WO2016171625A1 - Ciblage de la télomérase pour la thérapie cellulaire - Google Patents

Ciblage de la télomérase pour la thérapie cellulaire Download PDF

Info

Publication number
WO2016171625A1
WO2016171625A1 PCT/SG2016/050190 SG2016050190W WO2016171625A1 WO 2016171625 A1 WO2016171625 A1 WO 2016171625A1 SG 2016050190 W SG2016050190 W SG 2016050190W WO 2016171625 A1 WO2016171625 A1 WO 2016171625A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
htert
gene
stem cell
cell
Prior art date
Application number
PCT/SG2016/050190
Other languages
English (en)
Inventor
Shang LI
Chang Ching LIU
Patrick Boon Ooi TAN
Eyleen Lay Keow GOH
Dongliang MA
Original Assignee
National University Of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University Of Singapore filed Critical National University Of Singapore
Publication of WO2016171625A1 publication Critical patent/WO2016171625A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • the present invention relates to stem cell technology. More particularly, the present invention relates to inducing telomerase knockout in stem cells to limit their life span whilst retaining pluripotency until differentiated. As a result they can be banked with a predetermined lifespan and have reduced ability to cause tumor formation if used in therapy.
  • pluripotent stem cells share cellular and genetic similarity with tumor cells; such as unlimited potential for cell proliferation, rapid cell proliferation rate and a propensity for genomic instability when cultured in vitro (Baker, D. E. et al. Nat Biotechnol 25, 207-215 (2007)).
  • pluripotent stem cells can form teratomas when injected into immunodeficient mice (Blum, B. & Benvenisty, N. Stem Cells 25, 1924-1930 (2007)), and as little as a few hundred pluripotent stem cells are sufficient (Lee, A. S. et al.
  • stem cells may potentially develop into more malignant teratocarcinomas (Blum, B. & Benvenisty, N. Advances in cancer research 100, 133-158 (2008)), raising the legitimate concern of safety in clinical applications.
  • a recent report indicates the possibility of donor-derived tumor development following transplantation of undifferentiated neural stem cells (Amariglio, N. et al. PLoS medicine 6 (2009)).
  • undifferentiated stem cells show a high propensity to accumulate chromosome aberrations during in vitro culture.
  • the differentiated cells derived from stem cells may themselves also acquire genetic mutations and tumorigenicity during in vitro culture. Therefore, the technical burden of separating differentiated cells from undifferentiated stem cells, as well as ensuring the genetic stability of differentiated cells, remain major challenges for the clinical application of cell therapy.
  • An unlimited proliferation potential is a hallmark of cancer and is shared by stem cells. In order to proliferate continuously, cells need to find a way to maintain their telomere, a special nucleoprotein complex found at the ends of human linear chromosomes (Blackburn, E. H. Nature 408, 53-56 (2000)).
  • telomeres Human chromosome ends are capped by telomeres that contain long six-nucleotide DNA repeats 5'- TTAGGG-3 with single stranded 3' G-rich overhangs.
  • the telomeric DNA repeats are bound by shelterin protein complexes consisting of TRF1 , TRF2, RAP1 , TIN2, TPP1 and POT1 that distinguish naturally occurring chromosomal ends from DNA double- strand breaks. Therefore, telomeres are essential for cell genomic stability.
  • Telomeres are synthesized by telomerase, a reverse transcriptase that contains two core components: a catalytic protein, hTERT, and a RNA, hTER (Feng, J. et al. Science 269, 1236-1241 (1995); Nakamura, T. M. et al. Science 277, 955-959
  • telomere RNA (1997) ). Although the telomerase RNA (hTER) is widely expressed, the catalytic protein hTERT and, consequently, telomerase activity are hardly detectable in the majority of adult human cells, with the exception of stem cells and germ cells (Feng, J. et al. Science 269, 1236-1241 (1995); Nakamura, T. M. et al. Science 277, 955- 959 (1997); Kim, N. W. et al. Science 266, 2011-2015 (1994); Wright, W. E. et al. Dev Genet 18, 173-179 (1996)). Normal somatic cells only have a limited proliferation potential that is controlled by their telomere length (Hayflick, L. & Moorhead, P. S.
  • pluripotent stem cells share unlimited proliferation capacity with cancer cells, expressing high telomerase activity for telomere maintenance (Thomson, J. A. et al. Science 282, 1 145-1147
  • the novel strategy described herein involves engineering telomerase null stem cells with limited lifespan and reduced tumorigenic potential.
  • At least one isolated pluripotent telomerase activity null stem cell comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene, wherein said at least one telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
  • hTERT human telomerase reverse transcriptase
  • hTER human telomerase RNA
  • a preferred embodiment of the invention provides at least one isolated pluripotent inducible telomerase activity knockout stem cell, comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene; wherein said alleles comprise an introduced and removable portion of said hTERT or hTER gene.
  • hTERT human telomerase reverse transcriptase
  • hTER human telomerase RNA
  • the at least one isolated pluripotent inducible telomerase activity knockout stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length.
  • Another embodiment of the invention provides at least one isolated pluripotent telomerase activity null stem cell, wherein the pluripotent inducible telomerase activity knockout stem cell described supra has been further contacted with a knockout inducer to remove said introduced removable gene portion thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
  • the isolated pluripotent inducible telomerase activity knockout stem cell described supra wherein said removable portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cell causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, telomerase activity.
  • At least one isolated pluripotent telomerase activity null stem cell wherein said telomerase activity null stem cell has been produced by exposing at least one isolated pluripotent stem cell to a CRISPR-Cas or other synthetic nuclease system to knock out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene, thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
  • hTERT human telomerase reverse transcriptase
  • hTER human telomerase RNA subunit
  • the at least one isolated pluripotent stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length prior to exposure to CRISPR-Cas or other synthetic nuclease system.
  • Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells with limited lifespan and reduced tumorigenicity compared to wild type cells, comprising the steps of:
  • telomere activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene;
  • telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene; and (c) selecting telomerase activity null cells with an average telomere length evaluated to be 5 kb or less and a reduced ability to form a teratoma in vivo; or
  • Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use, comprising: evaluating the average telomere length and/or in vivo tumorigenicity of said pluripotent stem cells in which the human telomerase reverse transcriptase (hTERT) or the human telomerase RNA (hTER) activity has been inactivated; and identifying said pluripotent stem cells as suitable for clinical use if said evaluated average telomere length is about 5 kb or less and/or said cells have reduced ability to form a teratoma in vivo.
  • hTERT human telomerase reverse transcriptase
  • hTER human telomerase RNA
  • Another aspect of the invention provides the use of at least one isolated pluripotent telomerase activity null stem cell as described supra for the preparation of a therapeutic composition for cell therapy of a subject in need thereof.
  • the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one of ectodermal, endodermal or mesodermal lineage.
  • the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one lineage selected from the group comprising neurons, astrocytes and/or glia and hematopoietic cells.
  • Figure 1 shows the engineering of ZFNs and TALENs for gene targeting.
  • Figure 2 shows a schematic design of the gene targeting strategy used to introduce loxP sites flanking the exon 1 and exon 2 of hTERT genomic locus.
  • Figure 3 demonstrates the increased stability of the targeting vector that can be achieved with mutated ZFNs binding sites.
