WO2016208831A1 - 슈도모나스 속 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법 - Google Patents

슈도모나스 속 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법 Download PDF

Info

Publication number
WO2016208831A1
WO2016208831A1 PCT/KR2015/013227 KR2015013227W WO2016208831A1 WO 2016208831 A1 WO2016208831 A1 WO 2016208831A1 KR 2015013227 W KR2015013227 W KR 2015013227W WO 2016208831 A1 WO2016208831 A1 WO 2016208831A1
Authority
WO
WIPO (PCT)
Prior art keywords
pseudomonas
pla
lpe
pst
lpe18
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2015/013227
Other languages
English (en)
French (fr)
Inventor
유병태
이영표
정지혜
정성희
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority to CN201580081236.5A priority Critical patent/CN107787369B/zh
Publication of WO2016208831A1 publication Critical patent/WO2016208831A1/ko
Priority to US15/852,864 priority patent/US10030256B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/001Amines; Imines
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07FACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00Compounds containing elements of Groups 5 or 15 of the Periodic Table
    • C07F9/02Phosphorus compounds
    • C07F9/06Phosphorus compounds without P—C bonds
    • C07F9/08Esters of oxyacids of phosphorus
    • C07F9/09Esters of phosphoric acids
    • C07F9/10Phosphatides, e.g. lecithin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07FACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00Compounds containing elements of Groups 5 or 15 of the Periodic Table
    • C07F9/02Phosphorus compounds
    • C07F9/06Phosphorus compounds without P—C bonds
    • C07F9/08Esters of oxyacids of phosphorus
    • C07F9/09Esters of phosphoric acids
    • C07F9/10Phosphatides, e.g. lecithin
    • C07F9/103Extraction or purification by physical or chemical treatment of natural phosphatides; Preparation of compositions containing phosphatides of unknown structure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P9/00Preparation of organic compounds containing a metal or atom other than H, N, C, O, S or halogen
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/01Carboxylic ester hydrolases (3.1.1)
    • C12Y301/01004Phospholipase A2 (3.1.1.4)

