WO2016167589A1 - Ndrg3 단백질을 이용한 젖산의 정량 방법 - Google Patents

Ndrg3 단백질을 이용한 젖산의 정량 방법 Download PDF

Info

Publication number
WO2016167589A1
WO2016167589A1 PCT/KR2016/003921 KR2016003921W WO2016167589A1 WO 2016167589 A1 WO2016167589 A1 WO 2016167589A1 KR 2016003921 W KR2016003921 W KR 2016003921W WO 2016167589 A1 WO2016167589 A1 WO 2016167589A1
Authority
WO
WIPO (PCT)
Prior art keywords
ndrg3
protein
lactic acid
cells
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/003921
Other languages
English (en)
French (fr)
Inventor
염영일
이동철
박경찬
손현암
강민호
김정애
조성찬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020150053425A external-priority patent/KR101767605B1/ko
Priority claimed from KR1020150167802A external-priority patent/KR20170062239A/ko
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Publication of WO2016167589A1 publication Critical patent/WO2016167589A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention relates to a method for quantifying lactic acid using NDRG3 (N-myc downstream regulated gene 3) protein, and more particularly, to a method for quantifying the content of lactic acid in cells by measuring the expression level of NDRG3 protein and its mutants. .
  • NDRG3 N-myc downstream regulated gene 3
  • the present invention also relates to a gene expression cassette for lactic acid quantification comprising a gene encoding an NDRG3 gene and a fluorescent protein.
  • the present invention also relates to a gene expression cassette for quantifying lactic acid, including an NDRG3 gene and a Luciferase gene.
  • the present invention is Gal1DB (Gal4 DNA binding domain), and a first vector comprising an NDRG3 gene consisting of a nucleotide sequence represented by SEQ ID NO: 1; And a Gal4 upstream activating sequence (UAS) and a second vector comprising a luciferase gene.
  • the present invention also relates to an information providing method for diagnosing solid cancer, ischemic disease or inflammatory disease.
  • Lactic acid is produced in muscle cells, red blood cells, brain and other tissues during hypoxic energy production, and is usually present at low concentrations in the blood.
  • mitochondria use glucose and oxygen to produce ATP (adenosine triphosphate), but when the oxygen concentration decreases or the mitochondria are not functioning properly, the living body is converted to hypoxic energy production and glucose is converted into mitochondria.
  • ATP adenosine triphosphate
  • the main product of this process is lactic acid, which accumulates faster than the liver can break down. Lactic acid is one of the most commonly observed metabolites in metabolic processes. Lactic acid in blood and other biological samples is a marker for the detection of various biological conditions and diseases, including ischemic diseases. In view of the strong demand.
  • Hypoxia-inducible factor-1 is a nuclear transcription factor that is induced in large quantities in the hypoxic state to maintain oxygen homeostasis in cells, such as erythropoiesis and angiogenesis. And a function of expressing a gene related to glycolysis.
  • HIF-1 is divided into two groups, ⁇ and ⁇ , and HIF-1 ⁇ is a transcription factor that is decomposed at normal oxygen partial pressure, but it is known that the protein itself is stabilized in a hypoxic state.
  • HIF-1 ⁇ binds to ARNT, which is HIF-1 ⁇ , moves to the nucleus to express genes involved in angiogenesis and metabolism (Semenza et al., 1999; Wang et al., 1995; Wang and Semenza 1995).
  • HIF-1 activity has recently emerged as a major new drug target because it is closely related to the pathological mechanisms of various chronic metabolic diseases such as cancer development and metastasis, rheumatoid arthritis, ischemic stroke, and atherosclerosis.
  • HIF-1 it is reported that the promotion of HIF alone does not fully understand the progress of hypoxic reactions, and that there exists a regulatory pathway induced by HIF-independently. Therefore, a strategy for combining and analyzing HIF as well as promoters involved in HIF-independent regulatory pathways is needed for the quantification of intracellular lactic acid due to hypoxia.
  • the N-myc downstream regulated gene (NDRG) gene is the gene whose expression is increased in N-Myc mutant mice. Since its human ortholog NDRG1 has been identified in human cell lines, it has been called by Drg1, Cap43, and RTP / rit42. Four different constitutive genes have been reported in the NDRG group genes, and these four types of NDRG1, NDRG2, NDRG3, and NDRG4 have high homology, but the expression patterns vary considerably with the development and growth of the individual. (Qu et al., Mol Cell Biochem, 2002 (229), 35-44, Deng et al., Int J Cancer, 2003 (106), 342-7). Therefore, these genes are expected to function differently from these expression differences, but there is no report on their specific function yet.
  • An object of the present invention is to provide a method for quantifying intracellular lactic acid, which comprises the step of measuring the expression level of NDRG3 (N-myc downstream regulated gene 3) protein.
  • Gal4DB Gal4 DNA binding domain
  • a first vector comprising an NDRG3 gene consisting of a nucleotide sequence represented by SEQ ID NO: 1; And a Gal4 upstream activating sequence (UAS), and a second vector comprising a luciferase gene.
  • Still another object of the present invention is to measure the expression level of NDRG3 protein in a biological sample isolated from an individual suspected of ischemic disease or inflammatory disease (first step); And comparing the measured protein expression level with the protein expression level of a normal control sample (second step), to provide an information providing method for diagnosing solid cancer, ischemic disease or inflammatory disease.
  • the present invention provides a method for quantifying lactic acid generated under hypoxic conditions, and provides a method for quantifying lactic acid by measuring the amount of N-myc downstream-regulated gene 3 (NDRG3) protein expression, thereby proliferating cells based on NDRG3 protein and angiogenesis.
  • NDRG3 N-myc downstream-regulated gene 3
  • Figure 1a is a diagram showing the pCAGGS plasmid encoding human NDRG3 for the production of NDRG3 (N-myc downstream regulated gene 3) overexpressing transgenic mice.
  • 1B is a diagram confirming that human NDRG3 gene is inserted into genomic DNA of TG-2, TG-8 and TG-13 mice during the production of NDRG3 overexpressed transgenic mice.
  • Figure 1c is a diagram confirming the expression of the human NDRG3 gene in the liver tissue of established NDRG3 overexpressing transgenic mice TG-2, TG-8 and TG-13.
  • FIG. 2 is a diagram confirming the antigen-antibody reaction between the produced rabbit anti-NDRG3 antibody and human NDRG3 variant (N66D).
  • 3A is a diagram schematically illustrating a process of selecting candidate proteins that bind to prolyl hydroxylase domain 2 (PHD2).
  • Figure 3b is a diagram showing a protein binding to PHD2.
  • Figure 3c is a diagram showing the binding of PHD2 and NDRG3 protein.
  • FIG. 4A shows the binding of PHD2 and NDRG3 under hypoxia (hypoxia, 1% O 2 ) (FIG. 4A, top) and in vitro (FIG. 4A, bottom).
  • Figure 4b is a diagram confirming the induction of NDRG3 protein by PHD2 inhibition in MCF-7 cells in the normal oxygen state (normoxia, 21% O 2 ).
  • Figure 4c is a diagram confirming the induction of NDRG3 protein by PHD2 inhibition in HeLa cells under normal oxygen state.
  • Figure 5a is a diagram confirming the increase in NDRG3 protein expression by the PHD family group and VHL deletion in the normal oxygen state.
  • 5B is a diagram confirming binding of the PHD family group and the NDRG3 protein.
  • FIG. 6A shows the PHD2 docking site of NDRG3 through protein-protein docking simulation.
  • Figure 6b is a diagram confirming the binding force of the PHD2 docking site and PHD2 of NDRG3 confirmed by the docking simulation.
  • Figure 7a is a diagram confirming the expression of NDRG3 protein after the treatment of MG132, a proteasome inhibitor (proteasome) in the normal oxygen state.
  • Figure 7b is a diagram confirming the ubiquitination of NDRG3 protein in the normal oxygen state.
  • Figure 8a is a diagram confirming the accumulation of NDRG3 protein according to the oxygen concentration.
  • Figure 8b is a diagram confirming the accumulation of NDRG3 protein according to the persistent hypoxic state in the cell.
  • Figure 8c is a diagram confirming the accumulation of NDRG3 protein according to the persistent hypoxic state in several types of cancer cells.
  • Figure 8d is a diagram confirming the inhibition of ubiquitination of NDRG3 protein in the hypoxic state.
  • Figure 9a is a diagram confirming the change in NDRG3 protein expression according to the normal oxygen state and persistent hypoxic state.
  • Figure 9b is a diagram confirming the change in the expression of NDRG3 protein when restored to a normal oxygen state from a hypoxic state.
  • Figure 10a is a diagram confirming the hydroxylation target site of the NDRG3 protein.
  • 10B is a diagram confirming the hydroxylation target site mutation of NDRG3 protein and binding of PHD2 / VHL.
  • Figure 11a is a diagram confirming the RNA expression change of NDRG3 according to the change in oxygen state.
  • Figure 11b is a diagram confirming the expression change of NDRG3 protein according to HIF protein inhibition.
  • FIG. 11C shows the expression changes of NDRG3 protein in MCF-7 (HIF-1 + / + and VHL + / + ) and 786-O (HIF-1 ⁇ / ⁇ and VHL ⁇ / ⁇ ) cells under hypoxic conditions. to be.
  • 12A is a diagram analyzing the function of NDRG3 and HIF-1 related to hypoxic reaction.
  • 12B is a diagram analyzing the function of each gene upregulated in cells overexpressing the NDRG3 mutant (N66D) protein in the normal oxygen state and cells under the hypoxic state.
  • Figure 13a is a diagram confirming the change in angiogenic activity due to NDRG3 deletion in the hypoxic state.
  • Figure 13b is a diagram confirming the expression changes of angiogenesis markers IL8, IL1 ⁇ , IL1 ⁇ COX-2 and PAI-1 due to NDRG3 deletion in hypoxic state.
  • Figure 13c is a diagram confirming the changes in in vivo (in-vivo) by NDRG3 deletion.
  • Figure 14a is a diagram confirming the cell growth change by NDRG3 deletion in the hypoxic state.
  • 14B is a diagram confirming tumor formation change by NDRG3 and / or HIF deletion.
  • Figure 14c is a diagram confirming the change in tumor formation by the expression of the ectopic variant NDRG3 (N66D).
  • 14D is a diagram confirming tumor volume change in mice transplanted with NDRG3 and / or HIF deleted tumor cells.
  • Figure 14e is a diagram confirming the change in the volume of the tumor in mice transplanted with ectopic variant NDRG3 (N66D) -expressing tumor cells.
  • Figure 14f is a diagram confirming the expression changes of the cell proliferation marker Ki-67 and angiogenesis markers IL8, CD31 proteins by NDRG3 or HIF deletion in tumor tissues.
  • Figure 14g is a diagram confirming the change in the expression of angiogenesis markers by NDRG3 or HIF deletion in tumor tissue.
  • Figure 15a is a diagram confirming the changes in protein expression and lactic acid (Lactate) production of NDRG3 and HIF-1 ⁇ according to the oxygen state.
  • Figure 15b is a diagram confirming the changes in protein expression and lactic acid (Lactate) production of NDRG3 and HIF-1 ⁇ according to the persistent hypoxia after treatment with sodium oxamate (LDHA) lactate dehydrogenase A (LDHA) inhibitor.
  • LDHA sodium oxamate
  • LDHA lactate dehydrogenase A
  • Figure 15c is a diagram confirming the expression change of NDRG3 protein according to the inhibition of lactic acid production in the hypoxic state.
  • Figure 15d is a diagram confirming the expression change of NDRG3 protein according to the inhibition of glycolysis (2-deoxyglucose, 2-DG) in the hypoxic state.
  • Figure 15e is a diagram confirming the change in the expression of NDRG3 protein due to excessive lactic acid production by pyruvate (Pyruvate) or LDHA.
  • Figure 15f is a diagram confirming the ubiquitination change of NDRG3 protein by lactic acid production.
  • 16A shows the recombinant NDRG3 (G138W) variant and recombinant NDRG3 wild-type protein mutated at the lactic acid binding site of the NDRG3 protein.
  • Figure 16b is a diagram confirming the binding of recombinant NDRG3 wild type and recombinant NDRG3 (G138W) variant protein and lactic acid.
  • Figure 16c is a diagram confirming the expression change of the mutant mutated L-lactate binding site of NDRG3 in the hypoxic state.
  • Figure 16d is a diagram confirming the expression of NDRG3 protein by reoxygenation.
  • Figure 17a is a diagram confirming the change in cell growth by lactic acid production inhibition and ectopic variant NDRG3 (N66D) expression in the hypoxic state (3% O 2 ).
  • 17B is a diagram showing changes in cell colony formation by lactic acid inhibition and / or expression of ectopic variant NDRG3 (N66D).
  • Figure 17c is a diagram confirming the change in cell growth caused by LDHA deletion and / or ectopic variant NDRG3 (N66D) expression in the hypoxic state (3% O 2 ).
  • FIG. 17D shows tumor formation changes in mice transplanted with tumor cells expressing LDHA deletion and / or ectopic variant NDRG3 (N66D).
  • FIG. 17D shows tumor formation changes in mice transplanted with tumor cells expressing LDHA deletion and / or ectopic variant NDRG3 (N66D).
  • Figure 17e is a diagram confirming the change in NDRG3 protein expression by the inhibition of lactic acid production and / or ectopic variant NDRG3 (N66D) expression in a persistent hypoxic state.
  • Figure 17f is a diagram confirming the change in lactic acid production by the expression of ectopic variant NDRG3 (N66D) in a persistent hypoxic state.
  • FIG. 18 is a diagram confirming the changes in angiogenesis by the inhibition of lactic acid production and / or ectopic variant NDRG3 (N66D) expression in a persistent hypoxic state.
  • Figure 19a is a diagram confirming the change in phosphorylation (phosphorylation) of the protein by NDRG3 deletion in the hypoxic state.
  • 19b is a diagram confirming changes in activity of ERK1 / 2 protein according to NDRG3 protein expression.
  • Figure 19c is a diagram confirming the change in Raf-ERK1 / 2 activity by NDRG3 deletion in a persistent hypoxic state.
  • 19D is a diagram confirming binding of NDRG3 and c-Raf proteins in vitro (in-vitro, left) and in cells (right).
  • Figure 19e is a diagram confirming the change in Raf-ERK1 / 2 activity by NDRG3 protein deletion or ectopic variant NDRG3 (N66D) expression.
  • Figure 19f is a diagram confirming the phosphorylation change of c-Raf according to the inhibition of PKC- ⁇ activity by ectopic variant NDRG3 (N66D) and / or PKC-I.
  • Figure 19g is a diagram confirming the change in NDRG3 protein expression and Raf-ERK1 / 2 activity according to the inhibition of lactic acid production in the hypoxic state.
  • 20A is a diagram confirming binding between NDRG3 and RACK-1 proteins.
  • Figure 20b is a diagram confirming the change in Raf-ERK1 / 2 activity according to NDRG3 deletion or ectopic variant NDRG3 (N66D), RACK-1 and / or Raf expression.
  • Figure 20c is a diagram confirming the binding between ectopic variant NDRG3 (N66D) and PKC- ⁇ by the RACK1 deletion in the hypoxic state.
  • 20d is a diagram confirming changes in ERK1 / 2 activity by inhibition of PKC- ⁇ activity in a hypoxic state.
  • Figure 20e is a diagram confirming the formation of the recombinant heterotopic variant NDRG3 (N66D) and c-Raf, RACK1 and PKC- ⁇ complex.
  • 20f is a diagram confirming the formation of NDRG3, c-Raf, RACK1 and PKC- ⁇ complex through the simulation.
  • Figure 21a is a diagram confirming the tumor formation of NDRG3 overexpressing transgenic mice and control mice.
  • 21B is a diagram showing tumor formation in the lung, intestine, and hypogastrium of NDRG3 overexpressing transgenic mice and control mice.
  • 21C is a diagram illustrating B cells and T cells in mesenteric lymph nodes, spleen and liver tissues of NDRG3 overexpressing transgenic mice and control mice.
  • Figure 21D shows hepatocellular carcinoma (HCC) glutamine synthetase (GS) and heat shock protein 70 (HSP), and cell proliferation in liver tissue of NDRG3 overexpressing transgenic mice and control mice.
  • HCC hepatocellular carcinoma
  • GS glutamine synthetase
  • HSP heat shock protein 70
  • Figure 21e is a diagram confirming the mRNA expression of ERK1 / 2 activity and angiogenesis markers in liver tissue of NDRG3 overexpressing transgenic mice and control mice.
  • FIG. 22 is a diagram confirming the expression of NDRG3 and ERK1 / 2 activity in liver cancer patients.
  • FIG. 23 shows the mechanism of NDRG3 as a mediator of the Raf-ERK pathway induced by lactic acid in sustained hypoxic reactions.
  • 24 is a diagram confirming the expression of NDRG3 protein by lactic acid treated exogenously when LDHA expression is reduced in a hypoxic environment.
  • 25 is a diagram confirming the expression of NDRG3 protein by lactic acid treated exogenously after oxamate treatment in a hypoxic environment.
  • Figure 26 is a diagram confirming the expression of NDRG3 protein when blocking the influx of exogenously treated lactic acid by inhibiting MCT (monocarboxylate transporter) 1 in normal and hypoxic environment.
  • FIG. 27 is a diagram confirming the expression of NDRG3 protein and MCT 1 dependency by lactic acid treated exogenously after induction of oxamate treatment and glucose deficiency in normal oxygen environment.
  • FIG. 28 is a diagram showing a binding protein of the NDRG3 / fluorescent protein expressed in the lactic acid quantitative gene expression cassette of the present invention.
  • Figure 29 is a diagram showing the binding protein of NDRG3 / luciferase expressed in the gene expression cassette for lactic acid quantification of the present invention.
  • FIG. 30 is a diagram showing a GAL4 / UAS system for luciferase expression of the present invention.
  • the present invention provides an quantitative method for lactic acid in a cell, comprising measuring the expression level of N-myc downstream-regulated gene 3 (NDRG3) protein in a cell.
  • NDRG3 N-myc downstream-regulated gene 3
  • the cells may be collected from any one selected from the group consisting of tissue, blood, plasma, serum, saliva, semen, and urine, but is not limited thereto.
  • the NDRG3 protein may be composed of the amino acid sequence set forth in SEQ ID NO: 2, but is not limited thereto.
  • the NDRG3 protein is degraded when lactic acid is not bound, and may accumulate when lactic acid is bound.
  • the lactic acid may bind to 62th aspartic acid, 138th glycine, 139th alanine or 229th tyrosine in the amino acid sequence of NDRG3 protein, but is not limited thereto.
  • the method of quantifying lactic acid may be a method of comparing the expression level of the normal NDRG3 protein and the expression level of the NDRG3 protein in which the lactic acid binding site is mutated.
  • the NDRG3 protein is degraded when lactic acid is not bound, and may accumulate when lactic acid is bound.
  • the expression amount is in vitro binding assay, enzyme immunoassay, immunohistochemical staining, western blotting, protein chip and real-time fluorescence imaging method (Realtime Fluorescence Imaging). Method) may be measured by any one selected from the group consisting of, but is not limited thereto.
  • NDRG3 (among the candidate proteins that bind prolyl hydroxylase domain 2 (PHD2) proteins involved in the activity of HIF in search of HIF (Hypoxia-inducible factor) -independent factors associated with hypoxia)
  • SEQ ID NOs: 83-1210, SEQ ID NO: 1), and NDRG3 overexpressing transgenic C57 / BL6 mice TG-2, TG-8, and TG-13 were prepared to confirm the molecular biochemical function of NDRG3 protein in hypoxia.
  • NDRG3 protein amino acids 32-315, SEQ ID NO: 2
  • amino acids 32-315, SEQ ID NO: 2 amino acids 32-315, SEQ ID NO: 2
  • NDRG3 peptide Purified via affinity chromatography using amino acids 244-255, SEQ ID NO: 3 to prepare a Levit anti-human NDRG3 polyclonal antibody (see FIG. 2).
  • the present inventors have performed immunoprecipitation, western blotting, in-vitro pool to confirm the relationship between PHD2 and NDRG3 proteins according to the oxygen state.
  • the NDRG3 protein binds to the PHD2 protein in four PHD family groups and is the target protein of the PHD2 and E3 ubiquitin ligase complexes.
  • Confirmation of increased accumulation of NDRG3 protein by phosphorylation VHL inhibition confirmed that NDRG3 protein is an intrinsic substrate of PHD2 and that NDRG3 protein is a substrate of PHD2 / VHL-mediated post-transcriptional process (FIGS.
  • the present inventors performed immunoprecipitation, Western blotting, immunofluorescence staining, and in vivo ubiquitination assay to confirm the oxygen-dependency of NDRG3 protein.
  • hypoxia persists in several cancer cells such as the neck, kidney and colon
  • the ubiquitination of NDRG3 protein decreases, the expression and accumulation of NDRG3 protein increases, and on the contrary, the expression of NDRG3 protein slowly decreases when oxygen is restored to normal oxygen state.
  • mass spectrometry results in oxygen-dependent 294th proline of NDRG3 being hydroxylated and the proline amino acid being alanine (The mutant substituted with Alanine increased expression and confirmed that 294th proline hydroxylation of NDRG3 is a hypoxic target site (FIG. 10a and 10b).
  • the inventors performed gene expression profiling to confirm the biochemical function of the NDRG3 protein in the hypoxic reaction, and unlike HIF, the NDRG3 protein is proliferation. , Angiogenensis, and cell growth were found to be most relevant (FIGS. 12A and 12B), in-vivo angiogenesis assay and in-vivo. As a result of transplanted tumor volume measurement and MTT assay, it was confirmed that NDRG3 promotes angiogenesis, cell proliferation, and tumor growth in hypoxic response (FIGS. 13A and 13C, and FIGS. 14A to 14G).
  • NDRG3 ectopic variant NDRG3 (N66D) promotes cell proliferation and angiogenesis even when inhibition of lactate production, thus NDRG3 is induced by lactic acid-induced cell proliferation and blood vessels in persistent hypoxia. It acts as an important mediator of production (see Figures 17A-17F, and Figure 18).
  • the inventors have performed in vitro kinase assays, pull-down assays, immunoprecipitation methods, and in order to identify the molecular regulatory mechanisms of NDRG3 mediated hypoxic responses.
  • Western blotting confirmed that inhibition of NDRG3 expression in the hypoxic state inhibited the phosphorylation of c-Raf and ERK1 / 2, resulting in NDRG3 in the c-Raf-ERK1 / 2 pathway activated by lactic acid induced by hypoxic reactions. It was confirmed that it is an important mediator of the c-Raf-ERK1 / 2 signal (see FIGS. 19A-19G).
  • NDRG3 binds to RACK1 to induce PKC- ⁇ and together with c-Raf to form the NDRG3-RACK1-PKC- ⁇ -c-Raf complex, and the induced PKC- ⁇
  • -Raf protein is phosphorylated to activate c-Raf / ERK signal
  • NDRG3 regulated by lactic acid is a scaffold protein that regulates the activity of c-Raf (see FIGS. 20A to 20F).
  • the inventors performed immunohistochemical anaylysis using the NDRG3 overexpressing transgenic mice prepared above to confirm the pathological changes caused by NDRG3, and activated with NDRG3.
  • abnormal expression of NDRG3 activates the c-Raf / ERK pathway to form tumors. And promote angiogenesis.
  • Huh-1 cells were treated with sodium oxamate and L-lactic acid followed by Western blotting.
  • exogenous lactic acid recovers NDRG3 in a dose-dependent manner and does not affect the level of HIF-1 ⁇ protein (FIG. 24), which is inhibited by lxamate treatment (FIG. 25). Similar results were confirmed.
  • the NDRG3 protein of the present invention analyzes the mechanism by which degradation is inhibited by reacting with lactic acid, and confirms that lactic acid generated in the hypoxic reaction binds to and accumulates with the NDRG3 protein, thereby allowing the NDRG3 protein to be used for quantifying lactate. Said.
  • a gene expression cassette for lactic acid quantification comprising an NDRG3 gene consisting of the nucleotide sequence represented by SEQ ID NO: 1 and a gene encoding a fluorescent protein (FP).
  • expression cassette refers to a unit cassette capable of quantifying lactic acid, including an NDRG3 gene consisting of a nucleotide sequence represented by SEQ ID NO: 1, a gene encoding a fluorescent protein, or a luciferase gene.
  • the expression cassette can be used interchangeably with an expression construct or nucleic acid insert.
  • the fluorescent protein may be a red fluorescent protein (RFP), an enhanced red fluorescent protein (ERFP), a blue fluorescent protein (Cyan Fluorescent Protein, CFP), or an enhanced blue fluorescent protein (Enhanced cyan Fluorescent Protein).
  • RFP red fluorescent protein
  • ERFP enhanced red fluorescent protein
  • CFP blue fluorescent protein
  • Enhanced blue fluorescent protein Enhanced cyan Fluorescent Protein
  • ECFP Yellow Fluorescent Protein
  • EYFP Enhanced Yellow Fluorescent Protein
  • mTFP Monomeric Teal Fluorescent Protein
  • GFP Green Fluorescent Protein
  • Modified It may be any one selected from the group consisting of green fluorescent protein (EGFP).
  • the gene expression cassette of the present invention comprising an NDRG3 gene consisting of the nucleotide sequence represented by SEQ ID NO: 1 and a gene encoding a fluorescent protein may express a binding protein of NDRG3 / fluorescent protein in an environment in which lactic acid is excessively produced.
  • the gene expression cassette of the present invention can quantify lactic acid by measuring fluorescent proteins expressed in an environment in which lactic acid is excessively produced.
  • an expression cassette for lactic acid quantification comprising an NDRG3 gene and a Luciferase gene consisting of the nucleotide sequence represented by SEQ ID NO: 1.
  • expression cassette is the same as described above.
  • the luciferase (Luciferase) means a luminescent enzyme involved in the light of the organism.
  • the gene expression cassette of the present invention comprising the NDRG3 gene and the luciferase gene consisting of the nucleotide sequence represented by SEQ ID NO: 1 may express the binding protein of NDRG3 / luciferase in an environment in which lactic acid is excessively produced (FIG. 29). Therefore, the gene expression cassette of the present invention can quantify lactic acid by measuring luciferase protein expressed in an environment in which lactic acid is excessively produced.
  • a first vector comprising a Gal4DB (Gal4 DNA binding domain), and the NDRG3 gene consisting of a nucleotide sequence represented by SEQ ID NO: 1; And a Gal4 upstream activating sequence (UAS), and a second vector comprising a luciferase gene.
  • Gal4DB Gal4 DNA binding domain
  • UAS Gal4 upstream activating sequence
  • expression cassette is the same as described above.
  • Gal4 refers to a gene encoding a regulatory protein that binds to the Gal4 upstream activating sequence (UAS) upstream of the galactose metabolism gene of Saccharomyces yeast and promotes transcription.
  • UAS Gal4 upstream activating sequence
  • the GAL4 / UAS system using GAL4 which specifically binds to the UAS and promotes transcription refers to a system that enables expression of a gene to be expressed in a tissue in need of expression at a time when expression is required.
  • the gene to be expressed refers to luciferase (FIG. 30).
  • the gene expression cassette of the present invention in the environment in which lactic acid is excessively produced, the first vector including the NDRG3 gene and Gal4DB (Gal4 DNA binding domain) consisting of the nucleotide sequence represented by SEQ ID NO: 1 is a binding protein of NDRG3 / GAL4. Can be expressed.
  • the GAL4 protein region of the binding protein binds to the UAS gene of the second vector, and the second vector may express the luciferase protein by promoting transcription of the luciferase gene present near the UAS gene. Therefore, the gene expression cassette of the present invention is capable of quantifying lactic acid by measuring the luciferase protein expressed in an environment in which lactic acid is excessively produced.
  • the inventors performed immunoprecipitation, western blotting, immunofluorescence staining and in vivo ubiquitination assay to confirm the oxygen-dependence of NDRG3 protein. Although the expression decreased gradually after increasing the expression of NDRG3, the expression and accumulation of the NDRG3 protein increased as the hypoxic state continued, confirming that NDRG3 plays an important function in HIF-independently sustained hypoxic reactions (FIGS. 11A to FIG. 11c).
  • the present inventors in order to confirm the relationship between the lactic acid production in the hypoxic state and the increased expression of NDRG3 protein, the measurement of lactic acid production in the hypoxic state, Western blotting, immunoprecipitation, in vitro ubiquitin As a result of the assay, the hypoxic reaction produced lactic acid, and the resulting lactic acid binds to the lactic acid binding site containing the 62nd, 138th, 139th or 229th amino acids of NDRG3, thereby inhibiting ubiquitination of the NDRG3 protein and inhibiting HIF-ratio. It was confirmed that the expression is increased (see Figs. 15A to 15F, and Figs. 16A to 16D).
  • Huh-1 cells were treated with sodium oxamate and L-lactic acid followed by Western blotting.
  • exogenously treated lactic acid recovered NDRG3 in a dose-dependent manner and did not affect the level of HIF-1 ⁇ protein (FIG. 24).
  • NDRG3 protein is overexpressed through the gene expression cassette, and the expressed NDRG3 protein binds to lactic acid and accumulates in the cell, thus confirming the signal of NDRG3 to determine the amount of lactic acid. there was.
  • measuring the expression level of NDRG3 protein in a biological sample isolated from an individual suspected of solid cancer, ischemic disease or inflammatory disease step 1; And comparing the measured protein expression level with the protein expression level of the normal control sample (second step), and providing an information providing method for diagnosing ischemic disease or inflammatory disease.
  • diagnosis refers to confirming the presence or characteristics of a pathological condition, and for the purpose of the present invention, the diagnosis is to determine whether the onset of solid cancer, inflammatory disease or ischemic disease.
  • the solid cancer may be any one selected from the group including cervical cancer, kidney cancer, stomach cancer, liver cancer, prostate cancer, breast cancer, brain tumor, lung cancer, uterine cancer, colon cancer, bladder cancer, blood cancer and pancreatic cancer, but is not limited thereto. .
  • the inflammatory disease collectively refers to a disease of which inflammation is the main lesion, and the expression of cytokine expression that mediates the inflammatory response through the lactic acid produced by the hypoxic reaction and the lactic acid-NDRG3-Raf-ERK signaling pathway by NDRG3. It can be caused by palpation, but is not limited thereto.
  • the inflammatory diseases include asthma, allergic and non-allergic rhinitis, chronic and acute rhinitis, chronic and acute gastritis or enteritis, ulcerative gastritis, acute and chronic nephritis, acute and chronic hepatitis, chronic obstructive pulmonary disease, pulmonary fibrosis, irritability Bowel Syndrome, Inflammatory Pain, Migraine, Headache, Back Pain, Fibromyalgia, Fascia Disease, Viral Infection, Bacterial Infection, Fungal Infection, Burn, Surgical or Dental Surgery, Prostaglandin E Over Syndrome, Atherosclerosis Sclerosis, gout, degenerative arthritis, rheumatoid arthritis, ankylosing spondylitis, Hodgkin's disease, pancreatitis, conjunctivitis, iris, peritonitis, uveitis, dermatitis, eczema and multiple sclerosis, but are not limited thereto.
  • the ischemic disease is a disease caused by not supplying various nutrients contained in oxygen and blood by blocking blood supply in the heart and other tissues, and may exhibit a phenomenon in which lactic acid is overexpressed by a hypoxic reaction.
  • the ischemic disease may be any one selected from the group including cerebral ischemia, cardiac ischemia, diabetic vascular heart disease, heart failure, myocardial hypertrophy, retinal ischemia, ischemic colitis, ischemic acute renal failure, stroke, brain trauma and neonatal hypoxia, It is not limited to this.
  • the first step refers to measuring the expression level of NDRG3 protein in a biological sample isolated from an individual suspected of solid cancer, ischemic disease or inflammatory disease.
  • measuring the expression level of the NDRG3 protein may include contacting the sample with an antibody or aptamer specifically binding to the NDRG3 protein or a fragment of the protein.
  • antibody refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule, which antibody is cloned into an expression vector according to a conventional method by the marker gene.
  • the protein to be encoded can be obtained and prepared by conventional methods from the obtained protein.
  • the form of the antibody is not particularly limited and, if it is a polyclonal antibody, a monoclonal antibody or antigen-binding, a part thereof may be included in the antibody of the present invention and may include all immunoglobulin antibodies, as well as humanized antibodies. It may also contain a special antibody of.
  • the antibodies include functional fragments of antibody molecules as well as complete forms having two full length light chains and two full length heavy chains.
  • a functional fragment of an antibody molecule means a fragment having at least antigen binding function and may be Fab, F (ab '), F (ab') 2 and Fv.
  • aptamer refers to a single stranded oligonucleotide, and refers to a nucleic acid molecule having binding activity to a predetermined target molecule.
  • the aptamer may have various three-dimensional structures according to its nucleotide sequence, and may have a high affinity for a specific substance, such as an antigen-antibody reaction. Aptamers can inhibit the activity of a given target molecule by binding to the desired target molecule.
  • the aptamers of the invention may be RNA, DNA, modified nucleic acids, or mixtures thereof, and may be linear or cyclic in form, but are not limited thereto.
  • the aptamers of the invention can be used for NDRG3.
  • the aptamer having a binding activity to NDRG3 can be easily prepared according to a method well known to those skilled in the art with reference to each base sequence.
  • the term "individual” may refer to all animals, including humans, who have or are likely to develop solid cancer, ischemic disease or inflammatory disease.
  • the animal may be, but is not limited to, mammals such as cattle, horses, sheep, pigs, goats, camels, antelopes, dogs, cats, etc., which require treatment of similar symptoms as well as humans.
  • the second step refers to comparing the NDRG3 protein expression level measured in the first step with the protein expression level of the normal control sample.
  • normal control refers to an individual who does not develop or suspect a solid cancer, ischemic disease or inflammatory disease.
  • sample refers to a direct subject which is isolated from a patient having a solid cancer, an ischemic disease or an inflammatory disease, and measures the expression level of the NDRG3 protein.
  • the biological sample is a tissue, blood, plasma, serum. , Saliva, semen and urine may be any one selected from the group consisting of, but is not limited thereto.
  • the information providing method may further include determining a solid cancer, an ischemic disease, or an inflammatory disease when the expression level of the NDRG3 protein measured in the biological sample is higher than that of the normal control sample (step 3). Can be.
  • the NDRG3 protein accumulates HIF-independently by lactic acid and acts as an important mediator such as cell proliferation and angiogenesis, and thus provides a method for quantifying lactate by measuring the amount of NDRG3 protein expression.
  • NDRG3 overexpressing transgenic mice were constructed to determine the effect of NDRG3 expression on biochemical characteristics.
  • the human NDRG3 cDNA sequence (SEQ ID NO: 1) as shown in the schematic diagram of FIG. 1A is expressed in CAG-promoter (cytomegalovirus enhancer and chicken ⁇ -actin promoter) and Levit ⁇ -globin polya.
  • CAG-promoter cytomegalovirus enhancer and chicken ⁇ -actin promoter
  • Levit ⁇ -globin polya After cloning and linearization into a pCAGGS plasmid containing a polyadenylation sequence, the linearized construct was injected into the pronuclei of three C57 / BL6 mouse fertilized eggs.
  • mice To determine whether the gene was inserted, the tail of each of the three C57 / BL6 mice was cut and mouse tail lysis buffer (60 mM Tris pH 8.0 / 100 mM EDTA / 0.5% SDS, 500 ug / ml Proteinase). After genomic DNA (genomic DNA) was extracted using K), the genotype was confirmed by PCR using the primers of Table 1 below (FIG. 1B).
  • PCR was performed using the primers of Table 1 as described above to confirm overexpression of NDRG3 in the NDRG3 overexpressing transgenic mice TG-2, TG-8 and TG-13 (FIG. 1C).
  • Antisera were purified by affinity chromatography using NDRG3 peptide (QNDNKSKTLKCS; amino acids 244-255, SEQ ID NO: 3) to obtain anti-NDRG3 antibodies.
  • NDRG3 peptide QNDNKSKTLKCS; amino acids 244-255, SEQ ID NO: 3
  • Western blotting was performed.
  • Myc-tagged NDRG1 expression vector, Myc-tagged NDRG2 expression vector, Myc-tagged NDRG4 expression vector, and Myc-tagged NDRG3 expression vector were cloned.
  • site-directed mutation was performed using the KOD-Plus-Mutagenesis Kit (Toyobo) as the primer of Table 2 according to the manufacturer's procedure to perform the NDRG3 variant.
  • a Myc-tagged NDRG3 (N66D) variant was obtained in which the 66th asparagine (Asn, N) was substituted with aspartic acid.
  • each of the NDRG1-Myc, NDRG2-Myc, NDRG4-Myc and NDRG3 (N66D) -Myc were incubated with DMEM medium containing 10% FBS (Gibco BRL) and 100 U / ml penicillin (Gibco BRL).
  • DMEM medium containing 10% FBS (Gibco BRL) and 100 U / ml penicillin (Gibco BRL).
  • One HEK293T cells (ATCC) were transfected using Lipofectamine (Invitrogen) according to the manufacturer's procedure. Then, the transformed cells were incubated for 24 hours at 37 °C, CO 2 incubator (Sanyo) and recovered.
  • the recovered cells were then lysed in lysis buffer [1% Triton X-100, 150 mM NaCl, 100 mM KCl, 20 mM HEPES (pH 7.9), 10 mM EDTA, protease inhibitor cocktail (Roche)].
  • the protein lysate (30 ⁇ g) of the cells was electrophoresed with 9% SDS-PAGE and then transferred to nitrocellulose membranes (PALL Life Sciences). Subsequently, the obtained anti-NDRG3 antibody was reacted with the primary antibody and reacted, and then the HRP-conjugated secondary antibody was attached to the primary antibody attached to the membrane, and confirmed using ECL (Pierce chemical co, USA). 2).
  • N66D Sense GACCATAAATCCTGTTTCAATGCATTCTTT (SEQ ID NO: 11)
  • Antisense GAGGCCAATGTCATGATATGTTAGTATAAC SEQ ID NO: 12
  • the prepared anti-NDRG3 antibody binds only to NDRG3 (N66D) variants except NDRG1, NDRG2 and NDRG4, whereby the anti-NDDRG3 antibody binds the NDRG3 antibody and variant to the antigen. It was an antibody, and thus was used to confirm the molecular biological function of NDRG3 of the present invention (Fig. 2).
  • HIF-1 ⁇ Hypoxia-inducible Factor-1a
  • Protein bands showing different immunoprecipitation patterns in the PHD2-Flag samples were then separated from SDS-PAGE gels and digested with trypsin for micro-LC-MS / MS analysis.
  • the digested protein was injected into a fused silica capillary column (100 mm inner diameter, 360 mm outer diameter), including an 8 cm 5-mm particle size Aqua C18 reversed phase column.
  • the column was transferred to an Agilent HP 1100 4th LC pump and the peptide was separated using a flow rate of 250 nl / min as the separation system.
  • Buffer A 5% acetonitrile and 0.1% formic acid
  • Buffer B 80% acetonitrile and 0.1% formic acid
  • the eluted peptide was separated by electrospray method at 2.3 kV DC potential with LTQ linear ion trap mass spectrometer (Thermo Finnigan).
  • a data dependent scan consisting of one full MS scan (400-1400 m / z) and five data dependent MS / MS scans were used to generate the MS / MS spectrum of the eluted peptide.
  • MS / MS spectra were then analyzed from the NCBI human protein sequence database using Bioworks version 3.1. DTASelect was used to filter the search results, Xcorr values were applied to different charge states of the peptide: 1.8 applied to single charged peptides, 2.5 applied to double charged peptides, 3.5 to triple charge Applied as peptide (FIG. 3B).
  • MCF-7 cell lysates transformed with the control and Flag-tagged PHD2 constructs were immunoprecipitated using anti-FLAG M2 affinity gel (Sigma), followed by electrophoresis with 9% SDS-PAGE. And transferred to nitrocellulose membranes (PALL Life Sciences). Then, the reaction was performed by treating the anti-NDRG3 antibody and the anti-Flag antibody with the primary antibody, and then attaching the HRP-conjugated secondary antibody to the primary antibody attached to the membrane, and confirming this by using ECL (Pierce chemical co, USA). (FIG. 3C).
  • the construct encoding the flag-tagged PHD2 as in ⁇ Example 3> was cultured in DMEM medium containing 10% FBS (Gibco BRL) and 100 U / ml penicillin (Gibco BRL) HeLa cells (ATCC) were transformed and lysed after maintaining hypoxic with 1% oxygen for 24 hours. Cell lysates were then immunoprecipitated with anti-FLAG M2 beads and western blotting was performed with anti-NDRG3 and anti-Flag antibodies as primary antibodies (FIG. 4A, above).
  • PHD2 was cloned into the pET-28a recombinant plasmid by the method described in Example 1, transformed into E.
  • NDRG3 was cloned into pGEX-4T-2 recombinant plasmid, transformed into E. coli strain BL21, and purified using GST-binding agarose resin (ELPIS BIOTECH, South Korea). Then, 10 ⁇ g of the recombinant protein His-PHD2 and / or 10 ⁇ g of the recombinant protein GST-NDRG3 were incubated at 4 ° C. with Ni-NTA Agarose resin for 4 hours at a final concentration of 0.2 mg /. It was.
  • the NDRG3 protein bound to the resin was treated with SDS sample buffer and electrophoresed by SDS-PAGE as in ⁇ Example 3>, and then subjected to western blotting using an anti-NDRG3 antibody as a primary antibody (FIG. 4a, below).
  • MCF-7 cells (FIG. 4B) or HeLa cells (FIG. 4C) were incubated with PHD2 inhibitor DFX (desferrioxamine) for 24 hours under normal oxygen (21% O 2 ). After treatment, the cells were lysed as in ⁇ Example 3>. The cell lysates were subjected to Western blotting using anti-NDRG3, anti-HIF-1 ⁇ and anti- ⁇ -actin (FIGS. 4B and 4C).
  • NDRG3 protein is insufficient in HeLa cells
  • the expression of NDRG3 protein is decreased when PHD2 activity is inhibited by DFX, which is a PHD2 inhibitor in both MCF-7 and HeLa cells.
  • the PHD family consists of PHD1, PHD2, PHD3, P4HTM and P4HA1, and these families are reported to play an important role in the regulation of HIF proteins (Wenger, RH et al., Curr. Pharm. Des., 2009 ( 15), 3886-3894). Therefore, to confirm the association between VHD and NDRG3, a target protein of the P3 family other than PHD2 and the E3 ubiquitin ligase complex, RNA and PHD overexpressed cells and PHD family knocked down by RNA interference. Cells were subjected to RT-PCR, immunoprecipitation and Western blotting.
  • siVHL siGENOME SMARTpool, Dharmacon
  • Samchully Pharmaceutical Samchully Pharmaceutical
  • siRNA order Gfp sense GUUCAGCGUGUCCGGCGAGTT (SEQ ID NO: 13) Antisense CUCGCCGGACACGCUGAACTT (SEQ ID NO: 14) PHD1 sense CAUCGAGCCACUCUUUGACTT (SEQ ID NO: 15) Antisense GUCAAAGAGUGGCUCGAUGTT (SEQ ID NO: 16) PHD2 sense AACGGGUUAUGUACGUCAUTT (SEQ ID NO: 17) Antisense AUGACGUACAUAACCCGUUTT (SEQ ID NO: 18) PHD3 sense CCAGAUAUGCUAUGACUGUTT (SEQ ID NO: 19) Antisense ACAGUCAUAGCAUAUCUGGTT (SEQ ID NO: 20) P4HTM sense GAGUGUCGGCUCAUCAUCCTT (SEQ ID NO: 21) Antisense GGAUGAUGAGCCGACACUCTT (SEQ ID NO: 22) P4HA1 sense GAUCUGGUGACUUCUCUGATT (SEQ ID NO: 23) Anti
