- the plurality of sequence reads are aligned with a reference sequence for the virus-derived therapeutic (such as a non-mutated sequence) to produce an aligned sequence containing a plurality of aligned sequence reads. From the aligned sequence reads, the sequence of the virus-derived therapeutic can be determined, and the presence of sequence variations (e.g., mutations), if any, identified.
- the method further includes introducing the virus-derived therapeutic from the MVB into a host cell, such as a mammalian cell (e.g., Vero cell), for production of the virus-derived therapeutic.
- a host cell such as a mammalian cell (e.g., Vero cell)
- the resulting virus-derived therapeutic produced in the second host call can then be sequenced, and its sequence compared to the virus -derived therapeutic obtained and sequenced from the MVB.
- the method can further include introducing (e.g., transforming) the virus-derived therapeutic into mammalian host cells and growing the mammalian host cells under conditions that allow propagation of the virus-derived therapeutic. Viral nucleic acid molecules from the mammalian host cells are extracted (e.g., isolated).
- the isolated viral nucleic acid molecules can be DNA or RNA. If they are RNA, the method includes producing ds DNA (e.g., dscDNA) from the isolated viral RNA, for example using reverse transcription and generating a second viral nucleic acid strand. Viral ds DNA (e.g., dscDNA) is amplified (e.g., using PCR), and the amplified viral ds DNA quantified.
- ds DNA e.g., dscDNA
- Viral ds DNA e.g., dscDNA
- PCR amplified
- a sequencing library is then generated from at least 500 pg the amplified viral ds DNA, sequenced, the resulting plurality of sequence reads aligned with a reference sequence, and the sequence of the virus-derived therapeutic determined, and the presence of sequence variations (e.g., mutations), if any, identified, as described above.
- the method also allows for at least two different virus-derived therapeutics (such as 2, 3, 4, or 5 different virus-derived therapeutics) to be assayed simultaneously or contemporaneously, for example by using "bar codes” or "tags” that allow one to distinguish between the different virus- derived therapeutics.
- the different virus-derived therapeutics are different viruses.
- the different virus-derived therapeutics are the same virus, but from a different source (such as from different MVBs).
- producing the sequencing library can include producing one or more sequencing libraries for each virus-derived therapeutic, wherein the one or more sequencing libraries comprise 5 ' adaptors and 3' adaptors, and wherein each of the one or more sequencing libraries includes a unique barcode for identification.
- the one or more sequencing libraries are pooled and sequenced.
- the pooled raw sequence dataset can be demultiplexed using the barcodes to produce a demultiplexed raw sequence dataset for each sequencing library.
- Each of the demultiplexed raw sequence datasets can be aligned with its appropriate reference sequence for the virus-derived therapeutic.
- the mean read length, percentage of aligned reads, coverage, SNPs, or a combination thereof are determined for the aligned sequence reads.
- the unaligned sequence read can be added to a pool of unaligned sequence reads for identification. From the aligned sequence reads, the sequence of each virus-derived therapeutic analyzed can be determined, and the presence of sequence variations (e.g., mutations), if any, identified.
- producing the sequencing library from the ds DNA includes randomly fragmenting the double-stranded DNA to produce DNA (e.g., cDNA) fragments, ligating 5' adaptors and 3' adaptors to the DNA (e.g., cDNA) fragments to produce adaptor-ligated DNA (e.g., cDNA) fragments.
- the adaptor-ligated DNA (e.g., cDNA) fragments are amplified to produce the sequencing library.
- the sequencing library can be clonally amplified, for example using primers complementary to the 5' adaptors and the 3 ' adaptors (in some examples the primers are attached to solid surface or particle), thereby producing a clonally amplified sequencing library.
- the clonally amplified sequencing library is sequenced to produce the raw sequence dataset comprising a plurality of sequence reads. For example, sequencing the clonally amplified sequencing library can be performed using primers complementary to the 5 ' adaptors and the 3 ' adaptors.
- the mean read length, percentage of aligned reads, coverage, SNPs, or a combination thereof, are determined for the aligned sequence reads.
- the unaligned sequence read when an unaligned sequence read is produced, the unaligned sequence read is added to a pool of unaligned sequence reads for identification.
- the method includes reporting consensus homology for the virus-derived therapeutic to the reference sequence for the virus-derived therapeutic, coverage per base per position, heterogeneous bases at greater than a defined percentage of reads (e.g. , heterogeneous bases at greater than 0.1% of reads), InDels, or a combination thereof.
- the method further includes administering the sequenced virus-derived therapeutic to a subject, if the determined viral sequence variants are not contraindicated (e.g., if no mutations are detected that would lead of a toxic phenotype).
- FIG. 1 is a flow diagram of one embodiment of the analysis of deep sequencing data.
- FIG. 2 shows alignment statistics for dilution libraries of a PVS-RIPO vaccine lot.
- FIG. 3 is an exemplary read length plot for a 100 pg sample of a PVS-RIPO vaccine lot.
- FIG. 4 is an exemplary coverage plot for a 100 pg sample of a PVS-RIPO vaccine lot Toxicology lot L0603006.
- FIGS. 5A-500 show variations of the Master Viral Seed Bank Lot (SEQ ID NO. 80).
- FIG. 6 shows coverage depth of PVSRIPO Master Viral Bank lot L0403006.
- FIG. 7 shows coverage depth of PVSRIPO Final Vialed Product lot L0904010.
- FIG. 8 shows coverage depth of PVSRIPO Reference Standard lot L1310001.
- FIG. 9 shows coverage depth of PVSRIPO Purified Sterile Bulk Lot L1405001.
- FIG. 10 shows coverage depth of PVSRIPO Final Vialed Product Lot LI 402001.
- FIG. 11 shows coverage depth of PVSRIPO Master Viral Bank lot L131100.
- nucleic and amino acid sequences are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. ⁇ 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
- sequence listing generated on July 29, 2016 (24.3 kb) and submitted herewith is herein incorporated by reference.
- SEQ ID NOS: 1-79 are nucleic acid primer sequences used in sequencing assays.
- SEQ ID NO. 80 is a PVS-RIPO Master Viral Seed, lot L0403006 viral consensus sequence. The extreme 3' end bases (29) are missing and the 5'-most base (position #1) is incorrect, likely due to primer-based error. DETAILED DESCRIPTION
- nucleic acid molecule means “including a nucleic acid molecule” without excluding other elements. It is further to be understood that any and all base sizes given for nucleic acids are approximate, and are provided for descriptive purposes, unless otherwise indicated.
- 3' end The end of a nucleic acid molecule that does not have a nucleotide bound to it 3' of the terminal residue.
- Adjuvant A compound, composition, or substance that when used in combination with an immunogenic agent (such as a virus analyzed using the disclosed methods) augments or otherwise alters or modifies a resultant immune response.
- an adjuvant increases the titer of antibodies induced in a subject by the immunogenic agent.
- an adjuvant alters the particular epitopic sequences that are specifically bound by antibodies induced in a subject.
- Exemplary adjuvants include, but are not limited to, Freund's Incomplete Adjuvant (IFA), Freund's complete adjuvant, B30-MDP, LA-15-PH, montanide, saponin, aluminum salts such as aluminum hydroxide (Amphogel, Wyeth Laboratories, Madison, NJ), alum, lipids, keyhole lympet protein, hemocyanin, the MF59 microemulsion, a mycobacterial antigen, vitamin E, non-ionic block polymers, muramyl dipeptides, polyanions, amphipatic substances, ISCOMs (immune stimulating complexes, such as those disclosed in European Patent EP 109942), vegetable oil, Carbopol, aluminium oxide, oil-emulsions (such as Bayol F or Marcol 52), E. coli heat-labile toxin (LT), Cholera toxin (CT), and combinations thereof.
- IFA Incomplete Adjuvant
- B30-MDP Freund's complete adjuvant
- LA-15-PH
- an adjuvant includes a DNA motif that stimulates immune activation, for example the innate immune response or the adaptive immune response by T-cells, B-cells, monocytes, dendritic cells, and natural killer cells.
- a DNA motif that stimulates immune activation include CG oligodeoxynucleotides, as described in U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; 6,339,068; 6,406,705; and 6,429,199, and IL-2 or other immunomodulators.
- Administration To provide or give a subject an agent, such as a virus analyzed using the disclosed methods, by any effective route.
- routes of administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal,
- intratumoral, and intravenous oral, transdermal, intranasal, and inhalation routes.
- Amplifying a nucleic acid molecule To increase the number of copies of a nucleic acid molecule, such as a viral RNA or DNA. The resulting products are called amplification products or amplicons.
- An example of in vitro amplification is the polymerase chain reaction (PCR), in which a sample (such as a sample containing viral nucleic acid molecules) is contacted with a pair of oligonucleotide primers, under conditions that allow for hybridization of the primers to a nucleic acid molecule in the sample.
- the primers are extended under suitable conditions, dissociated from the template, and then re -annealed, extended, and dissociated to amplify the number of copies of the nucleic acid molecule.
- Attenuated pathogen A pathogen with a decreased or weakened ability to produce disease while retaining the ability to stimulate an immune response like that of the natural pathogen.
- a pathogen is attenuated by selecting for avirulent variants under certain growth conditions (for example see Sabin and Boulger. /. Biol. Stand. 1 : 115-8; 1973; Sutter et al., 2003. Poliovirus vaccine— live, p. 651-705. In S. A. Plotkin and W. A. Orenstein (ed.), Vaccines, Fourth ed. W.B. Saunders Company, Philadelphia).
- An exemplary attenuated pathogen is the Sabin polio virus.
- Contacting can occur in vitro or ex vivo, for example, by adding a reagent to a sample (such as one containing bacterial cells expressing a viral template plasmid), or in vivo by administering to a subject (such as administration of a virus analyzed using the disclosed methods).
- a sample such as one containing bacterial cells expressing a viral template plasmid
- administering to a subject (such as administration of a virus analyzed using the disclosed methods).
- Effective amount The amount of an agent (such as a virus analyzed using the disclosed methods) that is sufficient to effect beneficial or desired results, such as a protective immune response, such as an anti-cancer response.
- a therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art.
- the beneficial therapeutic effect can include enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
- an "effective amount” e.g., of virus analyzed using the disclosed methods
- an "effective amount” (e.g., of a virus purified using the disclosed methods) is an amount sufficient to increase the immune response in vivo, for example increase production of antibodies specific for the immunogen by at least 10%, at least 20%, at least 25%, at least 50%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 99%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% (as compared to no administration of the therapeutic agent).
- Host cell Cell in which a vector or virus can be propagated and its nucleic acids expressed.
- the cell may be prokaryotic or eukaryotic.
- the term also includes any progeny of the subject host cell.
- host cells can be transgenic, in that they include nucleic acid molecules that have been introduced into the cell, such as a viral template plasmid nucleic acid molecule or a virus.
- the host cell is a cell (such as a mammalian cell) in which a virus (such as PVS-RIPO) proliferates. Proliferation of the virus in host cells can be used for production of the viral material (for example, Vero cells used for production of PVS-RIPO), or, in some cases, for protein expression.
- recombinant baculoviruses can be used for recombinant protein expression in insect cells ("baculovirus expression system").
- Viral proliferation can occur in vitro, for example, in cell culture, or in vivo, when viral host cells are a part of an organism.
- Immune response A response of a cell of the immune system, such as a B-cell, T-cell, macrophage, monocyte, or polymorphonucleocyte, to an immunogenic agent (such as a virus analyzed using the disclosed methods) in a subject.
- An immune response can include any cell of the body involved in a host defense response, such as an epithelial cell that secretes interferon or a cytokine.
- An immune response includes, but is not limited to, an innate immune response or inflammation.
- the response can be specific for a particular antigen (an "antigen- specific response"), such as a polio virus.
- an immune response is a T cell response, such as a CD4+ response or a CD8+ response.
- the response is a B cell response, and results in the production of specific antibodies to the immunogenic agent.
- such an immune response provides protection for the subject from the immunogenic agent or the source of the immunogenic agent.
- the response can protect a subject, such as a human or veterinary subject, from infection by a pathogen, or interfere with the progression of an infection by a pathogen.
- An immune response can be active and involve stimulation of the subject's immune system, or be a response that results from passively acquired immunity.
- Increase or Decrease A statistically significant positive or negative change, respectively, in quantity from a control value (such as a value representing no therapeutic agent).
- An increase is a positive change, such as an increase at least 50%, at least 100%, at least 200%, at least 300%, at least 400% or at least 500% as compared to the control value.
- a decrease is a negative change, such as a decrease of at least 20%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% decrease as compared to a control value. In some examples the decrease is less than 100%, such as a decrease of no more than 90%, no more than 95%, or no more than 99%.
- Isolated An "isolated" biological component (such as a virus generated and analyzed using the disclosed methods) has been substantially separated, produced apart from, or purified away from other biological components in the cell or media in which the component occurs, such as other nucleic acid molecules and proteins (e.g., host cell chromosomal and extrachromosomal DNA and RNA, and proteins).
- Isolated viruses analyzed using the disclosed methods in some examples are at least 50% pure, such as at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9999%, or at least 100% pure, for example, as measured by residual host cell (HC) DNA.
