WO2016143995A1 - Puce de pcr multiplexe et dispositif de pcr multiplexe la comprenant - Google Patents

Puce de pcr multiplexe et dispositif de pcr multiplexe la comprenant Download PDF

Info

Publication number
WO2016143995A1
WO2016143995A1 PCT/KR2016/000304 KR2016000304W WO2016143995A1 WO 2016143995 A1 WO2016143995 A1 WO 2016143995A1 KR 2016000304 W KR2016000304 W KR 2016000304W WO 2016143995 A1 WO2016143995 A1 WO 2016143995A1
Authority
WO
WIPO (PCT)
Prior art keywords
multiplex pcr
probe
nucleic acid
chip
pcr chip
Prior art date
Application number
PCT/KR2016/000304
Other languages
English (en)
Korean (ko)
Inventor
김성우
김덕중
김도희
Original Assignee
나노바이오시스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 나노바이오시스 주식회사 filed Critical 나노바이오시스 주식회사
Publication of WO2016143995A1 publication Critical patent/WO2016143995A1/fr

Links

Images

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00—Heating or cooling apparatus; Heat insulating devices
    • B01L7/52—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00—Heating or cooling apparatus; Heat insulating devices
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the present invention relates to a multiplex PCR chip and a multiplex PCR device comprising the same, more specifically, multiplex PCR chip for simultaneously detecting a plurality of nucleic acid molecules different from each other based on the position between a plurality of probes and comprising the same A multiplex PCR device.
  • PCR Polymerase chain reaction
  • PCR Polymerase Chain Reaction
  • the diagnosis through the nucleic acid amplification or a specific gene search technique has a limitation in that it searches for one template at a time.
  • amplifying each one at a time is a cumbersome and time consuming task.
  • cancer and genetic defects are known to be caused by complex mutations of various genes. Genetic polymorphisms or mutations require additional screening of zygotes due to changes in loci of various genes. Since the amount of nucleic acid that can be extracted from a limited sample in a general environment is finite, it is often impossible to repeat the diagnosis through nucleic acid amplification using a limited amount of nucleic acid.
  • Figure 1 illustrates an exemplary process of conventional multiplex PCR.
  • the conventional multiplex PCR may perform PCR by injecting a plurality of primer sets into one reaction vessel (or tube). Multiple sets of primers can be specifically hybridized to various sequences of nucleic acid molecules, so that multiple target nucleic acid sequences can be amplified at the same time. That is, multiplex PCR can identify / diagnose a plurality of genes and diseases in one experiment, thereby reducing the number of experiments and labor, and providing cost saving effects.
  • the monitoring of the amplification products of multiplex PCR can be performed by irradiating excitation light and detecting the emission light generated during the amplification reaction, where the amplification for fluorescence is generated.
  • Oligonucleotides i.e., primers or probes
  • fluorescent dyes that can generate a signal indicative of the presence of the target nucleic acid sequence during the reaction are used, particularly in multiplex PCR to distinguish between multiple different nucleic acid sequences that can be amplified.
  • oligonucleotides specific to each nucleic acid sequence can be used. That is, in conventional multiplex PCR, multiple fluorescent dyes must be labeled for the detection of multiple target nucleic acid sequences, and also for detection of multiple fluorescences from the multiple fluorescent dyes, each in a separate wavelength band. There is a need for light sources and filters of multiple wavelengths that are optimized for the detection of fluorescent dyes. This requires multiple wavelength-specific measurement times to increase the time required to detect nucleic acid sequences, increase the overall size and complexity of the PCR device, and consequently can be cost-effective.
  • the present invention has been made to solve the problem, and an object thereof is to provide a multiplex PCR device for simultaneously detecting a plurality of nucleic acid molecules different from each other based on positions between a plurality of probes.
  • a multiplex PCR chip is provided.
  • the chip is
  • a plurality of hybridization probes specifically hybridized with different sequences of the nucleic acid molecules and spaced apart from each other to simultaneously detect a plurality of different nucleic acid molecules
  • the probe may be characterized in that a fluorescent substance and a fluorescent inhibitor are respectively bound to the end or the middle of the base sequence.
  • a multiplex PCR device comprises the multiplex PCR chip; A light providing unit configured to irradiate excitation light toward the probe in the multiplex PCR chip; And a light detector for detecting emission light generated by the plurality of probes by the excitation light beam, wherein the light providing unit and the detection by the light detector are performed using light having a single or multiple wavelengths. It can be characterized.
  • a multiplex PCR device comprises the multiplex PCR chip; And at least one heat block in contact with the multiplex PCR chip to transfer heat for multiplex PCR to the multiplex PCR chip.