  • each of the NDRG3 and the Flag-tagged PHD families was transformed into HeLa cells by the method described in ⁇ Example 3>, and cells were obtained after treatment with 20 ⁇ M MG132 for 8 hours in a steady state. Dissolved. The cell lysates were then immunoprecipitated with anti-FLAG M2 beads and Western blotting was performed with anti-NDRG3 antibodies (FIG. 5B).
  • NDRG3 accumulates when the expression of PHD2 and VHL is inhibited using RNA interference, so that PHD2 is the main post-transcriptional in stabilizing NDRG3 protein in the PHD family group.
  • PHD2 is the main post-transcriptional in stabilizing NDRG3 protein in the PHD family group.
  • NDRG3 is the target protein of ubiqutin, thus confirming that NDRG3 is the substrate of the PHD2 / VHL-mediated post-transcriptional process (FIGS. 5A and 5B).
  • NDRG3-EGLN1 protein-protein docking simulations of predicted target proteins were performed by HEX6.3 (D.W. Ritchie. Et al., Genet, 2000 (39), 178-194). In the computational options, shapes and electrostatistics were selected as correlation types and bumps and volumes were selected after the procedure. The remaining options used a default configuration. For single target docking (ie NDRG3-EGLN1), the simulation was performed using the options listed above once. Docking for multiple target structures (ie NDRG3 and PHD2) was performed through two-step experiments. In the first step, NDRG3 was used as the receptor protein in the docking experiment for each target. In the second step, resultant protein-protein interactions were used as receptor proteins for docking of other proteins.
  • the input order for the second experiment was PHD2. Docking calculations were performed by root-mean-square deviation (RMSD) and the results were filtered where the output from a single input matched the output from multiple inputs. Of the filtered results, the most stable one was selected using the HEX6.3 total score (sum of shape scores and vestibular scores) (FIG. 6A).
  • RMSD root-mean-square deviation
  • site-designated mutations were performed according to the manufacturer's procedure using a KOD-Plus-Mutagenesis Kit (Toyobo) using the NDRG3-Myc expression vector as a template to confirm the binding capacity of the NDRG3 docking site and PHD2 confirmed by the docking simulation.
  • the 47th arginine (Arginine) from the docking model between the published PHD2 substrate (Structure. 2009 (7), 981-9) and the NDRG3 substrate to the putative PHD2-docking site of NDRG3, 66th Asparagine, 68th Lysine, 69th Serine, 72th Asparagine, 73rd Alanine, 76th Asparagine, 77th Phenylalanine, 78th Glutamic Acid , 81st Glutamine, 97th Glutamine, 98th Glutamine, 99th Glutamic Acid, 100th Glycine, 101st Alanine, 102th Proline, 103th Serine, 203th Leucine, 204 Aspartic acid, 205 leucine, 208 threonine, 209 tyrosine, 211 methionine, 212 histidine, 214 alanine, 215 glutamine, 216th
  • the NDRG3 (V296D) variant and the NDRG3 (Q97E) variant bind PHD2, whereas the NDRG3 variant mutating the 47th or 66th position of NDRG3 does not bind PHD2.
  • NDRG3 variants showing high affinity with PHD2 were immunoprecipitated by VHL in large amounts, indicating that the NDRG3 variants exhibited various PHD2-binding forces (V296D> Q97E> R47DN66D), and the 47th and 66th of NDRG3 under normal oxygen conditions.
  • the first amino acid position is important for the docking of PHD2, it was confirmed that it is also associated with VHL (Fig. 6b).
  • MG132 was used to inhibit proteasome activity, Western blotting and bioassay. In-vivo ubiquitination assay was performed.
  • a transfection vector (MSCV retrovirus system) was prepared using full-length NDRG3 cDNA (SEQ ID NO: 1) and pMSCVneo retroviral vector (Clontech).
  • Lipofectamine (Invitrogen) was used to transfect the GP293 cell line.
  • cell supernatants containing NDRG3-retrovirus or control-retrovirus were treated with HeLa cells for 24 hours, such as 6 ⁇ g / ml polybrene, and then for 8 hours to the cells overexpressed with NDRG3.
  • Cells were obtained after treatment or no treatment with 20 ⁇ M MG132 and Western blotting was performed with anti-NDRG3 antibody and anti- ⁇ actin antibody (FIG. 7A).
  • a transfection vector was prepared using shNDRG3 (Sigma-Aldrich, SEQ ID NO: 4) and a lentivirus vector.
  • shNDRG3 Sigma-Aldrich, SEQ ID NO: 4
  • lentivirus vector a lentivirus vector
  • the cell supernatant containing the NDRG3 shRNA expressing lentivirus was treated with HeLa cells with 6 ⁇ g / ml polybrene, and then maintained in DMEM medium containing 10% FBS, followed by control HeLa cells,
  • the NDRG3 expression-inhibited HeLa cells and the NDRG3 overexpressed HeLa cells were transformed with HA-tagged ubiquitin as in ⁇ Example 3>, and treated with 20 ⁇ M MG132 for 8 hours to obtain and lyse the cells. It was.
  • the cell lysates were then precleared with the addition of 30 ⁇ l protein G-agarose beads (Santa Cruz Biotechnology), immunoprecipitated with anti-NDRG3 antibody, and polyubiquitinated. Form NDRG3 was confirmed by western blotting using anti-HA antibody (FIG. 7B).
  • MCF-7 cells cultured in DMEM medium containing 10% FBS and 100 U / ml penicillin were treated with 1%, 3%, 5% and 21% O 2 and 92-94% N 2 and 5% CO 2. After maintaining with time using an O 2 / CO 2 incubator containing a mixed gas consisting of cells were obtained. Then, the cells were lysed as in ⁇ Example 3>, and the cell lysates were Western blotting using anti-NDRG3 and anti- ⁇ actin to confirm the expression of NDRG3 and graphed them (FIG. 8A).
  • MCF-7 cells incubated in cover slips with DMEM medium containing 10% FBS and 100 U / ml penicillin were mixed with 1% O 2 , 94% N 2, and 5% CO 2 .
  • the hypoxic state was maintained over time using the included O 2 / CO 2 incubator.
  • the cells were then reacted with anti-NDRG3 antibody (1 / 1,000) for 1 hour at room temperature and washed, followed by secondary antibody [Alexa Flour 488-conjugated goat anti-rabbit IgG (1 / 1,000) Or Alexa Flour 594-conjugated goth anti-mouse IgG (1 / 1,000); Amersham] and DAPI (3 ⁇ M, Sigma). Then visualized using a Zeiss LSM 510 confocal microscope (FIG. 8B).
  • MCF-7 (breast), PLC / PRF / 5 (liver), Huh-1 (liver), HeLa (uterine cervix), HEK293T (incubated with DMEM medium containing 10% FBS and 100 U / ml penicillin) Kidney) and SW480 (colon) and IMR-90 (lung) incubated with MCF-10A (breast) cells and RPMI 1640 medium containing 10% FBS and 100 U / ml penicillin as described above in an O 2 / CO 2 incubator. After maintaining in a hypoxic state (1% O 2 ) with time using, cells were obtained.
  • the cells were lysed as in ⁇ Example 3>, and the cell lysates were Western blotting using anti-NDRG3 and anti- ⁇ actin to confirm the expression of NDRG3 and graphed them (FIG. 8C).
  • HA-tagged ubiquitin and Myc-tagged NDRG3 were transformed into HeLa cells as in ⁇ Example 3>, and then cultured in normal oxygen for 40 hours and treated with 20 ⁇ M MG132 for 8 hours. Then, after additionally incubated in hypoxic state (1% O 2 ) for 24 hours, cells were obtained and lysed. The cell lysates were then precleared with the addition of 30 ⁇ l protein G-agarose beads (Santa Cruz Biotechnology), followed by immunoprecipitation with anti-Myc antibody and Western blotting with anti-HA antibody. (FIG. 8D).
  • MCF-7 cells and normal oxygen state maintained and cultured in a hypoxic state (1% O 2 ) over time as shown in Example ⁇ 5-1> to confirm the expression of NDRG3 protein in a persistent hypoxic state.
  • MCF-7 cells cultured in O2 were obtained and lysed as in ⁇ Example 3>, followed by Western blotting and graphing using anti-NDRG3, anti-HIF-1 ⁇ and anti- ⁇ -actin antibodies. (FIG. 9A).
  • Example ⁇ 5-1> MCF-7 cells and normal oxygen maintained for 24 hours in a hypoxic state (1% O 2 ) as shown in Example ⁇ 5-1> to confirm the expression change of the NDRG3 protein when it is restored to the normal oxygen state
  • MCF-7 cells were maintained and cultured with time in state (21% O 2 ) and lysed as in ⁇ Example 3>, followed by anti-NDRG3, anti-HIF-1 ⁇ and anti- ⁇ -actin antibodies.
  • Western blotting and graphing FIG. 9B).
  • the expression of the HIF-1 ⁇ protein is induced at the early stage of hypoxia and the hypoxia persists, whereas the expression of the NDRG3 protein is decreased until the end stage of hypoxia. It was confirmed that it is maintained continuously. In addition, it was confirmed that NDRG3 expression induced by the persistent hypoxic state was slowly removed until the cells returned to normal oxygen state again (FIGS. 9A and 9B).
  • micro-LC-MS / MS analysis was performed, and Western blotting was performed using cells overexpressing the NDRG3 variant prepared with site-directed mutations.
  • immunoprecipitation and western blotting were performed to confirm the association of PHD2 / VHL with the hypoxic target site of NDRG3 protein in normal oxygen.
  • NDRG3 overexpressed MCF-7 cells obtained by the method described in Example ⁇ 4-2> to identify target sites of the NDRG3 protein under hypoxic conditions were treated with 10 ⁇ M MG132, and then cells were obtained and lysed. And immunoprecipitated with an anti-NDRG3 antibody as in ⁇ Example 3> and micro-LC-MS / MS analysis was performed (FIG. 10A).
  • the 294 th proline (Pro, P) which is expected to be the NDRG3 protein target site, was first alanine (Ala In order to substitute for A), Myc-tagged NDRG3 P294A variants were prepared by performing site-directed mutations as in Example ⁇ 4-3>. Then, the NDRG3 variant or wild-type NDRG3 construct was transformed into HEK293T cells as in ⁇ Example 3>, and then cultured under normal oxygen state (21% O 2 ) for 40 hours and 20 ⁇ M for an additional 8 hours.
  • Cells treated with and without MG132 were obtained.
  • the obtained cells were subjected to Western blotting using anti-Myc and anti- ⁇ actin antibodies after lysis (Fig. 10b, above).
  • Flag-tagged PHD2, HA-tagged VHL, and Myc-tagged NDRG3P294A variant or Myc-tagged NDRG3 were simultaneously transformed into HEK293T cells as in ⁇ Example 3>, and then normal for 40 hours.
  • Cells were obtained by incubating under oxygen (21% O 2 ) and treating 20 ⁇ M MG132 for an additional 8 hours. Then, the obtained cells were lysed, immunoprecipitated with an anti-Myc affinity gel, and Western blotting was performed using anti-Flag, anti-HA and anti-Myc antibodies (FIG. 10B, bottom).
  • MCF-7 cells and hypoxic state (1) maintained and cultured for 24 hours in normal oxygen state (21% O 2 ) as in Example ⁇ 5-2> to confirm the expression of HIF protein according to the oxygen state.
  • MCF-7 cells maintained in cultivation at% O 2 half were Western-treated using anti-HIF-1 ⁇ , anti-HIF-2 ⁇ and anti- ⁇ -actin as in ⁇ Example 3>. Blotting was performed to confirm the expression of the protein, half of which was performed by RT-PCR as in Example ⁇ 4-2> to confirm mRNA expression (FIG. 11A).
  • the control PLC / PRF / 5 cells, the PLC / PRF / 5 cells suppressed HIF-1 ⁇ or shHIF-2 ⁇ expression was depressedrioxamine (DFX) 1, a PHD2 inhibitor under normal oxygen (21% O 2 ) 1
  • DFX depressedrioxamine
  • DFX a PHD2 inhibitor under normal oxygen (21% O 2 ) 1
  • cells were obtained and lysed as in ⁇ Example 3>, and the lysate was used with anti-NDRG3, anti-HIF-1 ⁇ , anti-HIF-2 ⁇ , and anti- ⁇ -actin. Western blotting was performed (FIG. 11B).
  • MCF-7 HIF-1 + / + and VHL + / +
  • HIF-1 ⁇ and VHL loci were genetically disrupted to confirm expression of NDRG3 protein following HIF and VHL deletion.
  • -O HIF-1 -/- and VHL -/-
  • Cells were harvested and lysed as described above, and the cell lysates were subjected to western blotting using anti-NDRG3, anti-HIF-1 ⁇ and anti- ⁇ -actin (FIG. 11C).
  • FIG. 11B and FIG. 11C it was confirmed that accumulation of NDRG3 protein increased as the inhibition of PHD2 activity was continued without being affected by the deletion of HIF in the normal oxygen state (FIG. 11B). It was confirmed that expression of the NDRG3 protein was preserved without being affected by HIF and VHL deletion (FIG. 11C).
  • expression of NDRG3 protein is oxygen-dependently regulated by PHD2, and expression of NDRG3 continues as hypoxia persists, whereby expression of NDRG3 protein and mRNA is dependent on HIF activity. It was confirmed that it is not directly affected, and therefore NDRG3 has a major function in HIF-independently sustained hypoxic reaction.
  • RNA isolation kit RNeasy midi-prep, Qiagen
  • Huh-7 (2 ⁇ 10 5 cells / ml) and control Huh-7 cells in which NDRG3 expression was suppressed using shNDRG3 by the method described in Example ⁇ 4-4> were hypoxic (1% O 2 Incubated for 24 hours and then recovered the culture solution (1 ml) in a 6-well dish coated with Matrigel in advance with human umbilical vein endothelial cells (HUVEC) (1 ⁇ 0 5 cells / ml). The tube formation was observed by incubating for 6-12 hours (FIG. 13A).
  • NDRG3 deletion Huh- obtained by the method described in Example ⁇ 6-1>.
  • the cells were harvested after 7 days of incubation and control Huh-7 cells under normal oxygen (21% O 2 ) or hypoxic (1% O 2 ) for 24 hours.
  • the NDRG3 (N66D) variant prepared by the method described in Example ⁇ 4-3> was transformed into HeLa cells as described in ⁇ Example 3>, and the cells were recovered after maintenance for 24 hours under normal oxygen. It was.
  • RNA was isolated and RT-PCR was performed by the method described in Example ⁇ 4-4>.
  • expression of NDRG3 was confirmed by Western blotting of each of the cells using an anti-NDRG3 antibody as in ⁇ Example 3>.
  • a matrigel plug assay was performed for in vivo angiogenesis analysis by NDRG3 deletion.
  • NDRG3 deleted Huh-7 cells (1 ⁇ 10 6 cells / ml) and control Huh-7 cells (1 ⁇ 10 6 ) obtained by cold Matrigel (BD Biosciences) obtained by the method described in Example ⁇ 6-1> above. Cells / ml).
  • 500 ⁇ l of the mixed Matrigel was injected subcutaneously into the abdominal region of 6-week-old female BALB / c mice (Japan SLC).
  • mice were sacrificed and Matrigel plaques were obtained, then homogenized with 500 ⁇ l water in an ice bucket for hemoglobin quantification and washed by centrifugation at 12,000 rpm for 15 minutes at 4 ° C. Then, only the supernatant was separated, and then reacted according to the manufacturer's procedure using Drabkin's reagent (Sigma) and graphed by measuring absorbance at a wavelength of 570 nm with an absorbance spectrophotometer (FIG. 13C).
  • FIG. 13A shows that in the case of the cells inhibited NDRG3 expression under hypoxic state confirmed that the tube formation is reduced compared to the control, NDRG3 deletion inhibits the angiogenic activity induced by hypoxic reaction It was confirmed (FIG. 13A).
  • expression of angiogenesis markers IL8, IL1 ⁇ and IL1 ⁇ COX-2 and PAI-1 mRNA was significantly reduced in NDRG3 deleted cells in the hypoxic state (FIG. 13B, left), whereas PHD2 binding sites In cells overexpressed with the mutated NDRG3 (N66D) variant (Fig. 13B, right), the mRNA expression of the factor was increased, thereby increasing the expression of angiogenesis factor by NDRG3 in hypoxia reactions. It was confirmed to be promoted (FIGS. 13A and 13B).
  • MTT assay was performed to analyze cell growth and transplanted in vivo. Tumor volume was measured and immunofluorescence staining, western blotting and RT-PCR were performed.
  • MTT assay was performed to confirm cell growth due to NDRG3 deletion.
  • NDRG3 deleted Huh-1 cells and control Huh-1 cells obtained by the method described in Example ⁇ 6-1> were dispensed into 96-well plates at a number of 2,000 cells / well, and 37 C, incubated in 5% CO 2 incubator, hypoxic state (3% O 2 ) over time.
  • the medium containing the MTT was removed and treated with 100 DMSO to dissolve the MTT formazan crystal (formazan crystal).
  • absorbance at 570 nm wavelength was measured with an absorbance meter (FIG. 14A).
  • NDRG3, HIF-1 ⁇ , HIF-2 ⁇ , NDRG3 and HIF-1 ⁇ prepared by the methods described in Examples ⁇ 4-4> and ⁇ 5-4> to confirm the degree of tumor formation due to NDRG3 and HIF deletion.
  • Huh-7 cells (2 ⁇ 10 6 cells / 100), each of which inhibited NDRG3 and HIF-2 ⁇ expression, were administered subcutaneously to the 6 week old female BALB / c mouse flank (FIG. 14B).
  • Huh-1 cells (2 ⁇ 10 6 cells / 100 ⁇ l) transformed with the NDRG3 (N66D) variant prepared by the method described in Example ⁇ 4-3> in the same manner as in ⁇ Example 3> above were used as described above.
  • it was administered subcutaneously to the side of the mouse (FIG. 14C). Then, 16 and 20 days after dosing, the tumors were imaged for comparison, respectively (FIGS. 14B and 14C).
  • mice grafted with NDRG3, HIF-1 ⁇ , HIF-2 ⁇ , NDRG3 and HIF-1 ⁇ , or Huh-7 cells with suppressed NDRG3 and HIF-2 ⁇ expression (FIG. 14D) and the NDRG3 (N66D) variants were overexpressed.
  • Tumor volume was measured using a caliper at a given time after transplantation in mice transplanted with Huh-1 cells (FIG. 14E). Tumor volume was graphed by measuring the length (a), width (b) and height (c) and calculated as shown in Equation 1 below (FIGS. 14D and 14E).
  • Tumor volume tumor length (a) x tumor width (b) x tumor height (c) / 2
  • mice transplanted with Huh-7 cells (2 ⁇ 10 6 cells / 100) in which the NDRG3, HIF-1 ⁇ and HIF-2 ⁇ expressions were suppressed
  • the cells were extracted with 10% formalin at room temperature. Fixed for one day. Paraffin was then treated and 4 sectioned. Then, infiltrated with 0.3% TritonX-100 / PBS for 5 minutes at room temperature and incubated for 30 minutes with blocking solution (PBS with 1% BSA), followed by the method described in Example ⁇ 5-1>.
  • mice transplanted with Huh-7 cells (2 ⁇ 10 6 cells / 100 ⁇ l) in which NDRG3, HIF-1 ⁇ and HIF-2 ⁇ expression was suppressed were extracted and frozen with liquid nitrogen.
  • RT-PCR was performed to confirm the expression of mRNA by the method described in Example ⁇ 4-2>, and Western blots with anti-NDRG3 and anti- ⁇ actin antibodies by the method described in ⁇ Example 2>. Routing was performed to confirm the expression of the protein (FIG. 14G).
  • mice transplanted with NDRG3 suppressed cells is suppressed over time compared to the control and mice transplanted with HIF suppressed cells, particularly, Mice transplanted with NDRG3 and HIF-1 ⁇ or -2a co-deleted cells did not produce tumors (Figs. 14B and 14D).
  • mice transplanted with cells overexpressing the NDRG3 (N66D) mutant in which the docking site of PHD2 was mutated was significantly increased compared to the control group, especially in the control group until 20 days after transplantation, whereas NDRG3 ( N66D) mutant overexpressing cell transplantation mice were confirmed to increase the tumor size up to about 900 mm 3 , confirming that tumor growth is promoted by the NDRG3 (N66D) variant (Figs. 14B to 14E).
  • FIGS. 14F and 14G it was confirmed that the expression of Ki-67, a cell proliferation marker, was inhibited in tumor tissues of NDRG3 deficient cell transplanted mice (FIG. 14F).
  • Ki-67 a cell proliferation marker
  • protein and mRNA expression of tumor angiogenesis markers IL8 and CD31 are suppressed in tumor tissues of NDRG3 deficient cell transplanted mice (FIGS. 14F and 14G). Therefore, the results of ⁇ Example 6> confirmed that NDRG3 plays an important role in promoting angiogenesis and cell proliferation in a persistent hypoxic state.
  • Example ⁇ 5-2> Cells were collected and lysed as in ⁇ Example 3>. The cell lysates were then subjected to Western blotting using anti-NDRG3, anti-HIF-1 ⁇ and anti- ⁇ -actin and subjected to manufacturer's procedure using EnzyChromTM L-Lactate Assay Kit (BioAssay Systems). According to the L-Lactate production was measured and graphed. Values were normalized to L-lactic acid standard curve, through which it was confirmed that the lactic acid content according to the amount of intracellular NDRG3 protein expression can be calculated (Fig. 15a).
  • MCF-7 cells were treated with sodium oxamate, a concentration of lactate dehydrogenase A (LDHA) inhibitor, by concentration. After maintenance for 24 hours in a hypoxic state (1% O 2 ) as >>, cells were recovered and lysed as in ⁇ Example 3>. Then, Western blotting was performed using anti-NDRG3, anti-HIF-1 ⁇ , and anti- ⁇ -actin as described above, and L-Lactate production was measured and graphed. Values were normalized to L-lactic acid standard curve, and it was confirmed that the lactic acid content according to the amount of intracellular NDRG3 protein expression could be calculated (FIG. 15B).
  • LDHA lactate dehydrogenase A
  • MCF-7 cells were treated with 2-deoxyglucose (2-DG) that inhibits glycolysis by concentration, and the above Example 5 Incubated for 24 hours in a hypoxic state (1% O 2 ) as in -2>, the cells were recovered and lysed as in ⁇ Example 3>, and Western blotting using anti-NDRG3 and anti- ⁇ actin. Was performed (FIG. 15D).
  • 2-DG 2-deoxyglucose
  • a flag-tagged LDHA expression vector was prepared, and transformed into HeLa cells as in ⁇ Example 3> and normal oxygen state (21% O 2 ) It was kept incubated for 24 hours under. Then, additionally treated with 50 mM pyruvate and maintained in light hypoxia (3% O 2 ) for 24 hours, then cells were recovered and lysed, and anti-NDRG3, anti-Flag and anti- ⁇ actin Western blotting was performed using (Fig. 15E).
  • Huh-1 cells in which LDHA was deleted were prepared using siLDHA (siGENOME SMARTpool, Dharmacon) by the method described in Example ⁇ 4-2>.
  • siLDHA siLDHA
  • the L-lactic acid was treated by concentration and maintained incubated for 24 hours in a normal oxygen state (21% O 2 ), low oxygen state (1% O 2 ) as in Example ⁇ 5-2> and the ⁇ Example 3 Cells were harvested and lysed as>.
  • Western blotting was performed using anti-NDRG3, anti-HIF-1 ⁇ , anti-LDHA and anti- ⁇ -actin as described above, and the expression of NDRG3 protein and HIF-1 ⁇ protein was confirmed (FIG. 24).
  • RT-PCR was performed as in Example ⁇ 4-2> to confirm the effect on NDRG3 mRNA (FIG. 24).
  • Huh-1 cells were treated with sodium oxamate, and then L-lactic acid was treated by concentration. 5-2> was maintained and cultured for 24 hours under normal oxygen (21% O 2 ), low oxygen (1% O 2 ), and cells were recovered and lysed as in ⁇ Example 3>. Then, Western blotting was performed using anti-NDRG3, anti-HIF-1 ⁇ and anti- ⁇ -actin as described above, and the expression of NDRG3 protein and HIF-1 ⁇ protein was confirmed (FIG. 25).
  • Example ⁇ 4-2> After producing Huh-1 cells that inhibited MCT (monocarboxylate transporter) 1 and treating with L-lactic acid, the normal oxygen state (21% O 2 ), hypoxic state (1% O as shown in Example 5-2) 2 ) under incubation for 24 hours and cells were recovered and lysed as in ⁇ Example 3>. Then, Western blotting was performed using anti-NDRG3, anti-HIF-1 ⁇ and anti- ⁇ -actin as described above, and the expression of NDRG3 protein and HIF-1 ⁇ protein was confirmed (FIG. 26).
  • in vitro ubiquitin assay was performed to confirm the effect of lactic acid production on ubiquitination of NDRG3.
  • Flag-tagged PHD2 and HA-tagged VHL were transformed into HEK293T cells as in ⁇ Example 3>, and the cells were recovered and lysed.
  • the protein lysate 500 ⁇ g was then reacted for one day at 4 ° C. using anti-HA affinity gel (Sigma) or anti-Flag affinity gel (Sigma) to obtain recombinant PHD2 proteins or VHL proteins. It was.
  • recombinant human NDRG3-GST (treated with or without L-lactic acid (pH 7.0, 20 mM) obtained by the method described in Example ⁇ 4-1> above) was treated with the recombinant PHD2 / VHL-binding proteins. 4 ⁇ g), 500 ng ubiquitin-activating enzyme (E1, Upstate), 1 ubiquitin-conjugating enzyme (E2 (UbcH5a), Upstate), 2.5 ⁇ g ubiquitin-Flag (Sigma), 20 The reaction was carried out at 37 ° C. for 1 hour with 50 ⁇ l solution containing mM HEPES (pH 7.3), 5 mM MgCl 2, 1 mM DTT, and 2 mM ATP. Then, the mixture was incubated with GST-bound agarose resin at 4 ° C. for 4 hours, and then the precipitate was washed and Western blotting was performed using anti-Flag as shown in Example 3. 15f).
  • FIG. 15A the expression of HIF-1 ⁇ protein in the early stage of hypoxia increased significantly and then decreased, but lactic acid production and accumulation of NDRG3 protein increased significantly as the hypoxic state continued.
  • FIG. 15B the expression of NDRG3 protein in hypoxia is associated with lactic acid production. It was confirmed (FIG. 15A and 15B).
  • FIGS. 15C to 15E when lactic acid production is inhibited by inhibiting glycolysis through LDHA deletion or 2-deoxyglucose treatment, expression of NDRG3 protein in the hypoxic state decreases, whereas MCT4 deletion, Or when lactic acid is increased through LDHA overexpression and / or pyruvate-containing medium supply, the accumulation of NDRG3 protein in hypoxic states is increased, in contrast to hypoacidity induction of HIF protein, as well as oxygen deficiency in NDRG3 protein accumulation. As well as glycolytic lactate production was confirmed to be required additionally (Figs. 15c to 15e).
  • NDRG3 variant recombinant protein was prepared using NDRG3 recombinant protein and site-directed mutations and used in-vitro binding assay. , Immunostaining and western blotting were performed.
  • pGEX-4T-2-NDRG3 substituted with tryptophan (W) for glycine (Glycine, G), which is the 138th amino acid of L-lactic acid-binding site of NDRG3 (G138W) Variant constructs were obtained.
  • the recombinant plasmid pGEX-4T-2-NDRG3 wild type and -NDRG3 (G138W) is transformed into E.
  • the NDRG3 variant was prepared to confirm the interaction with the binding site of L-lactic acid and NDRG3 protein in the hypoxic state.
  • a site-directed mutation was carried out using a Myc-tagged NDRG3 expression vector as a template, as shown in Example 4-4.
  • Aspartic acid (Asp, D) which is the 62nd amino acid among L-lactic acid binding sites of NDRG3, was leucine.
  • each of the Myc-NDRG3 and Myc-NDRG3 variants was transformed into HEK293T cells as in ⁇ Example 3>, followed by normal oxygen state (21% O 2 ), as in Example ⁇ 5-2>, hypoxia (1% O 2), or 20 ⁇ M MG132 treatment after the culture and the cells were recovered and dissolved maintained for 24 hours under hypoxic conditions (1% O 2).
  • the cell lysates were then subjected to Western blotting using anti-Myc and anti- ⁇ actin antibodies (FIG. 16C).
  • MCF-7 cells were maintained in a hypoxic state (1% O 2 ) for 24 hours in order to confirm the expression of the NDRG3 protein when the hypoxic state was restored to the normal oxygen state, and then replaced with fresh medium and additionally normal oxygen Under the condition (21% O 2 ) was maintained incubated with time and cells were recovered and lysed as in ⁇ Example 3>.
  • the cell lysates were then subjected to Western blotting using anti-NDRG3, anti-HIF-1 ⁇ and anti- ⁇ -actin antibodies (FIG. 16D).
  • Example 7 confirmed that the hypoxic-induced lactic acid acts as a sensor of NDRG3 in the persistent hypoxic reaction to promote HIF-independent biological response by NDRG3.
  • an ectopic variant NDRG3 (N66D) expression vector was added to Huh-1 cells as in Example 4-4. After transformation, the cells were cultured in 96-well plates with Huh-1 cells and the NDRG3 (N66D) variant overexpressing Huh-1 cells at 1,000 cells / well, treated with sodium oxamate at different concentrations, and in a mild hypoxic state (3% O 2 ). It was maintained incubated with time under. Then, to confirm the cell growth was performed by the MTT assay as in Example ⁇ 6-3> was graphed (Fig. 17a).
  • colony formation assays were performed to determine the effect of ectopic variant NDRG3 (N66D) on cell growth after lactic acid production inhibition.
  • NDRG3 NDRG3
  • 40 mM of sodium oxamate was treated or untreated and normal oxygen state (21 Incubated for 10 days with dilution with fresh medium every 3 days under% O 2 ).
  • Colonies formed after 10 days of culture were identified and fixed with 100% methyl alcohol, followed by staining with 30% Gimsa stain solution (Sigma) (FIG. 17B).
  • NDRG3 (N66D) ectopic variant NDRG3
  • Huh-1 cells lacking LDHA were prepared by the method described in Example ⁇ 4-4>, and then transformed with NDRG3 (N66D) mutant expression vector as in ⁇ Example 3> to delete LDHA and NDRG3 (N66D) variant overexpressing Huh-1 cells were obtained.
  • control GFP deleted Huh-1 cells, the LDHA deleted Huh-1 cells and the LDHA deleted / NDRG3 (N66D) overexpressing Huh-1 cells were incubated at 96 cells / well in 96-well plates and light hypoxic (3 Incubated with time under% O 2 ). Then, in order to confirm cell growth, the graph was performed by performing the MTT assay as in Example ⁇ 6-3> (FIG. 17C).
  • tumor volume was measured after transplantation of tumor cells into mice to determine the effect of ectopic variant NDRG3 (N66D) on cell growth after inhibition of lactic acid production by LDHA deletion in vivo.
  • the control GFP deleted Huh-1 cells, the LDHA deleted Huh-1 cells and the LDHA deletion / NDRG3 (N66D) overexpressing Huh-1 cells were transplanted into BALB / c mice by the method described in Example ⁇ 6-3>.
  • the tumor volume was then measured and graphed using calipers at a given time (FIG. 17D).
  • Huh-1 cells and the NDRG3 which were maintained or cultured with sodium oxamate as above in a hypoxic state and were treated with time in order to confirm the effect of ectopic variant NDRG3 (N66D) on lactic acid production in a continuous hypoxic state.
  • N66D ectopic variant NDRG3
  • Variant overexpressing Huh-1 cells were harvested and graphed by measuring L-Lactate production by the method described in Example ⁇ 7-1>. Values were normalized to L-lactic acid standard curve (FIG. 17F).
  • FIGS. 17A to 17D the treatment of sodium oxamate in a hypoxic state inhibited cell growth in a concentration-dependent manner, whereas the treatment of sodium oxamate in a hypoxic state when exotropic variants of NDRG3 were overexpressed. It was confirmed that cell growth was increased (FIG. 17A). It was confirmed that tumor growth was promoted similarly to the hypoxic state when the NDRG3 ectopic variant was overexpressed even in the normal oxygen state even when lactic acid production was suppressed (FIG. 17B).
  • tube formation assays were performed using NDRG3 variant ectopic variant overexpressing cells.
  • the control cells and the NDRG3 (N66D) variant overexpressing Huh-1 cells were treated with or without sodium oxamate and were hypoxic (1% O After 2 ) maintenance culture for 24 hours, cells were recovered as in Example ⁇ 6-2>, and a tube formation assay was performed (FIG. 18).
  • Example ⁇ 4-4> After preparing GFP or NDRG3 deleted PLC / PRF / 5 cells using the control group shGFP or shNDRG3 by the method described in Example ⁇ 4-4>, the cells were stored under hypoxic state (1% O 2 ). The cells were maintained for a period of time and recovered as in ⁇ Example 3>. Then, the phosphorylated protein was identified according to the manufacturer's procedure using the Human Phospho-Kinase Array kit (FIG. 19A).
  • GFP or NDRG3 deleted SK-HEP-1 cells were prepared using the control shGFP or shNDRG3 by the method described in Example ⁇ 4-4>, and then the cells.
  • was maintained in a hypoxic state over time cells were recovered and lysed as in ⁇ Example 3>, and Western blotting was performed using anti-phosphorylated-ERK1 / 2 and anti-ERK1 / 2 antibodies (FIG. 19C). , Above).
  • the produced cells were maintained in a hypoxic state for 24 hours, and the cells were recovered and lysed as in ⁇ Example 3>, and anti-NDRG3, anti-phosphorylation-c-Raf (S338), and anti-c- Western blotting was performed with Raf, anti-phosphorylated-B-RAF1 (S445), anti-B-RAF1, anti-phosphorylated-A-RAF (S299), anti-A-RAF and anti- ⁇ actin antibody. (Figure 19c, below).
  • recombinant plasmid pET-28a-c-Raf construct encoding c-Raf was first cloned to confirm the interaction of NDRG3 and c-Raf by hypoxic reaction in vitro.
  • the c-Raf expression vector was transformed into a BL21 Escherichia coli strain to obtain a recombinant protein, and the c-Raf recombinant protein was obtained by using Ni-NTA agarose resin. Purified according to the manufacturer's procedure.
  • Example ⁇ 4-1> the purified recombinant proteins c-Raf-His and NDRG3-GST are reacted with Ni-NTA agarose resin to perform His pull-down, and then ⁇ Western blotting was performed using an anti-NDRG3 antibody as in Example 3> (FIG. 19D, left).
  • the Flag-tagged c-Raf vector was transformed into HeLa cells as in ⁇ Example 3>.
  • the Flag-c-Raf overexpressed HeLa cells were maintained in hypoxic condition (1% O 2 ) for 24 hours, followed by immunoprecipitation using anti-FLAG M2 beads, and Western with anti-NDRG3 antibody. Blotting was performed (FIG. 19D, right).
  • NDRG3 in order to confirm the molecular function of NDRG3 in a hypoxic state, the expression of NDRG3 was reduced by using four types of siNDRG3 (siGENOME SMARTpool, Dharmacon) (SEQ ID NO: 5 to SEQ ID NO: 8) as in Example ⁇ 4-2>.
  • siNDRG3 siGENOME SMARTpool, Dharmacon
  • SEQ ID NO: 5 to SEQ ID NO: 8 in Example ⁇ 4-2>.
  • Inhibited SK-HEP-1 cells were prepared and transformed using the Flag-tagged c-Raf expression vector as in ⁇ Example 3> to obtain NDRG3 deletion / c-Raf overexpressing cells.
  • NDRG3 (N66D) and c-Raf overexpressing HEK293T cells were obtained by transformation as in ⁇ Example 3> using Myc-tagged NDRG3 (N66D) and Flag-tagged c-Raf expression vectors.
  • the cells were maintained in a normal oxygen state (21% O 2 ) for 24 hours, and the cells were recovered and lysed as in ⁇ Example 3>, followed by anti-NDRG3, anti-phosphorylation-c-Raf ( S338), anti-c-Raf, anti-phosphorylated-B-RAF1 (S445), anti-B-RAF1, anti-phosphorylated-ERK1 / 2, anti-ERK1 / 2 and anti- ⁇ actin antibodies Routing was performed (FIG. 19E).
  • in vitro kinase assay was performed using [-32P] -ATP (PerkinElmer) label to confirm phosphorylation by NDRG3 in hypoxic state.
  • HEK293T cells transformed with Myc-tagged NDRG3 (N66D) expression vectors were prepared as in ⁇ Example 3>, and then NDRG3 protein was immunoprecipitated using an anti-Myc affinity gel. Subsequently, the immunoprecipitated NDRG3 complex was subjected to radiolabeling and treated or untreated with 5 ⁇ M of PKC inhibitor PKC-1 and contained in 40 ⁇ l reaction buffer [PKC activity buffer and SignaTECT protein kinase C assay kit (Promega).
  • PKC activity buffer and SignaTECT protein kinase C assay kit Promega
  • MCF-7 cells were maintained in the normal state (21% O 2 ) for 24 hours in order to confirm the lactic acid dependence of the NDRG3-mediated molecular pathway activity in the hypoxic state, and the above Example 7-1 LDHA expression-inhibited MCF-7 cells obtained by the method described in the above, or cells treated with or without sodium oxamate were maintained in a hypoxic state (1% O 2 ) for 24 hours.
  • Figs. 19A to 19D when NDRG3 is deleted, phosphorylation of ERK1 / 2 is decreased in a persistent hypoxic state (Figs. 19A and 19C, above), and expression of NDRG3 protein in normal oxygen state is decreased.
  • FIG. 19B By confirming that the phosphorylation level of ERK1 / 2 is different in proportion to the expression level of NDRG3 protein in different cell types (FIG. 19B), it was confirmed that NDRG3 activates ERK1 / 2 in a continuous hypoxic reaction.
  • FIGS. 19E and 19F when the ectopic variant of NDRG3 (N66D) is overexpressed, phosphorylation of ERK1 / 2 and c-Raf is induced even in a normal oxygen state (FIG. 19E), and in vitro, the NDRG3 ectopic variant molecule. It was confirmed that the host complex mediated phosphorylation of recombinant c-Raf protein (FIG. 19F).
  • RACK1 is a scaffold protein for PKC and is well known to maintain active conformation (Lendahl, U. et al., Nat. Rev. Genet., 2009 (10), 821-82). 832), PKCs are reported to phosphorylate and activate c-Raf (Epstein, AC et al., Cell, 2001 (107), 43-54, Mahon, P. c. Et al., Genes Dev, 2001 (15), 2675-2686). Therefore, in order to confirm the involvement of RACK1 in the kinase pathway activity by NDRG3 in hypoxic state, immunoprecipitation, Western blotting is performed, and protein structure to confirm complex formation between NDRG3 and proteins involved in the kinase pathway. Modeling was performed.
  • NDRG3 and / or Flag-tagged RACK1 expression vectors were transformed into HeLa cells as in ⁇ Example 3>, and 20% under normal oxygen (21% O 2 ). After culturing for 8 hours with ⁇ M MG132, cells were recovered and lysed and immunoprecipitated with anti-FLAG M2 beads. Then, Western blotting was performed using anti-NDRG3 antibodies to identify NDRG3 bound to RACK-1 (FIG. 20A).
  • NDRG3 N66D overexpressed HEK293T cells treated or untreated with 5 ⁇ M of PKC-I (LY333531) for 24 hours incubated under normal oxygen conditions, and then the cells were recovered and lysed as shown in ⁇ Example 3>, and then the anti- Western blotting is performed with NDRG3, anti-phosphorylated-c-Raf (S338), anti-c-Raf, anti-phosphorylated-ERK1 / 2, anti-ERK1 / 2, anti-RACK1 and anti- ⁇ actin antibodies (FIG. 20B).
  • NDRG3 N66D
  • Myc-NDRG3 N66D
  • siRACK1 siRACK1
  • HeLa cells were cultured under oxygenated state (21% O 2 ) or PKC inhibitor PKC-I (GO; GO 6976) 1 ⁇ M or PKC-I ( LY; LY333531) 5 ⁇ M and maintenance culture under hypoxic condition (1% O2) for 24 hours, and then the cells were recovered and lysed as in ⁇ Example 3> and anti-phosphorylation-ERK1 / 2 and anti-ERK1 Western blotting was performed using the / 2 antibody (FIG. 20D).
  • the Flag-c-Raf and Flag-RACK1 expression vector, and / or Myc-NDRG3 (N66D) expression vector were used in the above ⁇ Example HEK293T cells were transformed as shown in 3>, and the cells were recovered and lysed for 24 base acids under normal oxygen.
  • immunoprecipitation was performed using an anti-Myc affinity gel, followed by electrophoresis with SDS-PAGE, followed by Western blotting using anti-Flag, anti-Myc and anti-PKC- ⁇ antibodies (FIG. 20E). .
  • Example ⁇ 4-3> a protein docking simulation was performed as in Example ⁇ 4-3>. Docking for multiple target structures (ie NDRG3, RAF1, RACK1 (GNB2L1) and PKC- ⁇ ) was performed through a two-step experiment. In the first step, NDRG3 was used as the receptor protein in the docking experiment for each target. In the second step, resultant protein-protein interactions were used as receptor proteins for docking of other proteins. Input order for the second experiment was c-Raf, RACK1 and PKC- ⁇ in order.
  • BLASTp protein-protein BLAST search is performed to find template candidates used for homology modeling from well-known structures in a protein data bank (PDB) sequence database and have a p-value less than 10 ⁇ 3. The one with the highest identity scores was identified.
  • BLAST was performed to perform the alignment process, and the restrained spaces in the structure were identified.
  • FIG. 20c shows that NDRG3 interacts with RACK1 and PKC- ⁇ in the hypoxic state to promote c-Raf-ERK phosphorylation (FIGS. 20A-20D).
  • NDRG3 is present in the cell as complexed with c-Raf, RACK1 and PKC- ⁇ as shown in FIGS. 20E and 20F (FIG. 20E), NDRG3-c via docking simulation and protein structure modeling.
  • FIGS. 20E and 20F FIGS. 20E and 20F
  • NDRG3-c via docking simulation and protein structure modeling.
  • the flexibility of -Raf-RACK1-PKC- ⁇ quaternary complex formation was confirmed (FIG. 20F).
  • NDRG3 interacts with RACK1, thereby c-Raf is phosphorylated by PKC ⁇ induced in the NDRG3-RACK1 complex, so that NDRG3 regulated by lactic acid is c-Raf and It was confirmed that it is a scaffold protein of RACK1.
  • NDRG3 overexpressing transgenic C57 / BL6 mice 40 mice
  • control mice 32) prepared to overexpress the NDRG3 gene as a whole by the method described in Example 1 above.
  • Tumors were determined by stages up to 24 months and then graphed using a tumor-free Kaplan Meier assay (FIG. 21A).
  • lymph nodes, spleen, and liver tissues were extracted from the NDRG3 overexpressing transgenic mice and control mice, and then fixed at room temperature for 10 days with formalin.
  • the immobilized tissues were then treated with paraffin and sectioned at 4 ⁇ m and then transferred to silanylated slides (Histoserv).
  • the sectioned tissue slides were treated with 0.01 M citrate buffer (pH 6.0) for antigen retrieval and heated at 100 ° C. for 2 minutes.
  • the slides were cooled and treated with 3% hydrogen peroxide / PBS for 5 minutes to inactivate tissue intracellular peroxidase, followed by 30% with 10% non-immune mouse or goat serum. Blocked for minutes. Then, it was labeled with anti-CD45R and anti-CD3 antibodies for the detection of CD45R, a B cell marker expressed in lymphoma, and CD3, a T cell marker, and the label was labeled with DAB (3,3'-diaminobenzidine) substrate chromogen ( It was detected by ABC (avidin-biotin complex) method using a chromogen solution, and observed and photographed under a microscope. In addition, the slides were counterstained with hematoxylin-eosin (H & E) and observed and photographed under a microscope (FIG. 21C).
  • H & E hematoxylin-eosin
  • liver tissues of three types of NDRG3 overexpressing transgenic mice TG-2, TG-8 and TG-13 produced by the method described in Example 1 were prepared. After extraction, it fixed and sectioned as mentioned above. The sectioned liver tissue was then used to perform and visualize immunohistostaining as above.
  • PCNA and Ki-67 cell proliferation markers, hepatocellular carcinoma (HCC) markers glutamine synthetase (GS) and heat shock protien 70 (HSP) for the detection of anti-PCNA, anti Labeled with -HSP70, anti-Ki-67 and anti-GS antibodies.
  • HCC hepatocellular carcinoma
  • HSP heat shock protien 70
  • the sectioned tissues were immunofluorescent stained using anti-NDRG3 antibodies by the method described in Example ⁇ 4-1> and visualized using confocal microscopy (FIG. 21D).
  • liver tissue was extracted from the NDRG3 overexpressing transgenic mice and control mice and frozen with liquid nitrogen. Then, RT-PCR was performed by the method described in Example ⁇ 4-2>. In addition, the tissues were dissolved as in ⁇ Example 2> and Western blotting was performed using anti-NDRG3, anti-phosphorylated-ERK1 / 2 and anti-ERK1 / 2 antibodies (FIG. 21E).
  • FIGS. 21A to 21C tumors began to form after 9 months in NDRG3 overexpressing transgenic mice (FIG. 21A), and it was confirmed that tumors were found in various organs including the lung, intestine, and lower abdomen. (FIG. 21B). In addition, it was confirmed that lymphoma-expressing B-cells and T-cells were found not only in the liver of NDRG3 overexpressing mice but also in secondary lymphoid organs such as mesenteric lymph nodes and spleen (FIG. 21C).
  • tissue microarray analysis was performed using liver cancer tissue of human liver cancer patients.
  • tissue samples were obtained from patients with pathologically defined HCC at Inje University Paik Hospital. All tissue samples were fixed in 10% buffered formalin and treated with paraffin.
  • a core tissue biopsy (diameter 2 mm) is performed with the paraffin-treated HCC tissue sample (donor blocks) and a new one is obtained using a trephin instrument (Superbiochips Laboratories, Seoul, Korea). Aligned to the recipient paraffin block (tissue array block).
  • tissue array block included 104 HCCs and 20 non-new liver tissues. Immunohistochemical staining was performed by the method described in Example ⁇ 11-1> above using the 4-section of the tissue array block.
  • NDRG3 protein was hardly found in normal liver, whereas in liver of HCC patient, NDRG3 protein was strongly expressed in cytoplasm and plasma membrane, where expression of phosphorylated ERK1 / 2 protein was remarkable. It was confirmed that the increase. In particular, it was confirmed that ERK1 / 2 protein was phosphorylated in 19 (76%) HCC tissues out of 25 HCC tissues expressing NDRG3 protein (FIG. 22). Thus, the results confirm that abnormal expression of NDRG3 promotes tumor formation and activates the ERK1 / 2 pathway.
  • HHD-1 ⁇ protein accumulation is induced by inactivation of PHD2 at an early stage of hypoxia, and as a result, genes (LDHA, PDK1, etc.) related to metabolic adaptation of cells due to hypoxia are elevated. The course is activated by activation. Thereafter, the expression of NDRG3 protein was increased by lactic acid produced / accumulated by increased glycolysis, along with the 294 th proline hydroxylation inhibition phenomenon, which is a hypoxia target site of NDRG3 by hypoxic PHD2 inactivation.
  • genes LDHA, PDK1, etc.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 NDRG3 단백질을 이용한 젖산의 정량 방법에 관한 것으로, 구체적으로 NDRG3 유전자를 포함하는 유전자 발현 카세트를 이용하여 허혈성 질환 및 염증성 질환 등의 관련 질병의 진단이 가능하고, 향후 상기 질병의 치료, 예방 또는 관련 신약 개발 및 연구 등에 유용하게 사용할 수 있다.