- isolated viruses purified using the disclosed methods, or viral template plasmids expanded using the disclosed methods have less purity when measured by residual HC protein (HCP), such as at least 3% pure, at least 4% pure, or at least 5% pure (such as 3-4% pure), for example when an increase in total PFU is desired. Even at -3% protein purity the level of HCP is within acceptable limits for a therapeutic product.
- isolated viruses analyzed using the disclosed methods, when measured by residual HCP are at least 50% pure, such as at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.9999% pure.
- Master cell bank A population of cells, which can be established from a single clone, which is used as a source of materials for manufacturing, such as manufacture of a vaccine (e.g. , polio virus).
- the cells of the MCB include a plasmid or vector, such as a viral template plasmid encoding polio virus or polio virus, or include a virus (and thus can be referred to as a master viral bank, MVB).
- MVB master viral bank
- Cells from the MCB are expanded to form a working cell bank (WCB).
- MCBs and WCBs provide a flexible and practical approach for creating cell stocks.
- MCBs and WCBs can be analyzed using the methods herein, for example to identify as MCB or WCB that does not contain mutations (e.g., which may result in an undesirable virulent virus).
- Next generation sequencing also referred to as massively parallel or deep sequencing, describe a nucleic acid sequencing technology which performs sequencing of millions of small nucleic acid fragments (e.g., DNA) in parallel. Bioinformatics analyses are used to piece together these fragments by mapping the individual reads to the reference genome. NGS is unselective, and thus allows for analysis of a genome without bias.
- the methods generally include the use of a DNA polymerase that catalyzes the incorporation of fluorescently labeled dNTPs into a DNA template strand during sequential cycles of DNA synthesis. During each cycle, at the point of incorporation, the nucleotides are identify by fluorophore excitation. Millions of fragments are sequenced in a massively parallel fashion.
- Examples of such methods include, but are not limited to: those available from Illumina (e.g., sequencing by synthesis (SBS)), Ion Torrent (e.g., from ThermoFisher Scientific), Solexa® sequencing, 454® sequencing, chain termination sequencing, dye termination sequencing, or pyrosequencing. In some examples, single molecule sequencing is used.
- Illumina e.g., sequencing by synthesis (SBS)
- Ion Torrent e.g., from ThermoFisher Scientific
- Solexa® sequencing e.g., from ThermoFisher Scientific
- 454® sequencing e.g., from ThermoFisher Scientific
- chain termination sequencing e.g., from ThermoFisher Scientific
- dye termination sequencing e.g., from ThermoFisher Scientific
- pyrosequencing e.g., single molecule sequencing is used.
- compositions and formulations suitable for pharmaceutical delivery of a virus purified using the disclosed methods are conventional. Remington 's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of a virus purified using the disclosed methods.
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- Poliovirus An enterovirus of the Picornaviridae family that is the causative agent of poliomyelitis (polio). Poliovirus has three serotypes. Exemplary polio sequences are provided in Toyoda et al , J. Mol. Biol. 174:561-85, 1984 (herein incorporated by reference).
- Non-natural forms of the polio virus include the recombinant oncolytic poliovirus PVS- RIPO and the attenuated Sabin oral polio vaccine (OPV), and can be analyzed using the disclosed methods.
- PVS-RIPO is a recombinant, live attenuated, nonpathogenic oncolytic virus containing the oral poliovirus Sabin type 1 in which the internal ribosomal entry site (IRES) is replaced with the IRES from human rhinovirus type 2 (HRV2), with potential antineoplastic activity (see for example Brown et al., Cancer 120:3277-86, 2014 and Goetz et al., Cytokine Growth Factor Rev. 2010 21(2-3): 197-20).
- IRES internal ribosomal entry site
- the OPV includes 57 nucleotide substitutions which distinguish the attenuated Sabin 1 strain from its virulent parent (the Mahoney serotype), two nucleotide substitutions attenuate the Sabin 2 strain, and 10 substitutions are involved in attenuating the Sabin 3 strain.
- the primary attenuating factor common to all three Sabin vaccines is a mutation located in the virus's internal ribosome entry site (IRES) which alters stem-loop structures, and reduces the ability of poliovirus to translate its RNA template within the host cell.
- IRS internal ribosome entry site
- Exemplary Sabin sequences are provided in GenBank® Accession Nos. E01572.1, E01571.1 and E01570.1, as well as Nomoto et al, Proc Natl Acad Sci U S A. 79(19): 5793-5797, 1982.
- PV chemically inactivated polio vaccine
- Mahoney type 1 poliovirus
- MEF-1 type 2 poliovirus
- Saukett type 3 poliovirus
- a purified virus preparation is one in which the virus is more enriched than the virus is in a host cell or host cell extract.
- a preparation is purified such that the purified virus represents at least 50% of the total nucleic acid content of the preparation.
- a virus is purified to represent at least 60%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or even at least 99%, of all
- macromolecular species present in a purified preparation prior to admixture with other formulation ingredients such as a pharmaceutical carrier, excipient, buffer, absorption enhancing agent, stabilizer, preservative, adjuvant or other co-ingredient.
- the purified preparation is be essentially homogeneous, wherein other macromolecular species are not detectable by conventional techniques.
- Such purified preparations can include materials in covalent association with the active agent, such as materials admixed or conjugated with the active agent, which may be desired to yield a modified derivative or analog of the active agent or produce a combinatorial therapeutic formulation or conjugate.
- a recombinant nucleic acid molecule is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished using routine methods, such as by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques such as those described in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
- the term recombinant includes nucleic acid molecules that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid molecule.
- a recombinant protein is one encoded by a recombinant nucleic acid molecule.
- a recombinant virus includes one whose genes have been constructed and/or placed in an unnatural environment, for example for expression, for example using recombinant engineering techniques.
- a vertebrate such as a mammal, for example a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets.
- the subject is a non-human mammalian subject, such as a monkey or other non- human primate, mouse, rat, rabbit, pig, goat, sheep, dog, cat, horse, or cow.
- the subject has a tumor, such as a glioblastoma, that can be treated using the polio virus analyzed using the disclosed methods.
- the subject is a laboratory animal/organism, such as a mouse, rabbit, or rat.
- Transform or Transfect A virus or vector "transforms” or “transduces” a host cell when it transfers nucleic acid into the host cell.
- a cell is “transformed” or “transfected” by a nucleic acid transduced into the cell when the DNA becomes stably replicated by the cell, either by
- nucleic acid incorporation of the nucleic acid into the cellular genome, or by episomal replication.
- transfection Numerous methods of transfection are known to those skilled in the art, such as: chemical methods (e.g., calcium-phosphate transfection), physical methods (e.g., electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), receptor-mediated endocytosis (e.g., DNA-protein complexes, viral envelope/capsid-DNA complexes) and by biological infection by viruses such as recombinant viruses (Wolff, J. A., ed, Gene Therapeutics, Birkhauser, Boston, USA 1994).
- retroviruses the infecting retrovirus particles are absorbed by the target cells, resulting in reverse transcription of the retroviral RNA genome and integration of the resulting provirus into the cellular DNA.
- Transgene An exogenous gene supplied by a vector.
- a transgene includes a viral template sequence, such as viral DNA template sequence for an RNA virus, such as polio (a natural polio virus or a non-naturally occurring polio virus).
- Treating, Treatment, and Therapy Any success or indicia of success in the attenuation or amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement, remission, diminishing of symptoms or making the condition more tolerable to the patient, slowing in the rate of degeneration or decline, making the final point of degeneration less debilitating, improving a subject's physical or mental well-being, or prolonging the length of survival.
- the treatment may be assessed by objective or subjective parameters;
- treatment with the disclosed PV results in a decrease in the number, volume, and/or weight of a tumor (e.g., a brain tumor) and/or metastases.
- a tumor e.g., a brain tumor
- a phrase that is used to describe any environment that permits a desired activity is transformation of a host cell by a viral template plasmid, or growth of such a transformed host cell.
- the desired activity is sequencing of target viral nucleic acid molecules, for example using next generation sequencing.
- the desired activity is treatment of a tumor and/or stimulation of an immune response in vivo, for example using a viruses purified using the disclosed methods.
- Vaccine An immunogenic composition that can be administered to an animal or a human to confer immunity, such as active immunity, to a disease or other pathological condition. Vaccines can be used prophylactically or therapeutically. Thus, vaccines can be used reduce the likelihood of infection or to reduce the severity of symptoms of a disease or condition or limit the progression of the disease or condition.
- a vaccine includes one or more viruses analyzed using the disclosed methods (e.g., a natural polio virus or a non-naturally occurring polio virus).
- a nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell can include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication.
- a vector can also include one or more therapeutic genes or selectable marker genes and other genetic elements known in the art.
- a vector can transduce, transform or infect a cell, thereby causing the cell to express nucleic acid molecules or proteins other than those native to the cell.
- a vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a viral particle, liposome, protein coating or the like.
- a vector is a plasmid, such as a bacterial plasmid. Overview
- the MAPREC assay is a very laborious test, the required use of radio isotopes adds to its technical difficulty, and different laboratories have problems with various aspects of the assay.
- the neurovirulence testing assays currently used to test or validate a virus-derived therapeutic are expensive and time consuming.
- the WHO Working Group recommended that new technologies for quality control of polio vaccine be developed.
- the methods described herein provide an improved validation/safety testing method for RNA virus-derived therapeutics, particularly vaccines, and thus provide a solution to a long-felt need in the industry.
- the disclosed methods are currently under consideration for US-FDA approval.
- MNVT monkey neurovirulence safety test
- Cercopithecus monkeys an intraspinal inoculation.
- 11-18 monkeys are used for evaluation of the vaccine preparation and also 11-18 control monkeys.
- the monkeys are observed for clinical signs of virus infection, e.g., poliomyelitis, over 17-24 days. All monkeys that survive the observation period are euthanized and processed for analysis including histopathologic al evaluation of virus-specific lesions in brain and spinal cord tissue.
- MNVT test to assessing neurovirulence potential for humans, particularly in the case of polioviruses (Rubin, "Toward replacement of .the monkey
- RNA virus-derived therapeutics In addition to the MNVT procedure, plaque-based sequencing methods are also used to evaluate lots of RNA virus-derived therapeutics.
- the mutant analysis by PCR and restriction enzyme cleavage (MAPREC) method is used to determine the proportion of a single base mutation at a given point within a viral RNA. If the calculated value of the mutation at this site is greater than acceptable values, the monovalent bulk vaccine (e.g. , oral polio vaccine) will fail the
- Type 3 poliovirus vaccine the mutation of U to C at base position 472 in the viral RNA 5' NCR is directly related to the neurovirulence of the virus in monkeys.
- Type 1 and 2 oral polio vaccine there are mutations within the 5' NCR which revert rapidly when passaged in the human gut or in cell culture. These include Type 1 base positions 480 G ⁇ A and 525 U ⁇ C and Type 2 base position 481 A ⁇ G. These mutations are believed to lead to increased neurovirulence when present in high proportions in the viral population or through interaction with other mutations within the viral genome. Interestingly, no correlation with virulence in monkeys has been established when these mutations are present at levels typically found in vaccine batches.
- MAPREC Mutant Analysis by PCR and Restriction Enzyme Cleavage
- Sabin Oral Poliovirus
- Vaccine Types 1, 2, or 3 Version 5 (2012). Therefore, the MAPREC test for Type 1 and 2 oral polio vaccines has been developed to measure the consistency of vaccine production.
- the MAPREC test is, however, limited to determining only a small number of genomic loci known to contain attenuation markers. (Rubin, "Toward replacement of .the monkey neurovirulence test vaccine safety testing", Procedia in Vaccinology, 5, pp. 261-265 (2011)).
- RNA virus PVSRIPO Seven lots of the single- stranded RNA virus PVSRIPO were analyzed using Illumina deep sequencing protocols. The lots included the original Master Viral Banks (MVB, lot #L0403006) manufactured in 2004 and viral product lots derived from the 2004 MVB, including a non-clinical toxicology lot, the phase 1 clinical lot from 2009, clinical drug substance and drug product lots manufactured in 2014, and a reference standard lot. Illumina deep sequencing was also performed on a second MVB lot (MVB, lot #L1311002) manufactured using plasmid in vitro transcription and transfection in 2013. All of the lots examined exhibited surprisingly limited sequence micro- heterogeneity across the chimeric viral genome with average read depths in excess of 2 x 10 5 per base.
- the sequence variation observed was shown to consist of ⁇ 1% heterogeneous base calls relative to the canonical reference sequence; with only 5 polymorphic positions observed repeatedly in more than one lot of PVSRIPO. These five heterogeneous positions and their associated base variant patterns were observed to be consistent across all of the lots tested. This indicates that the limited variation present in the clinical lots of PVSRIPO is derived from the variation originally present in the parental MVB lot or may represent preferred modes of polymerase mis -incorporation during viral replication or cDNA sequencing.
- the plasmid DNA used to generate the MVB by in vitro transcription (IVT) may be a third source of the base variation pattern observed in the seven PVSRIPO lots.
- PVSRIPO deep sequencing of PVSRIPO validates prior analytical and neurotoxicity data which indicate PVSRIPO is a surprisingly stable single-stranded RNA virus.
- the second MVB lot of PVSRIPO (Lot L1311002) exhibits a low level of sequence micro-heterogeneity and the sequence variation pattern observed was consistent with the earlier 2004 MVB lot and its subsequent clinical lots.