  • the sequences of nucleic acid molecules hybridized by the probes can be distinguished based on the positions between the probes.
  • the need for different fluorescent dyes for labeling can be eliminated.
  • the sequence of the nucleic acid molecule hybridized with the probe is distinguishable based on the separation position between the probes.
  • multiplex real-time PCR using a single fluorescent dye is possible. This makes it possible to use only one light source and filter, thereby minimizing the size of the optical equipment and reducing the cost of the equipment, and also improving the efficiency of the operation of the multiplex PCR apparatus by reducing the time required for detection. have.
  • multiple probes bind through predetermined probe bonds on the surface of the multiplex PCR chip, thereby providing more firm binding force, which is a distorted result occurring during separation and hybridization and washing of the bonds. Can be prevented.
  • the probe coupling portion can form a porous structure (pore structure) and the probe is bonded to the surface of the porous structure, thereby increasing the contact area between the probe and the multiplex PCR product, it is possible to improve the reactivity. .
  • FIG. 1 illustrates an exemplary process of conventional multiplex PCR.
  • FIG. 2 illustrates a multiplex PCR chip according to an embodiment of the present invention.
  • FIG 3 illustrates a multiplex PCR chip according to an embodiment of the present invention.
  • FIG. 4 illustrates a multiplex PCR chip according to an embodiment of the present invention.
  • FIG. 5 shows a multiplex PCR device according to an embodiment of the present invention.
  • 6A and 6B show a multiplex PCR device according to an embodiment of the present invention.
  • FIG. 7 shows a multiplex PCR device according to an embodiment of the present invention.
  • FIG. 8 illustrates a fabrication of a multiplex PCR chip according to an embodiment of the present invention.
  • the multiplex PCR device is a device for performing a multiplex polymerase chain reaction (PCR) to amplify various nucleic acids having a specific base sequence.
  • PCR polymerase chain reaction
  • the multiplex PCR apparatus heats a double strand of DNA by heating a sample solution containing a double strand of DNA to a specific temperature, for example, about 95 ° C.
  • a denaturing step of separating single-stranded DNA, an oligonucleotide primer having a sequence complementary to the specific nucleotide sequence to be amplified in the sample solution, and providing a specific temperature with the isolated single-stranded DNA For example, an annealing step in which a primer is attached to a specific base sequence of a single strand of DNA by cooling to 55 ° C. to form a partial DNA-primer complex, and the sample solution is subjected to an appropriate temperature, for example, after the annealing step.
  • the multiplex PCR apparatus refers to an apparatus including modules for performing steps, and detailed modules not described herein are disclosed and apparent in the prior art for performing PCR. It is assumed that it is equipped with all in the range.
  • the multiplex PCR device can perform the multiplex PCR and at the same time measure and analyze the presence and extent of the multiplex PCR product generation.
  • FIG. 2 illustrates a multiplex PCR chip according to an embodiment of the present invention.
  • the multiplex PCR chip 200 is for performing amplification (amplification reaction) of nucleic acid molecules, detection of a target sequence (hybridization reaction), and the like. It may include.
  • the fluid is a nucleic acid such as double stranded DNA, an oligonucleotide primer having a sequence complementary to the specific nucleotide sequence to be amplified, DNA polymerase, deoxyribonucleotide triphosphates (dNTP), PCR reaction buffer (PCR). sample buffer, including a reaction buffer).
  • At least a part of the multiplex PCR chip 200 may be implemented with a light transmissive material, and may preferably include a light transmissive plastic material.
  • Multiplex PCR chip 200 using a plastic material can increase the heat transfer efficiency only by adjusting the thickness of the plastic, it is possible to reduce the manufacturing cost because the manufacturing process is simple.
  • the multiplex PCR chip 200 may have a light transmitting property as a whole, direct light irradiation is possible in a state in which it is disposed on one surface of the heat block, thereby measuring and analyzing nucleic acid amplification and amplification degree in real time. can do.
  • the multiplex PCR chip 200 contacts the thermal block, the heat of the thermal block is transferred to the multiplex PCR chip 200 and included in the reaction region 224 of the multiplex PCR chip 200.
  • the heated fluid may be heated or cooled to maintain a constant temperature.
  • the multiplex PCR chip 200 may preferably have a planar shape as a whole, but is not limited thereto.
  • the multiplex PCR chip 200 may include a probe 240 disposed therein for the hybridization reaction.