  • Figure 4 is a schematic representation of the gene targeting procedure in human H1 ES cells, as described in Example 3.
  • Figure 5 A is a Southern blot analysis, using genomic DNA samples that were digested with Xbal and Hindi restriction enzymes, confirming the targeted alleles of hTERT.
  • the probe used for Southern blotting analysis is shown on Figure 2, to the left of the first LoxP site.
  • B). shows the expression of full length hTERT in hTERT (+/+) ; hTERT (+/ -> and hTERT ⁇ ES cells, as analyzed by RNA protection assay (RPA) using 32 P labeled radioactive RNA probe encompassing hTERT exon 2.
  • RPA RNA protection assay
  • telomere shortening in telomerase null human ES cells A). Genomic Southern analysis of telomere length in independent hTERT + + , hTERT + loxP , hTERT loxP/loxP and hTERT " ' " ES cell lines. P2, P4, P6 and P8: indicate that the hTERT "7" ES cells have been passaged 2, 4, 6 and 8 times, respectively. B).
  • Figure 7 show loss of cell proliferation capacity and increased cell death in senescent hTERT (" _) ES cells.
  • Figure 8 demonstrates that transient overexpression of hTERT in hTERT io X p/ioxp ES ce
  • Figure 9 shows telomere shortening of hTERT ";" ES cells derived from hTERT loxP loxP ES cells whose telomere length was reset by transient overexpression of hTERT.
  • OE overexpression; P1 , P5 and P10: indicate the number of passages.
  • Figure 10 provides karyotyping of human ES cell lines, which shows that the cells maintained a normal karyotype.
  • Figures 11A-D show immunocytochemistry analysis of the expression of ES cell markers in hTERT inducible knockout hTERT + + ; hTERT + " and hTERT " '' " ES cells: A). TRA-1 -60; B). SSEA-4; C). OCT-4; and D). NANOG. The cell nuclei were stained with DAPI.
  • Figure 11E sets out the expression of OCT-4, SOX-2, KLF-4, and NANOG in independent hTERT +/+ ; hTERT + " and hTERT “ ' " ES cell lines, as quantified by qRT- PCR and normalized to the expression of GAPDH.
  • the expression level of OCT-4, SOX-2, KLF-4, and NANOG in independent hTERT +/+ is indicated by the dotted line.
  • Figures 12A-12E demonstrate spontaneous differentiation of human hTERT (+/+> and hTERT ("/_) ES cells in vitro into cell lineages of all three germ layers.
  • ectoderm markers Tuj1 and GFAP, respectively; C). and D).
  • mesoderm markers Desmin and ⁇ -SMA, respectively; and E).
  • endoderm marker AFP.
  • Figure 13 A shows the different teratoma formation efficiency in vivo of independent hTERT +/+ (+/+); hTERT +/" (+/-), and three different hTERT " _ (-/-) ES cell lines.
  • telomere of the hTERT _ " (-/-) ES cell line is 3.5 kb, the ability of the ES cells to form teratomas in vivo is completely suppressed.
  • B shows H&E staining of teratomas derived from independent hTERT + + ; hTERT + " , and hTERT _ " ES cell lines.
  • Endoderm respiratory epithelium (e); Mesoderm: cartilage (c) and skeletal muscle (m); Ectoderm: neural epithelium with rosettes (n). Scale bars, 200pm.
  • Figure 14 A is a schematic diagram showing the schedule for induction of neural progenitor cells (NPC) from human ES cells.
  • NPC neural progenitor cells
  • Figures 14B-14E show the differentiation of telomerase null human ES cells to neural lineages in vitro.
  • B). provides representative confocal images showing progenitor cells (identified by Nestin and Sox2 staining) induced from hTERT (+/+) ; hTERT ⁇ , and hTERT ⁇ ES cells.
  • C). provides representative confocal images showing the differentiation of these 3 groups of ES cells to neurons, identified by DCX staining; HuN: human nuclei; D). is a graphical representation of the percentage of DCX positive neurons (total DAPI positive cells) that are differentiated from neuronal progenitor cells induced from the different groups of ES cells, as indicated.
  • E). provides representative confocal images showing the differentiation of these different groups of ES cells to astrocytes, marked by GFAP staining.
  • Figures 15A-F shows effects of injection of hTERT (+ +) (with mean telomere length around 13 kb) and hTERT ⁇ ES cells (with mean telomere length around 3.5 kb) into mouse brain.
  • E). shows the gross morphology of brains from mice injected with hTERT (+/+) ES cells or hTERT ("A) ES cells. Tumor formation was visible in hTERT (+ +) ES but not hTERT ("A) ES-injected mouse brains.
  • F). provides representative confocal images showing human nuclei (HuN) staining of tumors in hTERT (+ +) ES cells-injected mouse.
  • Figure 16 includes representative confocal images showing lack of tumor formation but, instead, in vivo differentiation of hTERT ("/_) ES cells (with mean telomere length around 3.5 kb) into mature neurons.
  • A demonstrates that there is no tumor formation in immunodeficient mouse brain injected with hTERT ("/_) ES cells at 8 and 16 weeks post-injection.
  • B). shows the expression of mature neuronal marker, MAP2a, in hTERT ("A) ES cell-derived neuronal cells in vivo.
  • C). shows the expression of TH, a marker for dopaminergic neurons, in hTERT ("A) ES cell-derived neuronal cells in vivo (marked by arrows).
  • Figure 17 shows the engineering of telomerase-null ES cells (WA018) using the CRISPR-Cas9 system.
  • A) Shows sequences (S1 -S5) of five independent CRISPR guide RNAs targeting hTERT exon 1.
  • B) Cel-I assay showing DNA cleavage induced by the five independent CRISPR guide RNAs S1-S5.
  • iPSC induced pluripotent stem cell
  • pluripotent refers to the potential of a stem cell to make any differentiated cell of an organism. Pluripotent stem cells can give rise to any foetal or adult cell type. However, alone they cannot develop into a foetal or adult organism because they lack the potential to contribute to extraembryonic tissue, such as the placenta.
  • Cre refers to Cre recombinase; a tyrosine recombinase enzyme derived from the P1 Bacteriophage.
  • the enzyme uses a topoisomerase I like mechanism to catalyse the site specific recombination event between two DNA recognition (LoxP) sites.
  • CRISPR-Cas refers to a microbial adaptive immune system that uses RNA-guided nucleases to cleave foreign genetic elements. It comprises clustered regularly interspaced short palindromic repeats (CRISPRs), a CRISPR-associated (Cas) endonuclease and a synthetic guide RNA that can be programmed to identify and introduce a double strand break at a specific site within a targeted gene sequence.
  • the palindromic repeats are interspaced by short variable sequences derived from exogenous DNA targets known as protospacers, and together they constitute the CRISPR RNA (crRNA) array.
  • each protospacer is always associated with a protospacer adjacent motif (PAM), which can vary depending on the specific CRISPR system.
  • PAM protospacer adjacent motif
  • CRISPR-Cas9 is a specific version of the system referring to use of RNA-guided Cas9 nuclease, originally derived from Streptococcus pyogenes, whereby the target DNA must immediately precede a 5'-NGG PAM. Variations of the CRISPR-Cas9 system are known [Ran FA, et al., Nat.
  • FLP refers to FLP recombinase; derived from the baker's yeast Saccharomyces cerevisiae. The enzyme catalyses a site-specific recombination event between two DNA recognition (FRT) sites.
  • FRT refers to a flippase recognition target (FRT) site.
  • the 34bp minimal FRT site sequence has the sequence 5'GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC3' (SEQ ID NO: 1 ), wherein (FLP) binds to both 13-bp 5'-GAAGTTCCTATTC-3' arms flanking the 8 bp spacer.
  • LoxP refers to locus of X-over P1 ; a site on the bacteriophage P1 consisting of 34 base pairs (bp).
  • the site includes an asymmetric 8 bp sequence, variable except for the middle two bases, in between two sets of palindromic 13 bp sequences.
  • the sequence is ATAACTTCGTATAN N NTAN NNTATACGAAGTTAT (SEQ ID NO: 2), wherein ' ⁇ ' indicates bases which may vary.
  • TERT telomerase reverse transcriptase
  • hTERT telomerase reverse transcriptase
  • telomerase reverse transcriptase is a catalytic protein component (or subunit) of the ribonucleoprotein enzyme telomerase which, together with the telomerase RNA component (hTER), comprises the most important unit of the telomerase complex.
  • RNA As used herein, the term "Telomerase RNA” (abbreviated to TERC, TER, hTER, TRC3, TR and hTR) is an RNA, found in eukaryotes that is a component (or subunit) of telomerase, that contains a short segment that provides the template for telomere repeat synthesis. As used herein, the term 'comprising' does not preclude the presence of additional steps or substances in the methods and compositions, respectively, of the invention, and is understood to include within its scope the terms 'consisting of and 'consisting essentially of features defined in the claimed invention.