Description

NDRG3 단백질을 이용한 젖산의 정량 방법
본 발명은 NDRG3(N-myc downstream regulated gene 3) 단백질을 이용한 젖산의 정량 방법에 관한 것으로, 구체적으로 NDRG3 단백질 및 이의 돌연변이체의 발현양을 측정하여 세포 내 젖산의 함량을 정량하는 방법에 관한 것이다.
또한 본 발명은 NDRG3 유전자 및 형광 단백질을 코딩하는 유전자를 포함하는 젖산 정량용 유전자 발현 카세트에 관한 것이다.
또한 본 발명은 NDRG3 유전자 및 루시퍼레이즈(Luciferase) 유전자를 포함하는 젖산 정량용 유전자 발현 카세트에 관한 것이다.
또한 본 발명은 Gal4DB(Gal4 DNA binding domain), 및 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자를 포함하는 제1벡터; 및 Gal4 업스트림 활성화 염기서열(UAS), 및 루시퍼레이즈 유전자를 포함하는 제2벡터를 포함하는 젖산 정량용 유전자 발현 카세트에 관한 것이다.
또한 본 발명은 고형암, 허혈성 질환 또는 염증성 질환의 진단을 위한 정보제공방법에 관한 것이다.
세포 내 대사산물의 함량 측정은 생물학 연구와 의약학 산업 등에서 널리 사용되는데 이는 생체 상태 평가 및 질병 관리의 제어와 개선 등을 위해서는 대사산물 분석을 통한 신진대사 활성의 평가가 필수적이기 때문이다. 젖산은 저산소성 에너지 생산과정에서 근육세포, 적혈구, 뇌 및 다른 조직에서 생성되며, 평상시에는 혈중에 낮은 농도로 존재한다. 유산소성 에너지 생산과정 중에는 미토콘드리아에서 포도당과 산소를 이용하여 ATP(adenosine triphosphate)를 생산하나, 산소 농도가 감소하거나 미토콘드리아가 제대로 기능을 하지 못하게 되면, 생체는 저산소성 에너지 생산과정으로 전환되어 포도당을 미토콘드리아 기능 없이 대사하여 ATP를 생산하는데 이 과정에서 주로 발생되는 산물이 젖산이며, 이는 간이 분해할 수 있는 속도보다 더 빠르게 축적된다. 젖산은 신진대사 과정에서 가장 일반적으로 관찰되는 대사산물들 중 하나로서 혈중을 비롯한 생체 시료 중의 젖산은 허혈성 질환을 비롯한 다양한 생체 상태 및 질병 검출을 위한 마커가 되고, 이의 다양한 정량법의 개발은 의료 및 산업적 견지에서 강하게 요구되고 있다.
저산소유도인자(Hypoxia-inducible factor-1; HIF-1)는 저산소 상태에서 다량 유도 발현되는 핵 전사인자로서 세포 내에서의 산소 항상성을 유지하기 위해서, 적혈구 생성(erythropoiesis),신혈관생성(angiogenesis) 및 해당과정(glycolysis)에 관련된 유전자를 발현시키는 기능을 한다. HIF-1은 α와 β두 가지의 군으로 나뉘어지며 HIF-1α는 전사인자로서 정상산소 분압에서는 분해되지만 저산소 상태에서는 단백질 자체가 안정화되는 것으로 알려져 있다. 안정화된 HIF-1α는 HIF-1β인 ARNT와 결합하여 핵으로 이동하여 혈관생성과 대사에 관여하는 유전자들을 발현시킨다(Semenza et al., 1999; Wang et al., 1995; Wang and Semenza 1995). HIF-1의 활성은 암 발생과 전이, 류마티스성 관절염, 허혈성 뇌졸중, 동맥경화증 등 다양한 만성 대사성 질환의 병리학적 기전과 밀접한 관계가 있기 때문에 최근 주요 신약 표적으로 부상하고 있다. 그러나, HIF의 촉진만으로 저산소 반응 진행을 완전히 파악할 수 없고, 이를 통해 HIF-비의존적으로 유도되는 조절 경로가 존재한다고 보고되고 있다. 따라서, 저산소반응에 기한 세포 내 젖산의 정량을 위해 HIF 뿐만 아니라 HIF 비의존적-조절 경로에 관여하는 인자의 촉진 물질을 결합하여 분석하는 전략이 필요하다.
NDRG(N-myc downstream regulated gene)군 유전자는 N-Myc 돌연변이 쥐에서 발현이 증가하는 유전자로써 Ndr1이라는 이름으로 처음 밝혀지기 시작했다. 이의 인간 올소로그(human ortholog) NDRG1이 인간 세포주에서 동정되면서부터 Drg1, Cap43, RTP/rit42등과 같은 이름으로 불려지기 시작했다. NDRG군 유전자에는 서로 다른 4종류의 구성 유전자들이 보고되어 있으며, 이들 4종류의 NDRG1, NDRG2, NDRG3 및 NDRG4는 높은 유사성 (homology)을 가지지만 개체의 발달과 성장에 따라 발현 형태가 상당히 다른 것으로 보고되어 있다(Qu et al., Mol Cell Biochem, 2002(229), 35-44, Deng et al., Int J Cancer, 2003(106), 342-7). 따라서, 이러한 발현차이로 보면 이들 유전자들이 서로 다른 기능을 할 것으로 예상되고 있으나, 아직 이들의 명확한 기능에 관한 보고는 없었다.
기존의 젖산 정량 방법으로는 TLC(Thin layer chromatography)를 이용한 젖산 분석, HPLC(high performance liquid chromatography) 이용한 젖산 분석, Lactate dehydrogenase를 이용한 젖산 분석 등이 있으나 정확도가 높은 세포 내 젖산의 정량 방법에 대해서 여전히 연구가 필요한 실정이었다.
저산소 조건에서 생성되는 젖산을 정량하기 위한 방법을 찾기 위해 노력한 결과, 저산소 반응에서 생성된 젖산이 NDRG3 단백질과 결합하여 축적됨을 확인함으로써, 상기 NDRG3 단백질을 젖산 정량에 이용될 수 있음을 밝혀 본 발명을 완성하였다.
본 발명의 목적은 NDRG3(N-myc downstream regulated gene 3) 단백질의 발현양을 측정하는 단계를 포함하는 세포 내 젖산의 정량 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 NDRG3 유전자 및 형광 단백질을 코딩하는 유전자를 포함하는 젖산 정량용 유전자 발현 카세트를 제공하는 것이다.
본 발명의 또 다른 목적은 NDRG3 유전자 및 루시퍼레이즈(Luciferase) 유전자를 포함하는 젖산 정량용 유전자 발현 카세트를 제공하는 것이다.
본 발명의 또 다른 목적은 Gal4DB(Gal4 DNA binding domain), 및 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자를 포함하는 제1벡터; 및 Gal4 업스트림 활성화 염기서열(UAS), 및 루시퍼레이즈 유전자를 포함하는 제2벡터를 포함하는 젖산 정량용 유전자 발현 카세트를 제공하는 것이다.
본 발명의 또 다른 목적은 허혈성 질환 또는 염증성 질환이 의심되는 개체로부터 분리되는 생물학적 시료에서 NDRG3 단백질의 발현 수준을 측정하는 단계(제1단계); 및 상기 측정된 단백질 발현 수준을 정상 대조군 시료의 단백질 발현 수준과 비교하는 단계(제2단계)를 포함하는, 고형암, 허혈성 질환 또는 염증성 질환의 진단을 위한 정보제공방법을 제공하는 것이다.
본 발명은, 저산소 조건에서 생성되는 젖산을 정량하기 위한 방법으로, NDRG3(N-myc downstream-regulated gene 3) 단백질 발현양의 측정을 통한 젖산 정량 방법을 제공하여 NDRG3 단백질에 기한 세포증식 및 혈관신생 등의 작용을 예측 및 분석이 가능하도록 함으로써 향후 암 및 허혈성 질환 등 관련 질병의 진단, 관리, 치료, 예방 또는 관련 신약 개발 및 연구 등에 유용하게 사용할 수 있다.
도 1a는 NDRG3(N-myc downstream regulated gene 3) 과발현 형질전환 마우스의 제조하기 위하여 인간 NDRG3을 암호화하는 pCAGGS 플라스미드를 나타낸 도이다.
도 1b는 NDRG3 과발현 형질전환 마우스의 생산 과정에서, TG-2, TG-8 및 TG-13 마우스의 게놈 DNA에 인간 NDRG3 유전자가 삽입되어 있음을 확인한 도이다.
도 1c는 확립된 NDRG3 과발현 형질전환 마우스 TG-2, TG-8 및 TG-13의 간 조직에서 인간 NDRG3 유전자의 발현을 확인한 도이다.
도 2는 제작한 레빗(rabbit) 항-NDRG3 항체와 인간 NDRG3 변이체(N66D)와의 항원-항체 반응을 확인한 도이다.
도 3a는 PHD2(prolyl hydroxylase domain 2)와 결합하는 후보 단백질을 선별하는 과정을 모식화한 도이다.
도 3b는 PHD2와 결합하는 단백질을 나타낸 도이다.
도 3c는 PHD2 및 NDRG3 단백질의 결합을 나타낸 도이다.
도 4a는 저산소 상태(hypoxia, 1 % O2) 하에서(도 4a, 위) 및 시험관 내에서(in-vitro)(도 4a, 아래) PHD2 및 NDRG3의 결합을 나타낸 도이다.
도 4b는 정상 산소 상태(normoxia, 21 % O2) 하에 있는 MCF-7 세포에서 PHD2 억제에 의한 NDRG3 단백질 유도를 확인한 도이다.
도 4c는 정상 산소 상태 하에 있는 HeLa 세포에서 PHD2 억제에 의한 NDRG3 단백질 유도를 확인한 도이다.
도 5a는 정상 산소 상태에서 PHD 패밀리 군 및 VHL 결실에 의한 NDRG3 단백질 발현 증가를 확인한 도이다.
도 5b는 PHD 패밀리 군 및 NDRG3 단백질의 결합을 확인한 도이다.
도 6a는 단백질-단백질 도킹(docking) 시뮬레이션을 통해 NDRG3의 PHD2 도킹 부위(docking site)를 확인한 도이다.
도 6b는 도킹 시뮬레이션으로 확인한 NDRG3의 PHD2 도킹 부위와 PHD2의 결합력을 확인한 도이다.
도 7a는 정상 산소 상태에서 프로테아좀(proteasome) 억제제인 MG132 처리 후 NDRG3 단백질의 발현증가를 확인한 도이다.
도 7b는 정상 산소 상태에서 NDRG3 단백질의 유비퀴틴화를 확인한 도이다.
도 8a는 산소 농도에 따른 NDRG3 단백질의 축적을 확인한 도이다.
도 8b는 세포 내에서 지속적인 저산소 상태에 따른 NDRG3 단백질의 축적을 확인한 도이다.
도 8c는 여러 종류의 암 세포에서 지속적인 저산소 상태에 따른 NDRG3 단백질의 축적을 확인한 도이다.
도 8d는 저산소 상태에서 NDRG3 단백질의 유비퀴틴화 억제를 확인한 도이다.
도 9a는 정상 산소 상태 및 지속적인 저산소 상태에 따른 NDRG3 단백질 발현 변화를 확인한 도이다.
도 9b는 저산소 상태에서 정상 산소 상태로 회복될 때 NDRG3 단백질의 발현 변화를 확인한 도이다.
도 10a는 NDRG3 단백질의 하이드록실화(hydroxylation) 표적 부위를 확인한 도이다.
도 10b는 NDRG3 단백질의 하이드록실화(hydroxylation) 표적 부위 변이 및 PHD2/VHL의 결합을 확인한 도이다.
도 11a는 산소 상태 변화에 따른 NDRG3의 RNA 발현 변화를 확인한 도이다.
도 11b는 HIF 단백질 억제에 따른 NDRG3 단백질의 발현 변화를 확인한 도이다.
도 11c는 저산소 상태 하에 있는 MCF-7(HIF-1+/+ 및 VHL+/+) 및 786-O(HIF-1-/- 및VHL-/-) 세포에서 NDRG3 단백질의 발현 변화를 확인한 도이다.
도 12a는 저산소 반응과 관련된 NDRG3 및 HIF-1의 기능을 분석한 도이다.
도 12b는 정상산소 상태에서 NDRG3 변이(N66D) 단백질을 과발현 하는 세포 및 저산소 상태하에 있는 세포에서 상향 조절되는 각 유전자들의 기능을 분석한 도이다.
도 13a는 저산소 상태에서 NDRG3 결실에 의한 혈관생성 활성의 변화를 확인한 도이다.
도 13b는 저산소 상태에서 NDRG3 결실에 의한 신생혈관생성 마커 IL8, IL1α, IL1β COX-2 및 PAI-1의 발현 변화를 확인한 도이다.
도 13c는 NDRG3 결실에 의한 생체 내(in-vivo) 혈관생성 변화를 확인한 도이다.
도 14a는 저산소 상태에서 NDRG3 결실에 의한 세포 성장 변화를 확인한 도이다.
도 14b는 NDRG3 및/또는 HIF 결실에 의한 종양 형성 변화를 확인한 도이다.
도 14c는 이소성(ectopic) 변이체 NDRG3(N66D) 발현에 의한 종양 형성 변화를 확인한 도이다.
도 14d는 NDRG3 및/또는 HIF 결실된 종양 세포를 이식한 마우스에서 종양의 부피 변화를 확인한 도이다.
도 14e는 이소성 변이체 NDRG3(N66D) 발현된 종양 세포를 이식한 마우스에서 종양의 부피 변화를 확인한 도이다.
도 14f는 종양 조직에서 NDRG3 또는 HIF 결실에 의한 세포증식 마커 Ki-67 및 신생혈관생성 마커 IL8, CD31 단백질들의 발현 변화를 확인한 도이다.
도 14g는 종양 조직에서 NDRG3 또는 HIF 결실에 의한 신생혈관생성 마커의 발현 변화를 확인한 도이다.
도 15a는 산소 상태에 따른 NDRG3과 HIF-1α의 단백질 발현 및 젖산(Lactate)의 생성 변화를 확인한 도이다.
도 15b는 LDHA(lactate dehydrogenase A) 억제제인 소듐 옥사메이트(sodium oxamate) 처리 후 지속적인 저산소 상태에 따른 NDRG3과 HIF-1α의 단백질 발현 및 젖산(Lactate)의 생성 변화를 확인한 도이다.
도 15c는 저산소 상태에서 젖산 생성 억제에 따른 NDRG3 단백질의 발현 변화를 확인한 도이다.
도 15d는 저산소 상태에서 2-데옥시글루코오스(2-deoxyglucose, 2-DG)에 의한 해당과정(glycolysis) 억제에 따른 NDRG3 단백질의 발현 변화를 확인한 도이다.
도 15e는 피루베이트(Pyruvate) 또는 LDHA에 의한 과다한 젖산 생성에 따른 NDRG3 단백질의 발현 변화를 확인한 도이다.
도 15f는 젖산 생성에 의한 NDRG3 단백질의 유비퀴틴화 변화를 확인한 도이다.
도 16a는 NDRG3 단백질의 젖산 결합 부위를 돌연변이한 재조합 NDRG3(G138W) 변이체 및 재조합 NDRG3 야생형 단백질을 확인한 도이다.
도 16b는 재조합 NDRG3 야생형 및 재조합 NDRG3(G138W) 변이체 단백질와 젖산의 결합을 확인한 도이다.
도 16c는 저산소 상태에서 NDRG3의 L-젖산 결합부위를 돌연변이한 변이체의 발현 변화를 확인한 도이다.
도 16d는 재산소화(reoxygenation)에 의한 NDRG3 단백질 발현을 확인한 도이다.
도 17a는 저산소 상태(3% O2)에서 젖산 생성 억제 및 이소성 변이체 NDRG3(N66D) 발현에 의한 세포 성장 변화를 확인한 도이다.
도 17b는 젖산 생성 억제 및/또는 이소성 변이체 NDRG3(N66D) 발현에 의한 세포 콜로니(colony) 형성 변화를 확인한 도이다.
도 17c는 저산소 상태(3% O2)에서 LDHA 결실 및/또는 이소성 변이체 NDRG3(N66D) 발현에 의한 세포성장 변화를 확인한 도이다.
도 17d는 LDHA 결실 및/또는 이소성 변이체 NDRG3(N66D)가 발현된 종양 세포를 이식한 마우스에서 종양 형성 변화를 확인한 도이다.
도 17e는 지속적인 저산소 상태에서 젖산 생성 억제 및/또는 이소성 변이체 NDRG3(N66D) 발현에 의한 NDRG3 단백질 발현 변화를 확인한 도이다.
도 17f는 지속적인 저산소 상태에서 이소성 변이체 NDRG3(N66D) 발현에 의한 젖산 생성 변화를 확인한 도이다.
도 18은 지속적인 저산소 상태에서 젖산 생성 억제 및/또는 이소성 변이체 NDRG3(N66D) 발현에 의한 혈관생성 변화를 확인한 도이다.
도 19a는 저산소 상태에서 NDRG3 결실에 의한 단백질의 인산화(phosphorylation) 변화를 확인한 도이다.
도 19b는 NDRG3 단백질 발현에 따른 ERK1/2 단백질의 활성 변화를 확인한 도이다.
도 19c는 지속적인 저산소 상태에서 NDRG3 결실에 의한 Raf-ERK1/2 활성 변화를 확인한 도이다.
도 19d는 시험관 내에서(in-vitro, 왼쪽) 및 세포 내에서(오른쪽) NDRG3 및 c-Raf 단백질들의 결합을 확인한 도이다.
도 19e는 NDRG3 단백질 결실 또는 이소성 변이체 NDRG3(N66D) 발현에 의한 Raf-ERK1/2 활성 변화를 확인한 도이다.
도 19f는 이소성 변이체 NDRG3(N66D) 및/또는 PKC-I에 의한 PKC-β 활성 억제에 따른 c-Raf의 인산화 변화를 확인한 도이다.
도 19g는 저산소 상태에서 젖산 생성 억제에 따른 NDRG3 단백질 발현 및 Raf-ERK1/2 활성 변화를 확인한 도이다.
도 20a는 NDRG3 및 RACK-1 단백질들 간의 결합을 확인한 도이다.
도 20b는 NDRG3 결실 또는 이소성 변이체 NDRG3(N66D), RACK-1 및/또는 Raf 발현에 따른 Raf-ERK1/2 활성 변화를 확인한 도이다.
도 20c는 저산소 상태에서 RACK1 결실에 의한 이소성 변이체 NDRG3(N66D) 및 PKC-β간의 결합을 확인한 도이다.
도 20d는 저산소 상태에서 PKC-β활성 억제에 의한 ERK1/2 활성 변화를 확인한 도이다.
도 20e는 재조합 이소성 변이체 NDRG3(N66D)와 c-Raf, RACK1 및 PKC-β 복합체 형성을 확인한 도이다.
도 20f는 시뮬레이션을 통한 NDRG3, c-Raf, RACK1 및 PKC-β복합체 형성을 확인한 도이다.
도 21a는 NDRG3 과발현 형질전환 마우스 및 대조군 마우스의 종양 형성 여부를 확인한 도이다.
도 21b는 NDRG3 과발현 형질전환 마우스 및 대조군 마우스의 폐, 장 및 하복부(hypogastrium)에서 종양 형성을 확인한 도이다.
도 21c는 NDRG3 과발현 형질전환 마우스 및 대조군 마우스의 장간막 림프절(Mesenteric lymph node), 비장 및 간 조직에서 B 세포 및 T 세포를 확인한 도이다.
도 21d는 NDRG3 과발현 형질전환 마우스 및 대조군 마우스의 간 조직에서 간세포암종 마커(hepatocellular carcinoma, HCC)인 글루타민합성효소(glutamine synthetase, GS) 및 열충격단백질 70(heat shock protein 20, HSP), 및 세포증식 마커인 PCNA 및 Ki-67의 발현을 확인한 도이다.
도 21e는 NDRG3 과발현 형질전환 마우스 및 대조군 마우스의 간조직에서 ERK1/2의 활성 및 신생혈관생성 마커의 mRNA 발현을 확인한 도이다.
도 22는 간암 환자에서 NDRG3의 발현 및 ERK1/2 활성을 확인한 도이다.
도 23은 지속적인 저산소 반응에 있어서 젖산에 의해 유도된 Raf-ERK 경로의 매개자로서 NDRG3의 기전을 도식화한 도이다.
도 24는 저산소 환경에서 LDHA 발현 감소시 외인성으로 처리된 젖산에 의한 NDRG3 단백질의 발현을 확인한 도이다.
도 25는 저산소 환경에서 옥사메이트 처리후 외인성으로 처리된 젖산에 의한 NDRG3 단백질의 발현을 확인한 도이다.
도 26은 정상 및 저산소 환경에서 MCT(monocarboxylate transporter) 1을 억제하여 외인성으로 처리된 젖산의 세포내 유입을 차단할 경우 NDRG3 단백질의 발현을 확인한 도이다.
도 27은 정상산소 환경에서 옥사메이트(Oxamate) 처리 및 포도당 결핍을 유도한 후 외인성으로 처리된 젖산에 의한 NDRG3 단백질의 발현 과 MCT 1 의존성을 확인한 도이다.
도 28은 본 발명의 젖산 정량용 유전자 발현 카세트에서 발현된 NDRG3/형광 단백질의 결합 단백질을 나타낸 도이다.
도 29는 본 발명의 젖산 정량용 유전자 발현 카세트에서 발현된 NDRG3/루시퍼라제의 결합 단백질을 나타낸 도이다.
도 30은 본 발명의 루시퍼레이즈 발현을 위한 GAL4/UAS 시스템을 나타낸 도이다.
본 발명은 상기의 목적을 달성하기 위한 하나의 양태로서, 세포 내에서 NDRG3(N-myc downstream-regulated gene 3) 단백질의 발현양을 측정하는 단계를 포함하는 세포 내 젖산의 정량 방법을 제공한다.
상기 세포는 조직, 혈액, 혈장, 혈청, 타액, 정액 및 소변으로 구성된 군으로부터 선택된 어느 하나에서 채취할 수 있으나, 이에 한정되지 않는다.
상기 NDRG3 단백질은 서열번호 2로 기재되는 아미노산 서열로 이루어지는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 NDRG3 단백질은 젖산이 결합되지 않은 경우 분해되고, 젖산이 결합된 경우 축적될 수 있다.
상기 젖산은 NDRG3 단백질의 아미노산 서열 중 62번째 아스파르트산, 138번째 글라이신, 139번째 알라닌 또는 229번째 타이로신에 결합할 수 있으나, 이에 한정되지 않는다.
상기 젖산의 정량 방법은 정상적인 NDRG3 단백질의 발현 수준과 젖산 결합 부위가 돌연변이된 NDRG3 단백질의 발현 수준을 비교하는 방법일 수 있다.
상기 NDRG3 단백질은 젖산이 결합되지 않은 경우 분해되고, 젖산이 결합된 경우 축적될 수 있다.
상기 발현양은 시험관 내 결합 분석법(in-vitro binding assay), 효소면역분석법(ELISA), 면역조직화학염색, 웨스턴 블럿팅(Western Blotting), 단백질 칩(chip) 및 실시간 형광이미징 방법((Realtime Fluorescence Imaging Method)으로 구성된 군으로부터 선택된 어느 하나로 측정할 수 있으나, 이에 한정되지 않는다.
본 발명의 구체적인 실시예에서, 본 발명자들은 저산소증과 관련된 HIF(Hypoxia-inducible factor)-비의존적 인자를 찾기 위하여 HIF의 활성에 관여하는 PHD2(prolyl hydroxylase domain 2) 단백질과 결합하는 후보 단백질 중 NDRG3(염기서열 83-1210, 서열번호 1)을 선별하였고, 저산소증에 있어서 NDRG3 단백질의 분자생화학적 기능을 확인하기 위하여 NDRG3 과발현 형질전환 C57/BL6 마우스 TG-2, TG-8 및 TG-13을 제작하였으며(도 1a 내지 도 1c, 및 도 3a 내지 도 3c 참조), 재조합 인간 NDRG3 단백질(아미노산 32-315, 서열번호 2)를 항원으로 레빗(rabbit)에서 항-NDRG3 다클론 항혈청을 획득하고 NDRG3 펩타이드(아미노산 244-255, 서열번호 3)를 이용하여 친화 크로마토그래피를 통해 정제하여 레빗 항-인간 NDRG3 다클론 항체를 제조하였다(도 2 참조).
또한, 본 발명의 구체적인 실시예에서, 본 발명자들은 산소 상태에 따른 PHD2 및 NDRG3 단백질의 관계를 확인하기 위하여 면역침전법(immunoprecipitation), 웨스턴 블럿팅(western blotting), 시험관내(in-vitro) 풀-다운 분석법(pull-down assay) 및 RT-PCR을 수행한 결과, NDRG3 단백질은 4 종류의 PHD 패밀리 군 중 PHD2 단백질과 결합하고, PHD2 및 E3 유비퀴틴(ubiquitin) 연결효소(ligase) 복합체의 표적 단백질인 VHL 억제에 의해 NDRG3 단백질의 축적이 증가하는 것을 확인함으로써, NDRG3 단백질이 PHD2의 고유한 기질이며 NDRG3 단백질이 PHD2/VHL-매개 전사후 과정의 기질임을 확인하였다(도4a 내지 도 4c, 및 도 5a 및 도 5b 참조). 또한, 단백질-단백질 도킹 시뮬레이션을 수행한 결과 NDRG3의 PHD2 도킹 부위(docking site)를 확인하고, 상기 PHD2 도킹 부위 중 NDRG3의 47번째 또는 66번째 아미노산 위치가 더욱 중요한 부위임을 확인하였으며(도 6a 및 도 6b), 생체 내 유비퀴틴화 분석법(In-vivo ubiquitination assay)를 수행한 결과 정상 산소 상태에서 PHD2가 상기 NDRG3 도킹 부위에 결합함으로써 PHD2/VHL-매개 프로테아좀(proteasome) 경로를 통해 NDRG3이 유비퀴틴화되어 제거됨을 확인하였다(도 7a 및 도 7b 참조).
또한, 본 발명의 구체적인 실시예에서, 본 발명자들은 NDRG3 단백질의 산소-의존성을 확인하기 위하여, 면역침전법, 웨스턴 블럿팅, 면역형광염색법 및 생체내 유비퀴틴화 분석법을 수행한 결과 유방, 간, 자궁경부, 신장 및 대장 등 여러 암세포에서 저산소 상태가 지속될수록 NDRG3 단백질의 유비퀴틴화는 감소하고 NDRG3 단백질의 발현 및 축적이 증가하고 반대로, 정상 산소 상태로 산소 상태가 회복되면 NDRG3 단백질의 발현이 천천히 감소하며(도 8a 내지 도 8d, 및 도 9a 및 도 9b 참조), 특히, 질량 분석법을 수행한 결과 산소-의존적으로 NDRG3의 294번째 프롤린(proline)이 하이드록실화(hydroxylation) 되고 이 프롤린 아미노산이 알라닌(Alanine)으로 치환된 돌연변이체는 발현이 증가되므로 NDRG3의 294번째 프롤린 하이드록실화가 저산소증 표적 부위임을 확인하였다(도 10a 및 도 10b).
또한, 본 발명의 구체적인 실시예에서, 본 발명자들은 저산소 반응에 있어서 NDRG3 단백질의 생화학적 기능을 확인하기 위하여 유전자 발현 프로파일링(profiling)을 수행한 결과, HIF와 달리 NDRG3 단백질은 세포증식(proliferation), 신생혈관생성(angiogenensis), 세포성장(cell growth)과 가장 관련성이 높음을 확인하였고(도 12a 및 도 12b), 생체내 혈관생성분석법(in-vivo angiogenesis assay) 및 생체내(in-vivo) 이식한 종양 부피 측정 및 MTT 분석법을 수행한 결과 저산소 반응에서 NDRG3에 의해 신생혈관생성 및 세포증식 및 종양 성장이 촉진됨을 확인하였다(도 13a 및 도 13c, 및 도 14a 내지 도 14g).
또한, 본 발명의 구체적인 실시예에서, 본 발명자들은 저산소 상태에서 젖산 생성과 NDRG3 단백질의 발현 증가와의 관련성을 확인하기 위하여, MTT 분석법, 콜로니 형성 분석법(colony forming assay), 생체내 이식한 종양 부피 측정 및 튜브 형성 분석법을 수행한 결과 젖산 생성 억제에도 이소성 변이체 NDRG3(N66D)가 발현된 경우 세포증식 및 혈관생성이 촉진되는 것을 확인함으로써, NDRG3이 지속적인 저산소 상태에서 젖산에 의해 유도된 세포증식 및 혈관생성의 중요한 매개자로 작용함을 확인하였다(도 17a 내지 도 17f, 및 도 18 참조).
또한, 본 발명의 구체적인 실시예에서, 본 발명자들은 NDRG3에 의해 매개된 저산소 반응의 분자적 조절 기전을 확인하기 위하여 시험관내 키나아제 분석법(in-vitro kinase assay), 풀-다운 분석법, 면역침전법 및 웨스턴 블럿팅을 수행한 결과 저산소 상태에서 NDRG3 발현 억제로 c-Raf 및 ERK1/2의 인산화가 억제되는 것을 확인함으로써 저산소 반응으로 유도된 젖산에 의해 활성화된 c-Raf-ERK1/2 경로에서 NDRG3이 c-Raf-ERK1/2 신호의 중요한 매개자임을 확인하였다(도 19a 내지 도 19g 참조). 또한, 단백질 구조 모델링을 수행한 결과 NDRG3이 RACK1과 결합하여 PKC-β를 유도하고 c-Raf와 함께 NDRG3-RACK1-PKC-β-c-Raf 복합체를 형성하며, 유도된 PKC-β에 의해 c-Raf 단백질이 인산화되어 c-Raf/ERK 신호가 활성화됨을 확인함으로써, 젖산에 의해 조절된 NDRG3이 c-Raf의 활성을 조절하는 스캐폴드 단백질(scaffold protein)임을 확인하였다(도 20a 내지 도 20f 참조).
또한, 본 발명의 구체적인 실시예에서, 본 발명자들은 NDRG3에 의한 병리학적 변화를 확인하기 위하여 상기 제작한 NDRG3 과발현 형질전환 마우스를 이용하여 면역조직화학적 분석법(immunohistochemical anaylysis)를 수행하고, NDRG3와 활성화된 ERK1/2 단백질의 발현을 확인하기 위해 웨스턴 블럿팅, 유전자 발현변화를 확인하기 위하여 RT-PCR을 수행한 결과, NDRG3 과발현 형질전환 마우스의 폐, 장, 간 등 다양한 장기에서 종양이 발견되고 장간막 림프절 및 비장 등 2차 림프기관에서 림프종 발현 B-세포 및 T-세포가 발견되는 것을 확인하였으며, 세포증식 마커 및 신생혈관생성 마커의 발현이 증가하는 것을 확인하였다(도 21a 내지 도 21e 참조). 또한, 간암환자로부터 분리한 간암 조직 샘플에서도 NDRG3 단백질의 발현 및 ERK1/2 단백질의 활성이 촉진되는 것을 확인함으로써(도 22 참조), NDRG3의 비정상적인 발현이 c-Raf/ERK 경로를 활성화함으로써 종양 형성 및 신생혈관형성을 촉진함을 확인하였다.
아울러, 본 발명의 구체적인 실시예에서, 본 발명자들은 외인성 젖산 처리가 NDRG3 단백질 발현 및 저산소성 반응에 미치는 영향을 확인하기 위하여 LDHA가 결실된 Huh-1세포에 L-젖산을 처리한 뒤 웨스턴 블럿팅을 수행하였고, 외인성 젖산 처리와 옥사메이트(oxamate) 처리에 의한 영향과의 관계를 파악하기 위하여 Huh-1 세포에 소듐 옥사메이트(Sodium oxamate) 처리 후 L-젖산을 처리한 뒤 웨스턴 블럿팅을 수행한 결과, 외인성으로 처리된 젖산이 NDRG3를 용량의존적으로 회복시키고 HIF-1α 단백질의 수준에는 영향을 미치지 않음을 확인하였으며(도 24), 이는 옥사메이트 처리(도 25)로 젖산생성을 억제한 경우에도 유사한 결과가 나타남을 확인하였다. 또한, 젖산의 세포내 유입을 차단할 경우 외인성 젖산 처리가 효과를 나타내는지 확인하기 위하여 MCT(monocarboxylate transporter) 1을 억제한 Huh-1 세포에 젖산을 처리한 뒤 웨스턴 블럿팅을 수행하였고, 정상산소 환경에서 Huh-1세포에 옥사메이트 처리 또는 포도당 결핍을 유도하고 외인성으로 L-젖산을 처리한 뒤 MCT 1을 억제하여 웨스턴 블럿팅을 수행한 결과, MCT 1을 억제할 경우 외인성 젖산에 의한 NDRG3 발현 회복 효과가 없어짐을 확인하였다(도 26 및 도 27).
따라서, 본 발명의 NDRG3 단백질은 젖산과 반응하여 분해가 억제되는 기전을 분석하고, 저산소 반응에서 생성된 젖산이 NDRG3 단백질과 결합하여 축적됨을 확인함으로써, 상기 NDRG3 단백질이 젖산 정량에 이용될 수 있음을 밝혔다.
다른 양태로서, 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자 및 형광 단백질(fluorescent protein, FP)을 코딩하는 유전자를 포함하는 젖산 정량용 유전자 발현 카세트를 제공한다.
본 발명에서 용어, “발현 카세트”는 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자와 형광 단백질을 코딩하는 유전자 또는 루시퍼레이즈 유전자를 포함하고 있어, 젖산을 정량할 수 있는 단위 카세트를 의미한다. 상기 발현 카세트는 발현 구조체(construct) 또는 핵산 삽입체와 혼용할 수 있다.
상기 형광 단백질은 적색 형광 단백질(Red Fluorescent Protein, RFP), 증강된 적색 형광 단백질(Enhanced red Fluorescent Protein, ERFP), 청색 형광 단백질(Cyan Fluorescent Protein, CFP), 증강된 청색 형광 단백질(Enhanced cyan Fluorescent Protein, ECFP), 황색 형광 단백질(Yellow Fluorescent Protein, YFP), 증강된 황색 단백질(Enhanced Yellow Fluorescent Protein, EYFP), mTFP(monomeric teal Fluorescent Protein), 녹색 형광 단백질(Green Fluorescent Protein, GFP), 및 변형된 녹색 형광 단백질(modified green Fluorescent Protein, EGFP)로 구성된 군에서 선택된 어느 하나일 수 있다.
구체적으로, 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자와 형광 단백질을 코딩하는 유전자를 포함하는 본 발명의 유전자 발현 카세트는 젖산이 과다 생성하는 환경에서 NDRG3/형광 단백질의 결합단백질을 발현할 수 있다(도 28). 따라서, 본 발명의 유전자 발현 카세트는 젖산이 과다 생성하는 환경에서 발현된 형광 단백질을 측정하여 젖산 정량이 가능하다.
다른 양태로서, 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자 및 루시퍼레이즈(Luciferase) 유전자를 포함하는 젖산 정량용 발현 카세트를 제공한다.
본 발명에서 용어, “발현 카세트”는 상기에서 설명한 바와 동일하다.
상기 루시퍼레이즈(Luciferase)는 생물체가 빛을 내는 데에 관여하는 발광효소를 의미한다.
구체적으로, 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자와 루시퍼레이즈 유전자를 포함하는 본 발명의 유전자 발현 카세트는 젖산이 과다 생성하는 환경에서 NDRG3/루시퍼레이즈의 결합단백질을 발현할 수 있다(도 29). 따라서, 본 발명의 유전자 발현 카세트는 젖산이 과다 생성하는 환경에서 발현된 루시퍼레이즈 단백질을 측정하여 젖산 정량이 가능하다.
다른 양태로서, Gal4DB(Gal4 DNA binding domain), 및 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자를 포함하는 제1벡터; 및 Gal4 업스트림 활성화 염기서열(UAS), 및 루시퍼레이즈(Luciferase) 유전자를 포함하는 제2벡터를 포함하는 젖산 정량용 유전자 발현 카세트를 제공한다.
본 발명에서 용어, “발현 카세트”는 상기에서 설명한 바와 동일하다.
상기 Gal4는 사카로미세스속(Saccharomyces) 효모의 갈락토오스대사계 유전자 상류에 있는 Gal4 업스트림 활성화 염기서열(upstream activating sequence, UAS)에 결합하여 전사를 촉진하는 조절 단백질을 코딩하는 유전자를 의미한다.
상기 UAS에 특이적으로 결합하여 전사를 촉진하는 GAL4를 이용한 GAL4/UAS 시스템은 발현시키고자 하는 유전자를 발현이 요구되는 시기에 발현이 필요한 조직에서 발현시키는 것을 가능하게 해주는 시스템을 의미한다. 본 발명에서 상기 발현시키고자 하는 유전자는 루시퍼레이즈를 의미한다(도 30).
구체적으로, 본 발명의 유전자 발현 카세트는 젖산이 과다 생성하는 환경에서 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자와 Gal4DB(Gal4 DNA binding domain)을 포함하는 제1벡터가 NDRG3/GAL4의 결합단백질을 발현할 수 있다. 상기 결합단백질의 GAL4 단백질 영역은 제2벡터의 UAS 유전자에 결합하고, UAS 유전자 인근에 존재하는 루시퍼레이즈 유전자의 전사 촉진에 의해 제2벡터가 루시퍼레이즈 단백질을 발현할 수 있다. 따라서 본 발명의 유전자 발현 카세트는 젖산이 과다 생성하는 환경에서 발현된 루시퍼레이즈 단백질을 측정하여 젖산 정량이 가능하다.
본 발명의 구체적인 실시예에서, 본 발명자들은 NDRG3 단백질의 산소-의존성을 확인하기 위하여, 면역침전법, 웨스턴 블럿팅, 면역형광염색법 및 생체내 유비퀴틴화 분석법을 수행한 결과, HIF는 저산소 상태 초기 단계에 발현이 증가한 후 점점 감소하지만, 저산소 상태가 지속될수록 NDRG3 단백질의 발현 및 축적이 증가하는 것을 확인함으로써, NDRG3은 HIF-비의존적으로 지속적인 저산소 반응에서 중요한 기능을 함을 확인하였다(도 11a 내지 도 11c 참조).
또한, 본 발명의 구체적인 실시예에서, 본 발명자들은 저산소 상태에서 젖산 생성과 NDRG3 단백질의 발현 증가와의 관련성을 확인하기 위하여, 저산소 상태에서 젖산 생성 측정, 웨스턴 블럿팅, 면역침전법, 시험관내 유비퀴틴 분석법을 수행한 결과, 저산소 반응으로 젖산이 생성되고, 생성된 젖산이 NDRG3의 62번째, 138번째, 139번째 또는 229번째 아미노산을 포함한 젖산 결합 부위에 결합함으로써 NDRG3 단백질의 유비퀴틴화가 억제되며 HIF-비의존적으로 발현이 증가함을 확인하였다(도 15a 내지 도 15f, 및 도 16a 내지 도 16d 참조).
아울러, 본 발명의 구체적인 실시예에서, 본 발명자들은 외인성 젖산 처리가 NDRG3 단백질 발현 및 저산소성 반응에 미치는 영향을 확인하기 위하여 LDHA가 결실된 Huh-1세포에 L-젖산을 처리한 뒤 웨스턴 블럿팅을 수행하였고, 외인성 젖산 처리와 옥사메이트(oxamate) 처리에 의한 영향과의 관계를 파악하기 위하여 Huh-1 세포에 소듐 옥사메이트(Sodium oxamate) 처리 후 L-젖산을 처리한 뒤 웨스턴 블럿팅을 수행한 결과, 외인성으로 처리된 젖산이 NDRG3를 용량의존적으로 회복시키고 HIF-1α 단백질의 수준에는 영향을 미치지 않음을 확인하였다(도 24).
따라서, 젖산이 과발현된 저산소 상태에서는 상기 유전자 발현 카세트를 통해 NDRG3 단백질이 과발현되고, 상기 발현된 NDRG3 단백질이 젖산과 결합하여 세포 내에 축적되므로, NDRG3의 신호를 확인하여 젖산의 정량이 가능함을 알 수 있었다.
다른 양태로서, 고형암, 허혈성 질환 또는 염증성 질환이 의심되는 개체로부터 분리되는 생물학적 시료에서 NDRG3 단백질의 발현 수준을 측정하는 단계(제1단계); 및 상기 측정된 단백질 발현 수준을 정상 대조군 시료의 단백질 발현 수준과 비교하는 단계(제2단계)를 포함하는, 허혈성 질환 또는 염증성 질환의 진단을 위한 정보제공방법을 제공한다.
본 발명에서 용어, “진단”은 병리 상태의 존재 또는 특징을 확인하는 것을 의미하는 것으로, 본 발명의 목적상 상기 진단은 고형암, 염증성 질환 또는 허혈성 질환의 발병 여부를 확인하는 것이다.
본 발명에서, 상기 고형암은 암이 장기에 암 종양이 발생한 암으로서, 암이 발생한 부위에 따라 비고형암과 구분된다. 상기 고형암은 저산소 반응으로 생성된 젖산과 NDRG3에 의한 젖산-NDRG3-Raf-ERK 신호 경로를 통해 발병할 수 있으나, 이에 제한되는 것은 아니다.