- the present methods differ from other methods of analyzing virus-derived therapeutics
- the neverov and Chumakov reference proposes massively parallel sequencing methods to sequence live viral vaccines.
- the reference fails to provide detail regarding the viral preparation steps, likely because large volume high-titer cultures (i.e., clarified supematants) or 'purified' vaccine lots were used (viral RNA was obtained from HeLa or Vero cell supernatant). That is, the authors were not limited by sample volumes when generating viral RNA extracts.
- the PureLink Viral RNA kit used by Neverov and Chumakov does not include DNase.
- Hall et al. J. Virol. Meth. 195: 194-204, 2014 disclose a method that uses centrifugation, filtration and nuclease treatment to enrich enteroviruses sequences.
- Hall et al. teach using the DNase prior to extracting nucleic acid molecules, which is more procedurally efficient since the DNase is removed during extraction.
- the inventors found that by extracting nucleic acids prior to contacting them with DNase, the efficiency of the DNase reaction is unexpectedly and significantly improved when used after extraction and inactivated separately.
- the use of DNase prior to extraction as taught by Hall et al.
- Table 1 provides a summary comparing the disclosed methods to other methods for analyzing virus-derived therapeutics.
- nucleic acid molecules and treat with RNAse H transcribe RNA are RNA, produce into DNA
- Described herein are methods to rapidly and directly screen lots (e.g., viral seed banks, harvests, and purified drug product lots, such as master viral seed bank lots and working cell bank lots) of virus-derived therapeutics (e.g., polio and other viral vaccine products) in vitro using next generation sequencing methods (e.g., massively parallel sequencing) to determine the presence and frequency of substantially all potential genetic mutations across the complete viral genome.
- next generation sequencing methods e.g., massively parallel sequencing
- This method has routinely demonstrated several orders of magnitude (typically > 4 log) more sensitivity to sequence variants than current plaque-based sequencing methods and can be performed within 1- 2 weeks, unlike primate neurotoxicity testing which typically requires several months to complete.
- results reported herein cannot be obtained using traditional Sanger sequencing methods since the Sanger methods are limited in specificity to the primer sequences used, and in detection sensitivity to approximately 10-20% of the total signal. In other words, only a genetic variant that consisted of greater than approximately 10-20% of the entire sample could be reliably detected using Sanger sequencing methods, and generally only those high-frequency variants that did not occur at a sequencing or PCR priming site.
- the sequencing methods disclosed herein do not require sequencing or PCR primers specific for the target viral nucleic acid that can bias sequencing results. Sequencing protocols utilizing the pre-amplification PCR primers and the sequencing primers that target the ligated 5' - and 3 '-adaptor sequences, and do not directly target viral cDNA sequences, can be used (e.g., such as the Illumina® protocols).
- the methods described herein reduce primer- mediated bias (e.g. , hiding SNPs and InDels that occur at PCR priming sites) prior to, or during, sequencing while maintaining the advantages of overlapping reads via the use of quasi-random cDNA fragmentation.
- the sequencing methods described herein optionally employ a minimal amount of PCR pre-amplification of the target virus-derived therapeutic, with the level of pre-amplification readily compensated for during post-sequencing analysis where the use of higher PCR cycles
- the methods can detect sequence variation at any arbitrary level (e.g., ⁇ 0.0001% or PPM has been achieved) and is only limited by the depth of coverage and/or the number of target copies present in the sample.
- RNA and DNA in a given sample volume may be several logs greater than the amount of viral RNA present, making traditional Sanger sequencing methods impossible or potentially biased due to the need for extensive pre- amplification (PCR cycling) prior to Sanger sequencing.
- virus-derived therapeutics for the presence of a viral sequence variant. These sequencing and screening methods can be used to analyze lots of virus-derived therapeutic (such as those present in a MVB or WCB) for the presence of undesirable viral sequence variations (such as one or more nucleotide deletions, insertions, or substitutions). Exemplary virus-derived therapeutics that can be analyzed using the disclosed methods include, but are not limited to: a virus, a viral template plasmid, or a vaccine.
- Exemplary virus-derived therapeutics that can be sequenced using the methods disclosed herein include those based on RNA viruses that exhibit high mutation rates, such as polio virus, measles virus, hepatitis A virus, hepatitis C virus, mumps virus, influenza virus, rubella virus, HIV, HTLV, and the like.
- Exemplary vaccines that can be analyzed with the disclosed methods include MMR (measles, mumps, rubella) and MMRV (measles, mumps, rubella, chicken pox).
- the RNA virus-derived therapeutic is a vaccine, specifically PVS-RIPO, the live attenuated, oral (SAB IN) serotype 1 poliovirus vaccine containing a heterologous internal ribosomal entry site stemming from human rhinovirus type 2.
- the disclosed methods also allow for analysis of more than one virus-derived therapeutic at a time, for example by using multiplexing.
- the disclosed methods include extracting (e.g., isolating) nucleic acid molecules from viral seed banks, harvests, and purified drug product lots (e.g., a master viral bank (MVB) or a working cell bank (WCB)).
- Isolating nucleic acid molecules including viral genomic nucleic acids (e.g., RNA) from the viral seed banks, harvests, and purified drug product lot can be performed using methods known in the art such as the commercially available QIAamp® viral RNA mini kit from Qiagen. Total RNA can be quantitated spectrophotometrically or by quantitative RT-PCR.
- Viral seed banks include host cells (such as E. coli or other bacterial cells and their undesired host cell genomic DNA and host cell mitochondrial DNA) containing the virus-derived therapeutic, and harvests (e.g., from Vero cells), may include undesired host cell genomic DNA and host cell mitochondrial DNA.
- the virus-derived therapeutic to be analyzed is present in an unpurified sample, such as those from viral seed banks and harvests (e.g., a MVB or a WCB).
- a sample of a virus-derived therapeutic is an unpurified sample, such as one containing at least 85%, at least 90% or at least 95% of the total nucleic acid from sources other than the virus-derived therapeutic, such as host cell genomic and mitochondrial DNA.
- the method includes treating isolated viral genomic RNA from the unpurified sample with DNase and then inactivating the DNase prior to producing double- stranded cDNA from the isolated viral genomic RNA. The DNase treatment removes free DNA and allows for improved cDNA synthesis of the target viral RNA.
- the method includes treating isolated viral genomic DNA from the unpurified sample with DNase and then inactivating the DNase and recovering the viral genomic DNA.
- Such DNase treatment removes host cell DNA but allows for recover of viral DNA (e.g., if in a capsid).
- the virus-derived therapeutic is a DNA virus
- an appropriate structure-specific nuclease can be used instead of DNase following extraction.
- DNAse treatment is performed prior to nucleic acid extraction.
- DNase treatment is performed before and after extraction of nucleic acids.
- the virus -derived therapeutic to be analyzed is present in a purified sample, such as those from purified drug product lots.
- Purified samples include, for example, clinical lots of vaccine.
- Purified samples typically contain greater than 70%, typically greater than 95% of their total nucleic acids from the RNA virus-derived therapeutic.
- DNase treatment is not required for such purified samples.
- the sequence of a virus- derived therapeutic present in a purified sample is compared to the sequence of the virus-derived therapeutic previously obtained from an unpurified sample (e.g., at an earlier stage of processing).
- the disclosed methods can include analyzing the virus-derived therapeutic in the unpurified sample using the methods provided herein, and then subsequently analyzing the virus-derived therapeutic in the purified sample using the methods provided herein. This allows one to determine if the sequence of the virus-derived therapeutic changed during manufacturing of the virus-derived therapeutic.
- the extracted (e.g., isolated) nucleic acid molecules are incubated (e.g., contacted) with DNase under conditions that substantially digest host cell genomic DNA and host cell mitochondrial DNA, but do not substantially digest the desired viral nucleic acid molecule (such as a viral genomic RNA or DNA, or a viral template plasmid).
- An example of such as condition is at least 10 minutes (such as at least 15, at least 20, or at least 30 minutes) at 37°C.
- the condition is at least 10 minutes (such as at least 15 minutes, at least 20 minutes, at least 30 minutes, at least 60 minutes, at least 120 minutes, or at least 180 minutes) at 2°C to 40°C (with lower temperatures generally requiring longer incubation times). If a thermostable DNase is used, the sample can be incubated above 40°C. In some examples, the extracted or isolated nucleic acid molecules are incubated with the DNAse for less than 1 hour, such as less than 45 minutes, or no more than 30 minutes, such as 10-30 minutes.
- the extracted or isolated nucleic acid molecules are incubated with low amounts of DNAse, such as less than 10 U at 2U/uL, less than 5 U at 2U/uL, for example 1 U to 10 U at 2U/uL or 1 U to 5U at 2U/uL, such as 4 U at 2U/uL.
- DNAse such as less than 10 U at 2U/uL, less than 5 U at 2U/uL, for example 1 U to 10 U at 2U/uL or 1 U to 5U at 2U/uL, such as 4 U at 2U/uL.
- the purity of the desired virus-derived therapeutic nucleic acids following DNase treatment is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.
- the amount of virus-derived therapeutic nucleic acids degraded during DNase treatment is less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or less that 0.5%.
- the amount of host cell nucleic acids degraded during DNase treatment is at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.
- the resulting enriched viral nucleic acid molecules can be DNA or RNA. If they are RNA, the method includes producing double-stranded (ds) DNA (e.g., dscDNA) from the enriched viral RNA, for example using reverse transcription and generating a second viral nucleic acid strand.
- ds double-stranded
- the ThermoScriptTM system from Life technologies can be used with an oligo(dT) x primer such as an oligo(dT o primer and dNTPs to produce cDNA.
- an oligo(dT) x primer such as an oligo(dT o primer and dNTPs
- SMARTScribe system with SMARTer Oligo IIA and 01igo(dT) x primers from Clonetech are used to produce cDNA from low viral copy samples.
- RNAseH can be added to remove RNA/DNA hybrids.
- cDNA can then be quantitated, for example spectrophotometrically.
- Second strand DNA synthesis can be performed using methods known in the art such as the NEB Next® Second Strand Synthesis Kit from New England Biolabs.
- the QIAquick® PCR purification kit can be used to purify the ds cDNA which can then be quantitated, for example spectrophotometrically.
- Viral ds DNA e.g., dscDNA
- dscDNA a DNA sequence derived from the host cells
- PCR e.g., PCR-dependent PCR
- the amplified viral ds DNA quantified, for example spectrophotometrically.
- a sequencing library is then generated from at least 500 pg ng (such as at least 1 ng, at least 2 ng, at least 5 ng, or at least 10 ng) of the amplified viral ds DNA (e.g., ds cDNA), such as 500 pg to 1 ng, 500 pg to 5 ng, 500 pg to 10 ng, or 1 ng to 5 ng of the amplified viral ds DNA.
- the sequencing library includes 5' -adaptors and 3 '-adaptors attached to the viral ds DNA (e.g., the viral ds DNA fragments have a 5 '-adaptor and a 3' adaptor ligated thereto).
- the sequencing library can be produced by randomly fragmenting the ds DNA (e.g., ds cDNA) to produce DNA (e.g., cDNA) fragments, ligating 5' adaptors and 3 ' adaptors to the DNA (e.g., cDNA) fragments, and amplifying (e.g., clonally amplifying) he adaptor-ligated DNA (e.g., cDNA) fragments.
- the adaptor-ligated DNA (e.g., cDNA) fragments are amplified to produce the sequencing library.
- the amplifying is performed using oligonucleotides complementary to the 5 ' -adaptors and the 3 '-adaptors (wherein the primer can be attached to a solid surface or particle, e.g., are surface-bound or particle-bound) to produce a clonally amplified sequencing library.
- the DNA (e.g., cDNA) fragments of the sequencing library typically have a size of 200 to 400 base pairs. Fragmenting the ds DNA (e.g., ds cDNA) and ligating 5' - and 3- adaptors can be performed using Illumina® Nextera® "tagmentation".
- fragmenting e.g., enzymatically cutting
- tagging the fragments with adaptor sequences
- the fragmenting and ligating can also be done as discrete steps.
- the DNA ligase can be inactivated.
- a sequencing library is thus randomly fragmented double stranded DNA molecules which are ligated at their 3' and 5' end to adapter sequences.
- Use of the tagmentation process provides better control of fragment lengths with concomitantly improved sample yields. In turn this allows for better recoveries and greater potential read depths and sample coverage.
- the tagmentation method is also more reproducible than kinetic fragmentation methods.
- the specific design of the 5 ' and 3 ' adapters depends on the NGS platform to be used.
- the adapter sequences provide a known sequence composition allowing, for example, subsequent library amplification or sequencing primer annealing.
- As adaptors double-stranded or partially double- stranded nucleic acids of known sequence can be used.
- the adapters may have blunt ends, cohesive ends with 3' or 5' overhangs, may be provided by Y shaped adapters or by stem-loop shaped adapters.
- Y shaped adapters are described e.g. in U.S. Pat. No. 7,741,463 and stem-loop shaped adapters are described e.g. in US2009/0298075, herein incorporated by reference regarding the specific design of the adapters.
- Exemplary adaptors have a length of at least 7, at least 10, or at least 15 bases, such as 10 to 100 bases, 15 to 75 bases, or 20 to 60 bases. Either the same or different adaptors can be used at the 3'- and 5'-end of the fragments. Using the same type of adaptor for both ends, such as a Y shaped or a stem-looped shaped adapter, has the advantage that no fragments are lost during library preparation due to adapter mispairing, which is an advantage when working with low amounts of DNA.