  • At least one isolated pluripotent telomerase activity null stem cell comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene, wherein said telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
  • a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene, wherein said telomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
  • the specific type of mutation or alteration of the hTERT or hTER gene for the purpose of the invention is not intended to be limited, other than the mutation effects loss of telomerase activity in said stem cell.
  • the mutation may be a substitution, deletion, insertion or any modification of one or more nucleotides, or combination thereof, providing it results in loss of activity.
  • One way of effecting the strategy described herein involves engineering inducible telomerase activity knockout stem cells, using a gene targeting approach, which allows for an unlimited supply of pluripotent genetically-modified stem cells and the convenience to inactivate telomerase activity at the desired time in order to reduce the cells' life-span and reduce tumorigenicity.
  • At least one isolated inducible telomerase activity knockout pluripotent stem cell comprising two mutated alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA (hTER) gene; wherein said alleles comprise an introduced and removable portion of said hTERT or hTER gene.
  • hTERT human telomerase reverse transcriptase
  • hTER human telomerase RNA
  • telomere length may be reduced by introducing a knockout cassette. Once the telomerase activity gene is knocked out the average telomere length may be around 4 kb which may equate to around 20-30 cell divisions remaining before senescence.
  • telomere length in the mutated cells so that, once the activity of the said mutated hTERT or hTER gene is knocked out, the null cells have an increased lifespan so they can be expanded to derive enough cells for clinical use.
  • the at least one isolated inducible telomerase activity knockout stem cell has been further subjected to transient overexpression of hTERT, hTER or both hTERT and hTER to increase the average telomere length.
  • the average telomere length may be increased to any size between about 6 kb and the approximately 12-14 kb or longer of the parental H1 cells.
  • a preferred embodiment relates to an isolated inducible teiomerase activity knockout stem cell as described above, wherein after transient overexpression of hTERT or hTER the average telomere length in the stem cell is increased to at least 6 kb. More preferably, the average telomere length in the isolated inducible teiomerase activity knockout stem cell is increased to at least 9 kb.
  • Another aspect of the invention relates to at least one isolated pluripotent teiomerase activity null stem cell, comprising: at least one inducible teiomerase activity knockout pluripotent stem cell comprising an introduced and removable portion of a hTERT or hTER gene which has been contacted with a knockout inducer to remove said introduced removable gene portion; wherein said teiomerase activity null stem cell has limited lifespan and reduced tumorigenic potential.
  • said portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cell causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, teiomerase activity.
  • Cre/LoxP Cre/LoxP to create inducible knockout.
  • the LoxP sites could be substituted by FRT sites and the respective portion of the gene removed with FLP recombinase.
  • Another way of effecting the strategy described herein involves engineering teiomerase activity knockout stem cells using a gene editing approach.
  • An example of such an approach is use of a CRISPR-Cas system.
  • a CRISPR-Cas system used may be the CRISPR-Cas9 system described by Ran FA, et al., [Nat. Protoc 8: 2281-2308 (2013)] incorporated herein by reference.
  • CRISPR-Cas9 can be engineered to target and insert double strand DNA breaks in the hTERT or hTER gene, as shown in Example 13 herein.
  • At least one isolated pluripotent telomerase activity null stem cell wherein said telomerase activity null stem cell has been produced by exposing at least one isolated pluripotent stem cell to a CRISPR-Cas or other synthetic nuclease system to knock out alleles of a telomerase activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene, thereby resulting in at least one telomerase activity null stem cell with limited lifespan and reduced tumorigenic potential.
  • hTERT human telomerase reverse transcriptase
  • hTER human telomerase RNA subunit
  • the CRISPR-Cas9 system is used.
  • hTERT exon 1 is targeted by CRISPR-Cas using one or more guide RNAs having a nucleic acid sequence selected from the group comprising SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19. More preferably, guide RNAs having the sequences SEQ ID NO: 16 and SEQ ID NO: 17 may be used. If the CRISPR-Cas system is used the resulting null cells may have relatively short telomeres which could limit the remaining possible cell divisions to too few to provide sufficient cells for clinical use before the cells senesce.
  • the at least one isolated pluripotent stem cell has been subjected to transient over-expression of hTERT, hTER or both hTERT and hTER to increase the average telomere length prior to exposure to CRISPR-Cas or other synthetic nuclease system.
  • the isolated telomerase activity null stem cell has an average telomere length of 9 kb or less. More preferably, the average telomere length is 5 kb or less. More preferably, the average telomere length is 4 kb or less. Even more preferred, the average telomere length is 2 kb to 4 kb, or 3 to 4 kb.
  • the telomere length has a direct relationship with the number of cell divisions remaining for a cell, and that the cells of the invention may be passaged until the desired average telomere length is obtained.
  • the isolated telomerase activity null stem cell described above retains expression of at least one pluripotency marker.
  • the at least one pluripotency marker is selected from the group comprising Oct4, Nanog, Sox2 and Klf4.
  • the method according to any aspect of the invention may be performed in vitro. Accordingly, the method is performed with isolated pluripotent stem cell(s).
  • the pluripotent stem cell(s) for use in the invention may be from any animal.
  • the pluripotent stem cells may be human.
  • the pluripotent stem cell(s) may comprise induced pluripotent stem cell(s) or embryonic stem cell(s). Any method of preparing pluripotent stem cells or induced pluripotent stem cells is applicable for the invention.
  • the stem cell is a human embryonic stem cell (hESC) or induced pluripotent stem cell (iPSC).
  • hESC human embryonic stem cell
  • iPSC induced pluripotent stem cell
  • Specific gene activity may be knocked out either directly or delayed until desired and then knocked out using knockout inducers.
  • direct knockout of telomerase activity using for example ZFN, TALEN or CRISPR can be achieved, the cells derived from direct knockout do not last very long before senescing. Moreover, knockout cells generated this way have to be replaced by newly generated knockouts, which is impractical and quality control becomes a problem. Recombinant cells carrying an inducible knockout can be passaged and manipulated for longer before the target gene is knocked out.
  • telomere length to allow for expansion of telomerase knockout cells could be obtained by transiently increasing telomerase activity prior to CRISPR Cas-induced TERT or TER knockout.
  • Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells with limited lifespan and reduced tumorigenicity compared to wild type cells, comprising the steps of:
  • telomere activity gene selected from the group comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene;
  • hTERT human telomerase reverse transcriptase
  • hTER human telomerase RNA subunit
  • telomerase activity knockout stem cell clones comprising the human telomerase reverse transcriptase (hTERT) gene and the human telomerase RNA subunit (hTER) gene; and
  • telomerase activity null cells with an average telomere length evaluated to be 5 kb or less and a reduced ability to form a teratoma in vivo;
  • telomere length is evaluated to be 5 kb or less and the cells have reduced ability to form a teratoma in vivo.