Definitions

  • the present invention relates to a method for producing lysophosphatidylethanolamine 18: 1 (hereinafter referred to as LPE18: 1) from Pseudomonas sp., And more specifically, phospholipid extracted from bacterial microorganism belonging to Pseudomonas sp. to process the phospholipase a 2 (phospholipase a 2, PLA 2 below)
  • LPE18 relates to a process for producing 1.
  • Lysophosphatidylethanolamine (lysophosphatidylethanolamine) is produced by releasing a second acyl chain from the phosphatidylethanolamine, one of the major phospholipids, by the PLA 2 enzyme activity.
  • Treatment with lysophosphatidylethanolamine has been shown to inhibit plant aging and promote ripening of fruits (US Pat. No. 51,103,41 and US Pat. No. 5,126,155).
  • Lysophosphatidylethanolamine is mainly produced by treating PLA 2 enzyme with phosphatidylethanolamine extracted from egg yolk or soybean, and the composition is mostly LPE16: 0 and LPE18: 0 having 16: 0 or 18: 0 1 st acyl chain. .
  • LPE18: 1 is a superior molecule with much higher bioefficiency than LPE16: 0 or LPE18: 0 (US Patent No. 6426105).
  • a technique for preparing lysophosphatidylethanolamine using egg yolk or soybean as a material is mostly LPE16: 0 and LPE18: 0 and almost no LPE18: 1 (Korean Patent No. 0331932). Efforts have been made to find materials that produce LPE18: 1, but have not been found.
  • the present invention reveals that the material capable of producing LPE18: 1 is in a microorganism such as Pseudomonas, and detailed research methods and results are described below.
  • Pseudomonas Syringe FV with avrRpm1 Tomato DC3000 Pseudomonas syringae pv.
  • Tomato DC3000 below Pst-avrRpm1 the host plant Arabidopsis when penetrated the extracellular space (Arabidopsis thaliana, Col-0 ecotype ), pathogen Avr proteins (avrRpm1) the type III secretion mechanism If the host cell has RPM1, a resistance protein that recognizes the avrRpm1 protein, the interactions between these proteins increase salicylic acid, activation of NPR1 (NON-EXPRESSER OF PR GENES 1) and PR ( PATHOGENESIS-RELATED ) is known to elicit resistance gene-induced immune responses such as expression of genes. However, most of the higher-level molecules, genetics-based, and plant resistance gene-induced host immune responses linking these gene-for-gene interactions are unknown.
  • LPE18: 1 is a signaling factor inducing plant disease resistance in these unknown early signaling studies. Surprisingly, LPE18: 1 was found to be produced mainly by invading pathogens (Pseudomonas).
  • Pseudomonas pathogenic Pseudomonas
  • Pst-avrRpm1 non - pathogenic Pseudomonas
  • avrRpm1 phospholipase A 2- . alpha (PLA 2 ⁇ ) protein is expressed.
  • LPE18 Proteins are secreted out of cells with invading pathogens to break down phosphatidylethanolamine on the pathogen's membrane, producing LPE18: 1 as a major component.
  • the LPE18: 1 exerts its function as a signaling material, spreads around and enters neighboring cells that are not invaded by pathogens to induce disease resistance.
  • LPE18: 1 the material producing LPE18: 1 was found in microorganisms such as Pseudomonas.
  • the present inventors confirmed that the mass production of Pseudomonas bacteria, followed by extraction of lipids and treatment of PLA 2 enzyme resulted in mass production of LPE18: 1.
  • This self-produced LPE18: 1 was sprayed on the plants to compare the bioeffects with the conventional LPE16: 0 / LPE18: 0 mixture and commercially available high purity LPE18: 1.
  • Most of the LPEs produced by the microorganism Pseudomonas were LPE18: 1 and LPE16: 0, and contained very small amounts of LPE16: 1.
  • LPE18: 1 In-house produced crude LPE18: 1 was better than the LPE16: 0 / LPE18: 0 mixture and lower than pure LPE18: 1. In addition, it was examined whether the material producing LPE18: 1 can be obtained from microorganisms other than Pseudomonas. Gram negative bacteria E. coli , gram positive bacteria Bacillus subtilis , Arthrobacter citresus , yeast Saccharomyces cerevisiae and algae Phospholipids were isolated and analyzed for Chlorella vulgaris , which produced little LPE18: 1 when treated with PLA 2 but only in Pseudomonas.
  • Korean Laid-Open Patent Publication No. 2002-0086604 discloses a method of improving the health of plants, protecting plants from biological and abiotic stress-related damage, and increasing the recovery of damaged plants as a result of such stress.
  • Korean Patent Publication No. 1997-0001484 discloses a 'method and composition for immunizing a plant against disease', but the production of lysophosphatidylethanolamine 18: 1 from Pseudomonas sp. There is no description of the method.
  • the present invention was derived from the above-described needs, and the present inventors have been directed to lysophosphatidylethanolamine that induces plant immunity from cell membrane phospholipids of Pseudomonas serine dog, a pathogen invading plants by phospholipase A 2 ⁇ (PLA 2 ⁇ ). It was confirmed that 18: 1 is produced, based on this, the mass culture of Pseudomonas ( Pst ), followed by extraction of lipids and treatment of PLA 2 enzyme, confirmed that LPE18: 1 is produced in large quantities. In addition, in order to investigate whether the material of LPE18: 1 can be obtained from microorganisms other than Pseudomonas, Gram-negative bacteria E.
  • yeast Saccharomyces My process Levy jiae Saccharomyces cerevisiae
  • algae chlorella vulgaris chlorella vulgaris
  • LPE18: 1 was investigated in other species belonging to Pseudomonas genus, and phospholipids were extracted from Pseudomonas caeni , Pseudomonas fluorescens , and Pseudomonas putida .
  • the content of PE as a raw material was significantly higher in all Pseudomonas species tested, and it was confirmed that LPE18: 1 was produced in large quantities when PLA 2 enzyme was treated.
  • the present invention completed the present invention by confirming that LPE18: 1 can be mass-produced by mass-purifying Pseudomonas microorganisms, extracting lipids, and then treating PLA 2 obtained from animals.
  • Phospholipase A 2 phospholipase A 2
  • lysophosphatidylethanolamine lysophosphatidylethanolamine
  • phospholipase A 2 ⁇ produces lysophosphatidylethanolamine 18: 1, which induces plant immunity from cell membrane phospholipids of pathogens invading plants and induces a local immune response of plants.
  • Lysophosphatidylethanolamine 18: 1 produced by the treatment of phospholipase A 2 of the present invention is a natural-derived material, which is a vaccine material and a composition for enhancing fruit storage ability to increase the immune response of a plant without adversely affecting the growth of the plant. It can be used and furthermore it can be used for food, medicine, cosmetics and agriculture, which is very useful for related industries.
  • C confirmed ion leakage after 15 hours of infiltrating Pst-avrRpm1 ( avrRpm1 ), Pst-avrRpt2 ( avrRpt2 ), Pst-avrRps4 ( avrRps4 ) and toxic Pst ( Pst ) in the leaves of wild type and pla2 ⁇ mutant plants.
  • the result is.
  • NT untreated control.
  • D confirms the expression level of PR1 and PDF1.2 genes in plants 24 hours after Pst-avrRpm1 infiltration (* P ⁇ 0.05).
  • E shows the result of analysis of the wild-type plant, pla2 ⁇ mutant plant and the native- promoter :: PLA compensated by ⁇ 2 pla2 ⁇ mutant plants (PLA 2 ⁇ / pla2 ⁇ ) Pst-Pst avrRpm1 and growth of the bacterial infection in the (* P ⁇ 0.05 , ** P ⁇ 0.01).
  • F is the result of analyzing the growth of Pst-avrRpt2 and Pst-avrRps4 infected bacteria in wild type plants, pla2 ⁇ mutant plants (** P ⁇ 0.01).
  • PLA 2 is a result of confirming the effect of the transient expression of PLA 2 ⁇ on the production of lipid products such as LPE, A is confirmed that PLA 2 ⁇ expression in wild type plants inoculated with Pst-avrRpm1 ( avrRpm1 ), B is Pst -avrRpm1 and Pst-fill agent illustration 1.5 hours after PLA 2 ⁇ Promoter :: GUS and transformed picture analysis of the GUS activity in the plant Arabidopsis thaliana, C is the analysis of the lipid products that are generated after the pathogen inoculation for 3 hours at the wild-type plant, D is pla2 ⁇ mutant pathogens inoculated in a plant, and pathogen inoculation Recombinant PLA 2 ⁇ The results of the analysis of the lipid products according to the protein treatment, E is the result of analysis of each level of LPE species in the mock-treated leaves and wild-type leaves 3 hours after Pst-avrRpm1 inoculation, F is a live P
  • 3 is a result of confirming the recovery of the local immune response of pla2 ⁇ mutant plants by LPE18: 1 A is treated with LPE, lysophosphatidylcholine (LPC) and lysophosphatidylglycerol (LPG) to Pst-avrRpm1 infected pla2 ⁇ mutant plants This is a photograph observing whether the recovery, B is the result of LPE or LPG treatment of Pst-avrRpm1 infected pla2 ⁇ mutant plants and the growth of infected bacteria, C is PR1 gene, in wild type leaves treated with mock or LPE Results of analysis of the expression level of wound-related genes, D is the result obtained for the acquisition of local immunity by LPE treatment in wild type plants and pla2 ⁇ mutant plants, E is a toxic effect explaining the acquisition of local immunity by LPE. This is a picture showing the increase in disease resistance to Pst . F was analyzed in vitro whether LPE itself had antimicrobial activity against Pst . (* P ⁇ 0.05, **
  • a and C is the result of confirming the gene expression level
  • B and D is the result of analyzing the salicylic acid level.
  • E is a mock, LPE or salicylic acid treated transgenic plant with 35S :: NPR1-eGFP and confirmed the change of position of NPR1 from cytoplasm to nucleus.
  • Figure 5 PLA 2 ⁇
  • a and D change the gene expression level
  • B and E the ethylene synthesis level
  • C and F the synthesis level of jasmonic acid. This is the result of analysis (* P ⁇ 0.05, ** P ⁇ 0.01).
  • Figure 6 is a less mature leaves and a single growing plant as a result showing not greater in leaves, secretion of apo plast of PLA 2 ⁇ activity and PLA 2 ⁇ to the induction of local immune responses than a defect pla2 ⁇ mutant plant top This is the result of confirming the importance.
  • a and B are the result of confirming the bacterial growth by distinguishing the growth conditions (SD, single condition of 9 hours photoperiod; LD, long day conditions of 16 hours photoperiod) and leaf maturity in pla2 ⁇ mutant plants after Pst-avrRpm1 inoculation (* P ⁇ 0.05, ** P ⁇ 0.01).
  • C is a buffer in pla2 ⁇ mutant plants, Dsbc or PLA 2 Î ⁇
  • D is a mock treatment, PLA 2 ⁇ .
  • E was pretreated with PLA 2 ⁇ inhibitor, inoculated with Pst-avrRpm1 and then bacteria in wild type and pla2 ⁇ mutant plants.
  • F 2 does not secrete into apoplasts because it lacks a signal peptide and remains in the cytoplasm.
  • Figure 7 is a schematic diagram of the role of PLA 2 ⁇ protein and LPE signaling material of the present invention in the immune response to bacterial invasion.
  • Figure 8 is one kind of force Fourteen dill when the ethanolamine (PE) process the Phospholipase A 2 (phospholipase A 2) to lysophosphatidylethanolamine principles (lysophosphatidylethanolamine, LPE) the generation of phospholipids (phospholipid) It is a picture showing.
  • PE ethanolamine
  • Pseudomonas Phospholipid extract was treated with phospholipase A 2 to confirm the produced LPE. Degradation of PE and generation of LPE can be confirmed by HPLC-ELSD analysis of phospholipids extracted from Pseudomonas before (upper) and after (lower) phospholipase A 2 treatment.
  • Figure 12 of Pseudomonas Kaenni MS / MS analysis shows that LPE produced by treating phospholipidase A 2 to phospholipid extracts is mainly LPE18: 1 and LPE16: 0.
  • LPE produced by treating phospholipid A 2 to phospholipid extract is mainly LPE16: 0 and LPE18: 1.
  • FIG 14 of Pseudomonas putida MS / MS analysis shows that LPE produced by treating phospholipid A 2 to phospholipid extract is mainly LPE16: 0 and LPE18: 1.
  • FIG. 15 shows Gram-positive bacteria Bacillus subtilis , Arthrobacter citresus , and Gram-negative bacteria E. coli to investigate whether PE, which is a raw material of LPE, can be obtained from microorganisms other than Pseudomonas.
  • phospholipid was extracted from (Escherichia coli), chlorella vulgaris (chlorella vulgaris) yeast Saccharomyces process as MY three Levy jiae (Saccharomyces cerevisiae) and birds (algae).
  • a certain amount of PE was detected in Escherichia coli, and it was confirmed that the PE content was very low in other microorganisms.
  • step (c) isolating and purifying the resulting lysophosphatidylethanolamine of step (b); Provide mass production method.
  • the lysophosphatidylethanolamine is produced from the cell membrane phospholipids of pathogens invading plants by phospholipase A 2 protein, LPE 16 : 0, LPE 16: 1, LPE 18: 0, LPE 18: 1, LPE 18: 2 or LPE 18: 3, etc., preferably LPE 16: 0, LPE 16: 1 or LPE 18: 1, etc. More preferably LPE 18: 1, but is not limited thereto.
  • the microorganism may be Pseudomonas sp.
  • Microorganism preferably Pseudomonas caeni , Pseudomonas fluorescens , Pseudomonas putida ) Or Pseudomonas syringae , more preferably Pseudomonas caeni ( Pseudomonas caeni ) or Pseudomonas fluorescens ( Pseudomonas fluorescens ), but is not limited thereto.
  • the phospholipid may be phosphatidylcholine, phosphatidylserine or phosphatidylethanolamine, and the like, but preferably phosphatidylethanolamine, more preferably phosphatidylethanolamine
  • the acyl chain in the first position of may be 18: 1, but is not limited thereto.
  • the phospholipase A 2 is an enzyme that liberates lysophospholipids and fatty acids by hydrolyzing ester bonds in the glycerol phospholipid sn -2 position, which is a major component of the biological membrane, and the present invention.
  • Phospholipase A 2 of may be an enzyme of animal origin, microbial origin or plant origin such as snake venom, bee venom or swine pancreatic fluid, and may also be a recombinant protein, but is not limited thereto.
  • the method for extracting phospholipids from the harvested bacteria and the method for separating and purifying lysophosphatidylethanolamine may use any method known in the art.