  • Probe 240 is a labeled oligonucleotide capable of generating a signal indicative of the presence of a target nucleic acid sequence during an amplification reaction to detect nucleic acid to be amplified by PCR, and may specifically hybridize with the sequence of the nucleic acid molecule.
  • Each probe 240 may hybridize to a different sequence of nucleic acid molecules.
  • the probe 240 may be (covalently) bonded to a portion of the base sequence, that is, a fluorescent material (fluorphore) and a quencher (quencher) at the end or the middle of the base sequence, respectively.
  • the fluorescent material refers to a fluorescent material such as, for example, FAM
  • the fluorescent inhibitor suppresses fluorescence generation of the fluorescent material through, for example, fluorescence resonance energy transfer (FRET), for example, BHQ-1. (black hole quencher-1) and the like.
  • FRET fluorescence resonance energy transfer
  • the probe 240 in the annealing step of the PCR reaction, the probe 240 hybridizes specifically to the sequence (ie, template DNA) of the nucleic acid molecule, wherein the fluorescent material is fluorescent Occurrence is suppressed.
  • the probe 240 in the extension step of the PCR reaction, the probe 240 is decomposed due to the activity of exonuclease of the DNA polymerase, and at this time, the fluorescent material is released from the probe or is separated from the probe, thereby suppressing the fluorescence. May occur. That is, the probe 240 may detect the target nucleic acid (or target nucleic acid sequence) through fluorescence generation through hybridization with such target nucleic acid sequence, release, and distance.
  • each probe 240 may be coupled to be spaced apart from each other on the surface of the multiplex PCR chip 200. This bonding is performed by applying the probe 240 onto the surface of the multiplex PCR chip 200 using, for example, a spotter, an arrayer, an ink-jet, or the like. Can be. The separation between the probes allows identification of the detected nucleic acid only by detecting the location of the fluorescence.
  • Each probe 240 may be adsorbed on the surface of the multiplex PCR chip 200 or may be coupled through a probe coupling unit.
  • the probe coupling units may provide more firm binding force than adsorption between the conventional probe 240 and the multiplex PCR chip 200.
  • the probe binding portions may form a porous structure, and the probe 240 is bonded to the surface of the porous structure, thereby contacting the probe 240 with the multiplex PCR product (ie, amplified nucleic acid molecule). By increasing the area, the reactivity can be improved.
  • the size of the porous structure will depend on molecular weight, UV curing and washing conditions, and the size can be formed from nanometer to micrometer level, thereby controlling the reactivity between the porous structure and the multiplex PCR product.
  • the porous structure is polyethylene glycol diacrylate (PEGDA), polyethylene glycol dimethacrylate (PEGDMA), 2-hydroxyethyl methacrylate (HEMA), ethylene glycol Ethylene glycol Diacrylate (EGDA), Ethylene glycol Dimethacrylate (EGDMA), Polyvinyl alcohol (PVA), agarose, silicon, and paraffin It can be formed by adding a photo initiator and a buffer to a porogen formed of at least one of a gel material, polyethylene glycol (PEG), and ethylene glycol (EG).
  • the photoinitiator may be a linker or a spacer such as a PEG linker, a C linker, a TEG linker, or the like, 2-hydroxy-2-methyl-1-phenyl-1-propanone (2-Hydroxy-2-methyl- 1-phenyl-1-propanone), methylbenzoylformate, and the buffer may be Tris-EDTA buffer.
  • the molecular weight of polyethylene glycol diacrylate (PEGDA) may be 10 to 50,000 MW
  • the molecular weight of polyethylene glycol (PEG) may be 10 to 50,000 MW
  • polyethylene glycol diacrylate ( Polyethylene glycol Diacrylate, PEGDA) is 5 to 40% by weight
  • Polyethylene glycol (PEG) is 5 to 40% by weight
  • 2-hydroxy-2-methyl-1-phenyl-1-propanone (2-Hydroxy- 2-methyl-1-phenyl-1-propanone) may have a concentration ratio of 1 to 10%
  • the Tris-EDTA buffer may have a concentration ratio of 0.1 to 30%.
  • the probe binding unit is a linker material such as hexa-ethylene glycol (18-atom hexa-ethleneglycol) or an acridite binding material (Acrydite binding material) that binds to a fluorescent material or a primer in 1 to 100 units. Porous structural binding materials such as Thiol binding material, biotin binding material, and amine binding material.
  • the probe binding unit may further include a plurality of primers that specifically hybridize with different sequences of the nucleic acid molecules, such that the nucleic acid molecules hybridize to the primers and then hybridize with the probes.