  • the average telomere length is around 4 kb. In other preferred embodiments, the average telomere length may be 2 kb to 4 kb or 3 kb to 4 kb. It would be understood that the optimum telomere length desired may depend on the particular use intended for the cells; for example a requirement for in vitro use or a requirement for expansion prior to clinical implantation.
  • a portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP sites, which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cells causes deletion of the homologous DNA and in (b) a portion of the hTERT or hTER gene is edited by CRISPR-Cas, resulting in loss of telomerase activity.
  • the recombinant cells are homozygous for the homologous DNA insert.
  • the hTERT gene in (a) is replaced and the portion of the hTERT gene replaced includes exon 1 and/or exon 2.
  • the method may further comprise a step of inducing the telomerase activity null cells to differentiate.
  • the telomerase activity null cells are induced to differentiate into cells of at least one of ectodermal, endodermal or mesodermal lineage. Methods exist in the art to differentiate stem cells down particular lineages.
  • the telomerase activity null cells of the invention are induced to differentiate into neurons.
  • the telomerase null cells may be induced to differentiate in dopaminergic neurons, GABAergic neurons, motor neurons, or glutamatergic neurons.
  • the telomerase activity null cells are induced to differentiate into astrocytes and/or glia. In yet another preferred embodiment, the telomerase activity null cells are induced to differentiate into hematopoietic cells.
  • Another aspect of the invention provides a method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use, comprising: evaluating the average telomere length and/or in vivo tumorigenicity of said pluripotent stem cells in which the human telomerase reverse transcriptase (hTERT) or the human telomerase RNA subunit (hTER) activity has been inactivated; and identifying said pluripotent stem cells as suitable for clinical use if said evaluated average telomere length is 5 kb or less and/or said cells have reduced ability to form a teratoma in vivo.
  • the average telomere length is around 4 kb.
  • the average telomere length may be 2 kb to 4 kb or 3 kb to 4 kb. It would be understood that the optimum telomere length desired may depend on the particular clinical use intended for the cells.
  • the hTERT or hTER inactivation is by virtue of an induced, or CRISPR-Cas, knockout of hTERT or hTER gene activity.
  • a portion of the hTERT or hTER gene is replaced by homologous DNA flanked by LoxP which retains gene function, and at a selected time transient expression of Cre recombinase in the recombinant cells causes deletion of the homologous DNA resulting in loss of hTERT or hTER activity and, consequently, telomerase activity; or (ii) a portion of the hTERT or hTER gene is edited by CRISPR-Cas resulting in loss of hTERT or hTER activity and, consequently, telomerase activity.
  • any suitable inducible knockout system could be used, such as FLP/FRT.
  • the PGK-neo selection cassette was removed with FLP/FRT because the hTERT gene portion was cloned to be removable with Cre/LoxP.
  • the recombinant cells from the Cre-Lox method (i) are homozygous for the homologous DNA insert.
  • the stem cells have limited proliferation capacity.
  • the stem cells retain expression of at least one stem cell pluripotency marker. More preferably, the at least one stem cell marker is selected from the group comprising Oct4, Nanog, Sox2 and Klf4.
  • the pluripotent telomerase activity null stem cells are human embryonic stem cells (hESC), progenitor cells or induced pluripotent stem cells (iPSC).
  • the method may further comprise a further step of inducing said at least one isolated pluripotent telomerase activity null stem cells to differentiate.
  • the stem cells may be partially differentiated into progenitor cells such as, for example, neural progenitor cells.
  • progenitor cells are described by some in the art to be a form of stem cell and will be considered as such for the purpose of the invention.
  • the at least one telomerase activity null cells are induced to differentiate into cells of at least one of ectodermal, endodermal or mesodermal lineage. In a preferred embodiment, the at least one telomerase activity null cells are induced to differentiate into neurons.
  • the at least one telomerase activity null cells are induced to differentiate into astrocytes and/or glia. In yet another preferred embodiment, the at least one telomerase activity null cells are induced to differentiate into hematopoietic cells.
  • said evaluating step comprises performing one or more of: single telomere length analysis (STELA), fluorescence in-situ hybridization (FISH), flow-FISH and Southern blot analysis.
  • STELA single telomere length analysis
  • FISH fluorescence in-situ hybridization
  • FISH flow-FISH
  • Southern blot analysis comprises performing one or more of: single telomere length analysis (STELA), fluorescence in-situ hybridization (FISH), flow-FISH and Southern blot analysis.
  • the method of producing one or more isolated pluripotent telomerase activity null stem cells suitable for clinical use may further comprise:
  • telomere integrity comprises one or more of: karyotyping; analysis of variable number tandem repeats (VNTRs), short tandem repeats (STRs), single nucleotide polymorphisms (SNPs), and/or copy number variations (CNVs); analysis of culture mosaicism; analysis of DNA sequences related to genetic diseases; and complete genome sequencing and analysis; and
  • the genome integrity is assessed prior to gene inactivation.
  • at least one isolated pluripotent telomerase activity null stem cell herein defined for the preparation of a therapeutic composition for cell therapy of a subject in need thereof.
  • the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one of ectodermal, endodermal or mesodermal lineage. More preferably, the at least one isolated pluripotent telomerase activity null stem cell is differentiated into cells of at least one lineage selected from the group comprising neurons, astrocytes and/or glia and hematopoietic cells.
  • the method according to any aspect of the invention may include inducing differentiation of the at least one isolated pluripotent telomerase activity null stem cells into endoderm, mesoderm or ectoderm lineage. More particularly, the isolated pluripotent telomerase activity null stem cells are induced to differentiate into neurons, glia or hematopoietic cells.
  • Zinc Finger Nucleases ZFNs
  • TALENs Transcription Activator-Like Effector Nucleases
  • DSBs site-specific double strand breaks
  • TALENs Transcription Activator-Like Effector Nucleases
  • ZFNs zinc finger nucleases
  • Paired ZFNs were purchase from Sigma (Cat# CSTZFN-1 KT-hTERT). TALENs was engineered as previously described (Christian M., et al. Genetics 186, 757-761 (2010)). Paired ZFNs and TALENs were used to target distinct genomic DNA sequences in exon 1 of hTERT (refer to Figure 1 ).
  • the hTERT genomic locus was targeted to engineer telomerase inducible knockout in human ES cells.
  • the gene targeting strategy relies on the replacement of endogenous gene locus by exogenous DNA sequence, mediated by homologous recombination.
  • the targeting vector was engineered to introduce two LoxP sites flanking hTERT exon 1 and exon 2, as seen in Figure 2. Upon expression of Cre recombinase, both exon 1 and exon 2 are deleted from the hTERT genomic locus, which encompasses almost 50% of hTERT N-terminal protein coding region.
  • the targeting vector pBSK-3kb-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'- PGK-DTA (AZFN) (refer to Figure 2) (refer to Figure 2), was constructed as follows: Genomic DNA from H1 human embryonic stem cells was used as template for
  • the amplified PCR fragment was first cloned into pBSK, and the sequence was verified by capillary DNA sequencing. Multiple polymorphisms were detected in the PCR amplified fragments. The PCR fragment was then used in stepwise construction of gene targeting vector, using specific restriction enzymes.
  • SL0094 and SL0095 primers were used to amplify the Exon 1 +lntron 1+Exon 2+lntron 2 region with 5' Sail site (underlined) and 3' BamHI site (underlined) and cloned into pBSK (pBSK-5'-hTERT).
  • annealed double stranded oligonucleotides (SL0098 and SL0099) that encode a single LoxP site (underlined) were inserted in the 5' Sail site using in-fusion ligation kit (Clontech) to create (pBSK-5'-LoxP-hTERT).