  • the present invention also provides lysophosphatidylethanolamine produced by the above method.
  • Lipophosphatidylethanolamine produced by the process of the present invention may preferably be lysophosphatidylethanolamine 18: 1, but is not limited thereto.
  • Arabidopsis plants were grown at 22 ° C., 60% relative humidity, 16 hours photoperiod, and photon flux density of 120 ⁇ molesm ⁇ 2 s ⁇ 1 . Since the defense response of the plants is age dependent, fully mature leaves of 4 week old plants were used for a number of analyzes.
  • Arabidopsis thaliana variants including pla2 ⁇ , pla2 ⁇ -II , sid2 , npr1-5 , rps2 and ein2 (Salk_099415, CS857021, Salk_042603, CS3724, Salk_087581, CS3071 and CS8072, respectively), are available from Arabidopsis Biological Center Resource Center, USA).
  • Arabidopsis mutants eds1 and pad4-5 was obtained from each Whitham SA (Iowa State University, USA) and JE Parker (Max Planck Institute for Plant Breeding Research, Germany).
  • Transgenic lines expressing NPR1-eGFP and NahG were obtained from X.Dong (Duke University, USA) and OMPark (Korea University, Korea), respectively.
  • the pla2 ⁇ variant plants were floralized using the pCAMBIA1300 clone, a binary plant transformation vector containing PLA 2 ⁇ genomic DNA with native-promoter moieties (-1175 to +922) in place of BamH I transformed by dip method).
  • a pCAMBIA1300 vector with a signal peptide without pPLA 2 ⁇ :: PLA 2 ⁇ was constructed and Agrobacterium was introduced into the pla2 ⁇ plant.
  • PLA 2 ⁇ - for the creation of the transgenic lines were introduced pBIG binary vector with the [alpha] 2 with the wild-type plants PLA :: p35S.
  • Pseudomonas syringae pv. tomato DC3000 (hereinafter Pst ) and its non-toxic avrRpm1 containing strain Pst-avrRpm1 were obtained from YJKim (Korea University, Korea) and non-toxic avrRpt2 containing strain Pst-avrRpt2 was obtained from JMPark (KRIBB, Korea).
  • Reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative polymerase chain reaction (real-time qPCR) were performed using gene specific primers.
  • Real-time quantitative polymerase chain reaction analysis was performed using Applied Biosystems 7900 Real-Time PCR System TM equipment. 2X SYBR ® Green qPCR master mix was used for PCR amplification. Assay values were first normalized to the amount of ACTIN1 gene, and the fold increase in gene expression following treatment was determined in comparison to mock or untreated plants (1.0-fold).
  • An alternative reference gene ( AT1G13320 ) was obtained from previous studies (Hong et al., 2010, Plant Cell Physiol. 51: 1694-1706).
  • Gene specific primers used in the present invention are shown in Table 1 and Table 2.
  • Total lipids were obtained by mock or Pst - avrRpm1 bacterial suspension (1 x 10 8 CFU ml -1 in 0.018% Silwet L-) via the previously described method (Ruy et al., 1996, Biochem Biophys Acta. 1303: 243-250) . 77) was extracted from sprayed leaf samples (6 leaves from 3 plants for each sample). Each phospholipid and free fatty acid (FFA) were quantified by ESI-MS / MS analysis at the Kansas Lipidomics Research Center.
  • Lipid Lipid, the process of salicylic acid, and recombinant ⁇ PLA 2 protein
  • LPE 18: 1 was used in the present invention because it was the largest increase in Pst-avrRpm1 inoculation.
  • Mature form of the recombinant ⁇ PLA 2 protein was produced in E. coli as a fusion protein Dsbc, the method described previously: According to (Ryu et al, 2005, Biochem Biophys Acta 1736.. 144-151) affinity chromatography (affinity chromatography Purified). Protein mixture separated from PLA 2 ⁇ and Dsbc or Dsbc: PLA 2 ⁇ fusion protein (10 ⁇ g ml ⁇ 1 ) was treated with 0.5 ⁇ g of leaves of the pla2 ⁇ variant through syringe infusion .
  • the enzymatic activity of PLA 2 ⁇ was confirmed by in vitro analysis using substrate PE in a reaction mixture containing 50 mM Tris.HCl (pH 8.5), 10 mM Ca 2+ , 0.05% Triton X-100. Mock treated plants were infiltrated with buffer (50 mM Tris.HCl, pH 8.0) or Dsbc protein. For the inactivation of ⁇ PLA 2 activity, was pretreated at 30 °C for 30 minutes, the recombinant ⁇ PLA 2 leads to the agate al (manoalide) an irreversible inhibitor of 2 ⁇ M. Inactivation of PLA 2 activity by ⁇ agate Al lead was confirmed by in vitro analysis.
  • PLA 2 ⁇ 3 ⁇ g of free-maturated recombinant PLA 2 ⁇ produced according to the method of Ryu et al. ( Biochem Biophys Acta. 2005, 1736: 144-151) was tested for toxic Pst (5 ⁇ . 10 5 CFU ml ⁇ 1 ) are added to 100 ⁇ l of suspended solution (Tris.HCl (50 mM, pH 8.0), 10 mM calcium chloride (CaCl 2 )). Bacterial samples were incubated at 28 ° C. for 6 hours with mild agitation, and only live bacteria were titrated. Mock control was used as the bacteria suspended in a solution without PLA 2 ⁇ .
  • Salicylic acid, jasmonic acid and ethylene are Pst-avrRpm1 suspensions according to previously described methods (Bowling et al., 1994, Plant Cell 6: 1845-1857; Heck et al., 2003, Plant J. 36: 342-352).
  • NPR1-eGFP with LPE (100 nmol ml -1 in 0.018% Silwet L-77), salicylic acid (0.3 mM in 0.018% Silwet L-77) or mock solution (0.018% Silwet L-77) was sprayed and after 6 hours the leaves of the plants were observed with a laser scanning confocal microscope (Zeiss, Germany).
  • Leaf tissues (4 leaves per sample) were harvested, vacuum infiltrated with sterile water for 5 minutes, and incubated with stirring at room temperature for 2 hours.
  • the degree of electrolyte leakage in the sample was measured using a conductivity meter (Mettler Toledo, Switzerland). Data shown as percentage of total electrolyte leakage was obtained by melting at room temperature with stirring for 6 hours after freezing.
  • Pla2 ⁇ variants were not able to initiate local immune responses when inoculated with Pst-avrRpm1 , but also unable to respond to Pst-avrRpt2 or Pst-avrRps4 (FIG. 1F). These results are pla2 ⁇ Immune responses induced by proteins through both coiled-coil nucleotide-binding site-leucine-rich repeat (CC-NB-LRR) and toll-interleukin1 receptor-nucleotide binding-leucine rich repeat (TIR-NB-LRR) type resistance genes Meant to get involved.
  • CC-NB-LRR coiled-coil nucleotide-binding site-leucine-rich repeat
  • TIR-NB-LRR toll-interleukin1 receptor-nucleotide binding-leucine rich repeat
  • PLA 2 ⁇ is expressed at low levels.
  • PLA 2 ⁇ expression was suggested that Pst-avrRpm1 inoculated quickly, but is appropriately guided in response to the Pst inoculation of toxicity is induced weakly (Fig. 2A), PLA 2 ⁇ expression mediates resistance to react to. Similar results were observed in the pPLA 2 ⁇ :: GUS analysis, where the PLA 2 ⁇ promoter was activated in response to Pst-avrRpm1 inoculation but not by toxic Pst (FIG. 2B).
  • the pla2 ⁇ variant did not show increased LPE production in response to Pst-avrRpm1 inoculation (FIG. 2D).
  • the increased LPE species in the leaves of wild type plants infected with Pst-avrRpm1 compared to mock treated plants were LPE18: 1, LPE18: 2, LPE18: 3 and LPE16: 1 (FIG. 2E).
  • LPE18: 1 and LPE16: 1 were hardly identified in mock treated plants, but very increased in Pst-avrRpm1 treated leaves (FIG. 2E).
  • LPE18: 1 and LPE16: 1 are rare lipid types in Arabidopsis leaf tissue (Devaiah et al., 2006, Phytochemistry 67: 1907-1924). The inventors have therefore identified whether these lipid products are derived from the invading bacterial membranes. Bacterial infection stimulates the migration of PLA 2 ⁇ from the cytoplasmic Golgi apparatus to apoplasts. PLA 2 ⁇ showed antimicrobial activity against invading bacteria (FIG. 2G).
  • Pst-Pst-avrRpm1 avrRpm1 suspensions or lipid extracts when incubated with recombinant PLA 2 protein of ⁇ , LPE18: 1, LPE16: 0 LPE16 and: 1 was actually released lipid bacteria or bacteria from extracts (Fig. 2F).
  • Pst-avrRpm1 bacteria were radiolabeled with [ 14 C] -ethanolamine, which was inoculated onto the leaves of wild-type plants. The leaves were harvested 3 hours after inoculation and the lipid extracts of the infected leaves were separated by thin layer chromatography (TLC).
  • LPE18 1, a major class of LPE increased in response to Pst-avrRpm1 infection, is derived from pathogens that are released in small amounts from the host cell's membrane but mostly invade.
  • LPE18: 1 was supplemented by treatment with pla2 ⁇ variants. Indeed, LPE restored the ability to induce local immune responses of pla2 ⁇ variants and to limit the spread of disease symptoms beyond the hypersensitivity zone (FIGS. 3A and 3B). Very importantly, LPE itself increased local immunity in the absence of nontoxic Pst (FIGS. 3C-3E).
  • LPE induced expression of PR genes PR1 and PDF1.2 did not induce expression of wound-related genes VSP1 and JMT (FIG. 3C).
  • the acquisition of local immunity by LPE in the absence of bacteria was demonstrated by the results of LPE treatment inhibiting bacterial growth of toxic Pst in wild type plants as well as pla2 ⁇ mutant plants compared to mock treated groups (FIG. 3D).
  • the symptoms of the disease was much more relieved than the mock treated group in the leaves with LPE (Fig. 3E).
  • ICS1 is located in the plastid and acts as a major enzyme in salicylic acid biosynthesis in the host's immune response.
  • the expression of ICS1 was reduced compared to wild type plants (FIG. 4A).
  • pla2 ⁇ mutant plants inoculated with Pst-avrRpm1 had significantly lower levels of salicylic acid than the wild type (FIG. 4B).
  • pla2 ⁇ variants without the production of lipid products, including LPE failed to express ICS1 in response to non-toxic bacterial challenges, and these defects failed to induce lower signal amplification leading to PR gene expression by lowering salicylic acid levels.
  • NPR1 is an important regulator of salicylic acid mediated immune responses leading to PR1 gene expression.
  • NPR1 activation refers to the transfer of NPR1 from the cytoplasm to the nucleus by salicylic acid. Since NPR1 activation is mediated by salicylic acid, an increase in salicylic acid by LPE induction may activate NPR1.
  • LPE to transgenic plants with 35S :: NPR1-eGFP actually activated NPR1 via induction of protein migration from the cytoplasm to the nucleus, such as salicylic acid treatment (FIG. 4E).
  • FOG. 4E salicylic acid treatment
  • Example 5 PLA 2 and an ethylene ⁇ -dependent defense signaling pathway that is mediated LPE
  • the pla2 ⁇ variant was also found defective in the expression of PDF1.2 , which is known to be mediated by jasmonic acid and / or ethylene in response to Pst-avrRpm1 inoculation (FIG. 1D).
  • the pla2 ⁇ mutant plants also impaired the expression of the ethylene biosynthetic gene ACC synthase ( ACS ) and reduced ethylene production in response to Pst-avrRpm1 inoculation (FIGS. 5A and 5B).
  • the mutant plants showed unabated expression of LOX2 with no significant difference in the level of Jasmonic acid compared to wild type (FIGS. 5A and 5C).
  • Arabidopsis leaves treated with LPE showed ACS gene expression and increased ethylene levels, but no significant increase was observed in LOX2 gene expression or Jasmonic acid levels (FIGS. 5D-5F). These results are meant that are mediated by the expression ⁇ 2 In addition, PLA and their lipid products of ethylene-dependent PDF1.2 during the local immune response.
  • Example 6 passed PLA 2 ⁇ -derived lipid signal occurring in the plant immune response mechanism
  • PLA 2 ⁇ -derived lipid-based signaling may be proposed that works in the following way: In the resistance gene mediated method by inoculation of non-toxic Pst , PLA 2 ⁇ is rapidly and transiently expressed and released into apoplasts, a place where LPE-containing lipid products are produced from the invading bacteria and host cell membranes. . Then LPE promotes ICS1 / NPR1- acid dependent signaling and gene expression led PDF1.2 ACS- dependent ethylene signaling the resistance gene induction via the lower immune response leading to PR1 gene expression (Fig. 7).
  • Pseudomonas syringae was harvested by mass cultivation, and lipids were extracted. After this treatment the extract phospholipid Phospholipase A 2 (phospholipase A 2) for, using the HPLC-ELSD analysis confirmed whether decomposition is PE (phosphatidylethanolamine) and LPE (lysophosphatidylethanolamine) is created (Fig. 9). Before the PLA 2 treatment, only the PE peak of 9 minutes retention time was seen and the 12.5 minute retention time LPE peak was insignificant (top chromatogram of FIG. 9), but after the PLA 2 treatment, the PE peak of 9 minutes retention time disappeared and 12.5 minutes retention. A new LPE peak of time was created as a box (bottom chromatogram of FIG. 9).
  • PE phosphatidylethanolamine
  • LPE lysophosphatidylethanolamine
  • LPE18: 1 was produced from other microorganisms. phospholipids were extracted from Pseudomonas caeni , Pseudomonas fluorescens , and Pseudomonas putida . The PE content was significantly higher in all Pseudomonas species tested (FIG. 11), and when the PLA 2 enzyme was treated, it was confirmed that LPE18: 1 was produced in large quantities (FIGS. 12 to 14).
  • LPE18: 1 can be produced from Pseudomonas and other microorganisms, Escherichia coli , Gram-positive bacteria, Bacillus subtilis and Arthrobacter citresus And phospholipids were isolated from yeast Saccharomyces cerevisiae and algae Chlorella vulgaris , and as a result, almost no PE, a raw material of LPE, was detected in microorganisms other than Escherichia coli (Fig. 15). ). Some amount of PE was extracted from E. coli, but only LPE16: 0 was produced as a result of treatment with PLA 2 (FIG. 16). Therefore, it was found that in other microorganisms except Pseudomonas, at least the microorganisms examined were difficult to secure PE capable of producing LPE18: 1.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 슈도모나스 속(Pseudomonas sp.) 미생물로부터 추출된 인지질에 포스포리파아제 A2 (phospholipase A2)를 처리하여 리소포스파티딜에탄올아민 (lysophosphatidylethanolamine) 18:1을 생산하는 방법에 관한 것으로, 본 발명의 리소포스파티딜에탄올아민 18:1은 식물체의 생장 저해 부작용 없이 식물체의 면역 반응을 증가시키기 위한 백신 재료 및 과일 저장성 증진용 조성물로 사용될 수 있으며, 더 나아가 식품, 의약품, 화장품 및 농업용으로 사용될 수 있어 관련 산업에 매우 유용하다.