- an amplification step is performed. Using a minimal amount of PCR pre-amplification of the target virus can improve the signal-to-noise ratio and increase the sensitivity threshold to minimize reporting of false positive results. Changes in amplification can be readily compensated for during post-sequencing analysis. In one example, 10 to 15 cycles, such as 12 cycles, of PCR amplification are employed.
- barcodes are added to the DNA (e.g., cDNA) fragments. Barcodes are specific DNA sequences that can be used to identify the sample of origin. Barcodes can be used to de-multiplex or differentiate sequence reads from different samples. The use of barcodes also allows for in- silico linkage analysis, direct intra-assay comparison of two or more lots, and the like. The use of unique barcodes can also be used to rapidly identify laboratory cross-contamination from prior or concomitant studies.
- the sequencing library is clonally amplified, for example using surface-bound or particle-bound oligonucleotides complementary to the 5' adaptors and the 3' adaptors.
- clonal amplification uses bridge amplification of oligonucleotides complementary to the 5 ' -adaptors and the 3' -adaptors that are bound (e.g., attached) to the surface of a flow cell. Template clusters are thus formed directly on a flow cell.
- Ion Torrent PGMTM method library fragments are clonally amplified onto microbeads.
- the resulting clonally amplified sequencing library is then sequenced using NGS technology (for example using parallel single-end or paired-end sequencing) to produce a raw sequence dataset that includes a plurality of sequence reads. That is, the clonally amplified library fragments, or fragments from multiple libraries, are sequenced by synthesis in parallel. In one aspect, parallel paired-end sequencing is used. In paired-end sequencing, both ends of the same fragment are sequenced. In the Illumina® protocol, after completion of the first read, the clonal clusters are modified in situ to regenerate the templates for the paired read. Paired reads generate greater genomic information than single reads (e.g., 2x75 bp base paired reads compared to 150 bp single reads).
- the parallel paired-end sequencing is 2x75 to 2x200 bp sequencing.
- sequencing the clonally amplified sequencing library is performed using primers complementary to the 5 ' - adaptors and the 3 ' - adaptors .
- the resulting plurality of sequence reads are aligned with a reference sequence for the virus-derived therapeutic (such as a non-mutated sequence of the same virus) to produce an aligned sequence containing a plurality of aligned sequence reads.
- a reference sequence for the virus-derived therapeutic such as a non-mutated sequence of the same virus
- at least 80% of the sequence reads align with the reference sequence for the virus-derived therapeutic, such as at least 85, at least 90%, or at least 95%.
- the sequence of the virus- derived therapeutic can be determined, and the presence of sequence variations (e.g., mutations), if any, identified (e.g., reported).
- the mean read length of the plurality of sequence reads is about 75 to about 150 base pairs.
- the reporting includes coverage per base per position.
- coverage refers to the number of times a particular nucleotide is read during the sequencing process. Coverage is thus the average number of reads representing a particular nucleotide in the aligned sequence, in either direction.
- the coverage per base is at least 4X.
- the method can thus include determining that the aligned sequence is acceptable for screening the lot of the virus -derived therapeutic when the coverage of each base in the aligned sequence is 4X or greater, such as at least 4X, at least 5X, at least 6X, at least 7X, at least 8X, at least 9X or at least 10X. Average coverage is based on the total number of base reads divided by the size of the reference (or observed) target genome.
- Average coverage can thus be misleading because when sequencing a viral genome using a single RT primer, the 3 ' end of the cDNA will typically have much greater depth of coverage than the 5' end.
- Sanger sequencing can be performed on the virus-derived therapeutic to provide coverage of 4X or greater across the entire aligned sequence. For example, at the 5' end of the PVS-RIPO sequence, the strong RNA structure in the viral IRES domain can lead to RT exhaustion, resulting in reduced coverage.
- linear PCR amplification of the PVS-RIPO cDNA can be performed using only reverse primers to yield a minimum of 4X sequence coverage of the 5' end.
- a high-cycle number of linear (non-exponential) PCR may be employed to prevent over-writing the native PVS-RIPO viral sequence with primer sequence, especially at the under-represented (low copy dscDNA) and hyper- variable 5 ' end of the PVS-RIPO virus, for example.
- Primers are selected or designed for the regions necessitating additional coverage using target sites that have been previously demonstrated to have reduced sequence variability. Consensus homology to the PVS-RIPO reference sequence and any heterogeneous bases across the Sanger sequenced region are included in the final report.
- the mean read length, percentage of aligned reads, coverage, SNPs, or a combination thereof are determined for the aligned sequence reads.
- SNPs can be determined for the aligned sequence reads.
- Variants can be defined according to the following criteria (e.g., for a polio vaccine): if sequencing depth at a given base position is equal to or exceeds 4,096,000, potential variations are called at greater than 0.1 %; if depth is less than 4,096,000 but greater than 4096, variants exceeding a frequency of 4096 or greater are called; if the depth of coverage at a given base position is less than 4096 reads, potential variants are called if the consist of greater than 1.0%.
- a 0.1 % threshold is an exemplary threshold. However, the threshold can be set at any arbitrary value limited only by the target copy number and the fidelity of the RT, pre-PCR, and sequencing reactions employed.
- the method includes reporting consensus homology for the virus-derived therapeutic to the reference sequence for the virus-derived therapeutic, coverage per base per position, heterogeneous bases at greater than a defined percentage of reads (e.g., heterogeneous bases at greater than 0.1% of reads), InDels, or a combination thereof.
- Consensus homology of the virus-derived therapeutic to the reference sequence can be reported as a pairwise alignment of a portion or all of the consensus sequence and the sequence dataset, a report of variations at individual positions for a portion or all of the consensus sequence and the sequence dataset, or any other suitable format.
- reporting can also include coverage per base per position of a portion or all of the consensus sequence and the sequence dataset. Such data can be presented as a table or a graph, for example. Coverage can also include total coverage estimated by taking the total number of sequenced bases and dividing by the size of the genome. Reporting can also include heterogeneous bases at greater than 0.1% of reads which are expected to be above the signal to noise threshold.
- unaligned sequence read when an unaligned sequence read is produced, the unaligned sequence read is added to a pool of unaligned sequence reads for identification.
- unaligned read sequences can be analyzed by NCBI BLASTn to determine their identity; it is expected that unaligned reads, especially those from unpurified viral samples, will be from host cell genomic or mitochondrial DNA sequences, although human DNA or other laboratory contaminant DNA sequences may be observed as well.
- the identification of unaligned sequence reads by BLASTn analysis allows for the identification of potential contaminants other than host cell (e.g. , Vero) DNA.
- identification of unaligned reads can act as an adjunct to viral contaminant PCR and AVA safety testing as well as a means to identify potential process or laboratory contamination from human DNA.
- the information that can be ascertained from unaligned sequence reads includes: sample or testing laboratory contamination; manufacturing contamination (prior product, cell line contamination (e.g., HeLa contamination), human DNA, etc.); detection and identification of adventitious agents (lytic or lysogenic viruses, bacteria, mycoplasma, etc.) in the host cell line; potential to uniquely identify the host cell bank lot via mtDNA and/or gDNA sequences; possible identification of excessive host cell MCBAVCB age (passage number) or stress due to changes in mtDNA or gDNA sequences (or even mRNA expression levels); unaligned reads may be diagnostic for changes in the sample preparation method and/or sequencing; and unaligned reads act as a measure of sample purity, similar to residual host cell DNA testing.
- the method further includes introducing the virus-derived therapeutic obtained and sequence from the MVB into a host cell, such as a mammalian cell (e.g., Vero, HEK293, HeLa, or PerC6 cell), for production of the virus-derived therapeutic (e.g., a vaccine).
- a host cell such as a mammalian cell (e.g., Vero, HEK293, HeLa, or PerC6 cell)
- the resulting virus-derived therapeutic produced in the second host cell can then be sequenced using a similar protocol as used for the MVB or WCB, except that DNase is generally not required, as the virus-derived therapeutic (e.g., a vaccine) is of higher purity than the virus-derived therapeutic obtained from the MVB or WCB.
- the resulting sequence of the virus-derived therapeutic can be compared to a corresponding reference sequence and/or to the sequence of the virus-derived therapeutic obtained from the MVB or WCB.
- the method can further include introducing (e.g., transforming) the virus- derived therapeutic into mammalian or other host cells and growing the mammalian host cells under conditions that allow propagation of the virus-derived therapeutic.
- Viral nucleic acid molecules from the mammalian host cells are extracted (e.g., isolated) and purified, for example from the supernatant.
- the purity of the desired virus-derived therapeutic nucleic acids following such extraction and isolation is at least 50%, at least 60%, at least 75%, at least 80%, 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, or at least 99.99%.
- the isolated viral nucleic acid molecules can be DNA or RNA.
- the isolated viral nucleic acid molecules can be treated with DNase as described above (in some examples, the host cells or culture supernatant is treated with DNase prior to or after viral nucleic acid isolation).
- the method includes producing ds DNA (e.g., dscDNA) from the isolated viral RNA, for example using reverse transcription and generating a second viral nucleic acid strand.
- Viral ds DNA e.g., dscDNA
- is amplified e.g., using PCR
- a sequencing library is then generated from at least 500 pg ng (such as at least 1 ng, at least 2 ng, at least 5 ng, or at least 10 ng) of the amplified viral ds DNA (e.g., ds cDNA), such as 500 pg to 1 ng, 500 pg to 5 ng, 500 pg to 10 ng, or 1 ng to 5 ng of the amplified viral ds DNA, sequenced, the resulting plurality of sequence reads aligned with a reference sequence, and the sequence of the virus-derived therapeutic determined, and the presence of sequence variations (e.g., mutations), if any, identified, as described above.
- the resulting sequence of the virus-derived therapeutic can be compared to the sequence of the virus-derived therapeutic obtained from the MVB or WCB.
- the method allows for at least two different virus-derived therapeutics (such as at least 3, at least 4, at least 5, at least 10, or at least 20, such as 2, 3, 4 or 5 different virus-derived therapeutics) to be assayed simultaneously or contemporaneously, for example by using "bar codes” or "tags” that allow one to distinguish between the different virus-derived therapeutics.
- the different virus-derived therapeutics are different viruses (e.g., different polio viruses or different RNA viruses).
- the different virus-derived therapeutics are the same virus (e.g., PVS-RIPO), but from a different source (such as from different MVBs or WCBs).
- producing the sequencing library can include producing one or more sequencing libraries for each virus-derived therapeutic, wherein the one or more sequencing libraries include 5 '-adaptors and 3 '-adaptors, and wherein each of the one or more sequencing libraries includes a unique barcode for identification.
- the one or more sequencing libraries are pooled, sequenced as described herein using NGS, and analyzed as described above.
- the pooled raw sequence dataset can be demultiplexed using the barcodes to produce a
- Each of the demultiplexed raw sequence datasets can be aligned with its appropriate reference sequence for the virus -derived therapeutic. From the aligned sequence reads, the sequence of each virus-derived therapeutic analyzed can be determined, and the presence of sequence variations (e.g., mutations), if any, identified. For example, individual sequence reads can be classified as aligned sequence reads and unaligned sequence reads based on their alignment or non-alignment with the reference sequence. Aligned sequence reads can be evaluated for mean read length, percentage of aligned reads, coverage, SNPs, Insertions/Deletions (InDels) or a combination thereof.
- the method includes reporting consensus homology for the virus-derived therapeutic to the reference sequence for the virus-derived therapeutic, coverage per base per position, heterogeneous bases at greater than a defined percentage of reads (e.g., heterogeneous bases at greater than 0.1% of reads), InDels, or a combination thereof.
- the dataset is de-multiplexed.
- De-multiplexing refers to sorting of multiple samples that are sequenced together, generally using a barcode. For example, several dilutions of a lot of an RNA virus-derived therapeutic can be used to form libraries, wherein each library includes a unique barcode. Or, several individual lots of RNA virus-derived therapeutic can be used to form libraries, wherein each library includes a unique barcode. Demultiplexing is also useful when analyzing different sample preparation methods. The libraries can be pooled, and then the pooled libraries can be clonally amplified and sequenced together.
- the barcodes are then used to demultiplex the sequences, that is, to assign the sequences to a specific library. Each demultiplexed raw sequence can then be further analyzed. Demultiplexing allows for in silico linkage analysis using titrated (low copy) samples each with unique barcodes.
- the method further includes administering the sequenced virus-derived therapeutic to a subject, if the determined viral sequence is not contraindicated (e.g., if no mutations are detected that would lead of a toxic phenotype).
- the virus-derived therapeutic would not be administered.
- the virus-derived therapeutic would not be administered, but if the following mutations were not detected in a poliovirus, the virus -derived therapeutic could be administered:
- type 3 poliovirus vaccine the mutation of U to C at base position 472 in the viral RNA 5' NCR; for Type 1 and 2 oral polio vaccine a mutations within the 5' NCR which revert rapidly when passaged in the human gut or in cell culture (such as Type 1 base positions 480 G ⁇ A and 525 U ⁇ C and Type 2 base position 481 A ⁇ G discrete region of stem loop domain 5), and for PV Sabin vaccine strains and of PVSRIPO a mutation in an IRES region that would lead to reversal of the neuro-attenuated phenotype.