  • the 3' homologue arm of the targeting vector was amplified using SL0096 and SL0097 primer set and cloned into pBSK-5'-LoxP-hTERT to create pBSK-5'- LoxP-hTERT-3'. Restriction sites are underlined.
  • the DNA fragment containing PGK-neo selection cassette and 3' LoxP site was cut out from pF2L2 vector using BamHI and Nhel, and inserted into the BamHI /Nhel site in pBSK-5'-LoxP-hTERT-3' to derive pBSK-5'-LoxP-hTERT-FRT-PGKNeo- FRT-LoxP-3 1 .
  • Step 5 pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA
  • the Sall/Xhol DNA fragment from pF2L2 vector that contains PGK-DTA was then cloned into pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3' to create pBSK- 5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA.
  • Step 6 pBSK-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (ASacl) Site-directed mutagenesis was performed to eliminate the Sacl site in the
  • PGK-Neo and PGK-DTA fragments in the pBSK-5'-LoxP-hTERT-FRT-PGKNeo- FRT-LoxP-3'-PGK-DTA vector using oligonucleotide primers SL00171 and SL0172 (mutated site underlined).
  • 3 kb DNA fragment upstream of hTERT 5' was amplified from genomic DNA using SL0232 and SL0233.
  • the PCR fragment was then cloned into Sacl-linearized pBSK- 5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (ASacl) using In-Fusion® cloning kit (Clontech Laboratories Inc.).
  • SL0232 3 kb DNA fragment upstream of hTERT 5' (-1000— 4000) was amplified from genomic DNA using SL0232 and SL0233.
  • the PCR fragment was then cloned into Sacl-linearized pBSK- 5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (ASacl) using In-Fusion® cloning kit (Clontech Laboratories
  • Step 8 pBSK-3kb-5'-LoxP-hTERT-FRT-PGKNeo-FRT-LoxP-3'-PGK-DTA (AZFN)
  • site-directed mutagenesis was performed using SL0259/SL0259 antisense primer pairs.
  • Feeder-independent human H1 embryonic stem cells from WiCell (WiCell Research Institute, Madison, WN, USA) were grown on MatrigelTM (BD biosciences)- coated cell culture dishes using mTeSRTM1 culture medium (STEMCELL Technologies). When the cells were 80-90% confluent, the cells were passaged using Dispase, and split 1 :6 to 1 :12 onto new MatrigelTM -coated cell culture dishes.
  • the Neon® transfection system (Life Technologies) was used for targeting the first allele of hTERT. Briefly, the cells were harvested using trypsin and counted and the cells washed once with 1 xPBS before being re-suspended in Neon® Re- suspension buffer at 1x10 7 /ml final concentration.
  • the cells were plated onto MatrigelTM-coated 10cm dishes in the presence of 6ml of mTeSRTM1 with 10 ⁇ Y-27632 (Rock inhibitor). About 5-6x10 6 cells were plated into one 10cm dish. The cells were maintained in mTeSRTM1 and the medium changed every day.
  • mTeSRTM1 with 50 Mg/ml G418 (neomycin) was then added for selection of G418-resistant clones.
  • the cells need to be maintained in mTeSRTM1 with 50 Mg/ml G418 for about 12 days before the colonies are big enough for picking.
  • the G418-resistant colonies were about 3-4 mm in size, the individual G418-resistant clone on the 10cm dish was picked up using sterile p200 pipette tip and transferred into two new wells on a MatrigelTM-coated 96 well plate. The colonies were allowed to grow 2-3 days before being ready for screening, using PCR as previously described (Zhang et al. Nat Methods 5, 163-165 (2008)).
  • the PGK-Neo cassette was first removed by FLP.
  • the cells were transiently transfected with pCAG-Flpe:GFP plasmid using Neon® transfection system (as described above).
  • the cells were maintained in mTeSRTM1 with 10 ⁇ Y-27632 (Rock inhibitor) for 24 hours, and the GFP-positive cells then sorted out and collected using FACS.
  • the cells were then seeded at low density (200-500 cell/well in 6-well dishes) to allow the colonies derived from single ES cells to emerge. When the colonies grew to about 3-4 mm size, the colonies were transferred to 96-well dishes and used for PCR diagnosis for the loop out of PGK-Neo cassette.
  • the second allele was targeted exactly as described above for the first allele.
  • the targeted alleles of hTERT were confirmed by Southern blotting analysis (shown on Figure 5A).
  • the genomic DNA was extracted using Gentra® Puregene® genomic DNA purification kit (Qiagen). Southern blots for detection of targeted genomic insertions were performed as previously described (Liu C.Y. et al. Genes Dev 10, 1835-1843 (1996)). For telomerase activity analysis, telomeric repeat amplification protocol (TRAP) assay was performed as previously described (Kim N.W., et al. Science 266, 2011-2015 (1994)). For telomere length measurement, the genomic DNA was digested with Hphl and Mnll at 37°C for 16 hours. The DNA blot was hybridized to 32 P-labeled (TTAGGG)6 oligonucleotide, as previously described (Li S. et al., Cancer Res 64, 4833-4840 (2004)).
  • TTAGGG 32 P-labeled
  • pCre-IRES-mCherry plasmid (pmCherry-C1 vector from Clontech in which Cre-IRES was inserted into the multiple cloning site) was transiently transfected into ES cells that have both hTERT genomic alleles flanked by a LoxP site (as generated in Example 3), using Neon® transfection system (as described above).
  • the cells were maintained in mTeSRTM1 with 10 ⁇ Y- 27632 (Rock inhibitor) for 24 hours, and the mCherry-positive cells then sorted out and collected using FACS.
  • the cells were then seeded at a low density of 200-500 cell/well in 6-well dishes to allow the colonies derived from single ES cells to emerge. When the colonies grew to about 3-4 mm size, the colonies were transferred to 96- well dishes and used for PCR diagnosis for the loop out of hTERT Exons 1 and 2.
  • RNA protection assay using Ambion RPA IIITM Ribonuclease Protection Assay Kit; refer to Figure 5B
  • deletion of one copy of hTERT results in about 50% loss of hTERT mRNA expression
  • deletion of both copies of hTERT results in the complete loss of full-length hTERT mRNA expression in ES cells.
  • Figure 5C shows that deletion of one allele of hTERT results in about 50% reduction of telomerase activity, whereas deletion of both alleles of hTERT results in the complete loss of telomerase activity, as shown by TRAP assay.
  • telomere length in the parental ES cells is about 13-14 kb as shown by genomic Southern blotting analysis ( Figure 6A).
  • ES cell colonies with LoxP sites flanking the only one allele of hTERT showed slight shortening of telomere compared to the parental ES cells. This is probably due to the disruption of hTERT expression by the neomycin cassette in the targeting vector during the gene targeting process ( Figure 4).
  • Introduction of LoxP sites flanking the exon 1 and exon 2 of hTERT can potentially inhibit hTERT mRNA expression as well. Consistent with that, further telomere attrition was observed in ES cell colonies with LoxP sites flanking both allele of hTERT (hTERT loxP/loxP ).
  • the hTERT lo P/loxP ES cells have relatively short telomere, around 5 kb
  • the hTER /_ ES cell colonies derived from hTERT ioxP/loxP ES cells by transient expression of Cre recombinase have even shorter telomere length, and can only be passaged for approximately 8-9 times before they lose the capacity to divide continuously (as can be seen in Figure 6A).
  • hTERT +/+ , hTERT + " and hTERT " ES cells were analyzed for their incorporation of 5-ethynyl-2'-deoxyuridine (EdU) which marks dividing cells.
  • EdU 5-ethynyl-2'-deoxyuridine
  • Luminescence was measured on a microplate reader (Infinite 200, Tecan) every 24 hours.
  • hTERT _ " (P8) cells also showed increased cell death.
  • Annexin V and 7-AAD staining showed increased apoptosis in hTERT " ' " (P8) ES cells (29.78%) compared to hTERT +/+ , hTERT +/” and hTERT “ “ (P2) ES cells (4.15%) ( Figure 7D).
  • Cells were harvested by trypinization, washed once with PBS and stained with 7-AAD (BD Biosciences) and Annexin V (BD Biosciences) for 15 minutes at room temperature in the dark. Samples were acquired on flow cytometer (BD LSRFortessa, BD Biosciences) and data acquired were analyzed using FlowJo (Tree Star).
  • telomere length in hTERT loxP/loxP ES cells is maintained at a short (about
  • telomere activity in hTERT loxP/loxP ES cells is sufficient for telomere maintenance.
  • hTERT-IRES- GFP a mammalian expression vector overexpressing hTERT-IRES- GFP was transiently transfected into the hTERT loxP loxP ES cells, following which the GFP positive cells were FACS sorted and the single cell colonies were isolated.