상기 고형암은 자궁경부암, 신장암, 위암, 간암, 전립선암, 유방암, 뇌종양, 폐암, 자궁암, 결장암, 방광암, 혈액암 및 췌장암을 포함하는 군에서 선택되는 어느 하나일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 염증성 질환은 염증을 주병변으로 하는 질환을 총칭하는 것으로서, 저산소 반응으로 생성된 젖산과 NDRG3에 의한 젖산-NDRG3-Raf-ERK 신호 경로를 통해 염증반응을 매개하는 사이토카인 발현의 촉진에 의해 발병할 수 있으나, 이에 제한되는 것은 아니다.
상기 염증성 질환은 천식, 알레르기성 및 비-알레르기성 비염, 만성 및 급성 비염, 만성 및 급성 위염 또는 장염, 궤양성 위염, 급성 및 만성 신장염, 급성 및 만성 간염, 만성 폐쇄성 폐질환, 폐섬유증, 과민성 대장 증후군, 염증성 통증, 편두통, 두통, 허리 통증, 섬유 근육통, 근막 질환, 바이러스 감염, 박테리아 감염, 곰팡이 감염, 화상, 외과적 또는 치과적 수술에 의한 상처, 프로스타글라딘 E 과다 증후군, 아테롬성 동맥 경화증, 통풍, 퇴행성 관절염, 류머티스성 관절염, 강직성 척추염, 호지킨병, 췌장염, 결막염, 홍채염, 복막염, 포도막염, 피부염, 습진 및 다발성 경화증을 포함하는 군에서 선택된 어느 하나인 것일 수 있으나, 이에 제한되는 것은 아니다. 본 발명에서, 상기 허혈성 질환은 심장 및 기타 조직에서 혈액공급의 차단으로 산소와 혈액 내에 포함되어 있는 여러 가지 영양분이 공급되지 못해 발생하는 질환으로서, 저산소 반응에 의해 젖산이 과발현되는 현상을 나타낼 수 있다. 상기 허혈성 질환은 뇌허혈, 심장허혈, 당뇨병성 혈관심장 질환, 심부전, 심근비대증, 망막허혈, 허혈성 대장염, 허혈성 급성 신부전증, 뇌졸중, 뇌외상 및 신생아 저산소증을 포함하는 군에서 선택된 어느 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
제1단계는 고형암, 허혈성 질환 또는 염증성 질환이 의심되는 개체로부터 분리되는 생물학적 시료에서 NDRG3 단백질의 발현 수준을 측정하는 단계를 의미한다.
한편, 상기 NDRG3 단백질의 발현 수준을 측정하는 단계는 NDRG3 단백질 또는 상기 단백질의 단편에 특이적으로 결합하는 항체 또는 앱타머를 상기 시료와 접촉시키는 단계를 포함할 수 있다.
상기 "항체"는 단백질 또는 펩티드 분자의 항원성 부위에 특이적으로 결합할 수 있는 단백질성 분자를 의미하는데, 이러한 항체는, 각 유전자를 통상적인 방법에 따라 발현벡터에 클로닝하여 상기 마커 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 단백질로부터 통상적인 방법에 의해 제조될 수 있다. 상기 항체의 형태는 특별히 제한되지 않으며 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이면 그것의 일부도 본 발명의 항체에 포함되고 모든 면역 글로불린 항체가 포함될 수 있을 뿐만 아니라, 인간화 항체 등의 특수 항체를 포함할 수도 있다. 아울러, 상기 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며 Fab, F(ab'), F(ab') 2 및 Fv 등이 될 수 있다.
상기 "앱타머"는 단일 가닥 올리고 뉴클레오티드를 의미하는 것으로, 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자를 말한다. 상기 앱타머는 그 염기 서열에 따라 다양한 3차원 구조를 가질 수 있으며, 항원-항체 반응과 같이 특정 물질에 대하여 높은 친화력을 가질 수 있다. 앱타머는 소정의 표적 분자에 결합함으로써 소정의 표적 분자의 활성을 저해할 수 있다.
본 발명의 앱타머는 RNA, DNA, 변형된(modified) 핵산 또는 이들의 혼합물일 수 있으며, 그 형태가 직쇄상 또는 환상일 수 있으나 이들에 한정되지 아니한다. 본 발명의 앱타머는 NDRG3에 대하여 사용될 수 있다. 상기 NDRG3에 결합 활성을 갖는 앱타머는 각각의 염기 서열을 참조하여 당해 기술 분야에서 통상의 지식을 가진 자가 공지의 방법에 따라 쉽게 제작할 수 있다.
본 발명에서 용어, "개체"는 고형암, 허혈성 질환 또는 염증성 질환이 발병되었거나 발병할 가능성이 있는 인간을 포함한 모든 동물을 의미할 수 있다. 상기 동물은 인간뿐만 아니라 이와 유사한 증상의 치료를 필요로 하는 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물일 수 있으나, 이에 제한되는 것은 않는다.
제2단계는 제1단계에서 측정된 NDRG3 단백질 발현 수준을 정상 대조군 시료의 단백질 발현 수준과 비교하는 단계를 의미한다.
본 발명에서 용어, “정상 대조군”은 고형암, 허혈성 질환 또는 염증성 질환이 발병되지 않거나, 발병이 의심되지 않는 개체를 의미한다.
본 발명에서 용어, “시료”는 고형암, 허혈성 질환 또는 염증성 질환이 발병된 환자로부터 분리되어 NDRG3 단백질의 발현수준을 측정하는 직접적인 대상을 의미하며, 구체적으로 상기 생물학적 시료는 조직, 혈액, 혈장, 혈청, 타액, 정액 및 소변으로 구성된 군으로부터 선택된 어느 하나일 수 있으나, 이에 제한되는 것은 아니다.
상기 정보제공방법은 상기 생물학적 시료에서 측정한 NDRG3 단백질의 발현 수준이 정상 대조군 시료의 해당 단백질 발현 수준보다 높은 경우, 고형암, 허혈성 질환 또는 염증성 질환으로 판단하는 단계(제3단계)를 추가로 포함할 수 있다.
본 발명은, 상기 NDRG3 단백질이 젖산에 의해 HIF-비의존적으로 축적되어 세포증식 및 혈관신생 등의 중요한 매개자로 작용하는 바, NDRG3 단백질 발현양의 측정을 통한 젖산 정량 방법을 제공하여 NDRG3 단백질에 기한 세포증식 및 혈관신생 등의 작용을 예측 및 분석이 가능하도록 함으로써 향후 허혈성 질환 등 관련 질병의 진단, 관리, 치료, 예방 또는 관련 신약 개발 및 연구 등에 유용하게 사용할 수 있다.
이하, 실시예를 통하여 본 발명의 구성 및 효과를 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들 실시예에 의해 한정되는 것은 아니다.
< 실시예 1> NDRG3 과발현 형질전환 마우스의 제작
NDRG3의 발현이 생화학적 특징에 미치는 영향을 확인하기 위하여 NDRG3 과발현 형질전환 마우스를 제작하였다.
구체적으로, 도 1a의 모식도와 같이 인간 NDRG3 cDNA 서열(서열번호 1)을 CAG-프로모터(거대세포바이러스 인핸서(cytomegalovirus enhancer) 및 치킨(chicken) β-액틴 프로모터) 및 레빗 β-글로빈(globin) 폴리아데닐화(polyadenylation) 서열을 포함하는 pCAGGS 플라스미드에 클로닝하여 선형화한 후, 상기 선형화된 컨스트럭트(construct)를 3마리의 C57/BL6 마우스 수정란의 전핵(pronuclei)으로 주입하였다. 유전자의 삽입 여부를 확인하기 위하여 상기 3마리의 C57/BL6 마우스 각각의 꼬리를 잘라 마우스 꼬리 용해 버퍼(mouse tail lysis buffer, 60 mM Tris pH 8.0/100 mM EDTA/ 0.5 % SDS, 500 ug/ml Proteinase K)를 이용해 게놈 DNA(genomic DNA)를 추출한 후, 하기 표 1의 프라이머를 이용하여 PCR을 통해 유전자형을 확인하였다(도 1b). 상기 3마리의 C57/BL6 마우스 각각에서 이식된 NDRG3을 발현하는 것을 확인한 후, 정상 마우스와 교배하여 F1 세대의 마우스 각각을 획득하고 상기와 동일한 방법으로 유전자형을 확인하여 NDRG3을 과발현하는 형질전환 마우스의 계통 TG-2, TG-8 및 TG-13을 확립하였다.
프라이머(primer) 서열(5'→3')
인간 NDRG3 정방향 AACCATAAATCCTGTTTCAATG(서열번호 9)
역방향 TCCACAACATTGGTTGTCAGG(서열번호 10)
또한, 상기 NDRG3 과발현 형질전환 마우스 TG-2, TG-8 및 TG-13에서 NDRG3의 과발현을 다시 한번 확인하기 위하여 상기와 같이 표 1의 프라이머를 이용하여 PCR을 수행하였다(도 1c).
< 실시예 2> 인간 NDRG3 항체의 제조
인간 NDRG3 단백질에 대한 항체를 제조하기 위하여, 재조합 인간 NDRG3 단백질의 아미노산 32-315 서열(서열번호 2)을 pET-28a 벡터로 클로닝 하고 대장균 균주 BL21로 형질전환하고, 상기 형질전환된 대장균 균주 BL21를 37에서 100 mg/ 엠피실린(ampicillin)이 포함된 LB 배지로 OD값이 OD595=0.5가 될 때까지 배양한 후 1 mM 농도의 IPTG(isopropyl-β-D-thiogalactoside)를 첨가하여 16℃에서 12시간동안 유도(induction)하였다. 그 다음, 상기 균주를 4℃에서 15분 동안 4,000 rpm으로 원심분리하고 버퍼[50 mM HEPES (pH 7.5) 및 150 mM NaCl]로 재현탁한 후, 2분 동안 3초 펄스(pulse)로 얼음통 안에서 초음파 분쇄(sonication)하고, 다시 4℃에서 15분 동안 12,000 rpm으로 원심분리하였다. 그 다음, 재조합 단백질은 Ni-NTA 아가로오스 레진(Resin)을 이용하여 Ni-NTA 아가로오스 친화 크로마토그래피를 통해 제조사의 절차에 따라 정제하였다. 그 다음, 상기 정제한 인간 NDRG3 재조합 단백질(아미노산 32-315)을 레빗(rabbit, New Zealand White)에 면역화하였다. 다클론 항혈청(polyclonal antisera)의 생산은 AbFrontier(서울, 대한민국)에 의뢰하여 제작하였다. 항혈청은 NDRG3 펩타이드(QNDNKSKTLKCS; 아미노산 244~255, 서열번호 3)를 이용하여 친화 크로마토그래피로 정제하여 항-NDRG3 항체를 획득하였다. 상기 항-NDRG3 항체의 특이성을 확인하기 위하여, 웨스턴 블럿팅을 수행하였다.
구체적으로, Myc-태그된 NDRG1 발현 벡터, Myc-태그된 NDRG2 발현벡터, Myc-태그된 NDRG4 발현벡터 및, Myc-태그된 NDRG3 발현 벡터를 클로닝하였다. 또한, NDRG3 변이체를 제작하기 위하여 상기 Myc-태그된 NDRG3 발현 벡터를 주형으로 하여 하기 표 2의 프라이머로 KOD-Plus-Mutagenesis 키트(Toyobo)를 이용해 제조사의 절차에 따라 부위-지정 돌연변이를 수행하여 NDRG3의 66번째 아스파라긴(Asn, N)을 아스파르트산으로 치환한 Myc-태그된 NDRG3(N66D) 변이체를 획득하였다. 그 다음, 상기 NDRG1-Myc, NDRG2-Myc, NDRG4-Myc 및 NDRG3(N66D)-Myc 각각을 10 % FBS(Gibco BRL) 및 100 U/ml 페니실린(penicillin, Gibco BRL)이 포함된 DMEM 배지로 배양한 HEK293T 세포(ATCC)에 리포펙타민(Lipofectamine) (Invitrogen)을 이용하여 제조사의 절차에 따라 형질전환(transfection)하였다. 그 다음, 상기 형질전환된 세포를 37℃, CO2 배양기(Sanyo)에서 24시간 동안 배양하고 회수하였다. 그 다음, 상기 회수한 세포를 용해 버퍼[1 % Triton X-100, 150 mM NaCl, 100 mM KCl, 20 mM HEPES(pH 7.9), 10 mM EDTA, 프로테아제 억제제(protease inhibitor) 칵테일(Roche)]를 이용하여 용해하고, 상기 세포의 단백질 용해물(30 ㎍)을 9 % SDS-PAGE로 전기영동한 후, 니트로셀룰로오스 막(nitrocellulose membranes)(PALL Life Sciences)으로 전달시켰다. 그 다음, 일차 항체로 상기 획득한 항-NDRG3 항체를 처리하여 반응시킨 후, 상기 막에 붙은 일차 항체에 HRP-접합 이차 항체를 붙이고, 이를 ECL(Pierce chemical co, USA)을 이용하여 확인하였다(도 2).
프라이머 서열
NDRG3(N66D) 센스(sense) GACCATAAATCCTGTTTCAATGCATTCTTT(서열번호 11)
안티센스(antisense) GAGGCCAATGTCATGATATGTTAGTATAAC(서열번호 12)
그 결과, 도 2에 나타낸 바와 같이, 제조된 항-NDRG3 항체는 NDRG1, NDRG2 및 NDRG4를 제외한 NDRG3(N66D) 변이체에만 결합하는 것을 확인함으로써, 상기 항-NDDRG3 항체는 NDRG3 항체 및 변이체를 항원으로 결합하는 항체이며, 따라서, 본 발명의 NDRG3의 분자생물학적 기능을 확인하기 위해 사용하였다(도 2).
< 실시예 3> PHD2의 결합 단백질로서 NDRG3 확인
정상산소에서 PHD2(Prolyl-hydroxylase domain 2)는 저산소에 의해 유도되는 유전자의 발현에 중요한 전사인자인 HIF-1α(Hypoxia-inducible Factor-1a)의 활성을 조절한다고 보고되고 있다(Wenger, R. H. et al., Curr. Pharm. Des., 2009(15), 3886-3894). 따라서, 저산소 반응(hypoxia responses)에 있어서 PHD2에 의해 HIF-비의존적으로 조절되는 인자를 찾기 위하여, 면역침전법(immunoprecipitation), 면역염색(immunostaining) 및 마이크로-LC-MS/MS 분석법을 수행하였다.
구체적으로, PHD2 결합 단백질을 확인하기 위하여 도 3a의 모식도와 같이 Flag-태그된 PHD2를 암호화하는 컨스트럭트(construct)를 제작한 후, 10 % FBS(Gibco BRL) 및 100 U/ml 페니실린(penicillin, Gibco BRL)이 포함된 DMEM 배지로 배양한 MCF-7 세포(ATCC)에 상기 컨스트럭트 및 대조군(mock)을 리포펙타민(Lipofectamine) (Invitrogen)을 이용하여 제조사의 절차에 따라 형질전환(transfection)하였다. 그 다음, 상기 형질전환된 세포에 프로테아좀(proteasome) 억제제인 MG132 10 μM를 처리하고 92-94 % N2, 5 % CO2 및 1 % O2로 구성된 혼합 기체가 포함된 O2/CO2 배양기(Sanyo)를 이용하여 24시간 동안 저산소(hypoxia) 상태를 유지하고, 용해 버퍼[1 % Triton X-100, 150 mM NaCl, 100 mM KCl, 20 mM HEPES(pH 7.9), 10 mM EDTA, 프로테아제 억제제(protease inhibitor) 칵테일(Roche)]를 이용하여 용해하였다. 상기 세포의 단백질 용해물(1 mg)을 항-FLAG M2 친화 겔(Sigma)을 이용하여 4℃에서 하루 동안 반응하고 원심분리하여 면역침전한 후, 9 % SDS-PAGE로 전기영동하고 코마시 브릴리언트 블루(Coomassie Brilliant Blue, CBB)로 염색하였다. 그 다음, 상기 PHD2-Flag 샘플에서 다른 면역침전 패턴을 나타내는 단백질 밴드를 SDS-PAGE 겔로부터 분리하고 마이크로-LC-MS/MS 분석을 위하여 트립신(trypsin)으로 겔을 소화하였다. 상기 소화된 단백질은 8 cm의 5-mm 입자 사이즈 Aqua C18 역상 컬럼을 포함한 융합된 실리카 모세관 컬럼(100 mm 내부지름, 360 mm 외부 지름)에 주입하였다. 상기 컬럼은 Agilent HP 1100 4차 LC 펌프에 옮기고 분리 시스템으로 250 nl/분의 유속을 사용하여 펩티드를 분리하였다. 또한, 버퍼 A(5 % 아세토니트릴(acetonitrile) 및 0.1 % 포름산(formic acid)) 및 버퍼 B(80 % 아세토니트릴 및 0.1 % 포름산)를 120 분 구배(gradients)를 위해 사용하였다. 용출된 펩티드는 LTQ 선형 이온 트랩 질량분석기(Thermo Finnigan)로 2.3 kV DC 전위로 전기분무 방법으로 분리되었다. 하나의 전체 MS 스캔(400-1,400 m/z)으로 구성된 데이터 의존적 스캔 및 5개의 데이터 의존적 MS/MS 스캔은 용출된 펩티드의 MS/MS 스펙트럼을 발생시키기 위해 사용되었다. 그 다음, MS/MS 스펙트럼은 Bioworks version 3.1을 이용하여 NCBI 인간 단백질 서열 데이터베이스로부터 분석되었다. DTASelect는 검색 결과를 필터링하기 위해 사용하였고, Xcorr 값은 펩티드의 다른 전하 상태에 적용되었다: 1.8은 단일전하 펩티드(singly charged peptides)로 적용되었고, 2.5는 이중전하 펩티드로 적용되었고, 3.5는 삼중전하 펩티드로 적용되었다(도 3b).
그 결과, 도 3b에 나타낸 바와 같이, PHD2-Flag 샘플로부터 적출된 단백질 중 질량분석으로 10 종류의 PHD2 결합 단백질을 확인하였고, 그 중 분화 및 발생, 저산소증뿐만 아니라 세포 증식(proliferation), 이동(migration) 및 침입(invasion)과 연관이 있는 유전자 패밀리에 속하는 NDRG3을 선택하였다(도 3b).
또한, 상기 NDRG3이 PHD2 결합 단백질임을 다시 한번 더 확인하기 위하여 면역침전법 및 웨스턴 블럿팅을 수행하였다.
구체적으로, 상기 대조군 및 Flag-태그된 PHD2 컨스트럭트를 형질전환한 MCF-7 세포 용해물을 항-FLAG M2 친화 겔(Sigma)을 이용하여 면역침전한 후, 9 % SDS-PAGE로 전기영동하고 니트로셀룰로오스 막(nitrocellulose membranes)(PALL Life Sciences)으로 전달시켰다. 그 다음, 일차 항체로 항-NDRG3 항체 및 항-Flag 항체를 처리하여 반응시킨 후, 상기 막에 붙은 일차 항체에 HRP-접합 이차 항체를 붙이고, 이를 ECL(Pierce chemical co, USA)을 이용하여 확인하였다(도 3c).
그 결과, 도 3c에 나타낸 바와 같이, 면역침강된 FLAG 비드로부터 분리된 42 KDa의 단백질을 확인함으로써, NDRG3이 PHD2의 결합단백질임을 확인하였다(도 3c).
< 실시예 4> PHD2의 고유 기질로서 NDRG3 확인
<4-1> PHD2 NDRG3의 상호작용 확인
PHD2의 결합 단백질로서 NDRG3과 PHD2의 상호작용 및 NDRG3 단백질 발현에 있어서 PHD2 및 NDRG3의 상호작용이 미치는 영향을 확인하기 위하여 면역침전법 및 웨스턴 블럿팅, 및 시험관내(in-vitro) 풀-다운 분석법(pull-down assay)를 수행하였다.
구체적으로, 상기 <실시예 3>과 같이 Flag-태그된 PHD2를 암호화하는 컨스트럭트를 10 % FBS(Gibco BRL) 및 100 U/ml 페니실린(penicillin, Gibco BRL)이 포함된 DMEM 배지로 배양한 HeLa 세포(ATCC)에 형질전환하고, 24시간 동안 1 % 산소로 저산소 상태를 유지한 후 용해하였다. 그 다음, 세포 용해물을 항-FLAG M2 비드를 이용하여 면역침전하고, 일차항체로 항-NDRG3 및 항-Flag 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 4a, 위). 또한, 상기 <실시예 1>에 기재된 방법으로 PHD2를 pET-28a 재조합 플라스미드에 클로닝하고 대장균 균주 BL21에 형질전환한 후, Ni-NTA 아가로오스 레진을 이용하여 정제하였다. 또한, NDRG3을 pGEX-4T-2 재조합 플라스미드에 클로닝하고 대장균 균주 BL21에 형질전환한 후, GST-결합 아가로오스 레진(ELPIS BIOTECH, 한국)을 이용하여 정제하였다. 그 다음, 상기 재조합 단백질 His-PHD2 10 ㎍ 및/또는 재조합 단백질 GST-NDRG3 10 ㎍을 최종 농도 0.2 mg/로 Ni-NTA 아가로오스(Giagen) 레진(resin)과 함께 4℃에서 4 시간 동안 배양하였다. 그 다음 레진에 결합한 NDRG3 단백질을 SDS 시료 완충용액을 처리하고 상기 <실시예 3>과 같이 SDS-PAGE로 전기영동한 후, 일차항체로 항-NDRG3 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 4a, 아래).
또한, PHD2 및 NDRG3 간의 기능적 관계를 확인하기 위하여 MCF-7 세포(도 4b) 또는 HeLa 세포(도 4c)를 정상 산소 상태(21 % O2)하에서 24 시간 동안 PHD2 억제제인 DFX(desferrioxamine)를 농도별로 처리한 후, 상기 <실시예 3>과 같이 세포를 용해하였다. 상기 세포 용해물은 항-NDRG3, 항-HIF-1α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하였다(도 4b 및 도 4c).
그 결과, 도 4a에 나타낸 바와 같이, 저산소 상태 하에서 면역침전된 PHD2와 NDRG3이 결합하며, 재조합된 PHD2 및 NDRG3이 결합하는 것을 확인함으로써, PHD2 및 NDRG3이 직접적으로 상호작용함을 확인하였다(도 4a).
또한, 도 4b 및 도 4c에 나타낸 바와 같이, HeLa 세포에서 NDRG3 단백질의 기본 발현 수준이 미비하지만, MCF-7 및 HeLa 세포 모두 PHD2 억제제인 DFX에 의해 PHD2의 활성이 억제된 경우 NDRG3 단백질의 발현이 증가하는 것을 확인함으로써, PHD2 활성이 억제됨에 따라 약물-의존적으로 NDRG3이 축적되며, NDRG3이 PHD2의 고유 기질임을 확인하였다(도 4b 및 도 4c).
<4-2> PHD 패밀리 단백질 및 NDRG3의 상호작용 확인
PHD 패밀리는 PHD1, PHD2, PHD3, P4HTM 및 P4HA1 으로 구성되어 있으며, 이들 패밀리는 HIF 단백질의 조절에 중요한 역할을 하는 것으로 보고되고 있다(Wenger, R. H. et al., Curr. Pharm. Des., 2009(15), 3886-3894). 따라서, PHD2 이외 다른 PHD 패밀리 및 E3 유비퀴틴(ubiquitin) 연결효소(ligase) 복합체의 표적 단백질인 VHL와 NDRG3 간의 관련성을 확인하기 위하여, RNA 간섭으로 PHD가 낙다운(knockdown)된 세포 및 PHD 패밀리가 과발현된 세포를 이용해 RT-PCR, 면역침전법 및 웨스턴 블럿팅을 수행하였다.
구체적으로, siVHL(siGENOME SMARTpool, Dharmacon) 및 삼천리제약(한국)에 의뢰하여 하기 표 3의 서열을 이용하여 siRNA를 제작한 후 리포펙타민 2000을 이용하여 제조사의 절차에 따라 HeLa 세포에 형질전환하여, GFP, PHD1, PHD2, PHD3, P4HTM, P4HA1 또는 VHL의 발현이 억제된 세포를 획득하고, 상기 각각의 발현이 억제된 세포를 48 시간 동안 정상 산소 상태(21 % O2) 하에서 유지 배양한 후 회수하였다. 그 다음, 상기 회수한 세포를 Trizol Reagent(Invitrogen, Carlsbad, CA)를 이용하여 총 RNA를 분리한 후, 분리한 RNA 5 ㎍을 역전사효소(reverse transcriptase)와 함께 반응시켜 cDNA를 합성하고, PCR 산물을 아가로스 겔로 전기영동한 후 시각화하였다(도 5a).
siRNA 서열
GFP 센스 GUUCAGCGUGUCCGGCGAGTT(서열번호 13)
안티센스 CUCGCCGGACACGCUGAACTT(서열번호 14)
PHD1 센스 CAUCGAGCCACUCUUUGACTT(서열번호 15)
안티센스 GUCAAAGAGUGGCUCGAUGTT(서열번호 16)
PHD2 센스 AACGGGUUAUGUACGUCAUTT(서열번호 17)
안티센스 AUGACGUACAUAACCCGUUTT(서열번호 18)
PHD3 센스 CCAGAUAUGCUAUGACUGUTT(서열번호 19)
안티센스 ACAGUCAUAGCAUAUCUGGTT(서열번호 20)
P4HTM 센스 GAGUGUCGGCUCAUCAUCCTT(서열번호 21)
안티센스 GGAUGAUGAGCCGACACUCTT(서열번호 22)
P4HA1 센스 GAUCUGGUGACUUCUCUGATT(서열번호 23)
안티센스 UCAGAGAAGUCACCAGAUCTT(서열번호 24)
또한, PHD 패밀리와 NDRG3 단백질의 상호작용을 확인하기 위하여 Flag-태그된 PHD1, Flag-태그된 PHD2, Flag-태그된 PHD3 , Flag-태그된 P4HTM 및 Flag-태그된 P4HA1 발현 벡터, 및 NDRG3 발현벡터를 제작한 후, 상기 <실시예 3>에 기재된 방법으로 NDRG3 및 상기 Flag-태그된 PHD 패밀리 각각을 HeLa 세포로 형질전환하고, 정상 상태에서 20 μM MG132를 8 시간 동안 처리한 후 세포를 획득하여 용해하였다. 그 다음, 상기 세포 용해물을 항-FLAG M2 비드로 면역침전하고, 항-NDRG3 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 5b).
그 결과, 도 5a 및 도 5b에 나타낸 바와 같이, RNA 간섭을 이용하여 PHD2 및 VHL의 발현을 억제한 경우 NDRG3이 축적되는 것을 확인함으로써, PHD 패밀리 군 중에서 PHD2가 NDRG3 단백질의 안정화에 있어서 주된 전사후 조절자(posttranslational regulator)이고, 정상 산소 상태에서 NDRG3은 유비퀴틴(ubiqutin)의 표적 단백질이며, 따라서 NDRG3이 PHD2/VHL-매개 전사후 과정의 기질임을 확인하였다(도 5a 및 도 5b).
<4-3> NDRG3에서 PHD2의 도킹부위 확인
PHD2의 기질로서 NDRG3에 PHD2가 도킹(docking)하는 위치를 확인하기 위하여, 면역침전법 및 단백질 도킹 시뮬레이션(docking simulation)을 수행하고, 상기 도킹 시뮬레이션을 통해 확인한 NDRG3의 여러 추정상 PHD2-도킹 부위와 PHD2와의 결합력을 확인하기 위하여, 부위-지정 돌연변이(site-direct mutation)를 이용하여 도킹 부위를 돌연변이한 NDRG3 변이체를 이용하여 면역침전법 및 웨스턴 블럿팅을 수행하였다.
구체적으로, 예측되는 표적 단백질의 단백질-단백질 도킹 시뮬레이션은 HEX6.3(D.W. Ritchie. et al., Genet, 2000(39), 178-194)에 의해 수행되었다. 계산 선택사항에 있어서, 모양(shape) 및 정전기학(electrostatistics)은 상관관계 타입(correlation type)으로 선택되었고, 범프(bumps) 및 볼륨(volumes)은 과정 후 선택되었다. 나머지 선택사항은 디폴트 배열(default configuration)을 사용하였다. 단일 표적 도킹(즉, NDRG3-EGLN1)을 위하여, 시뮬레이션은 상기 나열된 선택사항을 한번 사용하여 수행되었다. 다중 표적 구조를 위한 도킹(즉, NDRG3 및 PHD2)은 두-단계 실험을 통해 수행되었다. 첫 단계에서는, NDRG3이 각각의 표적을 위한 도킹 실험에서 수용체 단백질로서 사용되었다. 두 번째 단계에서는, 결과물 단백질-단백질 상호작용이 다른 단백질의 도킹을 위한 수용체 단백질로서 사용되었다. 두 번째 실험을 위한 입력값(input order)는 PHD2로 하였다. 도킹 계산은 RMSD(root-mean-square deviation)에 의해 수행되었고 결과는 단일 입력으로부터의 산출값이 다중 입력으로부터의 산출값과 일치하는 곳에서 필터링하였다. 필터링된 결과값 중에서, 가장 안정된 하나를 HEX6.3 총 점수(모양 점수 및 전정기학 점수의 합)를 이용하여 선택하였다(도 6a).
또한, 도킹 시뮬레이션으로 확인한 NDRG3의 도킹부위와 PHD2의 결합력을 확인하기 위하여 NDRG3-Myc 발현 벡터를 주형으로 KOD-Plus-Mutagenesis 키트(Toyobo)를 이용하여 제조사의 절차에 따라 부위-지정 돌연변이를 수행하여 NDRG3의 47번째 알기닌(Arg, R)을 아스파르트산(Asp, D)으로 치환한 Myc-태그된 NDRG3(R47D) 변이체, NDRG3의 66번째 아스파라긴(Asn, N)을 아스파르트산으로 치환한 Myc-태그된 NDRG3(N66D) 변이체, NDRG3의 97번째 글루타민(Gln, Q)을 글루탐산(Glu, E)으로 치환한 Myc-태그된 NDRG3(Q97E) 변이체, NDRG3의 296번째 발린(Val, V)을 아스파르트산으로 치환한 Myc-태그된 NDRG3(V296D) 변이체를 획득하였다. 그 다음, 상기 <실시예 3>과 같이 상기 각각의 Myc-태그된 NDRG3 변이체, Flag-태그된 PHD2 및 HA-태그된 VHL 컨스트럭트를 동시에 HEK293T 세포(ATCC)로 형질전환하고, 상기 형질전환된 HEK293T 세포에 8 시간 동안 20 μM MG132를 처리한 후 용해하였다. 상기 세포 용해물은 항-Myc 친화겔(Sigma)을 이용하여 면역침전하고, 일차항체로 항-Flag, 항-HA 및 항-Myc 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 6b).
그 결과, 도 6a에 나타낸 바와 같이, 공개된 PHD2 기질(Structure. 2009(7), 981-9)과 NDRG3 기질 사이의 도킹 모델로부터 NDRG3의 추정상 PHD2-도킹 부위로 47번째 알기닌(Arginine), 66번째 아스파라긴(Asparagine), 68번째 라이신(Lysine), 69번째 세린(Serine), 72번째 아스파라긴, 73번째 알라닌(Alanine), 76번째 아스파라긴, 77번째 페닐알라닌(Phenylalanine), 78번째 글루탐산(Glutamic acid), 81번째 글루타민(Glutamine), 97번째 글루타민, 98번째 글루타민, 99번째 글루탐산, 100번째 글라이신(Glycine), 101번째 알라닌, 102번째 프롤린(Proline), 103번째 세린, 203번째 류신(Leucine), 204번째 아스파르트산(Aspartic acid), 205번째 류신, 208번째 쓰레오닌(Threonine), 209번째 타이로신(Tyrosine), 211번째 메티오닌(Methionine), 212번째 히스티딘(Histidine), 214번째 알라닌, 215번째 글루타민, 216번째 아스파르트산, 217번째 이소류신(Isoleucine), 218번째 아스파라긴, 219번째 글루타민, 296번째 발린(Valine), 297번째 발린, 298번째 글루타민, 300번째 글라이신 및 301번째 라이신 부위를 확인하였고, 상기 PHD2-도킹 부위 중 47번째, 66번째, 97번째 및 296번째 아미노산 위치가 더욱 중요함을 확인하였다(도 6a).
또한, 도 6b에 나타내 바와 같이, NDRG3(V296D) 변이체 및 NDRG3(Q97E) 변이체는 PHD2와 결합하는 반면, NDRG3의 47번째 위치 또는 66번째 위치를 돌연변이한 NDRG3 변이체가 PHD2와 결합하지 않으며, 또한, PHD2와 높은 친화도를 보이는 NDRG3 변이체는 VHL에 의해 많은 양으로 면역침전되는 것을 확인함으로써, NDRG3 변이체가 다양한 PHD2-결합력(V296D>Q97E>R47DN66D)을 나타내며, 정상 산소 상태하에서 NDRG3의 47번째 및 66번째 아미노산 위치가 PHD2의 도킹에 중요하며, VHL과도 관련이 있음을 확인하였다(도 6b).
<4-4> 정상산소 상태에서 PHD2 / VHL -매개 프로테아좀 경로에 의한 NDRG3의 조절 확인
정상산소 상태 하에서 PHD2 및 E3 유비퀴틴 연결효소 복합체의 표적 요소인 VHL이 NDRG3의 단백질 발현 및 조절에 미치는 영향을 확인하기 위하여, MG132를 이용하여 프로테아좀(proteasome) 활성을 억제하고 웨스턴 블럿팅 및 생체 내 유비퀴틴화 분석법(In-vivo ubiquitination assay)을 수행하였다.
구체적으로, 전장 NDRG3 cDNA(서열번호 1) 및 pMSCVneo 레트로바이러스 벡터(Clontech)를 이용하여 형질감염용 벡터(MSCV 레트로바이러스 시스템)를 제작하였다. 바이러스 제작을 위하여, 리포펙타민(Lipofectamine)(Invitrogen)을 사용하여 GP293 세포주에 형질감염하였다. 48시간 후, NDRG3-레트로바이러스 또는 대조-레트로바이러스가 포함된 세포 상층액을 6 ㎍/ml 폴리브렌(polybrene)와 같이 HeLa 세포에 24 시간 처리한 다음, 상기 NDRG3이 과발현된 세포에 8 시간 동안 20 μM MG132를 처리 또는 무처리한 후 세포를 획득하고, 항-NDRG3 항체 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 7a).
또한, 정상 산소 상태에서 NDRG3의 유비퀴틴화를 확인하기 위하여 생체 내 유비퀴틴화 분석법을 수행하였다. 먼저, NDRG3의 발현을 억제하기 위해 shNDRG3(Sigma-Aldrich, 서열번호 4) 및 렌티바이러스(lentivirus) 벡터를 이용하여 형질감염용 벡터를 제작하였다. 바이러스 제작을 위하여, 상기와 같이 패킹 세포주에 형질감염하였다. 그 다음, 상기 NDRG3 shRNA 발현 렌티바이러스가 포함된 세포 상층액을 6 ㎍/ml 폴리브렌(polybrene)와 함께 HeLa 세포에 처리한 후, 10 % FBS을 포함한 DMEM 배지에서 유지한 다음, 대조군 HeLa 세포, 상기 NDRG3 발현이 억제된 HeLa 세포 및 상기 NDRG3이 과발현된 HeLa 세포를 상기 <실시예 3>과 같이 HA-태그된 유비퀴틴로 형질전환하고, 8 시간 동안 20 μM MG132를 처리한 후 세포를 획득하여 용해하였다. 그 다음, 상기 세포 용해물은 30 ㎕ 단백질 G-아가로오스 비드(bead, Santa Cruz Biotechnology)를 첨가하여 프리클리어(preclear)한 후 항-NDRG3 항체로 면역침전하고, 다유비퀴틴화된(polyubiquitinated) 형태의 NDRG3을 항-HA 항체를 이용하여 웨스턴 블럿팅으로 확인하였다(도 7b).
그 결과, 도 7a 및 도 7b에 나타낸 바와 같이, 정상 산소 상태에서 MG132로 프로테아좀을 억제한 경우 NDRG3이 과발현된 세포에서 NDRG3 단백질이 활발하게 유비퀴틴화 되는 것을 확인함으로써, 정상 산소 상태에서 NDRG3이 유비퀴틴화 되어 프로테아좀 경로를 통해 분해되는 것을 확인하였다(도 7a 및 도 7b). 따라서, 상기 <실시예 4>의 결과들을 통해 NDRG3이 고유한 PHD2-상호작용하는 단백질이고, 상기 NDRG3 단백질의 발현은 PHD2/VHL-매개 프로테아좀 경로에 의해 전사후 조절됨을 확인하였다.
< 실시예 5> 저산소 상태에서 NDRG3의 발현 확인
<5-1> NDRG3 단백질의 산소-의존적 발현 확인
PHD2의 활성은 O2 유효성에 의존적이므로 PHD2의 고유 기질인 NDRG3 단백질 또한 안정성에 있어서 산소 상태가 영향을 미치는지 확인하기 위하여, 산소 상태를 달리한 여러 세포를 이용하여 면역침전법, 웨스턴 블럿팅, 면역형광염색법 및 생체내 유비퀴틴화 분석법을 수행하였다.
구체적으로, 10 % FBS 및 100 U/ml 페니실린이 포함된 DMEM 배지로 배양된 MCF-7 세포를 1 %, 3 %, 5 % 및 21 % O2와 92-94 % N2 및 5 % CO2로 구성된 혼합 기체가 포함된 O2/CO2 배양기를 이용하여 시간별로 유지한 후, 세포를 획득하였다. 그 다음, 상기 <실시예 3>과 같이 세포를 용해하고, 세포 용해물을 항-NDRG3 및 항-β액틴을 이용하여 웨스턴 블럿팅하여 NDRG3의 발현을 확인하고, 그래프화하였다(도 8a).
또한, 10 % FBS 및 100 U/ml 페니실린이 포함된 DMEM 배지로 커퍼슬립(cover slips)에서 배양된 MCF-7 세포를 1 % O2와 94 % N2 및 5 % CO2로 구성된 혼합 기체가 포함된 O2/CO2 배양기를 이용하여 저산소 상태를 시간별로 유지하였다. 그 다음, 20분 동안 4 % 파라포름알데하이드(paraformaldehyde)/PBS로 고정하고, 상온에서 5분 동안 0.3 % TritonX-100/PBS로 침투화한 후, 차단 용액(1 % BSA가 포함된 PBS)으로 30분 동안 배양하였다. 그 다음, 상기 세포를 상온에서 1시간 동안 항-NDRG3 항체(1/1,000)로 반응하고 세척한 후, 2차 항체[Alexa Flour 488-접합된 고트(goat) 항-레빗 IgG (1/1,000), 또는 Alexa Flour 594- 접합된 고트 항-마우스 IgG (1/1,000); Amersham] 및 DAPI (3 μM, Sigma)로 반응시켰다. 그 후, Zeiss LSM 510 공초점 현미경을 이용하여 시각화하였다(도 8b).
또한, 10 % FBS 및 100 U/ml 페니실린이 포함된 DMEM 배지로 배양된 MCF-7(유방), PLC/PRF/5(간), Huh-1(간), HeLa(자궁경부), HEK293T(신장) 및 MCF-10A(유방) 세포 및 10 % FBS 및 100 U/ml 페니실린이 포함된 RPMI 1640 배지로 배양된 SW480(대장) 및 IMR-90(폐)를 상기와 같이 O2/CO2 배양기를 이용하여 저산소 상태(1 % O2)에서 시간별로 유지한 후, 세포를 획득하였다. 그 다음, 상기 <실시예 3>과 같이 세포를 용해하고, 세포 용해물을 항-NDRG3 및 항-β액틴을 이용하여 웨스턴 블럿팅하여 NDRG3의 발현을 확인하고, 그래프화하였다(도 8c).