Description

슈도모나스 속 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법
본 발명은 슈도모나스 속(Pseudomonas sp.) 미생물로부터 리소포스파티딜에탄올아민 18:1 (lysophosphatidylethanolamine 18:1, 이하 LPE18:1)의 생산 방법에 관한 것으로, 더욱 상세하게는 슈도모나스 속에 속하는 박테리아 미생물로부터 추출된 인지질에 포스포리파아제 A2 (phospholipase A2, 이하 PLA2)를 처리하여 LPE18:1을 생산하는 방법에 관한 것이다.
리소포스파티딜에탄올아민(lysophosphatidylethanolamine)은 세포막 주요 구성성분 인지질(phospholipids) 중의 하나인 포스파티딜에탄올아민(phosphatidylethanolamine)에서 두 번째 아실 체인 (2nd acyl chain)이 PLA2 효소활성에 의하여 떨어져 나가면서 생성되며 생체 내에 소량으로 존재한다. 리소포스파티딜에탄올아민를 처리하였을 때 식물체 노화를 억제하고 과일의 숙성(ripening)을 촉진한다는 것이 밝혀졌다(미국등록특허 제5110341호 및 미국등록특허 제5126155호). 리소포스파티딜에탄올아민은 주로 계란 노른자위나 콩에서 추출한 포스파티딜에탄올아민에 PLA2 효소를 처리하여 생산되며, 조성 성분은 대부분 1st 아실 체인이 16:0 또는 18:0인 LPE16:0과 LPE18:0이다. 리소포스파티딜에탄올아민이 어떠한 생체 기작으로 노화를 억제하는지 연구하는 과정에서 LPE18:1이 LPE16:0 또는 LPE18:0 보다 훨씬 생체 효능이 뛰어난 superior molecule임을 밝혔다 (미국등록특허 제6426105호). 현재까지 리소포스파티딜에탄올아민 제조방법에 대한 기술은 계란 노른자위 또는 콩을 소재로 사용하여 성분이 대부분 LPE16:0과 LPE18:0이고 LPE18:1은 거의 없다(한국등록특허 제0331932호). 이에 LPE18:1를 생성시키는 소재를 찾는 노력이 있었으나 찾지 못하였다.
본 발명은 LPE18:1을 생산할 수 있는 소재가 슈도모나스와 같은 미생물에 있는 것을 밝힌 것으로 상세한 연구방법과 결과를 아래에 기술한다. 병원균이 식물체에 침입을 하면 식물체는 일부의 병원균에 대하여 병 저항성 반응을 일으키는데 그 기작이 아직 잘 밝혀져 있지 않다. 특히 초기 병저항성 유도 신호전달기작에 대한 정보가 많이 있지 않다. 그동안 avrRpm1를 지닌 슈도모나스 시린개 피브이. 토마토 DC3000 (Pseudomonas syringae pv. tomato DC3000, 이하 Pst-avrRpm1)이 숙주 식물체 애기장대 (Arabidopsis thaliana, Col-0 ecotype)의 세포외 공간에 침투하면, 병원균은 Avr 단백질 (avrRpm1)을 타입 Ⅲ 분비 기작을 통해 숙주의 세포질로 도입시키는데, 만약 숙주 세포가 avrRpm1 단백질을 인식하는 저항 단백질인 RPM1을 가지고 있으면, 상기 단백질간의 상호작용은 살리실산의 증가, NPR1 (NON-EXPRESSER OF PR GENES 1)의 활성화 및 PR (PATHOGENESIS-RELATED) 유전자의 발현 등과 같은 저항 유전자 유도 면역 반응을 이끌어낸다고 알려져 있었다. 그러나, 이러한 gene-for-gene 상호작용을 연결하는 상위 단계의 분자, 유전학 기반 및 식물체의 저항 유전자 유도 숙주 면역 반응은 대부분 밝혀져 있지 않았다.
본 발명자들은 이러한 밝혀져 있지 않은 초기 신호전달 연구에서 LPE18:1이 식물체의 병저항성을 유도하는 신호전달 인자인 것을 밝혔다. 놀랍게도 LPE18:1이 침입하는 병원균 (슈도모나스)에서 주로 생성되어 나오는 것을 밝혔다. 연구결과를 요약하면 비병원성 슈도모나스(Pst-avrRpm1)가 애기장대 식물체에 침입하면 avrRpm1 단백질을 세포내에 주입하는데 이때 식물체가 이 단백질 인자를 gene-for-gene interaction으로 인식하고, 곧 포스포리파아제 A2-alpha (PLA2α) 단백질을 발현시킨다. PLA2α 단백질은 침입한 병원균들이 있는 세포 밖으로 분비되어 병원균의 막에 있는 포스파티딜에탄올아민을 분해하여 LPE18:1을 주요성분으로 생성시킨다. 이 LPE18:1은 신호전달물질 기능을 발휘하여 주위로 퍼져나가 병원균이 침입하지 않은 이웃세포 안으로 들어가 병 저항성을 유도시킨다.
상기한 연구결과에서 보듯이 LPE18:1을 생성시키는 소재가 슈도모나스 등과 같은 미생물에 있음을 알 수 있었다. 이에 본 발명자들은 슈도모나스 박테리아를 대량 배양한 다음 지질을 추출하고 PLA2 효소를 처리하여 LPE18:1이 대량 생성되는 것을 확인하였다. 이러한 자체 제조한 LPE18:1를 식물체에 살포하여 생체효과를 기존의 LPE16:0/LPE18:0 혼합액 그리고 상업적으로 판매되는 높은 순도의 LPE18:1와 비교하였다. 미생물 슈도모나스에서 자체 제조한 LPE는 대부분 LPE18:1과 LPE16:0이었으며 극히 소량의 LPE16:1이 들어 있었다. 자체 제조한 crude LPE18:1은 효과 면에서 LPE16:0/LPE18:0 mixture보다 좋았으며 pure LPE18:1 보다는 낮았다. 또한, LPE18:1를 생성시키는 소재를 슈도모나스 외의 미생물에서도 얻을 수 있는지 조사하였다. 그람 음성 세균인 대장균(E. coli), 그람 양성 세균인 바실러스 서틸리스(Bacillus subtilis), 아쓰로박터 시트레서스(Arthrobacter citresus), 효모인 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 및 조류인 클로렐라 불가리스(Chlorella vulgaris)에 대해서 인지질을 분리하여 분석한 결과, 다른 미생물에서는 PLA2를 처리하였을 때 LPE18:1가 거의 생성되지 않았고 오직 슈도모나스에서만 생성되었다.
한편, 한국공개특허 제2002-0086604호에는 '식물의 건강을 증진시키고, 생물적 및 비생물적 스트레스관련 손상으로부터 식물을 보호하고, 그러한 스트레스의 결과로서 손상된 식물의 회복을 높이는 방법'이 개시되어 있고, 한국공개특허 제1997-0001484호에는 '병에 대해 식물을 면역시키기 위한 방법 및 조성물'이 개시되어 있으나, 본 발명의 슈도모나스 속(Pseudomonas sp.) 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법에 대해서는 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 포스포리파아제 A2α (PLA2α)에 의해 식물체에 침입한 병원균인 슈도모나스 시린개의 세포막 인지질로부터 식물 면역성을 유도하는 리소포스파티딜에탄올아민 18:1이 생성되는 것을 확인하였고, 이를 토대로 슈도모나스(Pst)를 대량 배양한 다음 지질을 추출하고 PLA2 효소를 처리하여 LPE18:1이 대량 생성되는 것을 확인하였다. 또한, LPE18:1의 소재를 슈도모나스 외의 미생물에서도 얻을 수 있는지 조사하기 위해, 그람 음성 세균인 대장균(E. coli), 그람 양성 세균인 바실러스 서틸리스(Bacillus subtilis), 아쓰로박터 시트레서스(Arthrobacter citresus), 효모인 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 및 조류인 클로렐라 불가리스(Chlorella vulgaris)에 대해서 인지질을 추출하여 PLA2를 처리한 결과, 다른 미생물에서는 LPE18:1를 포함한 LPE의 생성이 많지 않았고 오직 슈도모나스에서만 뚜렷이 생성되는 것을 확인하였다. 또한, 슈도모나스 속에 속하는 다른 종들에서도 LPE18:1을 대량생산할 수 있는지 조사한 결과, 슈도모나스 카에니(Pseudomonas caeni), 슈도모나스 플루오레센스(Pseudomonas fluorescens), 슈도모나스 푸티다(Pseudomonas putida)에서 인지질을 추출한 결과 LPE의 원소재가 되는 PE 함량이 실험한 슈도모나스 모든 종에서 상당히 많았으며 PLA2 효소를 처리하였을 때 LPE18:1이 대량 생성되는 것을 확인하였다.
따라서, 본 발명은 슈도모나스 미생물을 대량 배양한 후 지질을 추출한 다음 동물에서 구한 PLA2를 처리하여 LPE18:1를 대량생산할 수 있는 점을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 슈도모나스 속(Pseudomonas sp.) 미생물로부터 추출된 인지질에 포스포리파아제 A2 (phospholipase A2)를 처리하여 리소포스파티딜에탄올아민 (lysophosphatidylethanolamine) 18:1을 생산하는 방법을 제공한다.
본 발명에 따르면, 포스포리파아제 A2α에 의해 식물체에 침입한 병원균의 세포막 인지질로부터 식물 면역성을 유도하는 리소포스파티딜에탄올아민 18:1이 생성되고 식물체의 국소적 면역 반응이 유발되는 것을 확인하였다. 본 발명의 포스포리파아제 A2 처리에 의해 생산된 리소포스파티딜에탄올아민 18:1은 천연 유래의 물질로, 식물체의 생장 저해 부작용 없이 식물체의 면역 반응을 증가시키기 위한 백신 재료 및 과일 저장성 증진용 조성물로 사용될 수 있으며, 더 나아가 식품, 의약품, 화장품 및 농업용으로 사용될 수 있어 관련 산업에 매우 유용하다.
도 1은 pla2α 변이 식물체에서 국소적인 면역력이 손상된 것을 확인한 결과로, A와 B는 Pst-avrRpm1 인필트레이션 6일 후에 야생형 식물체와는 다르게 pla2α(녹아웃) 및 pla2α-Ⅱ(녹다운) 변이 식물체의 전체 식물체(A) 및 잎(B)에서 과민성 반응 지역을 넘어 질병의 증상이 진행되는 것을 관찰한 사진이다. C는 야생형 식물체와 pla2α 변이 식물체의 잎에서 Pst-avrRpm1(avrRpm1), Pst-avrRpt2(avrRpt2), Pst-avrRps4(avrRps4) 및 독성의 Pst(Pst)를 인필트레이션한 15시간 후의 이온 누출을 확인한 결과이다. NT: 무처리 대조군. D는 Pst-avrRpm1 인필트레이션 후 24시간째에 식물체에서 PR1PDF1.2 유전자의 발현 수준을 확인한 것이다(*P<0.05). E는 야생형 식물체, pla2α 변이 식물체 및 native-프로모터::PLA2α로 보상된 pla2α 변이 식물체(PLA2α/ pla2α)에서 Pst-avrRpm1 Pst 감염 세균의 성장을 분석한 결과이다(*P<0.05, **P<0.01). F는 야생형 식물체, pla2α 변이 식물체에서 Pst-avrRpt2 Pst-avrRps4 감염 세균의 성장을 분석한 결과이다(**P<0.01).
도 2는 일시적인 PLA2α의 발현이 LPE와 같은 지질 산물의 생성에 미치는 영향을 확인한 결과로, A는 Pst-avrRpm1(avrRpm1)로 접종한 야생형 식물체에서 PLA2α 발현을 확인한 것이고, B는 Pst-avrRpm1Pst 인필트레이션 1.5시간 뒤 PLA 2 α 프로모터::GUS 형질전환 애기장대 식물체에서 GUS 활성을 분석한 사진이고, C는 야생형 식물체에서 병원균 접종 3시간 후 생성되는 지질 산물을 분석한 결과이고, D는 pla2α 변이 식물체에서 병원균 접종, 병원균 접종 및 재조합 PLA2α 단백질 처리에 따른 지질 산물을 분석한 결과이고, E는 mock 처리 잎과 Pst-avrRpm1 접종 3시간 후의 야생형 잎에서 LPE 종류들의 각 수준을 분석한 결과이고, F는 살아있는 Pst-avrRpm1, 세균 지질 추출물 및 잎 조직과 PLA2α 단백질을 혼합한 현탁액으로부터 방출되는 LPE 종류들을 분석한 결과이고, G는 재조합 PLA2α 단백질의 항균 능력을 확인한 결과로, M은 mock, P는 PLA2α 단백질, PM은 PLA2α 단백질과 마노알리드의 혼합 그리고 PMM은 PLA2α 단백질과 마노알리드 버퍼(에탄올)의 혼합을 처리한 것을 의미한다(*P<0.05, **P<0.01). H는 방사선 표지한 Pst-avrRpm1를 야생형 식물체의 잎에 접종한 후 3시간 뒤 방사능의 정도를 확인한 결과이다.
도 3은 LPE18:1에 의한 pla2α 변이 식물체의 국소적인 면역 반응의 회복을 확인한 결과로, A는 Pst-avrRpm1 감염된 pla2α 변이 식물체에 LPE, LPC (lysophosphatidylcholine) 및 LPG (lysophosphatidylglycerol)를 처리하여 표현형적 결함이 회복되는지를 관찰한 사진이고, B는 Pst-avrRpm1 감염된 pla2α 변이 식물체에 LPE 또는 LPG를 처리하고 감염 세균의 성장을 분석한 결과이며, C는 mock 처리 또는 LPE를 처리한 야생형 잎에서 PR1 유전자, 상처 관련 유전자들의 발현 수준을 분석한 결과이고, D는 야생형 식물체와 pla2α 변이 식물체에서 LPE 처리에 의한 국소적인 면역력의 획득에 관해 확인한 결과이고, E는 LPE에 의한 국소적인 면역력 획득을 설명하는 독성의 Pst에 대한 병 저항성 증가의 모습을 보여주는 사진이며, F는 in vitro 상에서 LPE 자체의 Pst에 대한 항균 활성이 있는지 분석한 결과이다(*P<0.05, **P<0.01).
도 4는 LPE에 의한 ICS1-의존적 살리실산 생합성 및 NPR1 활성화를 확인한 결과로, A와 C는 유전자 발현 수준을 확인한 결과이며, B와 D는 살리실산 수준을 분석한 결과이다. E는 35S::NPR1-eGFP를 지닌 형질전환 식물체에 mock, LPE 또는 살리실산을 처리하고 NPR1의 세포질에서 핵으로의 위치변화를 확인한 이미지이다.
도 5는 PLA2α 단백질과 LPE에 의해 매개되는 에틸렌-의존적 PDF1.2의 발현을 확인한 결과로, A와 D는 유전자 발현 수준의 변화를, B와 E는 에틸렌 합성 수준을 그리고 C와 F는 자스몬산의 합성 수준을 분석한 결과이다(*P<0.05, **P<0.01).
도 6은 pla2α 변이 식물체의 결함이 정상보다 덜 성숙한 잎과 단일 생장 식물체 잎에서는 크지 않음을 보여주는 결과로, 국소적인 면역 반응의 유도를 위해 PLA2α 활성 및 PLA2α의 아포플라스트의 분비가 중요함을 확인한 결과이다. A와 B는 Pst-avrRpm1 접종 후 pla2α 변이 식물체에서 생장 조건(SD, 9시간 광주기의 단일조건; LD, 16시간 광주기의 장일조건) 및 잎의 성숙도 정도를 구분하여 세균 성장을 확인한 결과이다(*P<0.05, **P<0.01). C는 pla2α 변이 식물체에 버퍼, Dsbc 또는 PLA2α 단백질을 인필트레이션한 후 ICS1PR1 유전자의 발현 수준을 확인한 것이고, D는 mock 처리, PLA2α 단백질 처리 및 PLA2α 단백질 및 저해제(Mano)를 함께 처리한 군에서 PR1 유전자의 발현을 분석한 결과이고, E는 PLA2α 저해제를 전처리하고 Pst-avrRpm1 접종한 후 야생형과 pla2α 변이 식물체에서 세균 성장을 분석한 결과이고, F는 신호 펩티드가 없어 아포플라스트로 분비하지 못하고 세포질에 머물게 되는 PLA2α 구조의 벡터를 pla2α 변이 식물체에 형질전환(no S.P. PLA2α/PLA2α)한 후, Pst-avrRpm1를 접종하여 세균 성장을 분석한 결과이다.
도 7은 본 발명의 PLA2α 단백질과 LPE 신호전달물질이 세균 침입에 대한 면역반응에서 어떠한 역할을 담당하는지 모식화한 그림이다.
도 8은 포스포리피드(phospholipid)의 한 종류인 포스포티딜에탄올아민(PE)에 포스포리파아제 A2 (phospholipase A2)를 처리한 경우 리소포스파티딜에탄올아민 (lysophosphatidylethanolamine, LPE)이 생성되는 원리를 보여주는 그림이다.
도 9는 슈도모나스의 인지질 추출물에 포스포리파아제 A2를 처리하여 생산된 LPE를 확인한 결과이다. 슈도모나스에서 추출한 인지질에 포스포리파아제 A2 처리하기 전(상)와 후(하)를 HPLC-ELSD 분석법으로 PE의 분해 및 LPE의 생성을 확인할 수 있다.
도 10은 슈도모나스 시린개의 인지질 추출물에 포스포리파아제 A2를 처리하여 생산된 LPE가 주로 LPE16:0과 LPE18:1임을 보여 주는 MS/MS 분석 결과이다.