  • the probe 240 may be disposed on an upper surface of the reaction region 224 (or an upper inner surface of the multiplex PCR chip 200 or a lower surface of the third plate 230). Bubbles may occur during the PCR reaction, and these bubbles may cause interference in measuring the PCR reaction product. However, as shown in FIG. 2, the probe 240 is disposed on the upper surface of the reaction zone 224. Bubbles are moved around the probe 240, so that this interference can be eliminated to improve measurement efficiency.
  • the same fluorescent dye may be used for the plurality of probes 240.
  • probes 240 labeled with fluorescent dyes having different colors should be used to distinguish sequences of nucleic acid molecules hybridized by a plurality of probes 240, but in the present invention, Even if the same fluorescent dye is used, a plurality of probes 240 are spaced apart at predetermined intervals, and thus the sequence of nucleic acid molecules hybridized by the probes 240 can be distinguished based on the positions between these probes 240. The need for different fluorescent dyes can be eliminated.
  • the present invention by using one light source and a filter, detection of a multiplex PCR product is possible, which not only reduces the size of the optical equipment and reduces the equipment cost, but also reduces the time required for detection.
  • the efficiency of operation of the multiplex PCR device can be improved.
  • a flat plate-shaped first plate 210 may be provided as a base of the multiplex PCR chip 200.
  • the second plate 220 and the third plate 230 may be sequentially disposed on the first plate 210.
  • the second plate 220 may be disposed on the first plate 210.
  • the second plate 220 may include an inlet 222 through which a fluid (for example, a sample solution containing a nucleic acid to be amplified) is introduced, a reaction region through which the introduced fluid moves, and a PCR reaction and a hybridization reaction are performed ( 224 and an outlet portion 226 through which the reaction is completed is discharged.
  • a fluid for example, a sample solution containing a nucleic acid to be amplified
  • the reaction zone 224 of the second plate 220 is formed by recessing from the surface (eg, top and / or bottom) of the second plate 220 or through the second plate 220. Can be.
  • the inlet part 222 and the outlet part 226 of the second plate 220 may pass through the second plate 220 and may protrude from the surface of the second plate 220.
  • the thickness of the second plate 220 may vary, but may be selected from 0.1 mm to 2.0 mm.
  • the width and length of the reaction zone 224 may vary, but preferably the width of the reaction zone 224 is selected from 0.5 mm to 3 mm, and the length of the reaction zone 224 is 20 mm to 60 mm. Can be selected from.
  • the inner wall of the second plate 220 may be coated with a material such as silane-based and Bovine Serum Albumin (BSA) to prevent DNA and protein adsorption.
  • BSA Bovine Serum Albumin
  • the treatment can be performed according to methods known in the art.
  • the inlet 222 may have various sizes, but preferably may be selected from 0.5 mm to 3.0 mm in diameter.
  • the outlet portion 226 may have various sizes, but preferably may be selected from a diameter of 0.5 mm to 3.0 mm.
  • the third plate 230 may be disposed on the second plate 220.
  • the third plate 230 is disposed on the second plate 220, so that a portion of the reaction zone 224 of the second plate 220 (that is, the reaction zone 224 of the second plate 220) is provided.
  • the PCR reaction product may be measured through at least one probe 240 spaced apart from each other on a portion of the lower surface of the third plate 230.
  • the thickness of the third plate 230 may vary, but may preferably be selected from 0.1 mm to 2.0 mm.
  • the shape of at least one of the first plate 210, the second plate 220 and the third plate 230 may be injection molded, hot-embossing, casting, laser ablation. It can be formed by various mechanical and chemical processing processes.
  • the machining process is exemplary, and various machining processes may be applied according to the embodiment to which the present invention is applied.
  • the bonding between the first plate 210 and the second plate 220 and / or the bonding between the second plate 220 and the third plate 230 may be, for example, thermal bonding, ultrasonic bonding, ultraviolet bonding, solvent, or the like. It can be carried out by various bonding methods applicable in the art, such as bonding, tape bonding.
  • surface treatment may be performed on at least a portion (eg, an inner wall of the second plate 220) of the inner surface of the multiplex PCR chip 200.
  • the multiplex PCR chip 200 may be coated with a material such as silane series, Bovine Serum Albumin (BSA) to prevent DNA and protein adsorption on the surface, such surface treatment is It can be performed according to various techniques known in the art.
  • the multiplex PCR chip 200 is provided with separate cover means (not shown) for the inlet 222 and / or outlet 226, the inlet 222 and the outlet Contamination inside the multiplex PCR chip 200 through the unit 226 may be prevented, or leakage of fluid injected into the microfluidic chip 200 may be prevented.