또한, 저산소 상태에서 NDRG3의 유비퀴틴화를 확인하기 위하여 생체 내 유비퀴틴화 분석법을 수행하였다. 상기 <실시예 3>과 같이 HA-태그된 유비퀴틴 및 Myc-태그된 NDRG3을 HeLa 세포에 형질전환한 후, 40시간 동안 정상산소 상태에서 배양하고 8 시간 동안 20 μM MG132를 처리하였다. 그 다음, 24시간 동안 추가적으로 저산소 상태(1 % O2)에서 배양한 후, 세포를 획득하여 용해하였다. 그 다음, 상기 세포 용해물은 30 ㎕ 단백질 G-아가로오스 비드(bead, Santa Cruz Biotechnology)를 첨가하여 프리클리어한 후 항-Myc 항체로 면역침전하고, 항-HA 항체를 이용하여 웨스턴 블럿팅하였다(도 8d).
그 결과, 도 8a 및 도 8b에 나타낸 바와 같이, 세포에서 O2 농도가 감소할수록, 그리고 시간이 지속될수록 NDRG3 단백질의 축적이 증가하는 것을 확인함으로써, O2 농도에 반비례하게 NDRG3 단백질이 축적됨을 확인하였다(도 8a 및 도 8b).
또한, 도 8c에 나타낸 바와 같이, 저산소 상태에 따른 NDRG3 단백질의 축적은 비-형질전환된 세포뿐만 아니라 대장, 간, 자궁경부, 신장, 폐 등 다양한 조직 유래 암세포에서 동일하게 나타나는 것을 확인함으로써, O2 농도 및 NDRG3 단백질의 반비례 관계는 전형적인 현상임을 확인하였다(도 8c).
또한, 도 8d에 나타낸 바와 같이, 저산소 상태 하에 NDRG3 단백질이 유비퀴틴화가 감소하는 것을 확인하였다(도 8d). 따라서, 상기 결과들을 통해 정상산소 상태와 달리 저산소 상태 하에 NDRG3 단백질의 축적은 증가하고, 유비퀴틴화는 감소하는 것을 확인하였다.
<5-2> 산소 상태에 따른 NDRG3 단백질의 안정성 확인
저산소 상태 및 정상 산소 상태에 따른 NDRG3 단백질의 발현 변화를 확인하기 위하여, 산소 상태를 달리한 세포를 이용하여 웨스턴 블럿팅을 수행하였다.
구체적으로, 지속적인 저산소 상태에서 NDRG3 단백질의 발현을 확인하기 위하여 상기 실시예 <5-1>과 같이 저산소 상태(1 % O2)에서 시간별로 유지 배양한 MCF-7 세포 및 정상 산소 상태(21 % O2)에서 유지 배양한 MCF-7 세포를 획득하여 상기 <실시예 3>과 같이 용해한 후, 항-NDRG3, 항-HIF-1α 및 항-β-액틴 항체를 이용하여 웨스턴 블럿팅하고 그래프화하였다(도 9a).
또한, 정상 산소 상태로 회복될 때 NDRG3 단백질의 발현 변화를 확인하기 위하여 상기 실시예 <5-1>과 같이 저산소 상태(1 % O2)에서 24시간 동안 유지 배양한 MCF-7 세포 및 정상 산소 상태(21 % O2)에서 시간별로 유지 배양한 MCF-7 세포를 획득하여 상기 <실시예 3>과 같이 용해한 후, 항-NDRG3, 항-HIF-1α 및 항-β-액틴 항체를 이용하여 웨스턴 블럿팅하고 그래프화하였다(도 9b).
그 결과, 도 9a 및 도 9b에 나타낸 바와 같이, HIF-1α 단백질의 경우 저산소증 초기 단계에서 발현이 유도되고 저산소증이 지속됨에 따라 단백질의 발현이 감소하는 반면, NDRG3 단백질의 경우 저산소증 말기 단계까지 발현이 지속적으로 유지되는 것을 확인하였다. 또한, 상기 지속적으로 저산소 상태에 의해 유도된 NDRG3 발현은 세포가 정상 산소 상태로 다시 돌아갈 때까지 천천히 제거되는 것을 확인하였다(도 9a 및 도 9b).
<5-3> 산소 상태에 따른 NDRG3 단백질의 안정성 조절 기전 확인
저산소 상태에서 NDRG3 단백질의 표적 부위를 확인하기 위하여, 마이크로-LC-MS/MS 분석법을 수행하고, 부위-지정 돌연변이로 제작한 NDRG3 변이체가 과발현된 세포를 이용하여 웨스턴 블럿팅을 수행하였다. 또한, 정상 산소 상태에서 NDRG3 단백질의 저산소 표적 부위와 PHD2/VHL의 관련성을 확인하기 위하여, 면역침전법 및 웨스턴 블럿팅을 수행하였다.
구체적으로, 저산소 상태 하에서 NDRG3 단백질의 표적 부위를 확인하기 위하여 상기 실시예 <4-2>에 기재된 방법으로 획득한 NDRG3이 과발현된 MCF-7 세포에 10 μM MG132를 처리한 후 세포를 획득하여 용해하고 상기 <실시예 3>과 같이 항-NDRG3 항체를 이용하여 면역침전하고 마이크로-LC-MS/MS 분석을 수행하였다(도 10a).
또한, 상기 마이크로-LC-MS/MS 분석법의 결과를 통해 확인한 NDRG3 단백질 표적 부위와 PHD2/VHL의 결합을 확인하기 위하여 먼저 NDRG3 단백질 표적 부위로 예상되는 294번째 프롤린(Pro, P)을 알라닌(Ala, A)으로 치환하기 위하여 상기 실시예 <4-3>과 같이 부위-지정 돌연변이를 수행하여 Myc-태그된 NDRG3 P294A 변이체를 제작하였다. 그 다음, 상기 NDRG3 변이체 또는 야생형 NDRG3 컨스트럭트를 상기 <실시예 3>과 같이 HEK293T 세포로 형질전환한 후, 40시간 동안 정상 산소 상태(21 % O2) 하에서 배양하고 추가적으로 8시간 동안 20 μM MG132을 처리한 세포와 처리하지 않은 세포를 획득하였다. 상기 획득한 세포는 용해 후, 항-Myc 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 10b, 위). 또한, Flag-태그된 PHD2, HA-태그된 VHL, 및 상기 Myc-태그된 NDRG3P294A 변이체 또는 Myc-태그된 NDRG3을 상기 <실시예 3>과 같이 HEK293T 세포에 동시에 형질전환한 후, 40시간 동안 정상 산소 상태(21 % O2) 하에서 배양하고 추가적으로 8시간 동안 20 μM MG132을 처리하여 세포를 획득하였다. 그 다음, 상기 획득한 세포를 용해 후, 항-Myc 친화겔로 면역침전하고, 항-Flag, 항-HA 및 항-Myc 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 10b, 아래).
그 결과, 도 10a에 나타낸 바와 같이, 질량 분석을 통해 NDRG3의 294번째 프롤린이 PHD2-매개 저산소증 표적 부위이며, 상기 부위가 산소 의존적으로 하드록실화(hydroxylation) 되는 부위임을 확인하였다(도 10a).
또한, 도 10b에 나타낸 바와 같이, 예상되는 저산소증 표적 부위인 NDRG3 294번째 아미노산 부위를 알라닌으로 치환한 NDRG3 변이체를 과발현시킨 세포의 경우 정상 산소 상태에서 NDRG3 단백질 변이체의 축적이 증가하고(도 10b, 위), 또한, PHD2 및 VHL과의 결합이 감소하는 것(도 10b, 아래)을 확인함으로써, 상기 NDRG3 단백질 부위가 정상 산소 상태에서 PHD2/VHL과 상호작용하고, 산소 의존적으로 PHD2에 의해 조절됨을 확인하였다(도 10b).
<5-4> 산소 상태에 따른 HIF -비의존적 NDRG3 발현 조절 확인
산소 상태에 따라 NDRG3 발현 조절이 HIF 단백질과 관련이 있는지 확인하기 위하여, 산소 상태를 달리한 세포를 이용하여 웨스턴 블럿팅 및 RT-PCR을 수행하였다.
구체적으로, 산소 상태에 따른 HIF 단백질의 발현을 확인하기 위하여 상기 실시예 <5-2>와 같이 정상 산소 상태(21 % O2)에서 24 시간 동안 유지 배양한 MCF-7 세포 및 저산소 상태(1 % O2)에서 시간별로 유지 배양한 MCF-7 세포를 회수한 후, 절반은 상기 <실시예 3>과 같이 항-HIF-1α, 항-HIF-2α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하여 단백질의 발현을 확인하고, 절반은 상기 실시예 <4-2>와 같이 RT-PCR을 수행하여 mRNA의 발현을 확인하였다(도 11a).
또한, HIF 및 PHD2의 억제에 따른 NDRG3 단백질의 발현을 확인하기 위하여 웨스턴 블럿팅을 수행하였다. 먼저, HIF-1α 또는 HIF-2α의 발현을 억제하기 위하여 상기 실시예 <4-4>와 같이 shHIF-1α(Sigma-Aldrich), shHIF-2α(Sigma-Aldrich) 또는 대조군 shGFP 및 렌티바이러스 벡터를 이용하여 형질감염용 벡터를 제작하였다. 그 다음, 상기 shHIF-1α 또는 shHIF-2α 발현 렌티바이러스가 포함된 세포 상층액을 6 ㎍/ml 폴리브렌(polybrene)와 함께 PLC/PRF/5 세포에 처리한 후, 10 % FBS을 포함한 DMEM 배지에서 유지한 다음, 대조군 PLC/PRF/5 세포, 상기 HIF-1α 또는 shHIF-2α 발현이 억제된 PLC/PRF/5 세포를 정상 산소 상태(21 % O2)하에서 PHD2 억제제인 DFX(desferrioxamine) 1 mM을 시간별로 처리한 후, 상기 <실시예 3>과 같이 세포를 획득하여 용해하고, 상기 용해물을 항-NDRG3, 항-HIF-1α, 항-HIF-2α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하였다(도 11b).
또한, HIF 및 VHL이 결실에 따른 NDRG3 단백질의 발현을 확인하기 위하여 MCF-7(HIF-1+/+ 및 VHL+/+), 및 HIF-1α 및 VHL 좌위(loci)가 유전적으로 방해된 786-O(HIF-1-/- 및 VHL-/-) 세포를 상기 실시예 <5-2>와 같이 저산소 상태(1 % O2)에서 24시간 동안 유지 배양한 후, 상기 <실시예 3>과 같이 세포를 회수하여 용해하고, 상기 세포 용해물을 항-NDRG3, 항-HIF-1α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하였다(도 11c).
그 결과, 도 11a에 나타낸 바와 같이, 저산소 상태 초기단계에서 HIF-1α 단백질의 발현이 현저히 증가하는 것과 상관없이 저산소 상태가 지속되는 동안 NDRG3 mRNA의 발현 수준이 변화되지 않고 지속적으로 유지되는 것을 확인하였다(도 11a).
또한, 도 11b 및 도 11c에 나타낸 바와 같이, 정상 산소 상태에서 HIF의 결실에 영향을 받지 않고 PHD2의 활성 억제가 지속됨에 따라 NDRG3 단백질의 축적이 증가함을 확인하였고(도 11b), 저산소 상태에서도 HIF 및 VHL 결실에 영향을 받지 않고 NDRG3 단백질이 발현이 보존됨을 확인하였다(도 11c). 따라서, 상기 <실시예 5>의 결과들을 통해, NDRG3 단백질의 발현은 산소 의존적으로 PHD2에 의해 조절되고, 저산소 상태가 지속될수록 NDRG3의 발현이 지속되며, 이때 NDRG3 단백질 및 mRNA의 발현은 HIF 활성에 직접적으로 영향을 받지 않음을 확인하였고, 따라서 NDRG3이 HIF-비의존적으로 지속된 저산소 반응에 있어서 주요한 기능을 가짐을 확인하였다.
< 실시예 6> 지속적인 저산소 반응의 조절자로서 NDRG3 확인
<6-1> 저산소 상태에서 NDRG3의 기능 확인
저산소 반응에 있어서 NDRG3의 기능을 확인하기 위하여, NDRG3의 발현이 억제된 세포를 이용하여 마이크로어레이-기반 트랜스크립톰 데이터(microarray-based transcriptome data)의 GAzer(Gene Set Analyzer)를 통한 유전자 발현 프로파일링(profiling)을 수행하였다.
구체적으로, shNDRG3 및 shHIF-1α를 이용하여 상기 실시예 <4-4> 및 실시예 <5-4>에 기재된 방법으로 NDRG3 또는 HIF-1α의 발현이 억제된 Huh-7 세포를 제작한 후, 상기 실시예 <5-2>와 같이 저산소 상태(1 % O2)에서 시간별로 유지 배양하고 세포를 회수하였다. 그 다음, 상기 회수한 세포로부터 전체 RNA를 RNA 분리 키트(RNeasy midi-prep, Qiagen)를 이용하여 제조사의 절차에 따라 분리하였다. 그 다음, 마이크로어레이(microarray) 분석을 위하여 상기 분리한 전체 RNA 200 ng을 Illumina TotalPrepTM RNA 증폭 키트를 이용하여 증폭한 후, 증폭된 cRNA 700 ng을 HumanHT-12 v3/v4 발현 비드칩(Expression BeadChip)을 이용하여 16시간 동안 58 ℃에서 혼성화하였다. 세척 및 염색 후, 비드칩을 일루미나 비드어레이 리더(Illumina BeadArray Reader) 및 비드 스캔(Bead Scan) 소프트웨어(Illumina)를 이용하여 스캐닝하였다. 발현된 유전자는 GO(gene ontology) 분석을 이용하여 기능별로 구분하였다(Ashburner, M. et al., Nat. Genet., 2000(25), 25-29). 이 과정에서, Z 점수(표준값) 변환은 각각의 유전자 그룹화에 의한 표준화된 편차 점수를 계산하기 위하여 사용되었다. Z 점수 값은 GO 생물학적 과정의 활성을 가리킨다(도 12a).
또한, 상기 <실시예 3>과 같이 NDRG3(N66D) 변이체를 HeLa 세포에 형질전환한 후, 대조군 보다 1.5배 이상의 발현 증가를 나타내는 136개의 유전자, 정상산소 상태보다 저산소 상태에서 1,5배 이상의 발현 증가를 보이는 1535개 유전자, 그리고 NDRG3(N66D) 변이체의 과발현과 저산소 상태에서 공통적으로 증가되는 유전자 68개를 선발하고, 상기 선발된 유전자들의 기능을 조사하기 위해 GAzer(Gene Set Analyzer)분석을 통해 기능별로 분류한 생물학적 온톨로지의 Z 점수(표준값)를 다이어그램으로 나타내었다(도 12b).
그 결과, 도 12a에 나타낸 바와 같이, NDRG3 결실은 통계학적으로 24시간 저산소 상태 하에 기능적 유전자 그룹에서 중요한 발현 변화가 나타나는 것을 확인하였고, NDRG3 결실에 의해 가장 많이 영향을 받은 저산소증 기능이 혈관생성(angiogenesis) 및 세포 증식(proliferation)임을 확인하였고, 반면 해당과정(glycolysis)은 가장 관련이 적은 기능 중 하나임을 확인하였다. 반대로, HIF-1α의 경우, 저산소증 기능 중 가장 관련성이 높은 기능이 해당과정인 반면, 혈관생성 및 세포증식은 관련성이 적음을 확인하였다(도 12a).
또한, 도 12b에 나타낸 바와 같이, 정상 산소 상태에서 PHD2의 도킹 부위를 돌연변이한 NDRG3 N66D 변이체를 과발현시킨 경우, 혈관생성>세포증식세포성장세포사멸(apoptosis)세포이동(cell migration)>해당과정 순으로 상향조절이 이루어짐을 확인하였다(도 12b). 따라서, 상기 결과를 통해 NDRG3이 저산소증 반응에 있어서 중요한 기능을 가짐을 확인하였다.
<6-2> 저산소 상태에서 NDRG3에 의한 혈관생성 촉진 확인
상기 <6-1>의 분석으로 확인한 저산소증에서 NDRG3의 관련성이 높은 기능 중 혈관생성에 있어서 NDRG3의 영향을 확인하기 위하여, NDRG3 발현이 억제된 세포를 이용하여 튜브 형성 분석법(tube forming assay), RT-PCR, 웨스턴 블럿팅 및 생체 내 혈관생성 분석법(in-vivo angiogenesis assay)을 수행하였다.
구체적으로, NDRG3 결실에 의한 혈관생성 활성 변화를 확인하기 위하여 튜브 형성 분석법을 수행하였다. 먼저, 상기 실시예 <4-4>에 기재된 방법으로 shNDRG3을 이용하여 NDRG3의 발현이 억제된 Huh-7 (2 × 105 세포/ml) 및 대조군 Huh-7 세포를 저산소 상태(1 % O2)하에서 24시간 동안 배양한 다음 배양액 (1 ml)을 회수하여 HUVEC(human umbilical vein endothelial cells) (1×05 세포/ml) 세포 와 함께 미리 마트리겔(Matrigel)로 코팅한 6-웰 디쉬에서 6-12 시간동안 배양하여 튜브 형성을 관찰하였다(도 13a).
또한, 저산소 상태에서 NDRG3 결실로 인한 신생혈관생성 마커인 IL8, IL1α 및 IL1β COX-2 및 PAI-1의 발현을 확인하기 위하여 상기 실시예 <6-1>에 기재된 방법으로 획득한 NDRG3 결실 Huh-7 세포 및 대조군 Huh-7 세포를 정상 산소 상태(21 % O2) 하에서 또는 저산소 상태 (1 % O2) 하에서 24시간 동안 유지 배양한 후 세포를 회수하였다. 또한, 상기 실시예 <4-3>에 기재된 방법으로 제작한 NDRG3(N66D) 변이체를 상기 <실시예 3>과 같이 HeLa 세포에 형질전환하고 정상 산소 상태 하에서 24시간 동안 유지 배양한 후 세포를 회수하였다. 그 다음, 상기 실시예 <4-4>에 기재된 방법으로 전체 RNA를 분리하고 RT-PCR을 수행하였다. 또한, 상기 각각의 세포 일부를 항-NDRG3 항체를 이용하여 상기 <실시예 3>과 같이 웨스턴 블럿팅을 수행하여 NDRG3의 발현을 확인하였다(도 13b).
또한, NDRG3 결실에 의한 생체내 혈관생성 분석을 위하여 마트리겔 플러그 분석법(matrigel plug assay)을 수행하였다. 먼저, 차가운 매트리겔(BD Biosciences)을 상기 실시예 <6-1>에 기재된 방법으로 획득한 NDRG3 결실 Huh-7 세포(1×106 세포/ml) 및 대조군 Huh-7 세포(1×106 세포/ml)와 혼합하였다. 그 다음, 상기 혼합된 매트리겔 500 ㎕를 6주된 암컷 BALB/c 마우스(Japan SLC)의 복부 부위로 피하주입하였다. 7일 후, 상기 마우스를 희생하고 매트리겔 플라그를 획득한 후, 헤모글로빈 정량을 위하여(hemoglobin quantification) 얼음통 안에서 500 ㎕ 물로 균질화하고 4℃에서 15분 동안 12,000 rpm으로 원심분리하여 세척하였다. 그 다음, 상층액만 분리한 후, Drabkin's 시약(Sigma)을 이용하여 제조사의 절차에 따라 반응시키고 흡광광도계로 570 nm의 파장에서 흡광도를 측정하여 그래프화하였다(도 13c).
그 결과, 도 13a 및 도 13b에 나타낸 바와 같이, 저산소 상태 하에서 NDRG3 발현이 억제된 세포의 경우 대조군에 비해 튜브 형성이 감소하는 것을 확인함으로써, NDRG3 결실이 저산소 반응으로 유도된 혈관생성 활성을 억제함을 확인하였다(도 13a). 또한, 저산소 상태에 있는 NDRG3 결실된 세포(도 13b, 왼쪽)에서는 신생혈관생성의 표지 인자인 IL8, IL1α 및 IL1β COX-2 및 PAI-1 mRNA의 발현이 현저하게 감소하는 반면, PHD2 결합 부위가 돌연변이된 NDRG3(N66D) 변이체가 과발현된 세포(도 13b, 오른쪽)에서 상기 인자의 mRNA 발현이 증가하는 것으로 확인함으로써, 저산소증 반응에서 NDRG3에 의해 신생혈관생성 인자의 발현이 증가하여 혈관생성을 활성이 촉진됨을 확인하였다(도 13a 및 도 13b).
또한, 도 13c에 나타낸 바와 같이, NDRG3의 발현이 억제된 세포를 이식한 마우스에서 헤모글로빈 농도가 감소하는 것을 확인함으로써, 상기 결과와 동일하게 생체 내에서 NDRG3에 의해 혈관생성이 촉진됨을 확인하였다(도 13c).
<6-3> 저산소 상태에서 NDRG3에 의한 세포증식 촉진 확인
상기 <6-1>의 분석으로 확인한 저산소증에서 NDRG3의 관련성이 높은 기능 중 세포증식에 있어서 NDRG3의 영향을 확인하기 위하여, MTT 분석법을 수행하여 세포성장을 분석하고, 생체내(in vivo) 이식한 종양 부피를 측정하고, 면역형광염색법, 웨스턴 블럿팅 및 RT-PCR을 수행하였다.
구체적으로, NDRG3 결실에 의한 세포성장을 확인하기 위하여 MTT 분석법을 수행하였다. 먼저, 상기 실시예 <6-1>에 기재된 방법으로 획득한 NDRG3 결실 Huh-1 세포 및 대조군 Huh-1 세포를 2,000 세포/웰의 개수로 96-웰(well) 플레이트(plaste)에 분주하고 37℃, 5 % CO2 배양기, 저산소 상태(3 % O2)에서 시간별로 배양하였다. 그 다음, PBS로 희석한 1 mg/ MTT 용액을 처리하여 2시간 동안 반응한 후, 상기 MTT가 포함된 배지를 제거하고 MTT 포르마잔 크리스탈(formazan crystal)을 용해하기 위하여 100 DMSO을 처리하였다. 그 다음, 흡광광도계로 570 nm 파장에서 흡광도를 측정하였다(도 14a).
또한, NDRG3 및 HIF 결실에 따른 종양 형성 정도를 확인하기 위하여 상기 실시예 <4-4> 및 <5-4>에 기재된 방법으로 제작한 NDRG3, HIF-1α, HIF-2α, NDRG3 및 HIF-1α, 또는 NDRG3 및 HIF-2α 발현이 억제된 Huh-7 세포(2×106 세포/100 ) 각각을 6 주된 암컷 BALB/c 마우스 옆구리의 피하에 투여하였다(도 14b). 또한, 상기 실시예 <4-3>에 기재된 방법으로 제작한 NDRG3(N66D) 변이체를 상기 <실시예 3>과 같이 형질전환한 Huh-1 세포(2×106 세포/100 ㎕)를 상기와 같이 마우스 옆구리의 피하에 투여하였다(도 14c). 그 다음, 투여 후 16일, 20일 뒤 종양의 크기를 각각 비교하기 위해 이미지화하였다(도 14b 및 도 14c).
또한, 상기 NDRG3, HIF-1α, HIF-2α, NDRG3 및 HIF-1α, 또는 NDRG3 및 HIF-2α 발현이 억제된 Huh-7 세포를 이식한 마우스(도 14d) 및 상기 NDRG3(N66D) 변이체가 과발현된 Huh-1 세포를 이식한 마우스(도 14e)에서 이식 후 주어진 시간에 캘리퍼(caliper)를 이용하여 종양의 부피를 측정하였다. 종양의 부피는 길이(a), 넓이(b) 및 높이(c)를 측정하여 하기 수학식 1과 같이 계산하여 그래프화하였다(도 14d 및 도 14e).
[수학식 1]
종양부피 = 종양길이(a)×종양넓이(b)×종양높이(c)/2
또한, 상기 NDRG3, HIF-1α 및 HIF-2α 발현이 억제된 Huh-7 세포(2×106 세포/100 )를 이식한 마우스의 종양 조직을 적출한 후, 상온에서 10 % 포르말린(formaline)으로 하루동안 고정하였다. 그 다음, 파라핀(parinffin)을 처리하고 4 섹션화하였다. 그 다음, 상온에서 5분 동안 0.3 % TritonX-100/PBS로 침투화하고 차단 용액(1 % BSA가 포함된 PBS)으로 30분 동안 배양한 후, 상기 실시예 <5-1>에 기재된 방법으로 일차 항체로 세포 증식 바이오마커인 Ki67 확인을 위한 항-ki67 항체 및 항-NDRG3으로 반응하고, 이차 항체[Alexa Flour 488-접합된 고트(goat) 항-레빗 IgG (1/1,000), 또는 Alexa Flour 594- 접합된 고트 항-마우스 IgG (1/1,000)] 및 DAPI로 반응 후 Zeiss LSM 510 공초점 현미경을 이용하여 시각화하였다(도 14f).
또한, 상기 NDRG3, HIF-1α 및 HIF-2α 발현이 억제된 Huh-7 세포(2×106 세포/100 ㎕)를 이식한 마우스의 종양 조직을 적출한 후 액체질소로 동결하였다. 그 다음, 상기 실시예 <4-2>에 기재된 방법으로 RT-PCR을 수행하여 mRNA의 발현을 확인하고, 상기 <실시예 2>에 기재된 방법으로 항-NDRG3 및 항-β액틴 항체로 웨스턴 블럿팅을 수행하여 단백질의 발현을 확인하였다(도 14g).
그 결과, 도 14a에 나타낸 바와 같이, 가벼운 저산소 상태에서 NDRG3이 결실된 세포의 경우 대조군에 비해 시간이 경과함에 따라 세포 성장이 감소하는 것을 확인하였다(도 14a).
또한, 도 14b 내지 도 14e에 나타낸 바와 같이, NDRG3 발현이 억제된 세포를 이식한 마우스의 종양 크기가 대조군 및 HIF 발현이 억제된 세포를 이식한 마우스에 비해 시간이 경과함에 따라 억제되고, 특히, NDRG3 및 HIF-1α 또는 -2a의 동시 결실된 세포를 이식한 마우스의 경우 종양이 생성되지 않는 것을 확인하였다(도 14b 및 도 14d). 반면, PHD2의 도킹 부위가 돌연변이된 NDRG3(N66D) 변이체를 과발현한 세포를 이식한 마우스의 종양 크기는 대조군에 비해 현저히 증가하고, 특히 이식 후 20일까지 대조군의 경우 종양이 형성되지 않는 반면 NDRG3(N66D) 변이체 과발현 세포 이식 마우스의 경우 약 900 mm3까지 종양 크기가 증가하는 것을 확인함으로써, NDRG3(N66D) 변이체에 의해 종양 성장이 촉진됨을 확인하였다(도 14b 내지 도 14e).
또한, 도 14f 및 도 14g에 나타낸 바와 같이, NDRG3 결실 세포 이식 마우스의 종양 조직의 경우 세포 증식 마커인 Ki-67의 단백질 발현이 억제됨을 확인하였다(도 14f). 또한, NDRG3 결실 세포 이식 마우스의 종양 조직에서 종양 혈관생성 마커인 IL8 및 CD31의 단백질 및 mRNA 발현이 억제되는 것을 확인하였다(도 14f 및 도 14g). 따라서, 상기 <실시예 6>의 결과들을 통해 NDRG3이 지속적인 저산소 상태에서 혈관생성 및 세포증식을 촉진하는데 중요한 역할을 함을 확인하였다.
< 실시예 7> NDRG3 - 매개된 저산소 반응에서 L-젖산(L-Lactate) 생성과 외인성 L-젖산 처리에 의한 영향 확인 및 NDRG3 측정을 통한 L-젖산의 정량
<7-1> 저산소 상태에서 NDRG3 단백질 축적 및 젖산 생성 확인
상기 실시예 <5-2>를 통해 확인한 장기 유도기(long lag periods)의 NDRG3 단백질 축적 및 분해는 NDRG3의 저산소성 발현 조절에 있어서 여러 단계가 관여함을 나타낸다. 따라서, 저산소증과 관련된 생화학적 특징 및 NDRG3의 관련성을 확인하기 위하여, 저산소 상태에서 젖산 생성 측정, 웨스턴 블럿팅 및 RT-PCR을 수행하고, NDRG3의 유비퀴틴화를 확인하기 위하여 시험관내(in-vitro) 유비퀴틴 분석법을 수행하였다.
구체적으로, MCF-7 세포를 상기 실시예 <5-2>와 같이 정상 산소 상태(21 % O2)에서 24시간 동안 유지 배양하거나 또는 저산소 상태(1 % O2)에서 시간별로 유지 배양한 후, 상기 <실시예 3>과 같이 세포를 회수하여 용해하였다. 그 다음, 상기 세포 용해물을 항-NDRG3, 항-HIF-1α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하고, EnzyChromTM L-젖산 분석법 키트(BioAssay Systems)를 이용하여 제조사의 절차에 따라 L-젖산(L-Lactate) 생성을 측정하여 그래프화하였다. 값은 L-젖산 표준 곡선으로 정규화하였고, 이를 통하여 세포내 NDRG3 단백질 발현양에 따른 젖산 함량을 산출할 수 있음을 확인하였다(도 15a).
또한, L-젖산 생성 억제가 NDRG3 단백질 발현에 미치는 영향을 확인하기 위하여 MCF-7 세포에 LDHA(lactate dehydrogenase A) 억제제인 소듐 옥사메이트(sodium oxamate)를 농도별로 처리하고 상기 실시예 <5-2>와 같이 저산소 상태(1 % O2)에서 24시간 동안 유지 배양한 후, 상기 <실시예 3>과 같이 세포를 회수하여 용해하였다. 그 다음, 상기와 같이 항-NDRG3, 항-HIF-1α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하고, L-젖산(L-Lactate) 생성을 측정하여 그래프화하였다. 값은 L-젖산 표준 곡선으로 정규화하였고, 이를 통하여 세포내 NDRG3 단백질 발현양에 따른 젖산 함량을 산출할 수 있음을 확인하였다(도 15b).
또한, L-젖산 생성 억제가 NDRG3 단백질 발현에 미치는 영향을 확인하기 위하여 상기 실시예 <4-2>에 기재된 방법으로 siLDHA(siGENOME SMARTpool, Dharmacon) 또는 siMCT4(siGENOME SMARTpool, Dharmacon)를 LDHA 또는 젖산 수출(export)에 관여하는 모노카복실레이트 수송체(monocarboxylate transproter)인 MCT4가 결실된 MCF-7 세포를 제작한 후, 상기 실시예 <5-2>와 같이 저산소 상태(1 % O2)에서 24시간 동안 유지 배양하고, 상기 <실시예 3>과 같이 세포를 회수하여 용해하였다. 그 다음, 상기와 같이 항-NDRG3, 항-HIF-1α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하고, L-젖산(L-Lactate) 생성을 측정하여 그래프화하였다(도 15c). 또한, LDHA 및 MCT4 결실을 확인하기 위하여 상기 실시예 <4-2>와 같이 RT-PCR을 수행하였다(도 15c).
또한, 해당과정 억제가 NDRG3 단백질 발현에 미치는 영향을 확인하기 위하여 MCF-7 세포에 해당과정을 억제하는 2-데옥시글루코오스(2-deoxyglucose, 2-DG)를 농도별로 처리하고 상기 실시예 <5-2>와 같이 저산소 상태(1 % O2)에서 24시간 동안 유지 배양한 후, 상기 <실시예 3>과 같이 세포를 회수 및 용해하고 항-NDRG3 및 항-β액틴을 이용하여 웨스턴 블럿팅을 수행하였다(도 15d).
또한, 과다한 젖산 생성에 의한 NDRG3 단백질의 발현을 확인하기 위하여 Flag-태그된 LDHA 발현 벡터를 제작한 후, 상기 <실시예 3>과 같이 HeLa 세포에 형질전환하고 정상 산소 상태(21 % O2) 하에 24시간 동안 유지 배양하였다. 그 다음, 추가적으로 피루베이트(pyruvate) 50 mM을 처리하고 가벼운 저산소 상태(3 % O2) 하에서 24시간 동안 유지 배양한 후, 세포를 회수 및 용해하고 항-NDRG3, 항-Flag 및 항-β액틴을 이용하여 웨스턴 블럿팅을 수행하였다(도 15e).
또한, 외인성으로 처리된 젖산에 의한 NDRG3 단백질의 발현을 확인하기 위하여 상기 실시예 <4-2>에 기재된 방법으로 siLDHA(siGENOME SMARTpool, Dharmacon)를 이용하여 LDHA가 결실된 Huh-1 세포를 제작한 후 L-젖산을 농도별로 처리한 뒤 상기 실시예 <5-2>와 같이 정상 산소 상태(21% O2), 저산소 상태(1% O2) 하에서 24시간 동안 유지 배양하고 상기 <실시예 3>과 같이 세포를 회수 및 용해하였다. 그 다음, 상기와 같이 항-NDRG3, 항-HIF-1α, 항-LDHA 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하고, NDRG3 단백질과 HIF-1α 단백질의 발현을 확인하였다(도 24). 또한 NDRG3 mRNA에 미치는 영향을 확인하기 위하여 상기 실시예 <4-2>와 같이 RT-PCR을 수행하였다(도 24).
또한, 옥사메이트를 처리하여 세포내 젖산을 제거한 후 외인성 젖산 처리에 의한 NDRG3 단백질의 발현을 파악하기 위하여 Huh-1 세포에 소듐 옥사메이트를 처리한 뒤 L-젖산을 농도별로 처리하고 상기 실시예 <5-2>와 같이 정상 산소 상태(21% O2), 저산소 상태(1% O2) 하에서 24시간 동안 유지 배양하고 상기 <실시예 3>과 같이 세포를 회수 및 용해하였다. 그 다음, 상기와 같이 항-NDRG3, 항-HIF-1α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하고, NDRG3 단백질과 HIF-1α 단백질의 발현을 확인하였다(도 25).
또한, 외인성 젖산 처리에 의한 작용이 젖산의 세포내 유입을 차단할 경우에도 유지되는지 확인하기 위하여 상기 실시예 <4-2>에 기재된 방법으로 siMCT(siGENOME SMARTpool, Dharmacon)를 이용하여 젖산 유입에 관여하는 MCT(monocarboxylate transporter) 1을 억제한 Huh-1세포를 제작한 후 L-젖산을 처리한 뒤 상기 실시예 <5-2>와 같이 정상 산소 상태(21% O2), 저산소 상태(1% O2) 하에서 24시간 동안 유지 배양하고 상기 <실시예 3>과 같이 세포를 회수 및 용해하였다. 그 다음, 상기와 같이 항-NDRG3, 항-HIF-1α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하고, NDRG3 단백질과 HIF-1α 단백질의 발현을 확인하였다(도 26).
또한, MCT(monocarboxylate transporter) 1의 억제에 의한 효과를 명확히 하기 위하여 상기와 같이 MCT 1을 억제한 Huh-1세포를 제작한 후 포도당 결핍 또는 옥사메이트 처리하여 세포내 젖산을 제거한 후 외인성으로 L-젖산을 처리한 뒤 상기 실시예 <5-2>와 같이 정상 산소 상태(21% O2) 하에서 24시간 동안 유지 배양하고 상기 <실시예 3>과 같이 세포를 회수 및 용해하였다. 그 다음, 상기와 같이 항-NDRG3, 항-HIF-1α 및 항-β-액틴을 이용하여 웨스턴 블럿팅을 수행하고, NDRG3 단백질과 HIF-1α 단백질의 발현을 확인하였다(도 27).
또한, 젖산 생성이 NDRG3의 유비퀴틴화에 미치는 영향을 확인하기 위하여 시험관내 유비퀴틴 분석법을 수행하였다. 먼저, Flag-태그된 PHD2 및 HA-태그된 VHL을 상기 <실시예 3>과 같이 HEK293T 세포에 형질전환한 후, 세포를 회수하여 용해하였다. 그 다음, 단백질 용해물(500 ㎍)을 항-HA 친화겔(Sigma) 또는 항-Flag 친화겔 (Sigma)를 이용하여 4℃에서 하루동안 반응하고 원심분리하여 재조합 PHD2 단백질들 또는 VHL 단백질들을 획득하였다. 그 다음, L-젖산(pH 7.0, 20 mM)을 처리 또는 무처리하고, 상기 재조합 PHD2/VHL-결합 단백질들, 상기 실시예 <4-1>에 기재된 방법으로 획득한 재조합 인간 NDRG3-GST(4 ㎍), 500 ng 유비퀴틴-활성 효소(ubiquitin-activating enzyme; E1, Upstate), 1 유비퀴틴-접합 효소(ubiquitin-conjugating enzyme; E2(UbcH5a), Upstate), 2.5 ㎍ 유비퀴틴-Flag (Sigma), 20 mM HEPES (pH 7.3), 5 mM MgCl2, 1 mM DTT, 및 2 mM ATP가 포함된 50 ㎕ 용액으로 37℃에서 1시간 동안 반응시겼다. 그 다음, 상기 혼합물을 GST-결합 아가로오스 레진으로 4℃에서 4시간 동안 배양한 후, 침전물을 세척하고 상기 <실시예3>과 같이 항-Flag을 이용하여 웨스턴 블럿팅을 수행하였다(도 15f).
그 결과, 도 15a 및 15b에 나타낸 바와 같이, 저산소 상태 초기단계에서 HIF-1α 단백질의 발현이 현저하게 증가한 후 감소하지만 젖산 생성 및 NDRG3 단백질의 축적은 저산소 상태가 지속될수록 현저하게 증가하는 것을 확인하였다(도 15a). 반대로, 소듐 옥사메이트를 처리하여 젖산 생성을 억제한 경우, NDRG3 단백질 축적이 젖산의 발현과 비례하게 억제되는 것을 확인함으로써(도 15b), 저산소 상태에서 NDRG3 단백질의 발현은 젖산 생성과 관련이 있음을 확인하였다(도 15a 및 도 15b).
또한, 도 15c 내지 도 15e에 나타낸 바와 같이, LDHA 결실 또는 2-데옥시글루코오스 처리를 통해 해당과정을 억제하여 젖산 생성이 억제된 경우, 저산소 상태에서 NDRG3 단백질의 발현이 감소하는 반면, MCT4 결실, 또는 LDHA 과발현 및/또는 피루베이트 포함 배지 공급을 통해 젖산이 증가될 경우, 저산소 상태에서 NDRG3 단백질의 축적이 증가하는 것을 확인함으로써, HIF 단백질의 저산성 유도와 달리, NDRG3 단백질 축적에 있어서 산소 결핍뿐만 아니라 해당화 젖산(glycolytic lactate) 생산이 추가적으로 요구됨을 확인하였다(도 15c 내지 도 15e).
또한, 도 24 내지 도 27에 나타낸 바와 같이, Huh-1 세포에 외인성으로 처리된 젖산이, LDHA결실로 발현이 감소되었던 NDRG3를 용량의존적으로 회복시켰고, HIF-1α단백질의 수준에는 영향을 미치지 않았으며(도 24), 이는 옥사메이트 처리(도 25)로 젖산생성을 억제한 경우에도 유사한 결과가 나타남을 확인하였다. 그러나 MCT1(세포외 젖산을 세포내로 수송하는 역할을 하는 monocarboxylate transporter)을 표적으로 하는 siRNA에 의해, 젖산 매개에 의한 NDRG3 발현의 회복효과는 없어졌고 이는 정상산소 조건이든 저산소 조건이든 무관하였으며(도 26), MCT1을 넉다운(knockdown)시킨 Huh-1 세포에 포도당 결핍 또는 옥사메이트 처리한 경우에도 유사한 효과가 나타남을 확인하였다(도 27).
또한, 도 15f에 나타낸 바와 같이, 젖산을 처리한 경우 PHD2/VHL 복합체에 의한 재조합 NDRG3 단백질의 유비퀴틴화가 감소되는 것을 확인함으로써, 저산소 상태 하에 젖산 생성으로 NDRG3 단백질의 유비퀴틴화가 억제되고 세포내에서 축적됨을 확인하였다(도 15f).
<7-2> 저산소 상태에서 NDRG3 및 젖산의 결합 확인
산소 상태에 따른 젖산 및 NDRG3 단백질의 상호작용을 확인하기 위하여, NDRG3 재조합 단백질 및 부위-지정 돌연변이를 이용하여 NDRG3 변이체 재조합 단백질을 제작하고 이를 이용하여 시험관내(in-vitro) 결합 분석법(binding assay), 면역염색 및 웨스턴 블럿팅을 수행하였다.
구체적으로, L-젖산 및 NDRG3 단백질의 상호작용을 확인하기 위하여 상기 실시예 <4-1>에 기재된 방법으로 클로닝한 pGEX-4T-2-NDRG3을 주형으로 하기 표 4의 프라이머를 이용하여 상기 실시예 <4-3>과 같이 부위-지정 돌연변이를 수행하여 NDRG3의 L-젖산 결합부위 중 138번째 아미노산인 글리신(Glycine, G)을 트립토판(Tryptophan, W)으로 치환된 pGEX-4T-2-NDRG3(G138W) 변이체 컨스트럭트를 획득하였다. 그 다음, 상기 제조된 재조합 단백질의 발현을 위하여, 상기 재조합 플라스미드 pGEX-4T-2-NDRG3 야생형 및 -NDRG3(G138W)를 대장균 균주 BL21에 형질전환하고, 상기 <실시예 2>와 같이 GST-결합 아가로오스 레진을 이용하여 정제하였다. 그 다음, 상기 <실시예 3>과 같이 9 % SDS-PAGE로 전기영동한 후, 쿠마쉬 브릴리언트 블루로 염색하여 검출을 확인하고, 재조합 단백질의 발현을 확인하기 위하여 항-GST 및 항-NDRG3 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 16a).
프라이머 서열
NDRG3(G138W) 센스 GTTTGGGCTGGAGCTTACATCCTCAGC(서열번호 25)