  • the single cell colonies (those numbered 1 , 2 and 5), derived from transient overexpression of hTERT, have elongated telomeres of similar length as, or even longer than, the parental hTERT loxP loxP H1 ES cells.
  • No integration of the hTERT-IRES-GFP expressing vector was detectable in the newly derived hTERT loxP/loxP ES cell colonies.
  • the hTERT " ' " ES cell colonies derived from the new hTERT loxP/loxP ES cells also have longer telomeres to start with; about 9-10 kb, as shown in Figure 9; and can be passaged much longer than the hTERT " ' " ES cell with short telomeres of about 4 kb as was seen in Figure 6A.
  • Engineered hES cells maintain normal karyotype Given the propensity of human ES cells to accumulate genetic aberrations during in vitro culture, karyotyping was done during each step of gene targeting to ensure that the clonally-derived human ES cell lines maintained a normal karyotype.
  • the cells were grown to 50-60% confluent, and colcemid was then added to the culture at final concentration of 10 g/ml and incubation continued for 4 hours.
  • the cells were harvested by trypsin-EDTA and washed with HEPES buffered saline solution (HBSS).
  • HBSS HEPES buffered saline solution
  • the cells were then re-suspended in hypotonic solution (2 parts of 0.6% sodium citrate tribasic dihydrate + 1 part of 75 mM KCI) and incubated in 37°C water bath for 20 minutes. Subsequently, 1 ml of fixative (3 parts of methanol + 1 part of glacial acetic acid) was added to the tube and mixed by pipetting up/down.
  • ES cell-specific surface antigens (Adewumi O., et al. Nat Biotechnol 25, 803-816 (2007)), such as TRA-1 -60 and SSEA-4, as well as genes involved in the maintenance of undifferentiated ES cell state such as OCT4 and NANOG. This can be seen using immunocytochemistry assays, as set out in Figures 11 A-1 1 D.
  • Figure 1 1 E provides qRT-PCR results showing that the expression levels of ES cell marker genes in the hTERT +/" and hTERT _/" ES cells, such as OCT4, SOX2, KLF4 and NANOG, were comparable to the parental ES cells (hTERT +/+ ), although there were small variations in different independent hTERT + " and hTERT "A ES cell lines.
  • telomerase null ES cells To determine the differentiation potential of telomerase null ES cells in vitro, these cells were grown in suspension to induce the formation of embryoid bodies (EBs) (Itskovitz-Eldor J., et al. Mol Med 6, 88-95 (2000)).
  • EBs embryoid bodies
  • Embryoid bodies were formed by trypsinization to a single-cell suspension and plating into low-adherence dishes in human ES cell mTeSRTM1 medium. For spontaneous differentiation, 7-10 day old EBs were used according to the previously established protocol (Dimos J.T., et al. Science 321 , 1218-1221 (2008)). In brief, the EBs (about 5-10) from human ES cells were transferred onto gelatin-coated 24-well plates and allowed to differentiate in DMEM+10% fetal bovine serum for 1 -2 weeks.
  • the hTERT +/+ , hTERT +/" and hTERT A EBs were then plated on gelatin-coated plates for 2 weeks.
  • the attached cells spontaneously differentiated into cell types representative of the three germ layers (refer to Figures 12A - 12E), which express early differentiation markers for ectoderm (Tuj1 and GFAP); mesoderm (SMA and Desmin) and endoderm (AFP). These data indicate that the hTERT _/" ES cells remain pluripotent.
  • mice were fixed in 4% paraformaldehyde for 10 minutes. The fixed cells were washed three times with 0.1 M Tris buffered saline containing 0.1 % Triton-X 100 (TBS-TX) and incubated in primary antibody including: mouse anti-Oct3/4 (1 :500, Santa Cruz Biotechnology), mouse anti-Tra- - 60 (1 :100, Santa Cruz Biotechnology), rabbit anti-Nanog (1 :100, Cell Signaling Technology), mouse anti-SSEA-4 (1 :500, Millipore), rabbit anti-AFP (1 :400, Dako), mouse anti-Desmin (1 :100, Abeam); goat anti-SOX2 (1 : 500, Santa Cruz Biotechnology), mouse anti-SMA (1 :200, Sigma), mouse anti-Tujl (1 :1000, Covance), mouse anti-GFAP (1 :1000, Millipore), mouse anti-Human Nuclei (1 :500, Abeam), mouse anti-Nestin (1
  • Telomerase null hES cells do not form teratomas when telomeres are sufficiently short hTERT +/+ , hTERT +/" and hTERT ";” ES cells were injected subcutaneously into the dorsal-lateral area of immunodeficient (NSG) mice, as described previously (Prokhorova T.A., et al. Stem Cells Dev 18, 47-54 (2009); incorporated herein by reference). Eight weeks following the injection, the formation of teratoma was evaluated.
  • hTERT "7" ES cells with long telomere (9 kb) form teratomas in immunodeficient mice with high frequency, as can be seen in Figure 13A.
  • hTERT ;" ESCs with shorter telomere (4 kb, P2 in Figure 6A) were injected into immunodeficient mice, only one out of 20 injections resulted in the formation of teratoma.
  • hTER /_ ES cells with very short telomere (3.5 kb, P4 in Figure 6A) were injected into the immunodeficient mice, none out of 60 injections resulted in the formation of teratoma in vivo.
  • ES cells were harvested using Dispase, washed with 1xPBS and re-suspended in 30% MatrigelTM (BD Science). About 1x10 6 cells (100 ⁇ ) were injected subcutaneously into NSG mice (NOD.Cg-Prkdcscid ll2rgtm1Wjl/SzJ) in the dorso-lateral area on both sides, as previously described (Prokhorova T.A., et al. Stem Cells Dev 18, 47-54 (2009)). The mice were sacrificed and the tumors were harvested 8 weeks after injection. The tumors were dissected and fixed in PBS with 4% paraformaldehyde. Paraffin-embedded tissue was sliced and stained with hematoxylin and eosin.
  • hTER A ES cells with very short telomeres can only be passaged in vitro for another 4-5 passages (as seen in Figure 6A). Histological examination of the tumors derived from hTERT +/+ , hTERT +/" and TERT “/_ ES cells showed that they contained various tissues derived from all three germ layers, including respiratory epithelium (endoderm); striated muscle and cartilage (mesoderm), and neural epithelium with rosettes (ectoderm). The results are shown in Figure 13B.
  • hTERT (+/+) hTERT (+A) and hTERT ("A) ES cells was carried out as previously reported (Li et al., 2011 ) (see Figure 14A).
  • hTERT (+/+) and hTERT (“A) ES cells were cultured in mTeSRTM1 medium.
  • mTeSRTM1 medium was removed and replaced with neural induction media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1 xB27, 1 % Glutmax, 5 Mg/mL BSA, 4 ⁇ CHIR99021 (Cellagentech), 3 ⁇ SB431542 (Cellagentech), 0.1 ⁇ Compound E ( ⁇ -Secretase Inhibitor XXI, EMD Chemicals Inc.), 10 ng/mL hLIF (Millipore) for 7 days.
  • DMEM/F12 neural induction media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1 xB27, 1 % Glutmax, 5 Mg/mL BSA, 4 ⁇ CHIR99021 (Cellagentech), 3 ⁇ SB431542 (Cella
  • the culture was then split 1 :3 for the next six passages using AccutaseTM, and cells were cultured in human neural progenitor cells (NPCs) maintenance media containing DMEM/F12: Neurobasal (1 :1 ), 1 xN2, 1 xB27, 1 % Glutmax, 5 ⁇ g/mL BSA, 3 ⁇ CHIR99021 , 2 ⁇ SB431542, 10 ng/mL hLIF on MatrigelTM-coated plates. After six passages, the cells were split 1 :10 regularly.
  • NPCs neural progenitor cells
  • the human NPCs neural differentiation assay was performed by plating 5x10 4 cells/well on laminin-coated (37°C, 4 hours) 24-well plates in neural differentiation media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1xB27, 1 % Glutmax on polyL- Lysine (4°C, overnight). After 3 days, 10 ng/mL BDNF and 10 ng/mL GDNF (both from R&D Systems, MN, USA) were added to the media every other day and culturing was continued for another 14 days.
  • the human NPCs astrocytes differentiation assay was performed by plating 8x10 4 cells/well on 1% Glutmax on MatrigelTM-coated 24-well plates in neural differentiation media containing DMEM/F12: Neurobasal (1 :1 ), 1xN2, 1 % Fetal Bovine Serum (FBS). Immunocytochemistry, carried out as described in Example 9, above, showed that the (NPCs) derived from hTERT (+/+) ; hTERT (+A) and hTERT ( - A) (3.5 kb) ES cells were positive for Nestin and Sox2 ( Figure 14B).
  • NPCs derived from hTERT (+/+) ; hTERT (+A) and hTERT ⁇ ES cells showed similar efficiency to differentiate into DCX-positive immature neurons as well as GFAP-positive glial cells ( Figures 14C-14E).
  • hTERT (“A> hES cells differentiate into four different neuronal types. 1 ) dopaminergic neurons expressing TH; 2) GABAergic neurons expressing GAD65; 3) glutamatergic neurons expressing vGluTI ; 4) motor neurons expressing ChAT (data not shown). The specific differentiation of these four types of neurons was performed as follows:
  • hTERT For dopaminergic neurons expressing TH, hTERT ("A) cells were first treated with 100 ng/mL Sonic hedgehog (SHH) and 100 ng/mL FGF8b in neural differentiation media for 10 days, and then with 10 ng/mL BDNF, 10 ng/mL GDNF, 10 ng/mL IGF1 , 1 ng/mL TGF- 3 and 0.5 mM db-cAMP (Sigma-
  • hTERT For GABAergic neurons expressing GAD65, hTERT ("A) cells were treated with SHH (50-500 ng/ml) or its small molecular agonist purmorphamine (0.1-1.5 mM; Calbiochem, San Diego, CA) at days 12-26 to induce ventral progenitors. Retinoic acid (RA, 0.1 mM) was added from day 10 to 23. At day
  • cell clusters were dissociated with Accutase (1 unit/ml, Invitrogen) at 37°C for 5 minutes and placed onto polyornithine/laminin-coated coverslips in Neurobasal medium in the presence of valproic acid (VPA, 10 mM, Sigma) for 1 week, followed by a set of trophic factors, including brain-derived neurotrophic factor (BDNF, 20 ng/ml), glial-derived neurotrophic factor
  • GDNF GDNF, 10 ng/ml
  • IGF1 insulin-like growth factor 1
  • cAMP cAMP (1 mM).
  • hTERT /_ cells were treated with 200 ng/mL BMP2/4, 100 ng/mL FGF8b and 1 ⁇ RA (Sigma-Aldrich) in neural differentiation media for 10 days, and then with 10 ng/mL BDNF, 10 ng/mL GDNF, 1 ng/mL TGF- 3 and 0.5 mM db-cAMP (Sigma-Aldrich) for another 14-21 days in neural differentiation media.
  • hTERT ⁇ cells were sequentially treated with 1 ⁇ RA (Sigma-Aldrich) in neural differentiation media for 7 days, then with 100 ng/mL SHH and 0.1 ⁇ RA for additional 7 days, and finally with 50 ng/mL SHH and 0.1 ⁇ RA for another 7 days.
  • the cells were terminally differentiated in the presence of 10 ng/mL BDNF and 10 ng/mL GDNF in the neural differentiation media for about 7 days. All growth factors were from R&D Systems. All tissue culture products were obtained from Invitrogen except where mentioned.
  • hTERT (+/+) and hTERT (“/_) 3.5 kb ES cells directly into the midbrain of immunodeficient mice.
  • Coronal sections at 40 ⁇ thickness were cut using a cryostat, and serial sections were transferred to individual wells of a 24- well tissue culture dish. Sections were incubated in blocking solution (5% normal goat serum and 0.1 % Triton X-100 in TBS) for 1 hour. Subsequently, primary antibody (Mouse anti-Human Nuclei, 1 :500, Abeam; goat anti-DCX, 1 : 500, Santa Cruz; mouse anti-MAP2, 1 :1 :1 ,000, Sigma; mouse anti-NeuN, 1 :500, Abeam; mouse anti-GFAP, 1 :1000, Millipore) in blocking solution was added to the sections and they were incubated overnight at 4°C.
  • blocking solution 5% normal goat serum and 0.1 % Triton X-100 in TBS
  • MAP2a-positive cells, a neuronal marker, and tyrosine hydroxylase (TH)-positive cells, a marker for mature dopaminergic neurons, differentiated from hTERT ("A) ES cells can be detected at 16 weeks after injection (see Figures 16B and 16C, respectively).
  • DNA sequences encoding five CRISPR guide RNAs (S1-S5; SEQ ID NOs: 15-19) targeting hTERT exon 1 were designed, and all resulted in efficient, site-specific double strand breaks (DSBs).
  • the protospacer adjacent motif (PAM) in each sgRNA is at the 3' end and is shaded or underlined.
  • Feeder-independent human WA018 embryonic stem cells from WiCell were grown on MatrigelTM (BD biosciences)- coated cell culture dishes using mTeSRTM1 culture medium (Stemcell Technologies). When the cells were 80-90% confluent, the cells were passaged using Dispase, and split 1 :6 to 1 :12 onto new MatrigelTM -coated cell culture dishes.
  • telomerase-null WA018 cells using CRISPR/Cas9 system a Cas9 nickase expression vector, (pSPCas9 D10A_GFP S2/S3-derived from pSPCas9 D10A_GFP expression plasmid-Addgene Plasmid #44720 that co-express sgRNAs S2 and S3 as shown in Figure 17C), was transiently transfected into WA018 human ES cells using a Neon® transfection system to introduce targeted DSBs according to the methods in Ran FA, et al., Cell 154: 1380-1389 (2013) and illustrated in Figure 17C.
  • the ES cells grown on MatrigelTM were harvested using AccutaseTM and counted. The cells were washed once with 1xPBS before being re-suspended in Neon® Re-suspension buffer at 1x10 7 /ml final concentration.
  • Neon® Re-suspension buffer 50 pg of pSPCas9 D10A_GFP S2/S3 vector was added and mixed well before electroporation.
  • 100 ⁇ of cells and DNA mixture in Re-suspension buffer was electroporated using 100 ⁇ Neon® pipette in Neon® tube with 3 ml of Neon® Electrolytic Buffer.
  • the electroporation condition Pulse, V 1050, MS 30, Number 2.
  • the cells were plated onto MatrigelTM-coated 10cm dishes in the presence of 6ml of mTeSRTM1 with 10 ⁇ Y-27632 (Rock inhibitor). About 5-6x10 6 cells were plated into one 10 cm dish. The cells were maintained in mTeSRTM1 with 10 ⁇ Y-27632.
  • GFP positive ES cells were sorted out and collected using FACS.
  • the cells were seeded at low density (800-2000 cells/ 10 cm dish) on MatrigelTM -coated cell culture dish in mTeSRTM1 with 10 ⁇ Y-27632 for the first 48 hours, then cultured in mTeSRTM1 for about 12 days before the single cell- derived colonies were big enough for picking.
  • the colonies were about 3-4 mm in size, the individual clone on the 10 cm dish was picked up using sterile p200 pipette tip and transferred into two new wells on a MatrigelTM-coated 96 well plate.
  • telomere-induced insertion/deletion (indel) mutations in three clones were confirmed by Sanger sequencing ( Figure 17D). As shown in Figure 17E, the DSB- induced indels resulted in complete loss of telomerase activity in the three ES cell clones. All three telomerase-null ES cell clones maintained normal karyotype (data not shown). However, these telomerase null ES cell clones had short median telomeres, approximately 5-6 kb in length ( Figure 17F, lanes 2-4).
  • telomere deficient cells show an alternative approach for generating telomerase deficient cells with the same characteristics as those generated using the Cre-LoxP type system.
  • An advantage of the CRISPR-Cas 9 system is that it is simpler and much more time- efficient, generating telomerase deficient cells in a few months compared to around 12 months using the Cre-LoxP method described herein.
  • the telomeres may need to be increased in length prior to CRISPR-Cas treatment by transient increased expression of telomerase.
  • Pluripotent stem cells such as human embryonic stem cells and induced pluripotent stem cells, hold great promise for cell therapy.
  • stem cell-based therapy also brings concern due to the tumorigenic potential of stem cells.
  • pluripotent stem cells form teratomas when injected into immunodeficient mice. If the stem cell contains genetic mutations, it may potentially develop into more malignant teratocarcinomas.
  • Current approaches to reduce the risk of tumorigenicity of stem cells have focused on separating differentiated cells from undifferentiated stem cells. The technical burden of such application is enormous.
  • the high propensity of stem cells to accumulate chromosome aberrations during in vitro culture may result in the accumulation of genetic mutations in differentiated cells as well, which may result in tumorigenicity in vivo. It is close to impossible to check differentiated cells for their genetic variation and therefore eliminate their tumorigenicity in vivo.
  • the present invention provides telomerase knockout human embryonic stem cells, engineered by gene targeting.
  • the data herein indicate that by inactivating telomerase in stem cells, the two unique properties of stem cell can be functionally separated: the ability to proliferate indefinitely and the ability to differentiate into various cell types.
  • transgenic stem cells constitute an unlimited source for cell engineering but provide, in addition, the concomitant advantage that by limiting their proliferation capacity at a desired time, the risk of their developing tumors in vivo is significantly reduced.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Reproductive Health (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne la technologie des cellules souches. Plus particulièrement, la présente invention concerne un procédé pour l'ingénierie de cellules souches pluripotentes null de la télomérase. Ces cellules souches null de la télomérase restent pluripotentes et ont une durée de vie limitée et un potentiel de formation de tumeur réduit in vivo , ce qui laisse penser qu'ils sont utiles pour la thérapie cellulaire.
PCT/SG2016/050190 2015-04-22 2016-04-22 Ciblage de la télomérase pour la thérapie cellulaire WO2016171625A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SG10201503148P 2015-04-22
SG10201503148P 2015-04-22