도 11은 LPE의 원소재가 되는 PE를 슈도모나스 시린개 외의 슈도모나스 속에 속하는 다른 종들에서도 얻을 수 있는지 조사하기 위해, 슈도모나스 카에니 (Pseudomonas caeni), 슈도모나스 플루오레센스 (Pseudomonas fluorescens), 슈도모나스 푸티다 (Pseudomonas putida)에서 인지질을 추출한 결과 PE 함량이 실험한 슈도모나스 모든 종에서 상당히 많은 것을 확인하였다.
도 12는 슈도모나스 카에니의 인지질 추출물에 포스포리파아제 A2를 처리하여 생산된 LPE가 주로 LPE18:1과 LPE16:0임을 보여주는 MS/MS 분석결과이다.
도 13은 슈도모나스 플루오레센스의 인지질 추출물에 포스포리파아제 A2를 처리하여 생산된 LPE가 주로 LPE16:0과 LPE18:1임을 보여주는 MS/MS 분석결과이다.
도 14는 슈도모나스 푸티다의 인지질 추출물에 포스포리파아제 A2를 처리하여 생산된 LPE가 주로 LPE16:0과 LPE18:1임을 보여주는 MS/MS 분석결과이다.
도 15는 LPE의 원소재가 되는 PE를 슈도모나스 외의 미생물에서도 얻을 수 있는지 조사하기 위해, 그람 양성 세균인 바실러스 서틸리스(Bacillus subtilis), 아쓰로박터 시트레서스(Arthrobacter citresus), 그람 음성 세균인 대장균(Escherichia coli), 효모인 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 및 조류(Algae)인 클로렐라 불가리스(Chlorella vulgaris)에서 인지질을 추출하였다. 슈도모나스 시린개와 비교하여 대장균에서 어느 정도의 PE 함량이 검출되었으며, 그 외 미생물에서는 PE 함량이 매우 적은 것을 확인하였다.
도 16은 대장균의 인지질 추출물에 포스포리파아제 A2를 처리하여 생산된 LPE가 주로 LPE16:0이고 LPE18:1은 없는 것을 보여 주는 MS/MS 분석 결과이다.
본 발명의 목적을 달성하기 위하여, 본 발명은
(a) 슈도모나스 속(Pseudomonas sp.) 미생물을 대량 배양한 후 수확하여 인지질을 추출하는 단계;
(b) 상기 (a) 단계의 추출된 인지질에 포스포리파아제 A2 (phospholipase A2)를 처리하여 리소포스파티딜에탄올아민 (lysophosphatidylethanolamine)을 생성하는 단계; 및
(c) 상기 (b) 단계의 생성된 리소포스파티딜에탄올아민을 분리 및 정제하는 단계를 포함하는 리소포스파티딜에탄올아민의 대량 생산 방법을 제공한다.
본 발명의 일 구현 예에 따른 방법에 있어서, 상기 리소포스파티딜에탄올아민 (lysophosphatidylethanolamine, 이하 LPE)은 포스포리파아제 A2 단백질에 의해 식물체에 침입한 병원균의 세포막 인지질로부터 생산된 것으로, 상기 LPE는 LPE 16:0, LPE 16:1, LPE 18:0, LPE 18:1, LPE 18:2 또는 LPE 18:3 등일 수 있고, 바람직하게는 LPE 16:0, LPE 16:1 또는 LPE 18:1 등일 수 있으며, 더욱 바람직하게는 LPE 18:1일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 방법에 있어서, 상기 미생물은 슈도모나스 속(Pseudomonas sp.) 미생물일 수 있으며, 바람직하게는 슈도모나스 카에니(Pseudomonas caeni), 슈도모나스 플루오레센스(Pseudomonas fluorescens), 슈도모나스 푸티다(Pseudomonas putida) 또는 슈도모나스 시린개(Pseudomonas syringae)일 수 있으며, 더욱 바람직하게는 슈도모나스 카에니(Pseudomonas caeni) 또는 슈도모나스 플루오레센스 (Pseudomonas fluorescens)일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 방법에 있어서, 상기 인지질은 포스파티딜콜린 (phosphatidylcholine), 포스파티딜세린 (phosphatidylserine) 또는 포스파티딜에탄올아민 (phosphatidylethanolamine) 등일 수 있으나, 바람직하게는 포스파티딜에탄올아민일 수 있으며, 더욱 바람직하게는 포스파티딜에탄올아민의 첫 번째 위치의 아실 체인이 18:1인 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에 있어서, 상기 포스포리파아제 A2는 생체막의 주요한 구성성분인 글리세롤 인지질 sn-2위치의 에스테르결합을 가수분해하여 리소인지질과 지방산을 유리하는 효소로, 본 발명의 포스포리파아제 A2는 뱀독, 벌독 또는 돼지 췌장액과 같은 동물 유래, 미생물 유래 또는 식물 유래의 효소일 수 있고 또한 재조합 단백질일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 방법에 있어서, 수확한 세균으로부터 인지질을 추출하는 방법 및 리소포스파티딜에탄올아민을 분리 및 정제하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다.
본 발명은 또한, 상기의 방법에 의해 생산된 리소포스파티딜에탄올아민을 제공한다. 본 발명의 방법에 의해 생산된 리포포스파티딜에탄올아민은 바람직하게는 리소포스파티딜에탄올아민 18:1일 수 있으나, 이에 제한되지 않는다.
이하, 본 발명의 실시예에 대해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
식물 재료 및 시약
애기장대 식물체는 22℃, 상대습도 60%에서, 16시간 광주기 그리고 광자 유속 밀도(photon flux density) 120μmolesm-2s-1의 조건에서 키웠다. 식물체의 방어 반응이 연령 의존적이기 때문에, 4주령 식물체의 완전히 성숙한 잎을 다수의 분석을 위해 사용하였다. pla2α, pla2α-II, sid2, npr1-5, rps2ein2 (각각 Salk_099415, CS857021, Salk_042603, CS3724, Salk_087581, CS3071 및 CS8072)를 포함하는 애기장대 (Arabidopsis thaliana) 변이체는 애기장대 생물 자원 센터 (Arabidopsis Biological Resource Center, 미국)으로부터 구매하였다. 애기장대 변이체 eds1pad4-5는 각각 S.A. Whitham (Iowa State University, 미국)와 J.E. Parker (Max Planck Institute for Plant Breeding Research, 독일)로부터 얻었다. NPR1-eGFPNahG를 발현하는 형질전환 계통은 X.Dong (Duke University, 미국)과 O.M.Park (고려대학교, 한국)으로부터 각각 얻었다.
Native-프로모터::PLA 2 α를 지닌 pla2α 변이체의 상보성 실험 및 PLA 2 α 과발현 형질전환 계통의 생성
pla2α 변이체 식물체는 BamHI 자리에 native-프로모터 부분(-1175 부터 +922 까지)을 가지고 있는 PLA 2 α 게노믹 DNA를 포함하고 있는 바이너리 식물 형질전환용 벡터인 pCAMBIA1300 클론을 사용하여 꽃대침지법 (floral dip method)으로 형질전환하여 보완하였다. PLA2α의 세포내로의 위치(아포플라스트 (apoplast)로의 분비가 불가한) 인공적인 변형을 위해서, 신호 펩티드가 없는 pPLA2α::PLA 2 α를 지닌 pCAMBIA1300 벡터를 제작하였고, 아그로박테리움을 이용하여 pla2α 식물체로 도입하였다. PLA 2 α-과발현 형질전환 계통의 생성을 위해, p35S::PLA 2 α를 가지고 있는 pBIG 바이너리 벡터를 야생형 식물체로 도입하였다.
식물체의 세균 접종
Pseudomonas syringae pv. tomato DC3000 (이하 Pst) 및 이의 독성이 없는 avrRpm1 포함 균주인 Pst-avrRpm1은 Y.J.Kim (고려대학교, 한국)로부터 얻었고, 독성이 없는 avrRpt2 포함 균주인 Pst-avrRpt2는 J.M.Park (KRIBB, 한국)으로부터 얻었다. 독성이 없는 avrRps4 포함 균주인 Pst-avrRps4는 R.Innes (Indiana University, 미국)으로부터 얻었다. 세균 균주는 Katagiri 등 (Arabidopsis Book, 2002, 1:e0039)의 방법에 따라 배양하고 처리하였다.
유전자 발현 분석
총 RNA는 RNA isolator (Gibco, 미국)를 사용하여 액체 질소로 얼려두었던 시료(각 샘플당 2개의 잎)로부터 추출하였다. 역전사 중합효소연쇄반응 (RT-PCR) 및 실시간 정량적 중합효소연쇄반응 (real-time qPCR)은 유전자 특이적 프라이머를 사용하여 수행하였다. 실시간 정량적 중합효소연쇄반응 분석은 Applied Biosystems 7900 Real-Time PCR SystemTM 장비를 사용하였다. 2X SYBR® Green qPCR 마스터 믹스를 PCR 증폭에 사용하였다. 분석값은 우선 ACTIN1 유전자의 양으로 표준화하고, 처리에 따른 유전자 발현의 배(fold) 증가는 mock 또는 무처리 식물체(1.0 배)에 비교하여 결정하였다. 대안적인 참조 유전자 (AT1G13320)는 이전의 연구를 통해서 얻었다 (Hong et al., 2010, Plant Cell Physiol. 51:1694-1706). 본 발명에 사용된 유전자 특이적 프라이머는 하기 표 1 및 표 2와 같다.
표 1
Figure PCTKR2015013227-appb-T000001
표 2 실시간 qRT-PCR용 프라이머
유전자명 정방향(5'→3') (서열번호) 역방향(5'→3') (서열번호)
ACS2 ACCTCTTCTCCGAGCATGAA (23) GCCGTCAAAAACAACCCTAA (24)
ACS6 CCATAAGACGATGGAGACAGC (25) ACCGCCTCGTGTCACTAAAG (26)
ACTIN1 CGTACTACCGGTATTGTGCTCGACT (27) GACAATTTCACGCTCTGCTGTGG (28)
AT1G13320 GCGGTTGTGGAGAACATGATACG (29) GAACCAAACACAATTCGTTGCTG (30)
ICS1 CTAACCAGTCCGAAAGACGACCTC (31) CTTCCTTCGTAAGTCTCCCTGCC (32)
JMT GGCCAAAGAGGGTATCATCGAG (33) CCTCACTGATACTCCCACCTTCC (34)
LOX2 CACCATGGAAATCAACGCTCG (35) CTCAGCCAACCCCCTTTTGATG (36)
PAL1 GAACTTATTAGATTCCTTAACGCCGG (37) GGAAACTGGTAATTGCTTCGAGAATC (38)
PDF1.2 GCTTTCGACGCACCGGC (39) CGTAACAGATACACTTGTGTGCTGGG (40)
PLA 2 α TCCATTTCCTTGACTAAAGAATG (41) AGATAATCATTATTCTTGGATTGG (42)
PR1 CATGTGGGTTAGCGAGAAGGCTA (43) CTCACTTTGGCACATCCGAGTCT (44)
VSP1 CCTCGAATCGAACACCATCT (45) GGCACCGTGTCGAAGTTTAT (46)
GUS 활성의 조직 화학적인 분석 및 PLA2α의 아포플라스트로의 이동
조직 화학적인 위치 분석을 위해, PLA 2 α-프로모터::GUS 구조를 가지는 형질전환 애기장대 식물체를 만들었다 (Jung et al., 2012, Front Plant Sci. 3:126). 잎 조직의 감염 자리에 명확한 PLA 2 α 발현을 보여주기 위해서, 빛이 꺼지고 밤조건으로 전환된 3시간 후에 PLA 2 α-프로모터::GUS 형질전환 애기장대 잎의 배축(abaxial)면으로 병원균을 주사기-인필트레이션한 후, 1.5시간 뒤에 Jefferson (EMBO J. 1987, 6:3901-3907) 등의 방법에 따라 조직 화학적인 GUS 분석을 수행하였다.
잎으로부터 지질 추출 및 ESI-MS/MS 분석
총 지질은 이전에 기술된 방법 (Ruy et al., 1996, Biochem Biophys Acta. 1303:243-250)을 통해서 mock 또는 Pst-avrRpm1 세균 현탁액 (1 x 108 CFU ml-1 in 0.018% Silwet L-77)을 분사한 잎 시료(각 샘플당 3개의 식물체로부터 6개의 잎)로부터 추출하였다. 각각의 인지질 (phospholipid) 및 유리지방산 (FFA)은 Kansas Lipidomics Research center에서 ESI-MS/MS 분석을 통해 정량화하였다.
지질, 살리실산 및 재조합 PLA2α 단백질의 처리
모든 인지질은 Avanti Polar Lipids Inc.(미국)으로부터 구매하였고, 유리지방산(16:0, 18:0 및 18:1)은 Sigma Co.(미국)으로부터 구매하였다. 용매를 질소 가스 스트림 (stream) 하에서 건조한 후, 지질을 100 nmol ml-1 in 0.018% silwet L-77 (또는 200 nmol ml-1 in H2O)의 최종 농도가 되도록 초음파 분해를 통해 현탁하였다. LPE (lysophosphatidylethanolamine) 종류 중에서 LPE 18:1은 Pst-avrRpm1 접종에서 가장 크게 증가하였기 때문에, 본 발명에서 사용되었다.
재조합 PLA2α 단백질의 성숙한 형태는 Dsbc 단백질과 융합된 대장균에서 생산되었고, 이전에 기술된 방법 (Ryu et al., 2005, Biochem Biophys Acta. 1736:144-151)에 따라 친화크로마토그래피 (affinity chromatography)를 통해 정제하였다. PLA2α와 Dsbc가 분리된 단백질 혼합물 또는 Dsbc:PLA2α 융합 단백질(10㎍ml-1)은 주사기 인필트레인션을 통해 pla2α 변이체의 잎에 0.5㎍ 씩 처리하였다. PLA2α의 효소 활성은 50mM Tris·HCl(pH 8.5)에 10mM Ca2+, 0.05% Triton X-100을 포함하고 있는 반응 혼합물에 기질 PE를 사용하여 in vitro 분석을 통해 확인하였다. Mock 처리 식물체는 버퍼 (50mM Tris·HCl, pH 8.0) 또는 Dsbc 단백질으로 인필트레이션하였다. PLA2α 활성의 불활성화를 위해서, 재조합 PLA2α를 2μM의 비가역적 억제제인 마노알리드 (manoalide)로 30℃에서 30분 동안 전처리하였다. 마노알리드에 의한 PLA2α 활성의 불활성화는 in vitro 분석으로 확인하였다.
PLA2α의 항균 활성 및 세균으로부터 지질 산물의 방출
PLA2α의 항균 활성을 측정하기 위해, 류 등(Biochem Biophys Acta. 2005, 1736:144-151)의 방법에 따라 생산한 3㎍의 유리 성숙 형태의 재조합 PLA2α를 독성의 Pst(5 x 105 CFU ml-1)가 현탁되어 있는 100㎕의 용액(Tris·HCl(50mM, pH 8.0), 10mM 염화칼슘(CaCl2))에 첨가한다. 세균 샘플은 6시간 동안 28℃에서 약한 교반 상태로 배양한 후, 살아있는 세균만 적정하였다. Mock 대조군은 PLA2α가 없는 용액에 세균이 현탁된 것으로 사용하였다.
살리실산, 에틸렌 및 자스몬산의 정량화 및 NPR1의 전이
살리실산, 자스몬산 및 에틸렌은 이전에 기술된 방법 (Bowling et al., 1994, Plant Cell 6:1845-1857; Heck et al., 2003, Plant J. 36:342-352)에 따라 Pst-avrRpm1 현탁액 (1 x 108 CFU ml-1 in 0.018% Silwet L-77) 또는 LPE (100 nmol ml-1 in 0.018% Silwet L-77 또는 200 nmol ml-1 in H2O)를 살포한 애기장대 잎 시료의 0.5g으로부터 정량화하였다.
NPR1의 전이는 35S::NPR1-eGFP를 지닌 형질전환 식물체에 LPE(100 nmol ml-1 in 0.018% Silwet L-77), 살리실산(0.3 mM in 0.018% Silwet L-77) 또는 mock 용액(0.018% Silwet L-77)을 살포시키고, 6시간 후에 식물체의 잎을 레이저 주사 공초점 현미경 (laser scanning confocal microscope, Zeiss, 독일)으로 관찰하였다.
이온 누출 분석