안티센스 TCCAATTCCAATGATGCTTTTCAGGCT(서열번호 26)
또한, L-젖산 및 NDRG3 단백질의 상호작용을 확인하기 위하여 시험관내 결합 분석법을 수행하였다. GST 또는 상기 GST-NDRG3 재조합 단백질(50μg)을 30℃에서 1시간 동안 비표지된 L-젖산(pH 7.0, Sigma) 및 L-[14C]-젖산(PerkinElmer) 0.5 μCi와 함께 반응시켰다. 그 다음, GST-결합 아가로오즈 레진을 첨가하여 4시간 동안 반응한 후 상기 반응 혼합물에서 NDRG3-GST 단백질이 결합된 레진을 획득한 후, PBS로 불순물을 제거한 다음, 상기 NDRG3 결합된 아가로오스 레진을 2 ㎖ LSC-칵테일(PerkinElmer)이 포함된 섬광 용액으로 옮기어 14C 값을 측정하여 그래프화하였다(도 16b, 왼쪽). 또한, GST, 상기 GST-NDRG3 재조합 단백질(50 ㎍) 또는 상기 GST-NDRG3(G138W) 변이체 재조합 단백질(50 ㎍)을 30℃에서 1시간 동안 L-[14C]-젖산(PerkinElmer) 0.5 μCi과 반응한 후, 상기와 동일한 방법으로 14C 값을 측정하여 그래프화하였다(도 16b, 오른쪽).
또한, 저산소 상태에서 L-젖산 및 NDRG3 단백질의 결합부위와의 상호작용을 확인하기 위하여 NDRG3 변이체를 제작하였다. 먼저, Myc-태그된 NDRG3 발현 벡터를 주형으로 상기 실시예 <4-3>과 같이 부위-지정 돌연변이를 수행하여 NDRG3의 L-젖산 결합부위 중 62번째 아미노산인 아스파르트산(Asp, D)을 류신(Leu, L)으로 치환한 Myc-NDRG3(D62L) 변이체, NDRG3의 L-젖산 결합부위 중 138번째 아미노산인 글리신(G)을 아르기닌(Arg, R)으로 치환한 Myc-NDRG3(G138W) 변이체, NDRG3의 L-젖산 결합부위 중 139번째 아미노산인 알라닌(Ala, A)을 글루탐산(Glu, E)으로 치환한 Myc-NDRG3(A139E) 변이체 및 NDRG3의 L-젖산 결합부위 중 229번째 아미노산인 타이로신(Tyr, Y)을 프롤린(Pro, P)으로 치환한 Myc-NDRG3(Y229P) 변이체를 획득하였다. 그 다음, 상기 Myc-NDRG3 및 Myc-NDRG3 변이체 각각을 HEK293T 세포에 상기 <실시예 3>과 같이 형질전환한 후, 상기 실시예 <5-2>와 같이 정상 산소 상태(21 % O2), 저산소 상태(1 % O2), 또는 20 μM MG132 처리 후 저산소 상태(1 % O2) 하에서 24시간 동안 유지 배양하고 세포를 회수 및 용해하였다. 그 다음, 상기 세포 용해물을 항-Myc 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 16c).
또한, 저산소 상태에서 정상 산소 상태로 회복될 때 NDRG3 단백질의 발현을 확인하기 위하여 MCF-7 세포를 저산소 상태(1 % O2) 하에서 24시간 동안 유지 배양한 후, 새로운 배지로 교체하고 추가적으로 정상 산소 상태(21 % O2) 하에서 시간별로 유지 배양하고 상기 <실시예 3>과 같이 세포를 회수 및 용해하였다. 그 다음, 상기 세포 용해물을 항-NDRG3, 항-HIF-1α 및 항-β-액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 16d).
그 결과, 도 16a 내지 16c에 나타낸 바와 같이, NDRG3 및 NDRG3의 젖산 결합 부위가 돌연변이된 NDRG3(G138W) 변이체의 재조합 단백질의 발현을 확인하였고(도 16a), 시험관 내에서 NDRG3 재조합 단백질의 경우 젖산과의 결합이 증가하고(도 16b, 왼쪽), NDRG3 변이체의 경우 젖산-결합력이 감소하는 것을 확인하였다(도 16b, 오른쪽). 또한, 저산소 상태에서 정상적인 NDRG3는 단백질의 축적이 증가하는 반면, NDRG3의 젖산 결합 부위를 돌연변이한 변이체 모두 저산소 상태에서 단백질 축적이 감소하는 것을 확인함으로써(도 16c), 저산소 상태에서 NDRG3이 젖산과 결합하고, 이는 NDRG3 단백질의 축적과 관련이 있음을 확인하였다(도 16a 내지 도 16c).
또한, 도 16d에 나타낸 바와 같이, HIF-1α 단백질은 재산소화(reoxygenation)되면 빠르게 제거되지만, 반면 저산소 상태에서 NDRG3 젖산 복합체를 이루어 축적된 NDRG3 단백질은 정상 산소 상태로 회복되어도 세포에서 안정하게 유지되는 것을 확인하였다(도 16d). 따라서, 상기 <실시예 7>의 결과들을 통해 저산소-유도된 젖산이 지속적인 저산소 반응에 있어서 NDRG3의 센서로 작용하여 NDRG3에 의한 HIF-비의존적 생물학적 반응이 촉진됨을 확인하였다.
< 실시예 8> 저산소 반응에서 젖산-의존적 NDRG3의 기능 확인
<8-1> 저산소 반응에서 NDRG3에 의한 젖산-의존적 세포성장 촉진 확인
저산소 상태에서 젖산-의존적 세포성장에 있어서 NDRG3이 미치는 영향을 확인하기 위하여, NDRG3 변이체 및 젖산 생성이 억제된 세포를 이용하여 MTT 분석법, 콜로니 형성 분석법(colony forming assay) 및 생체내(in vivo) 이식한 종양의 부피를 측정을 수행하였다.
구체적으로, 젖산 생성 억제 후 이소성(ectopic) 변이체 NDRG3(N66D)가 세포성장에 미치는 영향을 확인하기 위하여 상기 실시예 <4-3>과 같이 이소성 변이체 NDRG3(N66D) 발현 벡터를 Huh-1 세포에 형질전환한 후, 96-웰 플레이트에 Huh-1 세포 및 상기 NDRG3(N66D) 변이체 과발현 Huh-1 세포 1,000 세포/웰로 배양하고, 농도별로 소듐 옥사메이트를 처리하고 가벼운 저산소 상태(3 % O2) 하에서 시간별로 유지 배양하였다. 그 다음, 세포 성장을 확인하기 위하여 상기 실시예 <6-3>과 같이 MTT 분석법을 수행하여 그래프화하였다(도 17a).
또한, 젖산 생성 억제 후 이소성 변이체 NDRG3(N66D)가 세포성장에 미치는 영향을 확인하기 위하여 콜로니 형성 분석법을 수행하였다. 6-웰 플레이트에 Huh-1 세포 및 상기 NDRG3(N66D) 변이체 과발현 Huh-1 세포 0.5×104 세포/2 ㎖로 접종한 후, 소듐 옥사메이트 40 mM을 처리 또는 무처리하고 정상 산소 상태(21 % O2) 하에서 3일 마다 새로운 배지로 희석하면서 10일 동안 배양하였다. 배양 10일 후 형성된 콜로니를 확인하여 100 % 메틸 알코올(methyl alcohol)로 고정한 다음, 30 % 김사 염색 용액(giemsa stain solution; Sigma)으로 염색하여 계수하였다(도 17b).
또한, 저산소 상태에서 LDHA 결실에 의한 젖산 생성 억제 후 이소성 변이체 NDRG3(N66D)가 세포성장에 미치는 영향을 확인하기 위하여 MTT 분석법을 수행하였다. 먼저, 상기 실시예 <4-4>에 기재된 방법으로 LDHA가 결실된 Huh-1 세포를 제작한 후, 상기 <실시예 3>과 같이 NDRG3(N66D) 변이체 발현벡터로 형질전환하여, LDHA 결실 및 NDRG3(N66D) 변이체 과발현 Huh-1 세포를 획득하였다. 그 다음, 대조군 GFP 결실 Huh-1 세포, 상기 LDHA 결실 Huh-1 세포 및 상기 LDHA 결실/NDRG3(N66D) 과발현 Huh-1 세포를 96-웰 플레이트에 1,000 세포/웰로 배양하고, 가벼운 저산소 상태(3 % O2) 하에서 시간별로 유지 배양하였다. 그 다음, 세포 성장을 확인하기 위하여 상기 실시예 <6-3>과 같이 MTT 분석법을 수행하여 그래프화하였다(도 17c).
또한, 생체 내에서 LDHA 결실에 의한 젖산 생성 억제 후 이소성 변이체 NDRG3(N66D)가 세포성장에 미치는 영향을 확인하기 위하여 마우스에 종양세포를 이식 후 종양 부피를 측정하였다. 상기 대조군 GFP 결실 Huh-1 세포, 상기 LDHA 결실 Huh-1 세포 및 상기 LDHA 결실/NDRG3(N66D) 과발현 Huh-1 세포를 상기 실시예 <6-3>에 기재된 방법으로 BALB/c 마우스에 이식한 후, 주어진 시간에 캘리퍼를 이용하여 종양부피를 측정하여 그래프화하였다(도 17d).
또한, 지속적인 저산소 상태에서 젖산 생성 억제가 이소성 변이체 NDRG3(N66D) 단백질 발현에 미치는 영향을 확인하기 위하여 Huh-1 세포 및 상기 NDRG3(N66D) 변이체 과발현 Huh-1 세포에 소듐 옥사메이트 40 mM을 처리 또는 무처리하고 가벼운 저산소 상태 하에서 시간별로 유지 배양한 후 상기 <실시예 3>과 같이 세포를 회수 및 용해하였다. 그 다음, 상기 세포 용해물을 항-NDRG3 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 17e).
또한, 지속적인 저산소 상태에서 젖산 생성에 있어서 이소성 변이체 NDRG3(N66D)의 영향을 확인하기 위하여 상기와 같이 소듐 옥사메이트를 처리 또는 무처리하고 가벼운 저산소 상태 하에서 시간별로 유지 배양한 Huh-1 세포 및 상기 NDRG3(N66D) 변이체 과발현 Huh-1 세포를 회수하여 상기 실시예 <7-1>에 기재된 방법으로 L-젖산(L-Lactate) 생성을 측정하여 그래프화하였다. 값은 L-젖산 표준 곡선으로 정규화하였다(도 17f).
그 결과, 도 17a 내지 17d에 나타낸 바와 같이, 저산소 상태에서 소듐 옥사메이트를 처리한 경우 농도 의존적으로 세포 성장이 억제되는 반면, NDRG3의 이소성 변이체가 과발현된 경우 저산소 상태에서 소듐 옥사메이트를 처리하여도 세포 성장이 증가하는 것을 확인하였다(도 17a). 정상 산소 상태에서도 젖산 생성이 억제되어도 NDRG3 이소성 변이체가 과발현된 경우 저산소 상태와 마찬가지로 종양 성장이 촉진되는 것을 확인하였다(도 17b). 또한, LDHA 결실을 통해 젖산 생성을 저해한 경우 시험관 내에서 및 생체 내에서 종양 성장이 억제되는 반면, LDHA가 결실되어도 NDRG3 이소성 변이체가 과발현된 경우에는 종양 성장이 현저하게 증가하는 것을 확인하였다(도 17c 및 17d).
또한, 도 17e 및 도 17f에 나타낸 바와 같이, 저산소 상태에서 소듐 옥사메이트를 처리하여 젖산 생성을 억제한 경우 NDRG3의 축적이 억제되는 반면, NDRG3 이소성 변이체가 과발현된 경우 젖산 생성 억제에도 불구하고 NDRG3 변이체의 축적이 지속되는 것을 확인하였다(도 17e). 또한, 저산소 상태에서 소듐 옥사메이트를 처리한 경우 무처리한 경우 모두 NDRG3 이소성 변이체가 과발현되어도 젖산 생성에는 변화가 없는 것을 확인함으로써, NDRG3 이소성 변이체는 젖산 생산에 직접적인 효과가 없음을 확인하였다(도 17f). 따라서, 상기 결과를 통해 지속적인 저산소 상태에서 젖산-유도된 세포성장에 있어서 NDRG3이 중요한 매개자임을 확인하였다.
<8-2> 저산소 반응에서 NDRG3에 의한 젖산-의존적 혈관생성 촉진 확인
저산소 상태에서 젖산-의존적 혈관생성에 있어서 NDRG3이 미치는 영향을 확인하기 위하여, NDRG3 변이체 이소성 변이체 과발현 세포를 이용하여 튜브 형성 분석법을 수행하였다.
구체적으로, NDRG3(N66D) 변이체가 과발현된 Huh-1 세포를 제작한 후, 대조군 세포 및 상기 NDRG3(N66D) 변이체 과발현 Huh-1 세포에 소듐 옥사메이트를 처리 또는 무처리하고 저산소 상태(1 % O2) 하에서 24시간 동안 유지 배양한 후 상기 실시예 <6-2>와 같이 세포를 회수하여 튜브 형성 분석법을 수행하였다(도 18).
그 결과, 도 18에 나타낸 바와 같이, 소듐 옥사메이트를 처리하여 젖산 생성을 억제한 경우 저산소 상태에서 혈관생성이 억제되는 반면, NDRG3 이소성 변이체가 과발현된 경우 젖산 생성을 억제하여도 저산소 상태에서 혈관생성이 다시 증가하는 것을 확인함으로써, NDRG3이 지속적인 저산소 상태에서 젖산-유도된 혈관생성에 중요한 매개자임을 확인하였다(도 18). 따라서, 상기 <실시예 8>의 결과를 통해 젖산은 저산소성 세포증식 및 혈관생성의 중요한 신호이며, NDRG3이 지속적인 저산소 상태에서 젖산-유도된 세포증식 및 혈관생성의 중요한 매개자로 작용함을 확인하였다.
< 실시예 9> NDRG3 - 매개된 저산소 반응의 분자적 조절 확인
<9-1> 저산소 상태에서 NDRG3에 의한 c- Raf - ERK 활성 조절 확인
저산소 상태에서 젖산-유도된 분자적 반응에서 NDRG3의 역할을 확인하기 위하여, 시험관내 키나아제 분석법(in-vitro kinase assay), 풀-다운 분석법, 면역침전법 및 웨스턴 블럿팅을 수행하였다.
구체적으로, 상기 실시예 <4-4>에 기재된 방법으로 대조군 shGFP 또는 shNDRG3을 이용하여 GFP 또는 NDRG3 결실 PLC/PRF/5 세포를 제작한 후, 상기 세포를 저산소 상태(1 % O2) 하에서 24시간 동안 유지 배양하고 상기 <실시예 3>과 같이 세포를 회수하였다. 그 다음, 인간 인산화-키나아제 어레이 키트(Human Phospho-Kinase Array kit)를 이용하여 제조사의 절차에 따라 인산화된 단백질을 확인하였다(도 19a).
또한, NDRG3의 발현 정도에 따른 분자적 조절 기능을 확인하기 위하여 Huh-1, Huh-7 및 786-O 세포를 정상 산소 상태(21 % O2) 하에서 24시간 동안 유지 배양한 후, 상기 <실시예 3>과 같이 세포를 회수 및 용해하고, 항-NDRG3, 항-인산화-ERK1/2, 항-ERK1/2 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 19b).
또한, 저산소 상태에서 NDRG3의 분자적 기능을 확인하기 위하여 상기 실시예 <4-4>에 기재된 방법으로 대조군 shGFP 또는 shNDRG3을 이용하여 GFP 또는 NDRG3 결실 SK-HEP-1 세포를 제작한 후, 상기 세포를 저산소 상태 하에서 시간별로 유지 배양하고 상기 <실시예 3>과 같이 세포를 회수 및 용해하고, 항-인산화-ERK1/2, 항-ERK1/2 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 19c, 위). 또한, 상기 제작한 세포를 저산소 상태 하에서 24시간 동안 유지 배양하고 상기 <실시예 3>과 같이 세포를 회수 및 용해하고, 항-NDRG3, 항-인산화-c-Raf(S338), 항-c-Raf, 항-인산화-B-RAF1(S445), 항-B-RAF1, 항-인산화-A-RAF(S299), 항-A-RAF 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 19c, 아래).
또한, 시험관 내에서 저산소 반응에 의한 NDRG3 및 c-Raf의 상호작용을 확인하기 위하여 먼저 c-Raf를 암호화하는 재조합 플라스미드 pET-28a-c-Raf 컨스트럭트를 클로닝하였다. 그 다음, 상기 실시예 <7-1>과 같이 상기 c-Raf 발현 벡터를 BL21 대장균 균주에 형질전환하여 재조합 단백질을 획득한 후, 상기 c-Raf 재조합 단백질은 Ni-NTA 아가로오스 레진을 이용하여 제조사의 절차에 따라 정제하였다. 그 다음, 상기 실시예 <4-1>과 같이 상기 정제된 재조합 단백질 c-Raf-His 및 NDRG3-GST를 Ni-NTA 아가로오스 레진과 함께 반응시켜 His 풀-다운을 수행한 후, 상기 <실시예 3>과 같이 항-NDRG3 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 19d, 왼쪽). 또한, Flag-태그된 c-Raf 발현 벡터를 클로닝한 후, 상기 Flag-태그된 c-Raf 벡터를 상기 <실시예 3>과 같이 HeLa 세포에 형질전환 하였다. 그 다음, 상기 Flag-c-Raf 과발현된 HeLa 세포를 저산소 상태(1 % O2) 하에서 24시간 동안 유지 배양한 후, 항-FLAG M2 비드를 이용하여 면역침전하고 항-NDRG3 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 19d, 오른쪽).
또한, 저산소 상태에서 NDRG3의 분자적 기능을 확인하기 위하여 상기 실시예 <4-2>와 같이 4 종류의 siNDRG3(siGENOME SMARTpool, Dharmacon)(서열번호 5 내지 서열번호 8)를 이용하여 NDRG3의 발현이 억제된 SK-HEP-1 세포를 제작하고, Flag-태그된 c-Raf 발현 벡터를 이용하여 상기 <실시예 3>과 같이 형질전환하여 NDRG3 결실/c-Raf 과발현 세포를 획득하였다. 또한, Myc-태그된 NDRG3(N66D) 및 Flag-태그된 c-Raf 발현 벡터를 이용하여 상기 <실시예 3>과 같이 형질전환하여 NDRG3(N66D) 및 c-Raf 과발현 HEK293T 세포를 획득하였다. 그 다음, 상기 세포들을 정상 산소 상태(21 % O2)에서 24시간 동안 유지 배양하고, 상기 <실시예 3>과 같이 세포를 회수 및 용해한 후, 항-NDRG3, 항-인산화-c-Raf(S338), 항-c-Raf, 항-인산화-B-RAF1(S445), 항-B-RAF1, 항-인산화-ERK1/2, 항-ERK1/2 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 19e).
또한, 저산소 상태에서 NDRG3에 의한 인산화를 확인하기 위하여 [-32P]-ATP(PerkinElmer) 표지를 이용하여 시험관내 키나아제 분석법을 수행하였다. 먼저, 상기 <실시예 3>과 같이 Myc-태그된 NDRG3(N66D) 발현 벡터로 형질전환된 HEK293T 세포를 제작한 후, 항-Myc 친화 겔을 이용하여 NDRG3 단백질을 면역침전하였다. 그 다음, 방사선 표지를 위하여 상기 면역침전된 NDRG3 복합체에 하고 PKC 억제제인 PKC-1 5 μM을 처리 또는 무처리하고 40 ㎕ 반응 버퍼[PKC 활성 버퍼 및 SignaTECT 단백질 키나아제 C 분석 키트(Promega)에 포함된 PKC 공동활성 버퍼, 10 μCi의 [-32P]-ATP, 및 2 ㎍의 정제된 c-Raf-GST 재조합 단백질]로 30℃에서 1시간 동안 반응하였다. 그 다음, 상기 반응 혼합물을 8 % SDS-PAGE로 전기영동하고 32P-표지된 c-Raf는 자가방사선법(autoradiography)으로 검출하였다(도 19f).
또한, 저산소 상태에서 NDRG3-매개된 분자적 경로 활성의 젖산 의존성을 확인하기 위하여 MCF-7 세포를 정상 상태(21 % O2) 하에서 24시간 동안 유지 배양하고, 및 상기 실시예 <7-1>에 기재된 방법으로 획득한 LDHA 발현 억제된 MCF-7 세포, 소듐 옥사메이트를 처리 또는 무처리한 세포를 저산소 상태(1 % O2) 하에서 24시간 동안 유지 배양하였다. 그 다음, 상기 <실시예 3>과 같이 세포를 회수 및 용해한 후, 항-NDRG3, 항-인산화-c-Raf(S338), 항-c-Raf, 항-인산화-ERK1/2, 항-ERK1/2 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 19g).
그 결과, 도 19a 내지 도 19d에 나타낸 바와 같이, NDRG3이 결실된 경우 지속적인 저산소 상태에서 ERK1/2의 인산화가 감소하며(도 19a, 및 도 19c, 위), 정상 산소 상태에서 NDRG3 단백질의 발현이 서로 다른 여러 종류의 세포에서 NDRG3 단백질의 발현정도에 비례적으로 ERK1/2의 인산화 수준이 차이가 남을 확인함으로써(도 19b), 지속적인 저산소 반응에서 NDRG3이 ERK1/2를 활성화함을 확인하였다. 또한, NDRG3이 결실된 경우 저산소 상태가 지속될수록 ERK1/2 인산화뿐만 아니라, c-Raf 및 B-RAF1의 인산화도 억제되고(도 19c, 아래), 시험관 내에서(19d, 왼쪽) 및 세포 내에서 저산소 반응으로(19d, 오른쪽) NDRG3과 c-Raf가 상호작용하는 것을 확인함으로써, NDRG3이 저산소 상태에서 ERK 및 c-Raf의 활성화에 관여함을 확인하였다(도 19a 내지 도 19d).
또한, 도 19e 및 도 19f에 나타낸 바와 같이, 이소성 변이체인 NDRG3(N66D)가 과발현된 경우 정상 산소 상태에서도 ERK1/2 및 c-Raf의 인산화가 유도되고(도 19e), 시험관 내에서도 NDRG3 이소성 변이체 분자적 복합체가 재조합 c-Raf 단백질의 인산화를 매개함을 확인하였다(도 19f).
또한, 도 19g에 나타낸 바와 같이, 저산소 상태에서 젖산 생성을 억제한 경우 NDRG3 단백질의 발현도 억제되고, c-Raf-ERK 경로의 활성이 억제되는 것을 확인하였다(도 19g). 따라서, 상기 결과들을 통해 NDRG3이 저산소 반응에서 젖산에 의해 유도된 c-Raf-ERK 신호 활성의 필수 매개자로서 역할을 함을 확인하였다.
<9-2> 저산소 상태에서 NDRG3에 의한 키나아제 경로 조절 확인
RACK1은 PKC에 대한 스캐폴드 단백질(scaffold protein)로서 활성화 형태변환(active conformation)을 유지하는 것으로 잘 알려져 있고(Lendahl, U. et al., Nat. Rev. Genet., 2009(10), 821-832), PKC는 c-Raf를 인산화하고 활성화하는 것으로 보고되고 있다(Epstein, A. C. et al., Cell, 2001(107), 43-54, Mahon, P. c. et al., Genes Dev, 2001(15), 2675-2686). 따라서, 저산소 상태에서 NDRG3에 의한 키나아제 경로 활성에 있어서 RACK1의 관련성을 확인하기 위하여, 면역침전법, 웨스턴 블럿팅을 수행하고, NDRG3과 키나아제 경로에 관여하는 단백질들 간의 복합체 형성을 확인하기 위하여 단백질 구조 모델링을 수행하였다.
구체적으로, NDRG3과 RACK1의 상호작용을 확인하기 위하여 NDRG3 및/또는 Flag-태그된 RACK1 발현 벡터를 상기 <실시예 3>과 같이 HeLa 세포에 형질전환하고 정상 산소 상태(21 % O2) 하에서 20 μM MG132를 8시간 동안 처리하여 배양한 후, 세포를 회수 및 용해하고, 항-FLAG M2 비드를 이용하여 면역침전하였다. 그 다음, RACK-1와 결합한 NDRG3을 확인하기 위하여 항-NDRG3 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 20a).
또한, NDRG3에 의한 키나아제 경로에 관여하는 단백질 간의 관계를 확인하기 위하여 상기 실시예 <9-1>과 같이 C-Raf, RACK1 과발현 및/또는 NDRG3 결실 HEK293T 세포, 및 c-Raf, RACK1 및/또는 NDRG3(N66D) 과발현 HEK293T 세포에 PKC-I(LY333531) 5 μM을 처리 또는 무처리하여 정상 산소 상태 하에서 24시간 동안 유지 배양한 후, 상기 <실시예 3>과 같이 세포를 회수 및 용해하고 항-NDRG3, 항-인산화-c-Raf(S338), 항-c-Raf, 항-인산화-ERK1/2, 항-ERK1/2, 항-RACK1 및 항-β액틴 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 20b).
또한, 저산소 상태에서 NDRG3에 의한 키나아제 경로에 관여하는 단백질 간의 관계를 확인하기 위하여 Myc-NDRG3(N66D) 발현벡터 및/또는 siRACK1(siGENOME SMARTpool, Dharmacon)을 이용하여 NDRG3(N66D) 과발현 및/또는 RACK1 결실 HeLa 세포를 제작하고 저산소 상태(1 % O2) 하에서 24시간 동안 유지 배양한 후, 상기 <실시예 3>과 같이 항-Myc 친화겔을 이용하여 면역침전하고 항-PKC-β-항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 20c).
또한, 저산소 상태에서 PKC가 ERK 활성화에 미치는 영향을 확인하기 위하여 HeLa 세포를 정산 산소 상태(21 % O2) 하에서, 또는 PKC 억제제인 PKC-I(GO; GO 6976) 1 μM 또는 PKC-I(LY; LY333531) 5 μM을 처리하고 저산소 상태(1 % O2) 하에서 24시간 동안 유지 배양한 후, 상기 <실시예 3>과 같이 세포를 회수 및 용해하고 항-인산화-ERK1/2 및 항-ERK1/2 항체를 이용하여 웨스턴 블럿팅을 수행하엿다(도 20d).
또한, 저산소 상태에서 NDRG3-cRaf-RACK1-PKC-β-복합체의 형성을 확인하기 위하여 Flag-c-Raf 및 Flag-RACK1 발현 벡터, 및/또는 Myc-NDRG3(N66D) 발현벡터를 상기 <실시예 3>과 같이 HEK293T 세포에 형질전환하고 정상 산소 상태 하에서 24기산 동안 유지 배양한 후 세포를 회수 및 용해하였다. 그 다음, 항-Myc 친화 겔을 이용하여 면역침전한 후 SDS-PAGE로 전기영동한 후 항-Flag, 항-Myc 및 항-PKC-β항체를 이용하여 웨스턴 블럿팅을 수행하엿다(도 20e).
또한, 저산소 상태에서 NDRG3-cRaf-RACK1-PKC-β복합체의 형성을 확인하기 위하여 상기 실시예 <4-3>과 같이 단백질 도킹 시뮬레이션을 수행하였다. 다중 표적 구조를 위한 도킹(즉, NDRG3, RAF1, RACK1(GNB2L1) 및 PKC-β)은 두-단계 실험을 통해 수행되었다. 첫 단계에서는, NDRG3이 각각의 표적을 위한 도킹 실험에서 수용체 단백질로서 사용되었다. 두 번째 단계에서는, 결과물 단백질-단백질 상호작용이 다른 단백질의 도킹을 위한 수용체 단백질로서 사용되었다. 두 번째 실험을 위한 입력값(input order)는 순서대로 c-Raf, RACK1 및 PKC-β로 하였다. 도킹 계산은 RMSD(root-mean-square deviation)에 의해 수행되었고 결과는 단일 입력으로부터의 산출값이 다중 입력으로부터의 산출값과 일치하는 곳에서 필터링하였다. 필터링된 결과값 중에서, 가장 안정된 하나를 HEX6.3 총 점수(모양 점수 및 전정기학 점수의 합)를 이용하여 선택하였다(도 20f, 위), 또한, 단백질 구조 모델링을 위하여 하기의 일련의 과정을 수행하였다. 첫 단계에서, PDB(protein data bank) 서열 데이터베이스에서 잘 알려진 구조로부터 상동성 모델링에 사용되는 주형 후보를 찾기 위해 단백질-단백질 BLAST(BLASTp) 검색을 수행하고, 10-3보다 작은 p-값을 가지는 것 중에서 가장 일치도(identity scores)가 높은 하나를 확인하였다. 두번째 단계에서, 정렬 과정(alignment process)를 수행하기 위하여 BLAST를 수행하고, 구조에 있어서 제한된 공간(restrained spaces)을 확인하였다. 세번째 단계에서, 단백질 구조의 예측이 잘 알려진 상동성 모델링 프로그램인 Modeller 9v10 (N. Eswar, M. A. et al., Current Protocols in Bioinformatics, John Wiley & Sons, Inc., Supplement 15, 5.6.1-5.6.30, 2006)을 이용하여 수행되었고, 마지막으로, 가장 좋은 단백질 모델을 DOPE(Discrete Optimized Protein Energy) 평가방법(Shen MY, et al., Protein Sci. 2006 Nov;15(11):2507-24)에 기반하여 선택하였다(도 20f, 아래).
그 결과, 도 20a 내지 도 20d에 나타낸 바와 같이, RACK1이 NDRG3과 상호작용하는 것을 확인하였다(도 20a). 또한, RACK1이 과발현되어도 NDRG3이 결실된 경우 c-Raf 및 ERK1/2 인산화가 억제되는 반면 NDRG3(N66D) 변이체가 과발현된 경우 c-Raf 및 ERK1/2 인산화가 증가하고, RACK1 및 NDRG3(N66D) 단백질이 과발현되어도 PKC의 활성이 억제된 경우 c-Raf 및 ERK1/2의 인산화가 억제되는 것을 확인하였다(도 20b). 특히, 저산소 상태에서 RACK1이 결실된 경우 NDRG3과 PKC의 상호작용이 억제되고(도 20c), PKC 억제제에 의해 PKC의 활성이 억제된 경우 저산소 상태에서 ERK1/2의 인산화가 억제되는 것을 확인함으로써(도 20d), 저산소 상태에서 NDRG3이 RACK1 및 PKC-β와 상호작용하여 c-Raf-ERK 인산화를 촉진하는 것을 확인하였다(도 20a 내지 도 20d).
또한, 도 20e 및 도 20f에 나타낸 바와 같이 세포 내에서 NDRG3이 c-Raf, RACK1 및 PKC-β와 복합체를 형성하여 존재하고(도 20e), 도킹 스뮬레이션을 및 단백질 구조 모델링을 통해 NDRG3-c-Raf-RACK1-PKC-β 4차(quaternary) 복합체 형성의 유연성을 확인하였다(도 20f). 따라서 상기 <실시예 10>의 결과들을 통해 NDRG3이 RACK1와 상호작용하고, 이를 통해 NDRG3-RACK1 복합체에 유도되는 PKCβ에 의한 c-Raf가 인산화되며, 따라서 젖산에 의해서 조절된 NDRG3이 c-Raf 및 RACK1의 스캐폴드 단백질임을 확인하였다.
< 실시예 10> NDRG3 발현에 따른 병리학적 변화 확인
<10-1> NDRG3 과발현 형질전환 마우스에서 종양 형성 및 신생혈관생성 촉진 확인
병리학적으로 NDRG3의 발현이 미치는 영향을 확인하기 위하여, NDRG3 과발현 형질전환 마우스를 이용하여 면역조직화학적 분석법(immunohistochemical analysis)을 수행하여 종양 형성을 확인하고, NDRG3의 발현 및 활성화된 ERK1/2 단백질의 발현을 확인하기 위하여 웨스턴 블럿팅, 유전자 발현 변화를 확인하기 위하여 RT-PCR을 수행하였다.
구체적으로, NDRG3 과발현이 종양 형성에 미치는 영향을 확인하기 위하여 상기 <실시예 1>에 기재된 방법으로 NDRG3 유전자가 전체적으로 과발현되도록 제작된 NDRG3 과발현 형질전환 C57/BL6 마우스 (40마리) 및 대조군 마우스 (32마리)에서 24개월 까지 시기별로 종양 생성 여부를 판별한 후 비-종양(tumor free) 카플란마이어(Kaplan Meier) 분석법을 이용하여 그래프화하였다(도 21a).
또한, NDRG3 과발현이 여러 조직의 종양 형성에 미치는 영향을 확인하기 위하여 18개월 된 상기 NDRG3 과발현 형질전환 마우스 및 대조군 마우스의 폐, 20개월 된 상기 NDRG3 과발현 형질전환 마우스 및 대조군 마우스의 장, 및 9개월 된 상기 NDRG3 과발현 형질전환 마우스 및 대조군 마우스의 하복부(hypogastrium) 조직을 적출한 후 종양 형성을 관찰하였다(도 21b).
또한, NDRG3 과발현이 림프종 발현에 미치는 영향을 확인하기 위하여 상기 NDRG3 과발현 형질전환 마우스 및 대조군 마우스에서 장간막 림프절(Mesenteric lymph node), 비장(spleen) 및 간(liver) 조직을 이용하여 면역조직학적 분석법을 수행하였다. 먼저, 상기 NDRG3 과발현 형질전환 마우스 및 대조군 마우스에서 림프절, 비장, 및 간 조직을 적출한 후, 상온에서 10 % 포르말린으로 하루동안 고정하였다. 그 다음, 상기 고정된 조직에 파라핀을 처리하고 4 μm로 섹션화한 후, 실라닌화된(silanylated) 슬라이드(Histoserv)로 옮겼다. 항원 검색을 위하여 상기 섹션화된 조직 슬라이드에 0.01 M 구연산염 버퍼(pH6.0)를 처리하고 100℃에서 2분 동안 가열하였다. 그 다음, 상기 슬라이드를 식히고 조직의 세포내 퍼옥시다아제(peroxidase)를 비활성화하기 위하여 5분 동안 3 % 과산화수소(hydrogen peroxide)/PBS를 처리한 후, 10 % 비면역 마우스 또는 고트(goat) 혈청으로 30분 동안 차단하였다. 그 다음, 림프종에서 발현되는 B 세포 마커인 CD45R 및 T 세포 마커인 CD3의 검색을 위하여 항-CD45R 및 항-CD3 항체로 표지화하고, 상기 표지는 DAB(3, 3'-diaminobenzidine) 기질 크로모젠(chromogen) 용액을 이용하여 ABC(avidin-biotin complex) 방법으로 검출하고 현미경으로 관찰 및 촬영하였다. 또한, 상기 슬라이드는 헤마톡실린-에오진(H&E)으로 대조염색하여 현미경으로 관찰 및 촬영하였다(도 21c).
또한, NDRG3 과발현이 간종양에 미치는 영향을 확인하기 위하여 상기 <실시예 1>에 기재된 방법으로 제작한 3 종류의 NDRG3 과발현 형질전환 마우스 TG-2, TG-8 및 TG-13 각각의 간 조직을 적출한 후, 상기와 같이 고정하여 섹션화하였다. 그 다음, 상기 섹션화된 간 조직을 이용하여 상기와 같이 면역조직학적 염색을 수행하고 시각화하였다. 세포증식 마커인 PCNA 및 Ki-67, 간세포암종(hepatocellular carcinoma, HCC) 마커인 글루타민합성효소(glutamine synthetase, GS) 및 열충격 단백질 70(heat shock protien 70, HSP)의 검색을 위하여 항-PCNA, 항-HSP70, 항-Ki-67 및 항-GS 항체로 표지화하였다. 또한, 상기 섹션화된 조직을 상기 실시예 <4-1>에 기재된 방법으로 항-NDRG3 항체를 이용하여 면역형광염색하고 공초점 현미경을 이용하여 시각화하였다(도 21d).
또한, NDRG3 과발현이 분자적으로 간종양에 미치는 영향을 확인하기 위하여 상기 NDRG3 과발현 형질전환 마우스 및 대조군 마우스에서 간 조직을 적출한 후 액체질소로 동결하였다. 그 다음, 상기 실시예 <4-2>에 기재된 방법으로 RT-PCR을 수행하였다. 또한, 상기 조직을 이용하여 상기 <실시예 2>와 같이 용해하고 항-NDRG3, 항-인산화-ERK1/2, 항-ERK1/2 항체를 이용하여 웨스턴 블럿팅을 수행하였다(도 21e).
그 결과, 도 21a 내지 도 21c에 나타낸 바와 같이, NDRG3 과발현 형질전환 마우스에서 9개월 이후 종양이 형성되기 시작하고(도 21a), 폐, 장 및 하복부를 포함한 다양한 장기에서 종양이 발견되는 것을 확인하였다(도 21b). 또한, NDRG3 과발현 마우스의 간뿐만 아니라 장간막 림프절 및 비장 등 2차 림프기관에서 림프종 발현 B-세포 및 T-세포가 발견되는 것을 확인하였다(도 21c).
또한, 도 21d 및 도 21e에 나타낸 바와 같이, 3 종류의 NDRG3 과발현 형질전환 마우스 모두 간세포암종 마커 및 세포증식 마커의 발현이 현저하게 높게 나타나고(도 20d), 분자적으로 신생혈관생성 마커인 IL-1α, IL-1β IL-6, COX-2 및 PAI-1 mRNA 발현이 증가하며, ERK1/2의 인산화가 증가하는 것을 확인함으로써(도 21e), 상기 결과들을 통해 NDRG3이 종양형성 및 신생혈관생성을 촉진하는 것을 조직학적으로 확인하였다.
<10-2> 암환자에서 NDRG3 발현 및 키나아제 경로 활성 확인
암에서 NDRG3의 임상적 관련성을 확인하기 위하여, 인간 간암환자의 간암 조직을 이용하여 조직 마이크로어레이(Tissue microarray) 분석법을 수행하였다.
구체적으로, 인제대학교 백병원에서 병리학적으로 정의된 HCC를 가진 환자로부터 적출된 조직 샘플을 제공받았다. 상기 모든 조직 샘플은 10 % 완충된 포르말린으로 고정하고 파라핀을 처리하였다. 그 다음, 상기 파라핀 처리된 HCC 조직 샘플(공여자 블락(blocks))을 가지고 코어 조직 생체검사(지름 2 mm)를 수행하고, 트레핀(trephin) 기구(Superbiochips Laboratories, Seoul, Korea) 를 이용하여 새로운 수여자 파라핀 블락(조직 어레이 블락)에 정렬되었다. 결과 조직 어레이 블락은 104개 HCC 및 20개 비-신생 간조직을 포함하였다. 상기 조직 어레이 블락의 4- 섹션을 이용하여 상기 실시예 <11-1>에 기재된 방법으로 면역조직학적 염색을 수행하였다. NDRG3 또는 인산화-ERK1/2 검색을 위하여 항-NDRG3 및 항-인산화-ERK1/2 항체로 표지화하였다. 또한, 일반 식염수가 음성대조군으로 사용되었다. >10 % 중경도의 세포질 염색을 보이는 샘플 및/또는 NDRG3에 대한 세포막 염색 및 >10 % 약경도의 인산화-ERK에 대한 핵염색은 양성 점수화 하였다. NDRG3 단백질 및 인산화-ERK의 발현 수준 사이의 통계학적 유의성은 2 테스트로 평가되었다(도 22).
그 결과, 도 22에 나타낸 바와 같이, 정상 간에서는 NDRG3 단백질이 거의 발견되지 않는 반면, HCC 환자의 간의 경우 세포질 및 원형질막에서 NDRG3 단백질의 발현이 강하게 나타나며, 이때 인산화된 ERK1/2 단백질의 발현이 현저하게 증가하는 것을 확인하였다. 특히, NDRG3 단백질을 발현하는 25개 HCC 조직 중에서 19 (76 %)개 HCC 조직에서 ERK1/2 단백질이 인산화됨을 확인하였다(도 22). 따라서, 상기 결과를 통해 NDRG3의 비정상적인 발현이 종양 형성을 촉진하고 ERK1/2 경로를 활성화함을 확인하였다.
< 실시예 11> 저산소 반응에서 NDRG3의 조절 메커니즘 확인
상기 <실시예 3> 내지 <실시예 11>의 결과들을 바탕으로 저산소 반응에 있어서 NDRG3의 역할에 관한 도식 모델을 완성하였다.
도 23에 나타낸 바와 같이, 저산소 상태 초기 단계에 PHD2의 비활성으로 HIF-1α 단백질의 축적이 유도되고, 그 결과 저산소증에 따른 세포의 대사 적응(metabolic adaptation)과 관련된 유전자(LDHA, PDK1 등)가 상향조절되어 해당과정이 활성화된다. 그 후, 저산소 상태의 PHD2 비활성에 의한 NDRG3의 저산소증 표적 부위인 294번째 프롤린 하이드록실화 억제 현상과 함께, 증가된 해당과정에 의해 생성/축적된 젖산에 의해 NDRG3 단백질의 발현이 증가하였다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (17)