- PVS-RIPO at the present time, there are no known HRV-2 IRES mutations that lead to pathogenic or neurotoxic phenotypes. Therefore, in some examples if PVSRIPO is the virus-derived therapeutic, the entire PVSRIPO genome is reviewed, including: UTRs, IRES, and polyprotein CDS regions of the virus.
- the virus-derived therapeutic analyzed using the methods provided herein to identify the presence of one or more sequence variants can be a virus, a viral plasmid template (such as one that is part of a vector and includes a template sequence of the virus), or a vaccine containing a virus.
- the virus-derived therapeutic can include plasmid DNA (e.g., a bacterial plasmid) containing a template sequence of the virus to be sequenced.
- plasmid DNA template for a virus can be used for the production of native or recombinant viruses in a host cell.
- the virus-derived therapeutic is a non-naturally occurring RNA-based virus (e.g., non-naturally occurring poliovirus).
- Non-naturally occurring viruses may differ from naturally occurring viruses in varying degrees.
- Non-naturally occurring viruses can be derived from naturally occurring viruses artificially produced ("engineered"), for example, by recombinant techniques, in which case the non-naturally occurring viruses can be referred to as "recombinant.”
- One example of non-naturally occurring viruses is pathogenic viruses that are modified, by genetic manipulation or other processes, such as selection or chemical modification, to reduce or destroy their pathogenicity. This process or, respectively, the resulting modified virus can be termed "attenuation,” “attenuated” or by other related terms.
- Exemplary non-naturally occurring viruses include, but are not limited to, viral vectors, oncolytic viruses and attenuated or recombinant viruses used as vaccines.
- Oncolytic viruses are viruses that are used to selectively infect and/or destroy, cancer cells.
- Viral vectors are viruses that are used to deliver genetic material into cells, either in vivo or in vitro (in cell culture) for various applications.
- viral vectors can be used for genetic modification, gene therapy, for protein expression or as viral vaccines.
- Viral vaccines are used to deliver genetic material into cells or organisms with the goal of triggering protective or therapeutic immune response.
- live attenuated viruses can be used as vaccines to trigger immune response against naturally occurring pathogenic versions of the same viruses (such as poliovirus, rubella virus, measles virus, etc.).
- the terms oncolytic viruses, viral vectors and viral vaccines sometimes overlap in meaning, but all of them can be artificially created, for example, by genetic modification of naturally occurring viruses using recombinant engineering techniques.
- Oncolytic viruses can be based on, but are not limited to, enterovirus, herpes virus (such as herpes simplex virus), vesicular stomatitis virus, poliovirus, reovirus, Seneca virus or vaccinia virus.
- Viral vectors include, but are not limited to, retroviral vectors, such as lentiviral vectors and vectors based on Moloney murine leukemia virus, adenoviral vectors and vectors based on adeno-associated viruses.
- Viral vaccines include, but are not limited to, influenza vaccines, measles vaccine strains, mumps vaccine, rubella vaccine, varicella (chicken pox) vaccine, smallpox vaccine, human papilloma virus vaccines, HIV and HTLV vaccines, hemorrhagic fever vaccines or any live, attenuated or inactivated viral vaccine.
- the virus-derived therapeutic sequenced by the disclosed methods is a recombinant poliovirus, such as an oncolytic attenuated recombinant poliovirus exemplified by
- PVS-RIPO is an attenuated form of the Sabin Type I poliovirus created by exchanging the cognate internal ribosomal entry site (IRES) of poliovirus with its counterpart from human rhinovirus type 2 (HRV 2) to yield a poliovirus strain that does not replicate in normal neuronal cells, but which exhibits oncolytic activity against brain tumor cells.
- IRS internal ribosomal entry site
- HRV 2 human rhinovirus type 2
- the poliovirus Upon intratumoral administration of recombinant oncolytic poliovirus PVS-RIPO, the poliovirus is selectively taken up by and replicates in tumor cells expressing CD 155 (poliovirus receptor, PVR or NECL5) eventually causing tumor cell lysis.
- CD 155 an oncofetal cell adhesion molecule and tumor antigen, is ectopically expressed in certain cancers, such as glioblastoma multiforme (GMB). Due to the heterologous HRV2 IRES in this recombinant virus, PVS-RIPO only propagates in susceptible, nonneuronal cells (e.g., GBM). PVS-RIPO and its properties and applications are described, for example, in Goetz et al., Cytokine Growth Factor Rev. 2010 21(2-3): 197-20, Yang et al. , J. Virol. Methods. 2009 155(l):44-54, Cello et al, J. Med. Virol. 2008 80(2):352-9, and Dobrikova et al, Molecular Therapy 2008 16(11):1865-1872.
- GBM glioblastoma multiforme
- the virus-derived therapeutic sequenced by the disclosed methods is the attenuated Sabin poliovirus (e.g., type 1, type 2 and/or type 3 poliovirus with the appropriate mutations).
- the virus-derived therapeutic sequenced by the disclosed methods is one used in the inactivated polio vaccine (e.g., type 1, type 2 and/or type 3 poliovirus), which can be chemically inactivated (e.g., with formalin) following its analysis using the disclosed methods (e.g., prior to administration to a subject).
- the virus-derived therapeutic sequenced by the disclosed methods is an encapsulated icosahedral RNA virus (e.g., one with a protein-based capsid), wherein the presence of the capsid protects the RNA from a DNase.
- viruses include, but are not limited to, polio virus (such as those described above), rubella virus, alphavirus, hepatitis C virus, Parvovirus (B 19 for example), other enteroviruses, etc.
- the virus-derived therapeutic sequenced by the disclosed methods is a single or double stranded a encapsulated DNA virus (e.g., one with a protein-based capsid), wherein the presence of the capsid protects the DNA from a DNase or other nuclease.
- encapsulated DNA virus e.g., one with a protein-based capsid
- examples of such viruses include, but are not limited to, adenovirus, hepatitis B virus, varicella-zoster virus, cytomegalovirus, Epstein-Barr virus, or herpes simplex virus (HSV).
- the virus-derived therapeutic sequenced by the disclosed methods is or is derived from a measles virus, hepatitis A virus, hepatitis C virus, mumps virus, influenza virus, rubella virus, human immune deficiency virus (HIV), or human T-lymphotropic virus (HTLV).
- a measles virus hepatitis A virus, hepatitis C virus, mumps virus, influenza virus, rubella virus, human immune deficiency virus (HIV), or human T-lymphotropic virus (HTLV).
- the virus-derived therapeutic is a viral template plasmid.
- the viral template plasmid includes a DNA template for an RNA virus, such as a polio virus (e.g., template for PVS-RIPO, inactivated polio virus (IPV), attenuated polio virus (i.e., Sabin vaccine).
- a polio virus e.g., template for PVS-RIPO, inactivated polio virus (IPV), attenuated polio virus (i.e., Sabin vaccine).
- the viral template plasmid includes a DNA template for a positive-strand RNA virus, such as a Picornavirus (such as Aphthoviridae [for example foot-and-mouth-disease virus (FMDV)], Hepatitis A, or polio), Cardioviridae; Enteroviridae (e.g., Coxsackie viruses, Echoviruses, Enteroviruses, and Polio viruses); Rhinoviridae (rhinoviruses, such as rhinovirus A, B or C)); Togavirus (e.g., rubella; alphaviruses (such as Western equine encephalitis virus, Eastern equine encephalitis virus, and Venezuelan equine encephalitis virus)); Flavivirus (e.g., Dengue virus, Zika virus, West Nile virus, hepatitis C virus, and Japanese encephalitis virus); and
- a positive-strand RNA virus such as a Picornavirus (such as Aphth
- the viral template plasmid includes a DNA template for a negative-strand RNA virus, such as an
- Orthomyxyovirus such as influenza, such as influenza A or B
- Rhabdovirus such as Rabies
- Filoviridae such as Ebola
- Paramyxovirus such as measles virus, respiratory syncytial virus, and parainfluenza viruses
- the viral template plasmid includes a DNA virus sequence, such as one from a Herpesvirus (such as Varicella-zoster virus, for example the Oka strain; cytomegalovirus; and Herpes simplex virus (HSV) types 1 and 2), adenovirus (such as adenovirus type 1, type 14, type 5, type 40, or type 41), Poxvirus (such as Vaccinia virus), Hepatitis B virus, and Parvovirus (such as Parvovirus B 19).
- a Herpesvirus such as Varicella-zoster virus, for example the Oka strain; cytomegalovirus; and Herpes simplex virus (HSV) types 1 and 2
- adenovirus such as adenovirus type 1, type 14, type 5, type 40, or type 41
- Poxvirus such as Vaccinia virus
- Hepatitis B virus such as Parvovirus B 19
- the viral template plasmid includes a DNA or RNA template for a retrovirus, such as human immunodeficiency virus type 1 (HIV-1), such as subtype C, HIV-2; equine infectious anemia virus; feline immunodeficiency virus (FIV); feline leukemia viruses (FeLV); simian immunodeficiency virus (SIV); and avian sarcoma virus.
- HIV-1 human immunodeficiency virus type 1
- HIV-2 equine infectious anemia virus
- feline immunodeficiency virus (FIV) feline leukemia viruses
- FeLV feline leukemia viruses
- SIV simian immunodeficiency virus
- next-generation sequencing technologies are known.
- the current disclosure is not restricted to a particular NGS method.
- pyrosequencing is a sequencing by synthesis technique that relies on the detection of pyrophosphate release upon nucleotide incorporation, rather than chain termination with dideoxynucleotides.
- Pyrosequencing methods such as those commercialized by Biotage (for low throughput sequencing) and 454® Life Sciences (for high-throughput sequencing), can be used.
- sequencing library amplicons are sequenced using an Illumina® (e.g., HiSeq), Ion Torrent®, Helicos®, PacBio®, Solid® (Applied Vioasystems) or other commercial sequencing system.
- Illumina® e.g., HiSeq
- Ion Torrent® e.g., HiSeq
- Helicos® e.g., Helicos®
- PacBio® e.g., PacBio®
- Solid® Applied Vioasystems
- the Illumina® sequencing by synthesis technology is based on reversible dye-terminators. DNA molecules are first attached to primers on a surface and amplified so that local clonal colonies are formed (bridge amplification). Four types of reversible terminator bases (RT-bases) are added, and non-incorporated nucleotides are washed away. Unlike pyrosequencing, the DNA can only be extended one nucleotide at a time. A camera takes images of the fluorescently labeled nucleotides, then the dye along with the terminal 3' blocker is chemically removed from the DNA, allowing the next cycle.
- RT-bases reversible terminator bases
- the Ion Torrent PGMTM system is an ion-based sequencing system that sequences nucleic acid templates by detecting hydrogen ions produced as a byproduct of nucleotide incorporation.
- the ion sensor comprises a field effect transistor (FET) coupled to an ion-sensitive detection layer that can sense the presence of H + ions or changes in solution pH.
- FET field effect transistor
- the ion sensor provides output signals indicative of nucleotide incorporation which can be represented as voltage changes whose magnitude correlates with the H + ion concentration in a respective well or reaction chamber.
- nucleotide types are flowed serially into the reaction chamber, and are incorporated by the polymerase into an extending primer (or polymerization site) in an order determined by the sequence of the template.
- Each nucleotide incorporation is accompanied by the release of H + ions in the reaction well, along with a concomitant change in the localized pH.
- the release of H + ions is registered by the FET of the sensor, which produces signals indicating the occurrence of the nucleotide incorporation.
- Nucleotides that are not incorporated during a particular nucleotide flow will not produce signals.
- the amplitude of the signals from the FET may also be correlated with the number of nucleotides of a particular type incorporated into the extending nucleic acid molecule thereby permitting homopolymer regions to be resolved. Further details regarding the
- compositions, design and operation of the Ion Torrent PGMTM sequencer can be found in U.S. Patent Publication Nos. 2009/0026082; 2010/0137143; and 2010/0282617, all of which
- WO 06/084132 A2 is based on the attachment of PCR amplified fragments of template nucleic acids via universal adapter sequences to magnetic beads and subsequent detection of the fragment sequences via ligation of labeled probes to primers hybridized to the adapter sequences.
- a set of four fluorescently labeled di-base probes are used for the readout. After read- out, parts of the probes are cleaved and new cycles of ligation, detection and cleavage are performed. Due to the use of di-base probes, two rounds of sequencing have to be performed for each template sequence.
- PacBio RS is a single molecule real time sequencing (SMRT) platform based on the properties of zero-mode waveguides.
- a single DNA polymerase enzyme is affixed at the bottom of a ZMW with a single molecule of DNA as a template.
- the ZMW is a structure that creates an illuminated observation volume that is small enough to observe only a single nucleotide of DNA being incorporated by DNA polymerase.
- Each of the four DNA nucleotides is attached to one of four different fluorescent dyes.
- the fluorescent tag is cleaved off and diffuses out of the observation area of the ZMW where its fluorescence is no longer observable.
- a detector detects the fluorescent signal of the nucleotide incorporation, and the base call is made according to the corresponding fluorescence of the dye.
- Helicos HeliscopeTM technology fragments are captured by polyT oligomers tethered to an array.
- polymerase polymerase
- single fluorescently labeled nucleotides are added and the array is imaged.
- the fluorescent tag is subsequently removed and the cycle is repeated.