잎 조직(샘플당 4개의 잎)을 수확하고, 멸균수로 5분 동안 진공 인필트레이션한 후, 상온에서 2시간 동안 교반하며 배양하였다. 샘플에서의 전해질 (electrolyte) 누출의 정도는 도전율계 (conductivity meter, Mettler Toledo, 스위스)를 사용하여 측정하였다. 총 전해질 누출의 퍼센트로 보여지는 데이터는 동결 후에 6시간 동안 교반하며 상온에서 융해함으로써 얻었다.
통계
Student's t-test는 그룹간에 통계학적인 의의를 결정하기 위해 사용하였다. 세균 성장 분석 및 이온 누출 분석의 데이터는 평균±표준편차로 나타내었으며, 유의값은 *P<0.05; **P<0.01이다. 그 외 다른 모든 데이터들은 평균±표준오차로 표시하였으며, *P<0.05; **P<0.01이다.
슈도모나스 지질 추출액으로부터 LPE18:1의 제조
슈도모나스 세포 배양물을 동결건조한 후 2mg을 물에 녹여 5초간 초음파분해(sonication) 하여 슈도모나스 기질을 얻었다. 이후 시판용 포스포리파아제 A2 (분말 형태)를 물에 녹여 20 ㎕를 취하였다. 상기 슈도모나스 기질 20㎕, 포스포리파아제 A2 효소 20㎕ 및 반응버퍼 (50 mM Tris-HCl, 10 mM CaCl2, 0.05% Triton X-100) 160㎕의 혼합물을 30℃에서 30분간 반응시켰다. 이후 750㎕의 Chl:MeOH(1:2)를 첨가하여 반응을 멈추고, 200㎕ 클로로포름 및 200㎕의 KCl(2M)을 첨가하여 원심분리 후, 상층액을 제거하여 LPE 18:1을 획득하였다.
실시예 1. pla 2 α 변이체에서 국소적 저항 유전자 유도 면역 반응의 손상
식물 방어 반응에서 분비형 PLA2α 단백질의 세포내 기능을 확인하기 위해, TAIR로부터 pla2α 변이체인 pla2α(녹아웃) 및 pla2α-Ⅱ(녹다운)를 얻었다. 정상 생장 조건하에서 pla2α 변이체는 야생형 식물체와 표현형적으로 다르지 않았다. 하지만, pla2α 변이체에서 Pst-avrRpm1에 대한 국소적 면역 반응이 손상된 것이 확인되었고(도 1A, 1B, 1E 및 1F), 독성의 Pst에 대한 pla2α 변이체의 기본적인 저항성은 약하게 손상된 것이 관찰되었다(도 1E). 비록 pla2α 변이체가 독성이 없는 세균에 대해서 정상적인 과민성 반응(HR, hypersensitive response)을 보였지만(도 1C), 야생형 식물체와 비교해서 적절하게 세균 성장을 제한하는 데는 실패하였다(도 1B, 1E 및 1F). qRT-PCR 분석 또한 야생형에 비해서 pla2α 변이 식물체가 훨씬 낮은 수준의 Pst-avrRpm1 유도 방어 유전자 발현 경향을 보여주었다(도 1D). 그러나, pla2α 변이체가 native-프로모터::pla2α 구조로 형질전환 방법에 의해 보완되면, Pst-avrRpm1의 성장 제한 능력이 복구되었다(도 1E). pla2α 변이체는 Pst-avrRpm1로 접종하면 국소적인 면역 반응을 시작할 수 없을 뿐만 아니라, Pst-avrRpt2 또는 Pst-avrRps4에 대한 반응도 불가했다(도 1F). 이러한 결과들은 pla2α 단백질이 CC-NB-LRR(coiled-coil nucleotide-binding site-leucine-rich repeat) 및 TIR-NB-LRR(toll-interleukin1 receptor-nucleotide binding-leucine rich repeat) 타입 저항 유전자 모두를 통해서 유도되는 면역 반응에 관여함을 의미했다.
실시예 2. 저항성 반응을 매개하는 유전자 PLA 2 α의 발현과 LPE 수준 증가
야생형 식물체에서, PLA 2 α는 낮은 수준으로 발현된다. PLA 2 α 발현은 Pst-avrRpm1 접종에 따라 신속하고 적정하게 유도되지만, 독성의 Pst 접종에 대한 반응에서는 약하게 유도되어(도 2A), PLA 2 α 발현이 저항성 반응을 매개함을 암시했다. 유사한 결과가 pPLA2α::GUS 분석에서도 관찰되었는데, PLA 2 α 프로모터가 Pst-avrRpm1 접종에 반응하여 활성화되었지만, 독성의 Pst에 의해서는 활성화되지 않았다(도 2B). 예상대로, mock 접종 식물체와 비교해서 Pst-avrRpm1를 접종한 야생형 식물체에서 LPE와 같은 PLA2α의 지질 산물의 상당한 증가가 접종 3시간 후에 확인되었다(도 2C). LPG (lysophosphatidylglycerol)와 LPC (lysophosphatidylcholine)도 약하게 증가되는 것이 확인되었다. 독성의 Pst를 접종하면, LPE의 증가는 확인되지 않고, LPC와 LPG만 약하게 증가되는 것이 확인된다(도 2C). 이러한 결과들은 LPE의 증가된 생산은 독성이 없는 Pst의 접종에 대한 특이한 반응임을 의미한다. 반대로, pla2α 변이체는 Pst-avrRpm1 접종에 대한 반응에서 증가된 LPE 생산을 보여주지 않았다(도 2D). Mock 처리 식물체와 비교하여 Pst-avrRpm1에 감염된 야생형 식물체의 잎에서 증가된 LPE 종류들은 LPE18:1, LPE18:2, LPE18:3 및 LPE16:1이었다(도 2E). LPE18:1 및 LPE16:1은 mock 처리 식물체에서는 거의 확인되지 않았지만, Pst-avrRpm1 처리 잎에서 매우 증가된 것이 관찰되었다(도 2E). LPE18:1 및 LPE16:1은 애기장대 잎 조직에서는 거의 없는 지질 종류임이 보고되었다 (Devaiah et al., 2006, Phytochemistry 67:1907-1924). 그래서 본 발명자들은 이러한 지질 산물들이 침입한 세균의 막으로부터 유래된 것인지를 확인해보았다. 세균 감염은 PLA2α의 세포질 골지체로부터 아포플라스트로의 이동을 자극한다. PLA2α는 침입하는 세균에 대한 항균 활성을 보였다(도 2G). Pst-avrRpm1 현탁액 또는 Pst-avrRpm1의 지질 추출물을 재조합 PLA2α 단백질과 함께 배양하면, LPE18:1, LPE16:0 및 LPE16:1이 실제로 세균 또는 세균 지질 추출물로부터 방출되었다(도 2F). LPE 종류들의 일부가 침입한 병원균으로부터 유래한 것에 대한 보다 직접적인 증거를 얻기 위해, Pst-avrRpm1 세균을 [14C]-에탄올아민으로 방사선 표지하였고, 이를 야생형 식물체의 잎에 접종하였다. 접종 3시간 후에 잎을 수확하고, 감염된 잎의 지질 추출물을 박층크로마토그래피 (TLC)로 분리하였다. 세균 접종 후 바로 수확한 대조군(0시간)에서는 방사능의 대부분이 PE 스팟 구역에서 검출되었고, LPE 스팟 구역(0.6%)에서는 확인되지 않았다. 그러나 총 방사능의 약 9%가 세균 접종 3시간 후에 LPE 스팟 구역에서 검출되었고(도 2H), pla2α 변이 식물체에서는 훨씬 적은 방사성 LPE(~3%)가 발견되었다. 이상의 결과는 일부 LPE가 침입한 병원균의 막으로부터 생성되었음을 의미했다. 또한, 어떤 종류의 LPE가 PLA2α 효소 활성에 의해 숙주 세포로부터 생성되는지를 조사하였다. 재조합 PLA2α 단백질을 야생형 식물체의 잎으로 인필트레이션하면, 처리 3시간 째에 LPE16:0이 대부분이고 소량의 LPE18:1, LPE18:2 및 LPE18:3이 검출되었다(도 2F). 이 결과는 Pst-avrRpm1 감염에 대한 반응에서 증가된 LPE의 주요한 종류인 LPE18:1이 숙주 세포의 막으로부터 소량 방출되나 대부분이 침입하는 병원균에서 유래됨을 제시했다.
야생형 잎에 Pst-avrRpm1를 접종하면 LPE 수준이 mock 처리 잎에 존재하는 양에 비해 35% 증가한다(도 2C). pla2α 변이 식물체의 잎에 세균 접종 2.5시간 후에 재조합 PLA2α로 인필트레이션한 경우에, 잎에서 30분 후에 LPE 수준이 100% 정도 증가되는 것을 관찰할 수 있었다(도 2D).
실시예 3. pla2α 변이체의 면역 반응 결함과 외인성 LPE18:1 처리에 의한 면역반응 회복
야생형과 비교한 pla2α 변이 식물체의 분석을 기반으로, pla2α 변이 식물체의 면역 반응의 결함이 하위 면역 반응을 매개하는 지질 산물의 생성 실패에 기인한 것으로 가정하였다. 이 가정을 확인하기 위해, Pst-avrRpm1 접종 1.5시간 후에 LPE18:1를 pla2α 변이체에 처리하여 보충하였다. 실제로, LPE는 pla2α 변이체의 국소적 면역 반응 유도 및 과민성 반응 지역 너머로 질병 증상의 전파를 제한하는 능력을 복구시켰다(도 3A 및 3B). 매우 중요하게, LPE 자체가 독성이 없는 Pst의 부재에서 국소적 면역력을 증가시켰다(도 3C-3E). LPE는 PR 유전자인 PR1PDF1.2의 발현을 유도하였지만, 상처 관련 유전자인 VSP1JMT의 발현은 유도하지 않았다(도 3C). 세균의 부재에서 LPE에 의한 국소적 면역력의 획득은 mock 처리군에 비해 야생형 식물체 뿐만 아니라 pla2α 변이 식물체에서 LPE 처리가 독성의 Pst의 세균 성장을 억제하는 결과에 의해 증명되었다(도 3D). 게다가, 질병의 증상이 LPE를 살포한 잎에서 mock 처리군보다 훨씬 완화된 것을 확인할 수 있었다(도 3E). 이러한 결과들은 pla2α 변이체의 결함이 하위 면역 반응을 촉발하는 LPE18:1과 같은 지질 매개제 생산의 실패 때문임을 지지한다.
실시예 4. PLA2α와 LPE가 매개하는 ICS1 및 NPR1 의존적 살리실산 신호전달 과정
ICS1은 색소체에 위치하며, 숙주의 면역 반응에서 살리실산 생합성의 주요 효소로서 작용한다. pla2α 변이 식물체에 Pst-avrRpm1을 접종했을 때, 야생형 식물체와 비교하여 ICS1의 발현이 감소되었다(도 4A). 또한, Pst-avrRpm1으로 접종한 pla2α 변이 식물체는 야생형보다 살리실산의 수준이 매우 낮았다(도 4B). 본 발명자들은 LPE를 포함한 지질 산물의 생성이 없는 pla2α 변이체는 독성이 없는 세균의 도전에 대한 반응에서 ICS1을 발현하지 못하고, 이러한 결함은 살리실산의 수준을 낮추어 PR 유전자 발현에 이르는 하위 시그날 증폭 유도가 실패될 것이라는 가설을 세웠다. 상기 가정을 검정하기 위해, 외인성의 LPE 처리가 ICS1 발현을 유도하는지 확인해보았다. LPE18:1로 처리한 애기장대 잎은 처리 후 4시간째에 ICS1 유전자 발현을 보여주었으나 PAL1 발현을 증가시키지는 못했다(도 4C). ICS1 유전자 발현은 대조구에 비해 살리실산 생성을 2.5배 증가시켰다(도 4D). 이러한 결과들은 LPE가 ICS1-매개 살리실산 생합성 유도를 통해 살리실산 수준을 우선적으로 증가시킴을 의미했다.
NPR1은 PR1 유전자 발현을 이끄는 살리실산 매개 면역 반응의 중요 조절자이다. NPR1 활성화는 살리실산에 의하여 세포질로부터 핵으로 NPR1이 이동하는 것을 말한다. NPR1 활성화는 살리실산에 의해 매개되기 때문에, LPE 유도에 의한 살리실산의 증가는 NPR1을 활성화시킬 수 있을 것이다. 35S::NPR1-eGFP를 지닌 형질전환 식물체에 LPE의 적용은 실제로 살리실산 처리와 같은, 세포질로부터 핵으로의 단백질 이동 유도를 통해 NPR1을 활성화시켰다(도 4E). 이상의 결과들은 LPE가 저항 유전자 유도 살리실산 생합성에 이어, NPR1 활성 및 PR1 유전자 발현을 매개할 것이라는 가설을 증명한다.
실시예 5. PLA2α와 LPE가 매개하는 에틸렌 의존적 방어 신호전달 과정
pla2α 변이체는 또한 Pst-avrRpm1 접종에 대한 반응에서 자스몬산 및/또는 에틸렌에 의해 매개되는 것으로 알려진 PDF1.2의 발현에도 결함이 확인되었다(도 1D). pla2α 변이 식물체는 에틸렌 생합성 유전자인 ACC 신타제 (ACS)의 발현도 손상되었고, Pst-avrRpm1 접종에 대한 반응에서 에틸렌 생산이 감소되었다(도 5A 및 5B). 그에 반해서, 변이 식물체는 야생형과 비교해서 자스몬산의 수준에는 큰 차이 없이 LOX2의 약화되지 않은 발현을 보여주었다(도 5A 및 5C). LPE를 처리한 애기장대 잎은 ACS 유전자 발현을 보여주며 에틸렌 수준의 증가를 보여주었지만, LOX2 유전자 발현 또는 자스몬산 수준에는 큰 증가가 확인되지 않았다(도 5D-5F). 이상의 결과들은 국소적인 면역 반응동안에 에틸렌 의존적인 PDF1.2의 발현 또한 PLA2α 및 그의 지질 산물들에 의해 매개됨을 의미했다.
실시예 6. 식물 면역 반응에서 일어나는 PLA2α 유래 지질 신호전달 기작
앞서 서술한 결과들은 일관되게 pla2α 변이 식물체의 국소적인 숙주 면역 반응의 결함이 PLA2α의 저항 유전자 유도 면역 반응을 매개하는 LPE와 같은 지질 산물들의 생산 실패에서 기인된다는 가설을 지지했다. 상기 가설을 지지하여, pla2α 변이체의 잎에 재조합 PLA2α 단백질의 외부적인 처리는 LPE를 포함하는 내인성의 지질 산물을 생산하였고(도 2D), ICS1PR1 유전자의 in situ 발현을 유도하였다(도 6C). 반면에, PLA2 저해제인 마노알리드 (manoalide)로 촉매 반응을 일으켜 비활성화시킨 재조합 PLA2α 단백질의 처리는 PR1 유전자 발현 유도에 실패하였다(도 6D).
상기의 결과들을 토대로, PLA2α 유래 지질-기반 시그날링은 다음과 같이 작동됨을 제안할 수 있다. 독성이 없는 Pst의 접종에 의한 저항 유전자 매개 방법에 있어서 PLA2α는 급격하고 일시적으로 발현되며, 침입한 세균과 숙주 세포의 막으로부터 LPE를 포함하는 지질 산물이 생성되는 장소인 아포플라스트로 방출된다. 그 후 LPE는 PR1 유전자 발현을 이끄는 ICS1/NPR1-의존적 살리실산 신호 체계 및 PDF1.2 유전자 발현을 이끄는 ACS-의존적 에틸렌 신호 체계를 통해서 저항 유전자 유도 하위 면역 반응을 촉진한다(도 7).
실시예 7. 슈도모나스 지질 추출액으로부터 LPE18:1의 제조 확인
슈도모나스 시린개(Pseudomonas syringae)를 대량 배양하여 수확한 후 지질을 추출하였다. 이러한 인지질 추출물에 포스포리파아제 A2 (phospholipase A2)를 처리한 후, HPLC-ELSD 분석법을 이용하여 PE(phosphatidylethanolamine)가 분해되고 LPE (lysophosphatidylethanolamine)이 생성되는지 여부를 확인하였다(도 9). PLA2 처리 전에는 9분 retention time의 PE 피크만 보이고 12.5분 retention time LPE 피크는 미미하게 보였지만(도 9의 상단 크로마토그램), PLA2 처리 후에는 9분 retention time의 PE 피크는 사라지고, 12.5분 retention time의 새로운 LPE 피크가 생겨난 것을 박스로 표시하였다(도 9의 하단 크로마토그램). 따라서, 슈도모나스 시린개로부터 분리된 인지질에 포스포리파아제 A2를 처리하면 LPE를 생성함을 알 수 있었다. MS/MS 분석을 통하여 슈도모나스 시린개에 PLA2를 처리한 후 생성된 LPE의 주요 구성원이 LPE18:1과 LPE16:0임을 확인할 수 있었다 (도 10).
또한, 다른 미생물로부터도 LPE18:1을 생산할 수 있는지를 알아보기 위해서, 슈도모나스 카에니(Pseudomonas caeni), 슈도모나스 플루오레센스(Pseudomonas fluorescens), 슈도모나스 푸티다(Pseudomonas putida)에서 인지질을 추출한 결과 LPE의 원소재가 되는 PE 함량이 실험한 슈도모나스 모든 종에서 상당히 많았으며(도 11), PLA2 효소를 처리하였을 때 LPE18:1이 대량 생성되는 것을 확인하였다(도 12 내지 도 14).
실시예 8. 슈도모나스 이외의 다른 미생물에서 PE 생산 가능성 검정
슈도모나스 외 다른 미생물로부터도 LPE18:1을 생산할 수 있는지를 알아보기 위해서, 그람 음성 세균인 대장균(Escherichia coli), 그람 양성 세균인 바실러스 서틸리스(Bacillus subtilis), 아쓰로박터 시트레서스(Arthrobacter citresus) 및 효모인 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 및 조류인 클로렐라 불가리스(Chlorella vulgaris)에서 인지질을 분리 분석한 결과, 대장균 외의 다른 미생물에서는 LPE의 원소재인 PE가 거의 검출되지 않았다(도 15). 대장균에서 어느 정도의 PE가 추출되었으나 PLA2를 처리한 결과 오직 LPE16:0만 생성되었다(도 16). 따라서, 슈도모나스를 제외한 다른 미생물에서, 최소한 조사한 미생물에서는, LPE18:1을 생성할 수 있는 PE를 확보하는 것이 어렵다는 것을 알 수 있었다.