  1. 세포 내에서 NDRG3(N-myc downstream-regulated gene 3) 단백질의 발현양을 측정하는 단계를 포함하는 세포 내 젖산의 정량 방법.
  2. 제 1항에 있어서, 상기 세포는 조직, 혈액, 혈장, 혈청, 타액, 정액 및 소변으로 구성된 군으로부터 선택된 어느 하나에서 채취한 것을 특징으로 하는 젖산의 정량 방법.
  3. 제 1항에 있어서, 상기 NDRG3 단백질은 서열번호 2로 기재되는 아미노산 서열로 이루어지는 것을 특징으로 하는 젖산의 정량 방법.
  4. 제 1항에 있어서, 상기 젖산은 NDRG3 단백질의 아미노산 서열 중 62번째 아스파르트산, 138번째 글라이신, 139번째 알라닌 또는 229번째 타이로신에 결합하는 것을 특징으로 하는 젖산의 정량 방법.
  5. 제 1항에 있어서, 젖산이 결합되지 않은 NDRG3 단백질은 분해되는 것을 특징으로 하는 젖산의 정량 방법.
  6. 제 1항에 있어서, 젖산이 결합된 NDRG3 단백질은 축적되는 것을 특징으로 하는 젖산의 정량 방법.
  7. 제 1항에 있어서, 상기 발현양은 시험관 내 결합 분석법(in-vitro binding assay), 효소면역분석법(ELISA), 면역조직화학염색, 웨스턴 블럿팅(Western Blotting), 단백질 칩(chip) 및 실시간 형광이미징 방법(Realtime Fluorescence Imaging Method)으로 구성된 군으로부터 선택된 어느 하나로 측정하는 것을 특징으로 하는 젖산의 정량 방법.
  8. 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자 및 형광 단백질(fluorescent protein, FP)을 코딩하는 유전자를 포함하는 젖산 정량용 유전자 발현 카세트.
  9. 제 8항에 있어서, 상기 형광 단백질은 적색 형광 단백질(Red Fluorescent Protein, RFP), 증강된 적색 형광 단백질(Enhanced red Fluorescent Protein, ERFP), 청색 형광 단백질(Cyan Fluorescent Protein, CFP), 증강된 청색 형광 단백질(Enhanced cyan Fluorescent Protein, ECFP), 황색 형광 단백질(Yellow Fluorescent Protein, YFP), 증강된 황색 단백질(Enhanced Yellow Fluorescent Protein, EYFP), mTFP(monomeric teal Fluorescent Protein), 녹색 형광 단백질(Green Fluorescent Protein, GFP), 및 변형된 녹색 형광 단백질(modified green Fluorescent Protein, EGFP)로 구성된 군에서 선택된 어느 하나인 것인, 유전자 발현 카세트.
  10. NDRG3 유전자 및 루시퍼레이즈(Luciferase)를 코딩하는 유전자를 포함하는 젖산 정량용 유전자 발현 카세트.
  11. Gal4DB(Gal4 DNA binding domain), 및 서열번호 1로 표시되는 염기서열로 이루어지는 NDRG3 유전자를 포함하는 제1벡터; 및
    Gal4 업스트림 활성화 염기서열(UAS), 및 루시퍼레이즈 유전자를 포함하는 제2벡터를 포함하는 젖산 정량용 유전자 발현 카세트.
  12. 고형암, 허혈성 질환 또는 염증성 질환이 의심되는 개체로부터 분리되는 생물학적 시료에서 NDRG3 단백질의 발현 수준을 측정하는 단계(제1단계); 및
    상기 측정된 단백질 발현 수준을 정상 대조군 시료의 단백질 발현 수준과 비교하는 단계(제2단계)를 포함하는, 고형암, 허혈성 질환 또는 염증성 질환의 진단을 위한 정보제공방법.
  13. 제 12항에 있어서, 상기 고형암은 자궁경부암, 신장암, 위암, 간암, 전립선암, 유방암, 뇌종양, 폐암, 자궁암, 결장암, 방광암, 혈액암 및 췌장암을 포함하는 군에서 선택되는 어느 하나인 것인, 정보제공방법.
  14. 제 12항에 있어서, 상기 허혈성 질환은 뇌허혈, 심장허혈, 당뇨병성 혈관심장 질환, 심부전, 심근비대증, 망막허혈, 허혈성 대장염, 허혈성 급성 신부전증, 뇌졸중, 뇌외상 및 신생아 저산소증을 포함하는 군에서 선택되는 어느 하나인 것인, 정보제공방법.
  15. 제 12항에 있어서, 상기 염증성 질환은 천식, 알레르기성 및 비-알레르기성 비염, 만성 및 급성 비염, 만성 및 급성 위염 또는 장염, 궤양성 위염, 급성 및 만성 신장염, 급성 및 만성 간염, 만성 폐쇄성 폐질환, 폐섬유증, 과민성 대장 증후군, 염증성 통증, 편두통, 두통, 허리 통증, 섬유 근육통, 근막 질환, 바이러스 감염, 박테리아 감염, 곰팡이 감염, 화상, 외과적 또는 치과적 수술에 의한 상처, 프로스타글라딘 E 과다 증후군, 아테롬성 동맥 경화증, 통풍, 퇴행성 관절염, 류머티스성 관절염, 강직성 척추염, 호지킨병, 췌장염, 결막염, 홍채염, 복막염, 포도막염, 피부염, 습진 및 다발성 경화증을 포함하는 군에서 선택되는 어느 하나인 것인, 정보제공방법.
  16. 제 12항에 있어서, 상기 정보제공방법은 상기 생물학적 시료에서 측정한 NDRG3 단백질의 발현 수준이 정상 대조군 시료의 해당 단백질 발현 수준보다 높은 경우 고형암, 허혈성 질환 또는 염증성 질환으로 판단하는 단계(제3단계)를 추가로 포함하는 것인, 정보제공방법.
  17. 제 12항에 있어서, 상기 생물학적 시료는 조직, 혈액, 혈장, 혈청, 타액, 정액 및 소변으로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 것인, 정보제공방법.
PCT/KR2016/003921 2015-04-15 2016-04-15 Ndrg3 단백질을 이용한 젖산의 정량 방법 Ceased WO2016167589A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2015-0053425 2015-04-15
KR1020150053425A KR101767605B1 (ko) 2015-04-15 2015-04-15 Ndrg3 단백질을 이용한 젖산의 정량 방법
KR10-2015-0167802 2015-11-27
KR1020150167802A KR20170062239A (ko) 2015-11-27 2015-11-27 허혈성 질환 또는 염증성 질환의 진단 또는 치료용 카세트