- Genomic RNA is isolated from all test samples using the QIAamp® Viral RNA Mini Kit from Qiagen as per a modified version of the Qiagen protocol. Briefly, 560 ⁇ of Buffer AVL (Viral Lysis Buffer "A" - chaotropic detergent solution) without carrier RNA is added to 140 ⁇ of the sample. The sample is vortexed and incubated at room temperature (23° + 2°C) for 10 minutes. 560 ⁇ of 100% ethanol is added to the sample, vortexed, and then half the sample (approximately 630 ⁇ ) is added to the QIAamp® Mini column and centrifuged for 1 minute at 6000 x g.
- Buffer AVL Virtual Lysis Buffer "A" - chaotropic detergent solution
- RNA is quantitated spectrophotometrically using a NanoDropTM 8000 spectrophotometer. The RNA is then used to make cDNA using the ThermoScriptTM RT-PCR System from Life Technologies. Briefly, 9 ⁇ of RNA, 1 ⁇ of oligo (dT)2o primer, and dNTPs are incubated at 65 °C for five minutes.
- cDNA synthesis buffer, DTT, RNaseOUTTM, and ThermoScriptTM RT are added to the sample and the sample is incubated at 50°C for 45 minutes, then 85 °C for five minutes to terminate the reaction.
- RNase H is added to the sample and incubated at 37°C for 20 minutes.
- the cDNA is quantitated spectrophotometrically using a NanoDropTM 8000 spectrophotometer.
- a second strand reaction is then performed using the NEB NextTM Second Strand Synthesis Kit from New England BioLabs using 5 ⁇ of the cDNA product.
- the cDNA is combined with second strand synthesis buffer and second strand synthesis enzyme mix and incubated at 16°C for 2.5 hours.
- the product is purified using the QIAquick® PCR purification kit from Qiagen and eluted in 30 ⁇ of nuclease-free water.
- the dscDNA is quantitated spectrophotometrically using a NanoDropTM 8000 spectrophotometer and stored at -20 + 4°C for short-term storage.
- the prepared dscDNA is used to prepare libraries for sequencing on the Illumina® HiSeq® 2500.
- One library is prepared from each original sample.
- the libraries are prepared using the Nextera® XT library preparation kit from Illumina®.
- the starting total input of dscDNA is 1 ng for each library based on prior development range finding efforts using between 1 pg and 1 ng of input dscDNA.
- the libraries are prepared following the Illumina® Nextera® XT library preparation protocol. Briefly, each sample is fragmented enzymatically and tagged (ligated) with adapter sequences simultaneously using the Nextera® Tagmentation chemistry. The process fragments the input DNA and adds adapter sequences to the ends of the fragments for use in downstream processing.
- the ligation enzyme is then neutralized and a brief, 12 cycle amplification is performed to add barcodes on to each sample at the 5'- and 3 '-ends.
- Each library can be assigned a different barcode to identify and delineate different samples during analysis.
- the PCR reactions are cleaned up using a double round of AMPure® XP bead washes and then eluted in TE buffer.
- Each of the libraries is then analyzed on the Agilent Bioanalyzer using high sensitivity DNA chips to assess for quality and quantity of the libraries.
- the sample libraries are stored at -20 + 4°C for short-term storage.
- Illumina® DNA Sequencing and Analysis For each sample, one Rapid flow cell is run on the Illumina® HiSeq® 2500. For each flow cell, the library is denatured and diluted for on- instrument clustering. Paired end 2x150 bp sequencing is then performed on each of the libraries using Illumina® SBS sequencing technology and reagents. The resulting data is de-multiplexed using the Illumina® HiSeq® software and then analyzed. Each flow cell is run using a single sample. FastQ files are generated for all sequenced fractions. Overall flow of data analysis process is described in FIG. 1. Samtools and mpileup software are used to convert the output files from a SAM to BAM format and index output files for viewing in the Integrated Genome Viewer.
- Mpileup is used with a flag to increase the depth of each position in order to examine coverages of the virus and look for potential variations.
- Variants are defined according to the following criteria: if sequencing depth at a given base position is equal to or exceeds 4,096,000, potential variations are called at greater than 0.1%; if depth is less than 4,096,000 but greater than 4096, variants exceeding a frequency of 4096 or greater are called; if the depth of coverage at a given base position is less than 4096 reads, potential variants are called if the consist of greater than 1.0%.
- the minimum read coverage per base position is set at 4X (regulatory minimum), before additional sequencing efforts (Illumina® or Sanger) would be required.
- Reads are aligned for each sample to the PVS-RIPO reference sequence using Bowtie (short read reference aligner).
- the values for the total number of bases, the coverage, and the mean read length and the percent of reads aligned to the reference for each sample are calculated and compared to pre-established specifications for assay validity.
- the estimated coverage is found by taking the total sequenced bases and dividing by the size of the PVS-RIPO reference sequence (7303 base pairs). Plots of coverage compared to location across the reference for each sample are prepared, as well as plots of sample read length for each sample. Analysis is performed to examine variants in each sample when compared to the reference sequence. Elevated levels of
- Non-aligned read sequences can be analyzed by NCBI BLASTn to determine their identity; it is expected that non-aligned reads, especially those from unpurified viral samples, will be from Vero host cell genomic or mitochondrial DNA sequences, although human DNA or other laboratory contaminant DNA sequences may be observed as well.
- Viral RNA is extracted from each of the test samples using the Qiagen QIAamp® Viral RNA mini extraction kit without the addition of carrier RNA. An aliquot of each sample is used for the extraction. Since the majority (by copy number and mass) of nucleic acids in unpurified viral samples are host cell genomic and mitochondrial DNA, an additional purification step is necessary to remove these interfering molecules. A DNase digestion of free DNA in the sample is used which permits the viral RNA to be unaffected. An aliquot of the extracted RNA from the master viral bank sample is subsequently DNase treated using the Turbo DNase-freeTM kit from Life Technologies.
- the sample is treated with 2 ⁇ of the Turbo DNase, incubated at 37°C for 30 minutes, and then inactivated with the DNase inactivation reagent.
- the resulting enriched viral RNA is quantitated using the Leidos/BDP-QC "POIPR" RT-qPCR assay.
- the RNA is then used as the input for reverse transcription and second strand synthesis using the SMARTer® UltraTM Low Input RNA Preparation Kit from Clontech Laboratories.
- a first strand synthesis is performed using the SMARTer® IIA CDS and Oligonucleotide primers at 42°C for 90 minutes.
- the SMARTer IIA Oligo improves the recovery of full-length poly-adenylated
- PVSRIPO RNA (and contaminating Vero mRNA) sequences through the use of the 5' terminal transferase activity of SMARTScribe RT with the SMARTer IIA Oligo which prevents tagging of cDNA generated from stalled RT procession events.
- the resulting full-length cDNA is then amplified by long distance PCR using the oligo-dT and SMART primers introduced in the cDNA preparation.
- the sample is then polished to remove primers and dNTPs using AMPure beads and quantitated on a Qubit 2.0 Fluorometer or NanoDrop 8000 spectrophometer and validated for size on the Agilent 2100 Bioanalyzer using a DNA chip.
- a quantitative PCR reaction targeting the HRV-2 IRES or the 5' end of the polio polyprotein CDS sequence can be used to determine the target copy number prior to sequencing.
- the dscDNA from the two different preparations is used as the template for library preparation; the Nextera® XT Library Preparation Kit from Illumina® is used. One nanogram of each dscDNA sample will be used to prepare each library.
- the Nextera® kit uses "tagmentation" technology, where the input is fragmented and tagged with adapters in one single incubation step. The ligation enzyme is then neutralized and each sample is barcoded through a short, 12 cycle amplification, and then purified using AMPure® XP beads. Following purification, the quantity and quality of each library is assessed using Agilent 2100 Bioanalyzer High Sensitivity DNA chips.
- Illumina® Sequencing The libraries are then be used for sequencing on the Illumina® HiSeq® 2500 instrument.
- the instrument is used in Rapid Run mode and each library is sequenced on one Rapid Run Flow Cell.
- the libraries are denatured and diluted, and then the on-board clustering capabilities of the instrument are used for cluster formation.
- the libraries are sequenced using 2x100 bp paired end sequencing. The resulting sequence must obtain a minimum of 4X coverage across all bases or additional Sanger sequencing will be performed to complete the coverage across those regions, this is expected to occur at the 5' of the virus where RT exhaustion occurs due to strong RNA structure in the viral IRES domains.
- Illumina® sequence analysis procedures follow those for purified viral samples detailed above and in FIG. 1. A report detailing consensus homology to the PVSRIPO reference sequence, coverage per base position, and heterogeneous bases at > 0.1 % of reads or > 4096 reads as applicable is generated.
- Illumina® methodology Sanger Sequencing will be employed. If the portion of the genome lacking appropriate coverage is near the 5' end of the genome, several gap filling techniques may be used including alternative NGS methods such as Roche/454 FLX and/or alternative pre- amplification methods such 'linear amplification' of the PVS-RIPO cDNA using only reverse primers to prevent primer masking of the 5' sequence variability..
- alternative NGS methods such as Roche/454 FLX
- alternative pre- amplification methods such 'linear amplification' of the PVS-RIPO cDNA using only reverse primers to prevent primer masking of the 5' sequence variability.
- a high-cycle number of linear (non-exponential) PCR is employed to prevent over-writing the native PVS-RIPO viral sequence with primer sequence, especially at the under-represented (low copy dscDNA) and hyper- variable 5' end of the PVS-RIPO virus.
- Extracted RNA must be a minimum of 5 nanograms total per sample.
- Resultant cDNA must be a minimum of 2 nanograms total per sample for use in the second strand reaction.
- sequence acceptance criteria include:
- Average coverage of the reference viral sequence is > 18,000X.
- Each base must be covered at 4X or greater. This can be from Illumina® alone, a combination of Illumina® and Sanger sequencing.
- RNA Extraction and Reverse Transcription Following an approved procedure, 250 ⁇ of test sample is added to 1120 ⁇ Qiagen buffer AVL/Carrier RNA, vortexed, and incubated at room temperature for 10 minutes. Half of the sample + buffer AVL (685 ⁇ ) is transferred to a second micro-centrifuge tube, and 560 ⁇ of ethanol (96-100%) is added to each tube, mixed by pulse-vortexing for 15 seconds, and briefly centrifuged. The solution is then added to a QIAamp spin column, washed with appropriate wash buffers, and eluted in 60 ⁇ , Buffer AVE. The viral RNA is quantitated using a spectrophotometer per an approved procedure.
- RNA is then stored at ⁇ -65°C until use.
- PCR Amplification and Sequencing Primer Selection The synthetic oligonucleotides used for PCR amplification and Sanger sequence analysis of test articles are derived from the PVSRIPO reference sequence (see Table 2).
- the primers are designed to anneal approximately 250 bases apart, have an approximate 50% GC content, and be between 18-24 bp in length.
- Primer sites are designed such that when both strands of cDNA are sequenced, four or more reads will be generated per base pair (two from each strand) based on the expected read lengths from each primer extension.
- Table 2 Representative oligonucleotide primers used for Sanger sequencing of PVSRIPO.
- RTPCR1 R51 TTTTTATCAGGACATCCTTGATGGGC 42
- PVSRIPO RNA is reverse transcribed (RT) and PCR amplified in -1200 base sections using a Superscript III RT-PCR kit. Approximately 0.1 micrograms of extracted viral RNA is combined with 25 ⁇ of 2X reaction mix, and 10 pmoles each of forward and reverse primer and brought to a 50 ⁇ final volume with nuclease free water. Amplicons are purified using a QIAquick PCR Cleanup Column per an approved procedure. To verify that an amplicon of expected size is present following PCR, an aliquot of each PCR reaction is analyzed by agarose gel electrophoresis and stained with ethidium bromide for imaging. Successful PCR reactions are subsequently stored at -18+2°C until further use.
- Fluorescent dye- terminator DNA cycle sequencing of the test article samples and a pGEM3Z control plasmid is carried out using the ABI BigDye vl.l Sequencing Kit per an approved procedure. 2.0 ⁇ of 5x BigDye Sequencing Buffer is combined with 2.0 ⁇ Ready Reaction Premix, 2 ⁇ 1 of 2 ⁇ sequencing primer, 20ng of purified PCR product and purified water to a final reaction volume of 10 ⁇ .
- pGEM3Z control reactions For the pGEM3Z control reactions that serve as the reaction and instrument controls, 200 ng of pGEM3Z are sequenced with 20 ng (approximately 3.2 pmol) of the M13F-20 positive control primer (5' GTAAAACGACGGCCAGT-3' ; SEQ ID NO: 79). Control reactions are performed with each sequencing set-up (i.e., plate) and analyzed on the AB 13130x1 per an approved procedure. Cycle sequencing reactions were performed using a PTC-225 Peltier thermal cycler per an approved procedure. Before analysis, sequencing reactions are purified from unincorporated dye terminators, salts, and low molecular weight compounds using Centriflex Gel Filtration Cartridges.
- Automated DNA sequence analysis is carried out using an ABI3130xl DNA sequencer following an approved procedure.
- fluorescent sequence data is gathered from each channel of the 3130x1 by the sequencing computer and analyzed.
- the raw sequence run data is trimmed and aligned into a contiguous arrangement of sequences, also known as a "contig” using Sequencher software (GeneCodes, Ann Arbor, MI), per an approved procedure.