Publications (1)

Publication Number Publication Date
WO2016171625A1 true WO2016171625A1 (fr) 2016-10-27

Family

ID=57143322

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2016/050190 WO2016171625A1 (fr) 2015-04-22 2016-04-22 Ciblage de la télomérase pour la thérapie cellulaire

Country Status (1)

Country Link
WO (1) WO2016171625A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114144231A (zh) * 2019-05-15 2022-03-04 得克萨斯系统大学评议会 用于治疗癌症的crispr方法
CN116189765A (zh) * 2023-02-23 2023-05-30 上海捷易生物科技有限公司 一种iPS细胞遗传学风险评估系统及应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009061442A1 (fr) * 2007-11-06 2009-05-14 Children's Medical Center Corporation Procédé de production de cellules souches pluripotentes induites (ips) à partir de cellules humaines non embryonnaires
WO2012010976A2 (fr) * 2010-07-15 2012-01-26 Cellectis Variants de méganucléases clivant une séquence d'adn cible dans le gène tert et leurs utilisations

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009061442A1 (fr) * 2007-11-06 2009-05-14 Children's Medical Center Corporation Procédé de production de cellules souches pluripotentes induites (ips) à partir de cellules humaines non embryonnaires
WO2012010976A2 (fr) * 2010-07-15 2012-01-26 Cellectis Variants de méganucléases clivant une séquence d'adn cible dans le gène tert et leurs utilisations

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
KINOSHITA, T. ET AL.: "Telomerase reverse transcriptase has an extratelomeric function in somatic cell reprogramming", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 289, no. 22, 2014, pages 15776 - 15787, XP055324996 *
PUCCI, F. ET AL.: "Short telomeres in ESCs lead to unstable differentiation", CELL STEM CELL, vol. 12, 2013, pages 479 - 486, XP055324985 *
SCARIA, G. ET AL., BLOOD, vol. 124, 2014, pages 5816 *
WANG, F. ET AL.: "Molecular insights into the heterogeneity of telomere reprogramming in induced pluripotent stem cells", CELL RESEARCH, vol. 22, 2012, pages 757 - 768, XP055324989 *
WINKLER, T. ET AL.: "Defective telomere elongation and hematopoiesis from telomerase-mutant aplastic anemia iPSCs", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 123, no. 5, 2013, pages 1952 - 1963, XP055324981 *
ZENG, S. ET AL.: "Telomerase-mediated telomere elongation from human blastocysts to embryonic stem cells", JOURNAL OF CELL SCIENCE, vol. 127, 2014, pages 752 - 762, XP055324999 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114144231A (zh) * 2019-05-15 2022-03-04 得克萨斯系统大学评议会 用于治疗癌症的crispr方法
CN114144231B (zh) * 2019-05-15 2024-05-24 得克萨斯系统大学评议会 用于治疗癌症的crispr方法
CN116189765A (zh) * 2023-02-23 2023-05-30 上海捷易生物科技有限公司 一种iPS细胞遗传学风险评估系统及应用
CN116189765B (zh) * 2023-02-23 2023-08-15 上海捷易生物科技有限公司 一种iPS细胞遗传学风险评估系统及应用

Similar Documents

Publication Publication Date Title
JP6758440B2 (ja) ラットの遺伝子組換え
JP6993063B2 (ja) ゲノムエンジニアリング
EP2989199B1 (fr) Cellules souches pluripotentes naïves isolées et leurs procédés de génération
CN110300803B (zh) 提高细胞基因组中同源定向修复(hdr)效率的方法
US10648002B2 (en) Method for correcting a genetic sequence
US20200407693A1 (en) Method for producing low-antigenic cell
KR20190140950A (ko) 인간 유전자 교정
JP2015500637A (ja) 一倍体細胞
Liu et al. Distinct responses of stem cells to telomere uncapping—a potential strategy to improve the safety of cell therapy
KR20050096974A (ko) 인간 줄기 세포의 지시된 유전적 변형
US20240060047A1 (en) Cells with sustained transgene expression
Young et al. Patient-specific induced pluripotent stem cells as a platform for disease modeling
US20190365818A1 (en) Genetically-tagged stem cell lines and methods of use
WO2021216622A1 (fr) Édition génique de gba1 dans des cellules souches et procédé d'utilisation de cellules différenciées à partir de celles-ci
JP2024107098A (ja) 鳥類の作出方法および卵の製造方法
US20100233142A1 (en) Stem Cells Derived from Uniparental Embryos and Methods of Use Thereof
WO2016171625A1 (fr) Ciblage de la télomérase pour la thérapie cellulaire
KR101796518B1 (ko) 일체형 유전자 치료 유도만능줄기세포 제작방법
KR20200011817A (ko) 혈액 응고인자 ⅷ의 교정용 조성물 및 이를 이용한 방법
WO2015152146A1 (fr) Procédé de culture de cellules souches embryonnaires haploïdes
Hag Insertion of an inducible construct in the genome of human pluripotent stem cells by CRISPR-Cas9 mediated homology directed repair
Liang Development of Genome Engineering Strategies for Cell Therapy Safety
KR20240083158A (ko) Nanog 넉인 생식세포 분화 추적용 세포주 및 이의 용도
RU2774076C2 (ru) Генетическая модификация крыс
JP2022542359A (ja) 人工多能性幹細胞のゲノム安定性およびリプログラミング効率の上昇

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16783512

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16783512

Country of ref document: EP

Kind code of ref document: A1