Claims (6)

  1. (a) 슈도모나스 속(Pseudomonas sp.) 미생물을 대량 배양한 후 수확하여 인지질을 추출하는 단계;
    (b) 상기 (a) 단계의 추출된 인지질에 포스포리파아제 A2 (phospholipase A2)를 처리하여 리소포스파티딜에탄올아민 (lysophosphatidylethanolamine)을 생성하는 단계; 및
    (c) 상기 (b) 단계의 생성된 리소포스파티딜에탄올아민을 분리 및 정제하는 단계를 포함하는 리소포스파티딜에탄올아민의 대량 생산 방법.
  2. 제1항에 있어서, 상기 리소포스파티딜에탄올아민은 주요성분이 리소포스파티딜에탄올아민 18:1인 것을 특징으로 하는 방법.
  3. 제1항에 있어서, 상기 슈도모나스 속 미생물은 슈도모나스 카에니(Pseudomonas caeni), 슈도모나스 플루오레센스(Pseudomonas fluorescens), 슈도모나스 푸티다(Pseudomonas putida) 또는 슈도모나스 시린개(Pseudomonas syringae)인 것을 특징으로 하는 방법.
  4. 제1항에 있어서, 상기 인지질은 포스파티딜에탄올아민 (phosphatidylethanolamine)인 것을 특징으로 하는 방법.
  5. 제4항에 있어서, 상기 포스파티딜에탄올아민은 첫 번째 위치의 아실 체인이 18:1인 것을 특징으로 하는 방법.
  6. 제1항에 있어서, 상기 포스포리파아제 A2 는 동물, 미생물 또는 식물 유래인 것을 특징으로 하는 방법.
PCT/KR2015/013227 2014-06-24 2015-12-04 슈도모나스 속 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법 Ceased WO2016208831A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201580081236.5A CN107787369B (zh) 2014-06-24 2015-12-04 由假单胞菌属微生物生产溶血磷脂酰乙醇胺18:1的方法
US15/852,864 US10030256B2 (en) 2014-06-24 2017-12-22 Method for producing lysophosphatidylethanolamine 18:1 from microorganism of Pseudomonas sp