- Sequencher software GeneCodes, Ann Arbor, MI
- the contig for each sample is then aligned with the PVSRIPO reference sequence and searches for base changes, indels, gaps, and ambiguities (polymorphic) sites are conducted manually with automated assistance from ABI software, Sequencher, BioEdit,
- Sequencing Acceptance Criteria for Sanger-based methods The pGEM3Z positive control sequencing reactions run on each sequencing plate must generate at least 500 base length of read (LOR) and have a quality value (QV) > 20 for the first 500 bp of the sequence read as determined by the Applied Biosystems (ABI 3130x1) analysis report. Overall sequencing quality of the plasmid controls must be greater than 90%.
- Genomic RNA was isolated from all test samples using the QIAamp® Viral RNA Mini Kit from Qiagen as per a modified version of AIB SOP MOLBIO00050. Briefly, 560 ⁇ of Buffer AVL without carrier RNA was added to 140 ⁇ of the sample. The sample was vortexed and incubated at room temperature (23° ⁇ 2°C) for 10 minutes. 560 ⁇ of 100% ethanol was added to the sample, vortexed, and then half the sample (approximately 630 ⁇ ) was added to the QIAamp® Mini column and centrifuged for 1 minute at 6000 x g. The rest of the sample was added to the column and the spin step was repeated.
- the cDNA was quantitated spectrophotometrically using a NanoDropTM 8000 spectrophotometer as per AIB SOP MOLBIO00077. A second strand reaction was then performed using the NEBNextTM Second Strand Synthesis Kit from New England BioLabs using 100 total nanograms of the cDNA product. The cDNA was combined with second strand synthesis buffer and second strand synthesis enzyme mix and incubated at 16°C for 2.5 hours. The product was purified using the QIAquick® PCR purification kit from Qiagen and eluted in 30 ⁇ of nuclease- free water. The dscDNA was quantitated spectrophotometrically using a
- the prepared dscDNA was used to prepare libraries for sequencing on the Illumina® HiSeq® 2500. A total of eleven libraries were prepared from each original sample. The libraries were prepared using the Nextera® XT library preparation kit from Illumina®. The starting total input of dscDNA differed for each library prepared and were as follows: library 1- 1000 pg, library 2- 750 pg, library 3- 500 pg, library 4- 250 pg, library 5- 100 pg, library 6- 75 pg, library 7- 50 pg, library 8- 25 pg, library 9- 10 pg, library 10- 5 pg, library 11- 1 pg.
- the dscDNA was diluted to the varying input amounts based on the quantitation from the NanoDropTM 8000 spectrophotometer.
- the libraries were prepared following the Illumina® Nextera® XT library preparation protocol. Briefly, each sample was tagged and fragmented enzymatically simultaneously using the Nextera®
- Tagmentation chemistry The process fragments the input DNA and adds adapter sequences to the ends of the fragments for use in downstream processing. A brief, 12 cycle amplification was then performed to add barcodes on to each sample. Each dilution was assigned a different barcode to separate out the different samples during analysis.
- the PCRs were cleaned up using a double round of AMPure® XP bead washes and then eluted in TE buffer. Each of the libraries was then analyzed on the Agilent Bioanalyzer to assess for quality and quantity of the libraries. The libraries were stored at -20 ⁇ 4oC for short-term storage.
- Next Generation DNA Sequence Analysis For each original sample, two flow cells were run on the Illumina® HiSeq® 2500. The first flow cell consisted of one single library- the highest input library (library 1). The second flow cell had all 11 libraries combined at equimolar concentrations. For each flow cell, the library or library pool was denatured and diluted for on-instrument clustering.
- Paired end 2x150 bp sequencing was then performed on each of the libraries using Illumina® SBS sequencing technology and reagents. When applicable, resulting data was de-multiplexed using the Illumina® HiSeq® software and then analyzed. Reads were aligned to the supplied reference genome sequence PVS-RIPO (SEQ ID NO. 1). FastQ files were generated for all sequenced fractions and will be supplied on a drive and mailed. FastQ files from the two lanes were combined into a single data set and analyzed as one sample. Overall flow of data analysis process is described in FIG. 1. Samtools and mpileup were used to convert the output files from a SAM to BAM format and index output files for viewing in the Integrated Genome Viewer.
- Mpileup was used with a flag to increase the depth of each position in order to examine coverages of the virus and look for potential variations. Variants were defined according to the following criteria; if sequencing depth at a given position is equal to or exceeded 4,096,000 potential variations were called at greater than 0.1%; if depth is less than 4,096,000 and greater than 4096 variants exceeding a frequency of 4096 or greater are called; if depth of coverage is less than 4096, potential variants are called that are greater than 1.0%. The minimum read coverage was set at 4X. If a position had coverage less than the minimum, no data was reported for that position.
- Table 4 Read length statistics for each dilution library.
- aligned reads i.e. , reads that contain viral sequence vs. 'junk'/random and host cell DNA sequences
- peak at -500-1000 pg ds-cDNA input and there is no apparent effect above -25 pg input on read lengths.
- a sample read length plot is shown in FIG. 3.
- the average read length is approximately 100 base pairs. Approximate coverage was calculated for the entire virus using the following equation.
- Table 5 Estimated coverage of the PVSRIPO genome for each dilution library based on read length and number of reads ilution Estimated Coverage
- Prior Sanger sequencing methods utilized PCR pre-amplification and sequencing primers derived from the theoretical viral sequence and which directly targeted viral cDNA sequences.
- the use of generously overlapping sequencing reads creates a strong bias in favor of the primer sequences used, effectively preventing recovery of any heterologous bases at the priming positions.
- This biasing effect is especially egregious at the extreme ends of the viral cDNA where overlapping reads are limited to a single direction. This effect leads to the inability to recover the extreme 3 '-end of the viral sequence containing the polyadenylation signal, even when oligo dT priming is used for reverse transcription (RT).
- RNA extraction recovery and volumetric ratios of subsequent cDNA synthesis and sequencing steps assuming 100% of the total RNA input mass consists of PVSRIPO viral RNA.
- 3 MVB lots are not column purified and have a larger percentage of host cell nucleic acids, impacting viral RNA extraction yields.
- RNA extraction and cDNA synthesis methodologies are similar but not identical to those used with later GLP studies.
- a small fraction of the non-aligned reads represent extreme viral 3 ' end sequences missing from the reference and may potentially contain even rarer (and so far unobserved) viral sequences that may harbor 'large' (>10 nt) indels that do not readily align to the PVSRIPO reference sequence.
- Table 9 Summary of Illumina read depths, read lengths, reference sequence alignment scores, and variant position ratios for seven lots of PVSRIPO.
- the polymorphism 'call' threshold is set to >0.1%; for read depths ⁇ 4096, the threshold is set to > 1.0%.
- RNA extraction and cDNA synthesis methodologies are similar but not identical to those used with later GLP studies and have attendant higher error rates.
- a larger number of polymorphic base positions are observed for lots with greater read depths and especially for the two lots used with the Illumina method. Not including the two method development lots (L0403006 and L0603006), the number of called variant base positions ranges between 27 and 331 in the remaining five lots tested.
- the 5' end hyper- variable region of the PVSRIPO (and polio) genome lies within positions 1 through 34; as expected, and despite (or perhaps because of) the low read depths, this is the region of the viral genome that exhibits the highest frequency of base variants and polymorphisms as detailed in Table 10. Table 10 also breaks down the number of polymorphic and variant base positions in each major region of the PVSRIPO genome, with the majority occurring in the polio polyprotein coding sequence - the largest element within the viral genome.
- Table 10 Comparison of sequence variant frequencies and locations (base positions) in seven lots of PVSRIPO using Illumina deep sequencing.
- the most critical region for changes in intra-cellular viral tropism and pathogenicity are the IRES domains V and VI which mediate binding and assembly of the eIF4G-rbosomal complex.
- This region of PVSRIPO only a single polymorphism (at position 618) was observed in four of the seven lots analyzed (Table 11). Three of the lots were not found to be polymorphic at position 618 as the canonical guanine consisted of >99.9% of all reads; while for the remaining four lots, >97% of all reads at position 618 were guanine.
- the four lots exhibiting polymorphism at position 618 have the identical substitution pattern (G»T>A>C).
- Polymorphism at position 618 was not observed in the parental MVB lot (L0403006) or in the L0904010 clinical lot despite the observation of polymorphism at 618 in four lots derived from the MVB. Whether this conversion represents a true sequence mutation at position 618 during viral expansion in manufacturing or is a preferential site for polymerase substitution during the sequencing process cannot be immediately determined, although the frequency is sufficiently high (up to 2.6%) to suggest the former.
- PVSRIPO lot which exhibited the greatest substitution (-2.6%) at position 618 was the non-clinical toxicology lot L0603006. This lot was used with prior in vivo animal and xenographic studies that demonstrated the non-pathogenic phenotype and stable genotype of PVSRIPO. As detailed in Table 11, only a total of 5 sequence variation sites were observed in more than one lot of PVSRIPO and only two of these are found in the MVB lots. All of the five positions are located in the 5' UTR IRES at positions: 35, 60, 80, 340, and 618. The preferred substitution patterns of the 5 sites are also conserved, most critically between the two polymorphic sites (positions 35 and 60) present in the independently generated Master Viral Banks. Table 11: All five PVSRIPO IRES sequence variants that are observed in more than one lot, including a comparison of polymorphic base substitution patterns where present. Reference sequence cDNA bases are shown the column header for each position.
- 3 PVSRIPO Clinical DP lot L0904010 exhibited no 'above threshold' base polymorphisms within the IRES region of the viral genome (positions 35-622). Reads depths in this region increase in the 3' direction and varied for each lot with depths ranging between ⁇ 2 x 10 2 to ⁇ 8 x 10 5 reads/base position. Refer to the appendixes for additional details for each lot.
- L1405001 and L1402001 consist of the identical purified virus (bulk DS vs. vialed DP) but lot L1402001 only exhibits one of the base polymorphisms observed in L1405001. The primary difference between these two runs was the ⁇ 2-fold increase in read depth achieved with L1405001. The reason for the large discrepancy in %G at positon 35 is unknown, but may be tied to a significant G > A polymorphism present at position 34 and the end of the hyper- variable 5 'UTR region.
- the read depths across the 5' half of the genome containing the IRES are lower than the average due to RT exhaustion and the stronger secondary structure of the IRES domains. Despite these effects on RT efficiency, the read depths still range between 10 3 and 10 5 reads per base position in the IRES domains.
- the two polymorphic positions identified in the 2010 HTB-15 xenograph study were not identified as polymorphic in the Illumina deep sequencing with PVSRIPO, including lot L0603006, suggesting they were the result of de novo base mutations following passaging in the HTB-15 xenographs.
- Position 1824 falls within an internal homopolymeric adenine stretch prone to mutation, but which may also be partially masked by internal Oligo-dT priming during Illumina sample preparation (see below).
- PVSRIPO Illumina read depths decrease rapidly when progressing from the 3' UTR (and the poly- A first strand priming site) to the 5 ' UTR and hyper- variable region at the 5 ' terminus (FIGS. 4 and 6-11). This drop in coverage occurs due to RT stalling, which can be observed as periodic spikes in the coverage depth, and by RT exhaustion when progressing from the 3' first strand priming site.
- PVSRIPO contains an 11 base internal poly-adenine stretch at positions 1822-1833 (with a single intervening guanine at position 1831) acting as an alternative internal oligo-dT priming site for first strand synthesis; albeit at a much lower extension efficiency than the 3' poly-adenine signal.
- the presence of the internal poly-adenine site allows for a ⁇ 3-fold increase in read depths below position 1822, including the key IRES domains.
- PVSRIPO-specific first strand primer sequences can be used to improve read depths and sequence coverage below positions -4000 and -2000 in the viral genome. Due to the rapid decay in read depths near the 5' terminus, especially in the presence of the high host-cell background in the 2013 MVB lot, several other approaches were utilized to verify the viral sequence in this region (positions 1 to -60). Initially ION Torrent and FLX pyrosequencing NGS approaches were tried with minimal improvement in depths below positon -35 in the genome. Ultimately the extreme 5' end (below position 10) could not be recovered in depths >3 reads per base using NGS methods even with linear PCR 'amplification' using a 3' PCR priming site. While the rapid reduction 5' terminal read depths was observed with the purified lots of PVSRIPO, it most severely impacted the lower concentration and higher host cell background MVB lots.
- PVSRIPO-specific first- strand primers targeting a base position below -2000 will allow for improved cDNA copy numbers at the extreme 5' end and greatly improved read depths, obviating the need for supplementary Sanger sequencing approaches with unpurified low concentration viral samples such harvests, seed stocks, and banks.
- Table 8 compares the published replication error rates for wild-type polio as well as the estimated incorporation error rates for the various polymerases used with the deep sequencing of PVSRIPO.
- the estimated error rate of native polio base incorporation is -9 x 10 ⁇ 5 to -9 x 10 ⁇ 6 while the error rate for the two RT approaches with Illumina amplification and sequencing is estimated at ⁇ 5 x 10 "4 , equivalent to 0.05%. Therefore the rate of base incorporation error in the sequencing method is expected to be ⁇ 5 to 55 times more error prone than the native viral replication error rate in infected cells.