Publications (1)

Publication Number Publication Date
WO2016167589A1 true WO2016167589A1 (ko) 2016-10-20

Family

ID=57127292

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/003921 Ceased WO2016167589A1 (ko) 2015-04-15 2016-04-15 Ndrg3 단백질을 이용한 젖산의 정량 방법

Country Status (1)

Country Link
WO (1) WO2016167589A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119746079A (zh) * 2025-03-07 2025-04-04 华中科技大学同济医学院附属同济医院 组蛋白乳酸化修饰作为靶点在制备预防或治疗慢性阻塞性肺疾病药物中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101632833A (zh) * 2008-07-25 2010-01-27 上海市计划生育科学研究所 一种前列腺癌相关的基因及其用途

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101632833A (zh) * 2008-07-25 2010-01-27 上海市计划生育科学研究所 一种前列腺癌相关的基因及其用途

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
LEE ET AL.: "A Lactate-induced Response to Hypoxia", CELL, vol. 161, no. 3, 23 April 2015 (2015-04-23), pages 595 - 609, XP055322084 *
MELOTIE ET AL.: "The N-myc Downstream Regulated Gene (NDRG) Family: Diverse Functions, Multiple Applications", THE FASEB JOURNAL, vol. 24, no. 11, 2010, pages 4153 - 4166, XP055240924 *
MELOTTE ET AL.: "N-Myc Downstream-regulated Gene 4 (NDRG4): a Candidate Tumor Suppressor Gene and Potential Biomarker for Colorectal Cancer", JOURNAL OF THE NATIONAL CANCER INSTITUTE, vol. 101, no. 13, July 2009 (2009-07-01), pages 916 - 927, XP055207624 *
WANG ET AL.: "NDRG3 is an Androgen Regulated and Prostate Enriched Gene that promotes in Vitro and in Vivo Prostate Cancer Cell Growth", INTERNATIONAL JOURNAL OF CANCER, vol. 124, no. 3, 1 February 2009 (2009-02-01), pages 521 - 530, XP055322071 *
YANG ET AL.: "NDRG3 and NDRG4, Two Novel Tumor-related Genes", BIOMEDICINE & PHARMACOTHERAPY, vol. 67, no. 7, 2013, pages 681 - 684, XP055322076 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119746079A (zh) * 2025-03-07 2025-04-04 华中科技大学同济医学院附属同济医院 组蛋白乳酸化修饰作为靶点在制备预防或治疗慢性阻塞性肺疾病药物中的应用

Similar Documents

Publication Publication Date Title
WO2016018088A1 (ko) Met 저해제에 대한 감수성 예측용 신규한 바이오 마커 및 이의 용도
WO2019182371A1 (ko) 퇴행성 신경질환 진단용 조성물
WO2017010744A1 (ko) 엑소좀 단백질 eif3a 특이반응 오토항체검출용 항원 조성물 및 이를 이용한 간암진단법
WO2024155098A1 (ko) 조절 t 세포 표면 항원 및 이에 특이적으로 결합하는 항체
WO2015130115A1 (en) Novel antibody specific for tspan8 and uses thereof
WO2016167589A1 (ko) Ndrg3 단백질을 이용한 젖산의 정량 방법
WO2020111379A1 (en) A method for screening a therapeutic agent for cancer using binding inhibitor of cyclin-dependent kinase 1 (cdk1)-cyclin b1 and retinoic acid receptor responder 1 (rarres1) gene knockout animal model
WO2013100273A1 (ko) 방사선 피폭 진단용 마커 igfbp-5, 그 마커의 발현수준을 측정하는 방사선 피폭 진단용 조성물, 그 조성물을 포함하는 방사선 피폭 진단용 키트, 및 그 마커를 이용한 방사선 피폭을 진단하는 방법
WO2017082655A1 (ko) 항암 치료 내성 판단 방법 및 상기 방법에 사용되는 조성물
WO2010137770A1 (ko) 신규한 gpcr 단백질 및 이의 용도
WO2020218866A1 (ko) 만성 골수성 백혈병의 진단용 바이오마커
WO2021010800A1 (ko) Wrs 단백질에 특이적으로 결합하는 항체 및 이의 용도
WO2011090283A2 (ko) Sh3rf2 발현 또는 활성 억제제를 함유하는 암의 예방 또는 치료용 조성물
WO2020197227A1 (ko) 간세포암 진단용 바이오마커 세레브론 및 이에 특이적인 신규한 단일클론항체
WO2014157965A1 (ko) P34의 발현 억제제 또는 활성 억제제를 유효성분으로 포함하는 암의 치료 또는 전이 억제용 조성물
WO2011118994A9 (ko) 간암 진단 마커 및 치료제로서의 엔엘케이
WO2023144708A1 (ko) 난소암의 진단용 신규 바이오마커
WO2020080892A1 (ko) Her2 및 her3의 헤테로다이머를 표적으로 하는 약물 및 이의 스크리닝 방법
WO2018088826A2 (ko) 대장암 전이 진단 또는 예후 예측용 조성물 및 이의 용도
WO2023167544A1 (ko) Fam167a를 포함하는 bcr-abl 비의존성 타이로신 키나아제 억제제 내성을 진단하기 위한 바이오마커 및 fam167a를 타겟으로 하는 만성 골수성 백혈병 예방 또는 치료용 조성물
WO2017048069A1 (ko) 신규한 피라졸린 유도체 및 이의 용도
WO2024085603A1 (ko) USP47 (Ubiquitin-specific protease 47) 발현 억제를 통한 c-Myc 관련 질병의 예방 또는 치료용 조성물 및 이의 용도
WO2017023001A1 (ko) 비알콜성 지방간 조절인자 14-3-3 단백질
WO2024039196A1 (ko) 암의 진단, 전이가능성 또는 예후 예측용 바이오 마커 및 이의 용도
WO2021015419A1 (ko) 인산화된 베타-카테닌에 특이적으로 결합하는 항체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16780312

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16780312

Country of ref document: EP

Kind code of ref document: A1