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
KR20140077359 2014-06-24
KR1020150089016A KR101661706B1 (ko) 2014-06-24 2015-06-23 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법
KR10-2015-0089016 2015-06-23

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/852,864 Continuation-In-Part US10030256B2 (en) 2014-06-24 2017-12-22 Method for producing lysophosphatidylethanolamine 18:1 from microorganism of Pseudomonas sp

Publications (1)

Publication Number Publication Date
WO2016208831A1 true WO2016208831A1 (ko) 2016-12-29

Family

ID=55164313

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/013227 Ceased WO2016208831A1 (ko) 2014-06-24 2015-12-04 슈도모나스 속 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법

Country Status (4)

Country Link
US (1) US10030256B2 (ko)
KR (1) KR101661706B1 (ko)
CN (1) CN107787369B (ko)
WO (1) WO2016208831A1 (ko)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101661706B1 (ko) * 2014-06-24 2016-10-04 한국생명공학연구원 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법
KR102343292B1 (ko) * 2019-10-21 2021-12-27 한국생명공학연구원 식물바이러스병 증상을 완화시키는 리소-포스파티딜에탄올아민 18:2를 포함하는 조성물 및 이의 용도
KR102368228B1 (ko) * 2020-04-14 2022-02-25 황성기 사물기생 병원체에 대한 식물체 면역증강용 조성물
KR102942853B1 (ko) 2023-01-31 2026-03-23 유한회사 아워바이오 식물의 생리대사를 특이적으로 활성시키는 천연지질 및 그의 이용

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010048900A (ko) * 1999-11-30 2001-06-15 최승철 리소포스파티딜에탄올아민의 제조방법
US6426105B1 (en) * 1997-11-10 2002-07-30 Wisconsin Alumni Research Foundation Use of lysophosphatidylethanolamine (18.1) and lysophosphatidylinositol to retard senescence and to enhance fruit ripening
KR20030084200A (ko) * 2002-04-25 2003-11-01 주식회사 두산 비 유기용매시스템에서의 포스파티딜에탄올아민 및리소포스파티딜에탄올아민의 제조방법 및 그 방법으로제조된 리소포스파티딜에탄올아민을 포함하는 수용성 조성물
KR20130005770A (ko) * 2011-07-07 2013-01-16 충남대학교산학협력단 항염증 활성을 갖는 리소포스파티딜에탄올아민 유도체 또는 이의 약학적으로 허용가능한 염, 이의 제조방법 및 이를 유효성분으로 함유하는 항염증 조성물

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0313512B1 (de) 1987-08-21 1992-11-25 Ciba-Geigy Ag Benzothiadiazole und ihre Verwendung in Verfahren und Mitteln gegen Pflanzenkrankheiten
US5110341A (en) 1990-04-18 1992-05-05 Wisconsin Alumni Research Foundation Plant and fruit treatment with lysophosphatidylethanolamine
US5126155A (en) 1990-04-18 1992-06-30 Wisconsin Alumni Research Foundation Plant and fruit treatment with lysophosphatidylethanolamine
US6559099B1 (en) 2000-03-29 2003-05-06 Wisconsin Alumni Research Foundation Methods for enhancing plant health, protecting plants from biotic and abiotic stress related injuries and enhancing the recovery of plants injured as a result of such stresses
UA109884C2 (uk) * 2009-10-16 2015-10-26 Поліпептид, що має активність ферменту фосфатидилінозитол-специфічної фосфоліпази с, нуклеїнова кислота, що його кодує, та спосіб його виробництва і застосування
KR101661706B1 (ko) * 2014-06-24 2016-10-04 한국생명공학연구원 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6426105B1 (en) * 1997-11-10 2002-07-30 Wisconsin Alumni Research Foundation Use of lysophosphatidylethanolamine (18.1) and lysophosphatidylinositol to retard senescence and to enhance fruit ripening
KR20010048900A (ko) * 1999-11-30 2001-06-15 최승철 리소포스파티딜에탄올아민의 제조방법
KR20030084200A (ko) * 2002-04-25 2003-11-01 주식회사 두산 비 유기용매시스템에서의 포스파티딜에탄올아민 및리소포스파티딜에탄올아민의 제조방법 및 그 방법으로제조된 리소포스파티딜에탄올아민을 포함하는 수용성 조성물
KR20130005770A (ko) * 2011-07-07 2013-01-16 충남대학교산학협력단 항염증 활성을 갖는 리소포스파티딜에탄올아민 유도체 또는 이의 약학적으로 허용가능한 염, 이의 제조방법 및 이를 유효성분으로 함유하는 항염증 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
COWAN, A. KEITH: "Plant Growth Promotion by 18:0-lyso-phosphatidylethanolamine Involves Senescence Delay", PLANT SIGNALING AND BEHAVIOR, vol. 4, no. 4, 2009, pages 324 - 327, XP055341011 *

Also Published As

Publication number Publication date
CN107787369A (zh) 2018-03-09
KR101661706B1 (ko) 2016-10-04
US20180105849A1 (en) 2018-04-19
CN107787369B (zh) 2020-11-06
KR20160000436A (ko) 2016-01-04
US10030256B2 (en) 2018-07-24

Similar Documents

Publication Publication Date Title
Yu et al. Increased ratio of galactolipid MGDG: DGDG induces jasmonic acid overproduction and changes chloroplast shape
Yang et al. AtPLAI is an acyl hydrolase involved in basal jasmonic acid production and Arabidopsis resistance to Botrytis cinerea
Farmer et al. Fatty acid signaling in Arabidopsis
Chary et al. Superoxide dismutase (sod-1) null mutants of Neurospora crassa: oxidative stress sensitivity, spontaneous mutation rate and response to mutagens.
Trull et al. An Arabidopsis mutant missing one acid phosphatase isoform
WO2016208831A1 (ko) 슈도모나스 속 미생물로부터 리소포스파티딜에탄올아민 18:1의 생산 방법
CN101686705A (zh) 来自Bacillus thuringiensis的半翅目和鞘翅目活性的毒素蛋白
Louis et al. Antibiosis against the green peach aphid requires the Arabidopsis thaliana MYZUS PERSICAE‐INDUCED LIPASE1 gene
Guo et al. Fengycin produced by Bacillus subtilis NCD-2 is involved in suppression of clubroot on Chinese cabbage
O'Sullivan et al. A galactolipase activity associated with the thylakoids of wheat leaves (Triticum aestivum L.)
US7041678B2 (en) Alkaloid that inhibits biosynthesis of mycotoxins and method for screening for mycotoxin inhibitors
HU216645B (hu) Eljárások dezacetiláz-gének izolálására és alkalmazására
Meng et al. Pseudomonas thivervalensis K321, a promising and effective biocontrol agent for managing apple Valsa canker triggered by Valsa mali
Zou et al. Extracellular self-DNA as a DAMP signal for induced systemic resistance to anthracnose rot in postharvest loquat fruit via EjRAV2-EjERF39 module
Ellis et al. SDS-PAGE analysis of bud-forming cotyledons of Pinus ponderosa
KR20090128239A (ko) 대장균 특이적 박테리오파아지 및 이를 이용한 대장균오염의 예방 또는 통제 방법
KR20150124586A (ko) 스트렙토코커스 파라우베리스 감염을 방지 및 처치하는 방법
US20120015404A1 (en) Gene cluster for thuringiensin synthesis
Godiard et al. Differential regulation in tobacco cell suspensions of genes involved in plant-bacteria interactions by pathogen-related signals
Watanabe et al. Detection and molecular analysis of plant-and insect-associated bacteria harboring aconitate isomerase involved in biosynthesis of trans-aconitic acid as antifeedant in brown planthoppers
KR100745832B1 (ko) 식물의 곰팡이 저항성을 갖는 glip1 유전자 및 그단백질
Kwon et al. Biotic and abiotic stresses induce AbSAMT1, encoding S-adenosyl-L-methionine: salicylic acid carboxyl methyltransferase, in Atropa belladonna
Hussain et al. Replication of cauliflower mosaic virus DNA in leaves and suspension culture protoplasts of cotton
McClean et al. Genetic loci involved in rubrifacine production in the walnut pathogen Brenneria rubrifaciens
Nejad et al. Factors influencing pathogenic ice-nucleation active (INA) bacteria isolated from Salix plants, soil and litter

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15896465

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15896465

Country of ref document: EP

Kind code of ref document: A1