- FIGS. 5A-5NN shows the results from PVSRIPO MVB.
- the 7 lots of PVSRIPO virus examined by Illumina deep sequencing exhibited surprisingly limited sequence micro-heterogeneity across the chimeric viral genome with average read depths in excess of 2 x 10 5 per base.
- These five recurrent heterogeneous positions were all located within the HRV2 IRES (positions 35, 60, 80, 340, and 618) and their associated base substitution patterns were observed to be consistent across all of the lots tested.
- PVSRIPO limited variation present in the clinical lots of PVSRIPO is derived from the variation originally present in the parental MVB lot (i.e., positions 35 and 60) or may represent preferred modes of polymerase mis- incorporation during viral replication or cDNA sequencing.
- the plasmid DNA used to generate the MVB via in vitro transcription and transfection may be a third source of the base variation pattern observed in the seven PVSRIPO lots.
- the NGS of PVSRIPO validates prior analytical and neurotoxicity data which indicate PVSRIPO is a surprisingly stable single- stranded RNA virus. Therefore, extensive in vivo non- human primate neurotoxicity studies may not be necessary prior to the use of the second MVB lot of PVSRIPO (Lot L1311002) given the low level of micro-heterogeneity observed and the consistency of its' sequence variation pattern with the earlier clinical lots of PVSRIPO derived from the first MVB manufactured in 2004. Additional sequencing development efforts are either underway (i.e., de novo assemblies for recovery of the 3' UTR sequence) or are warranted to improve the depth of coverage at the key 5' UTR of the viral sequence.
- results provided herein provide a baseline against which future clinical studies can be compared.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2018525528A JP6907202B2 (ja) | 2015-07-31 | 2016-07-29 | ウイルス由来の治療剤を解析する方法 |
| CN201680045182.1A CN108026567B (zh) | 2015-07-31 | 2016-07-29 | 分析病毒来源治疗剂的方法 |
| EP16750580.9A EP3329013B1 (en) | 2015-07-31 | 2016-07-29 | Methods of analyzing virus-derived therapeutics |
| US15/580,299 US10662464B2 (en) | 2015-07-31 | 2016-07-29 | Methods of analyzing virus-derived therapeutics |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562199663P | 2015-07-31 | 2015-07-31 | |
| US62/199,663 | 2015-07-31 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017023782A1 true WO2017023782A1 (en) | 2017-02-09 |
Family
ID=56682276
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/044788 Ceased WO2017023782A1 (en) | 2015-07-31 | 2016-07-29 | Methods of analyzing virus-derived therapeutics |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US10662464B2 (https=) |
| EP (1) | EP3329013B1 (https=) |
| JP (1) | JP6907202B2 (https=) |
| CN (2) | CN114107559A (https=) |
| WO (1) | WO2017023782A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109280700A (zh) * | 2018-09-17 | 2019-01-29 | 上海海洋大学 | 精确测定中华绒螯蟹线粒体全基因组序列的方法 |
| US10954492B2 (en) | 2015-06-10 | 2021-03-23 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Processes for production and purification of nucleic acid-containing compositions |
| CN113722162A (zh) * | 2021-08-17 | 2021-11-30 | 大连海天兴业科技有限公司 | Mvb网卡稳定性测试系统、方法及存储介质 |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923359A (zh) * | 2019-11-29 | 2020-03-27 | 中国食品药品检定研究院 | 检测ⅰ型脊灰减毒活疫苗核酸突变的质谱检测引物组及其方法 |
| EP3892737A1 (en) * | 2020-04-09 | 2021-10-13 | Takeda Vaccines, Inc. | Qualitative and quantitative determination of single virus haplotypes in complex samples |
| EP4157300A4 (en) * | 2020-05-29 | 2024-07-17 | BioHSV Holdings, Inc. | MASS NUCLEIC ACID TEST |
| CN114067907B (zh) * | 2020-07-31 | 2022-07-08 | 普瑞基准生物医药(苏州)有限公司 | 一种准确鉴定rna病毒基因组变异的方法 |
| CN114075596A (zh) * | 2020-08-12 | 2022-02-22 | 深圳华大因源医药科技有限公司 | 一种基于高通量测序技术检测目的微生物基因组rna的方法 |
| CN112646859B (zh) * | 2020-12-30 | 2022-04-26 | 中国人民解放军疾病预防控制中心 | 一种基于宏基因组学的呼吸道咽拭子样本的建库方法和病原检测方法 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009091934A1 (en) * | 2008-01-17 | 2009-07-23 | Sequenom, Inc. | Single molecule nucleic acid sequence analysis processes and compositions |
| WO2014020356A1 (en) * | 2012-08-02 | 2014-02-06 | Ucl Business Plc | Method for quality controlling vaccine |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5728519A (en) * | 1990-11-06 | 1998-03-17 | The United States Of America As Represented By The Department Of Health And Human Services | Assay for virulent revertants of attenuated live vaccines and kits therefor |
| EP0966538A1 (en) * | 1997-08-07 | 1999-12-29 | Altwell Biotech. Inc. | Replication-competent recombinant sabin type 1 strain of poliovirus |
| US8066983B2 (en) * | 2008-03-14 | 2011-11-29 | The Research Foundation Of State University Of New York | Attenuated poliovirus |
| CN104936608A (zh) * | 2012-11-21 | 2015-09-23 | 杜克大学 | 用于人肿瘤的溶瘤脊髓灰质炎病毒 |
| EP3233132A4 (en) * | 2014-12-19 | 2018-06-27 | Modernatx, Inc. | Terminal modifications of polynucleotides |
| US10954492B2 (en) | 2015-06-10 | 2021-03-23 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Processes for production and purification of nucleic acid-containing compositions |
-
2016
- 2016-07-29 CN CN202111246733.XA patent/CN114107559A/zh active Pending
- 2016-07-29 WO PCT/US2016/044788 patent/WO2017023782A1/en not_active Ceased
- 2016-07-29 JP JP2018525528A patent/JP6907202B2/ja active Active
- 2016-07-29 EP EP16750580.9A patent/EP3329013B1/en active Active
- 2016-07-29 US US15/580,299 patent/US10662464B2/en active Active
- 2016-07-29 CN CN201680045182.1A patent/CN108026567B/zh active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009091934A1 (en) * | 2008-01-17 | 2009-07-23 | Sequenom, Inc. | Single molecule nucleic acid sequence analysis processes and compositions |
| WO2014020356A1 (en) * | 2012-08-02 | 2014-02-06 | Ucl Business Plc | Method for quality controlling vaccine |
Non-Patent Citations (8)
| Title |
|---|
| A. NEVEROV ET AL: "Massively parallel sequencing for monitoring genetic consistency and quality control of live viral vaccines", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 107, no. 46, 16 November 2010 (2010-11-16), pages 20063 - 20068, XP055041954, ISSN: 0027-8424, DOI: 10.1073/pnas.1012537107 * |
| ALEXANDER L. GRENINGER ET AL: "A Metagenomic Analysis of Pandemic Influenza A (2009 H1N1) Infection in Patients from North America", PLOS ONE, vol. 5, no. 10, 18 October 2010 (2010-10-18), pages e13381, XP055306315, DOI: 10.1371/journal.pone.0013381 * |
| ANONYMOUS: "DNA-free (TM) Kit DNase Treatment and Removal Reagents", 1 January 2012 (2012-01-01), XP055306154, Retrieved from the Internet <URL:https://tools.thermofisher.com/content/sfs/manuals/cms_055739.pdf> [retrieved on 20160928] * |
| ANONYMOUS: "QIAamp Viral RNA Mini Handbook, Fourth Edition December 2014", 1 December 2014 (2014-12-01), XP055306088, Retrieved from the Internet <URL:https://www.qiagen.com/us/resources/download.aspx?id=c80685c0-4103-49ea-aa72-8989420e3018&lang=en> [retrieved on 20160928] * |
| ANONYMOUS: "Technical Bulletin #176 Avoiding DNA Contamination in RT-PCR", 7 December 2007 (2007-12-07), XP055305978, Retrieved from the Internet <URL:https://www.tamu.edu/faculty/riggs/BIOT602/ambion_dna_contamination.pdf> [retrieved on 20160927] * |
| J. G. VICTORIA ET AL: "Viral Nucleic Acids in Live-Attenuated Vaccines: Detection of Minority Variants and an Adventitious Virus", JOURNAL OF VIROLOGY, vol. 84, no. 12, 15 June 2010 (2010-06-15), pages 6033 - 6040, XP055013810, ISSN: 0022-538X, DOI: 10.1128/JVI.02690-09 * |
| JIM GOMBOLD ET AL: "Lot Release and Characterization Testing of Live-Virus-Based Vaccines and Gene Therapy Products, Part 1", BIOPROCESS INTERNATIONAL, 1 April 2006 (2006-04-01), pages 46 - 54, XP055306580, Retrieved from the Internet <URL:http://www.bioprocessintl.com/wp-content/uploads/bpi-content/4-4_Schenerman_CMCp_103112a.pdf> [retrieved on 20160929] * |
| LUISA BARZON ET AL: "Applications of Next-Generation Sequencing Technologies to Diagnostic Virology", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 12, no. 12, 14 November 2011 (2011-11-14), pages 7861 - 7884, XP055305759, DOI: 10.3390/ijms12117861 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10954492B2 (en) | 2015-06-10 | 2021-03-23 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Processes for production and purification of nucleic acid-containing compositions |
| CN109280700A (zh) * | 2018-09-17 | 2019-01-29 | 上海海洋大学 | 精确测定中华绒螯蟹线粒体全基因组序列的方法 |
| CN109280700B (zh) * | 2018-09-17 | 2022-04-12 | 上海海洋大学 | 精确测定中华绒螯蟹线粒体全基因组序列的方法 |
| CN113722162A (zh) * | 2021-08-17 | 2021-11-30 | 大连海天兴业科技有限公司 | Mvb网卡稳定性测试系统、方法及存储介质 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP6907202B2 (ja) | 2021-07-21 |
| EP3329013B1 (en) | 2020-09-02 |
| CN108026567B (zh) | 2021-10-22 |
| CN114107559A (zh) | 2022-03-01 |
| CN108026567A (zh) | 2018-05-11 |
| US20180237835A1 (en) | 2018-08-23 |
| US10662464B2 (en) | 2020-05-26 |
| EP3329013A1 (en) | 2018-06-06 |
| JP2018527948A (ja) | 2018-09-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10662464B2 (en) | Methods of analyzing virus-derived therapeutics | |
| US20240139309A1 (en) | Variant strain-based coronavirus vaccines | |
| US20240100151A1 (en) | Variant strain-based coronavirus vaccines | |
| JP2024513999A (ja) | インフルエンザ-コロナウイルス組み合わせワクチン | |
| WO2023283651A1 (en) | Pan-human coronavirus vaccines | |
| Haegeman et al. | Investigation of a Possible Link between Vaccination and the 2010 Sheep Pox Epizootic in M orocco | |
| JP7198759B2 (ja) | 弱毒化表現型を有するヒト呼吸器多核体ウイルス(rsv)のためのワクチン候補 | |
| EP3307878B1 (en) | Processes for production and purification of nucleic acid-containing compositions | |
| JP5197362B2 (ja) | デング熱セロタイプ1弱毒株 | |
| Amexis et al. | Sequence diversity of Jeryl Lynn strain of mumps virus: quantitative mutant analysis for vaccine quality control | |
| EP4365312A2 (en) | A method for detecting the presence of a dengue virus serotype in a sample containing at least one dengue virus serotype | |
| Tecle et al. | Molecular characterisation of two mumps virus genotypes circulating during an epidemic in Lithuania from 1998 to 2000 | |
| KR20150110531A (ko) | Ibv, csfv 및 ndv 의 고 해상도 용융 유전자형분석 | |
| Zou et al. | Recombination of host cell mRNA with the Asia 1 foot-and-mouth disease virus genome in cell suspension culture | |
| Kalaycioglu et al. | Molecular characterization of measles viruses in Turkey (2010–2011): First report of genotype D9 involved in an outbreak in 2011 | |
| Pérez et al. | Sequencing of S and N genes of SARS-CoV-2 strains circulating in Cuba during March-September 2020 | |
| Okino et al. | Rapid detection and differentiation of avian infectious bronchitis virus: an application of Mass genotype by melting temperature analysis in RT-qPCR using SYBR Green I | |
| Gouandjika‐Vasilache et al. | Cocirculation of measles virus genotype B2 and B3. 1 in Central African Republic during the 2000 measles epidemic | |
| KR101617142B1 (ko) | 개선된 검출 정확성을 제공해 줄 수 있는 핵산검사 기반의 조류 인플루엔자 바이러스 검출 키트 | |
| Guirao et al. | Phylogeny of canine coronavirus (CCoV) from Brazilian dogs based on membrane protein partial sequences | |
| Grywalski | Towards in silico IBV vaccine design: defining the role of polymorphism in viral attenuation | |
| CN120225693A (zh) | 测定制剂中具有包含至少一个减毒基因座的核苷酸序列的活减毒黄病毒的比例的方法 | |
| CN116144608A (zh) | 病毒培养方法 | |
| Rosseel | Genome sequencing by random priming methods for viral identification | |
| Boussier et al. | Attenuation of RNA viruses by redirecting their evolution in sequence space |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16750580 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15580299 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2018525528 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2016750580 Country of ref document: EP |