  • cover means may be embodied in various shapes, sizes or materials. The shape or structure of the multiplex PCR chip 200 shown in FIG.
  • first plate 210, the second plate 220, or the third plate 230 may be implemented in various materials, but preferably, polymethylmethacrylate (PMMA), polycarbonate , PC), cycloolefin copolymer (COC), polyamide (PA), polyethylene (PE), polypropylene (PP), polyphenylene ether (PPE), polystyrene (polystyrene, PS), polyoxymethylene (POM), polyetheretherketone (PEEK), polytetrafluoroethylene (PTFE), polyvinylchloride (PVC), polyvinylidene fluoride (polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), fluorinated ethylene propylene (FEP), perfluoroalkoxyalkane (PFA), polydimethyl Siloxane (pol
  • PMMA polymethylmethacrylate
  • PC polycarbonate
  • COC cycloolefin copolymer
  • PA
  • FIG 3 illustrates a multiplex PCR chip according to an embodiment of the present invention.
  • the third plate 230 may include a portion of the reaction region 224 of the second plate 220 (that is, the reaction region of the second plate 220). 224) can be inserted into the through region. To this end, some regions of the lower surface of the third plate 230 may protrude downward. The protruded region covers the through region of the reaction region 224 of the second plate 220 and the ease of the third plate 230 and the second plate 220 through insertion into the through region. One joint alignment can be achieved.
  • the shape of the multiplex PCR chip 300 illustrated in FIG. 3 is exemplary and various shapes may be applied according to an embodiment to which the present invention is applied.
  • At least one region of the inner surface of the multiplex PCR chip 300 (that is, one region of the lower surface of the third plate 230) is treated with a hydrophilic material 310 to facilitate the performance of multiplex PCR.
  • Hydrophilic material 310 may be a variety of materials, but may be preferably selected from the group consisting of carboxyl group (-COOH), amine group (-NH2), hydroxy group (-OH), and sulfone group (-SH). .
  • the treatment of the hydrophilic material 310 may be treated by a method selected from the group consisting of oxygen and argon plasma treatment, corona discharge treatment, and surfactant application, which is exemplary, the embodiment to which the present invention is applied Depending on the various treatment methods known in the art can be applied.
  • FIG. 4 illustrates a multiplex PCR chip according to an embodiment of the present invention.
  • Figure 4 (a) shows a plan view of the multiplex PCR chip 500
  • Figure 4 (b) shows a cross-sectional view in the AA 'direction of the multiplex PCR chip 500
  • Figure 4 (c) shows a bottom perspective view of the inner surface of the multiplex PCR chip 500 shown in Figs. 4A and 4B.
  • the multiplex PCR chip 500 may further include a probe fixing part 510.
  • Probe fixing portion 510 is for receiving and fixing the probe 240 for the detection of the target sequence, for example, formed in one region of the lower surface of the third plate 230 of the multiplex PCR chip 500 It may be composed of a central portion 512 and a peripheral portion 514 protruding to surround the central portion 512.
  • the center portion 512 may provide an accommodation space of the probe 240, and the peripheral portion 514 may prevent the probe 240 from being separated from the center portion 512.
  • the shape of the probe fixing part 510 shown in FIG. 4 is exemplary, and various shapes of the probe fixing part may be used according to an embodiment to which the present invention is applied.
  • FIG. 5 shows a multiplex PCR device according to an embodiment of the present invention.
  • the multiplex PCR device 1000 may be configured to drive light to provide light to a thermal block 900, multiplex PCR chips 200 to 700, and multiplex PCR chips 200 to 700.
  • the display unit 1010 and the multiplex PCR chip (200 to 700) may further include a light detector 1020 is disposed to be driven to receive light.
  • the light providing unit 1010 may be a module for providing light to the multiplex PCR chips 200 to 700.
  • the light providing unit 1010 may include a light source for emitting light, such as a light emitting diode (LED) light source, a laser light source, a first light filter for selecting light having a predetermined wavelength from light emitted from the light source, and It may include a first optical lens for collecting the light emitted from the first optical filter to increase the intensity of the emitted light.
  • the light provider 1010 may further include a first aspherical lens disposed to spread light between the light source and the first light filter. That is, by adjusting the arrangement direction of the first aspherical lens, it is possible to extend the light range emitted from the light source to reach the measurable area.
  • the configuration of the light providing unit 1010 is not limited thereto.
  • the light detector 1020 is a module for receiving the light emitted from the multiplex PCR chips 200 to 700 and measuring a PCR reaction product performed by the multiplex PCR chips 200 to 700. Light emitted from the light passes through or reflects through the multiplex PCR chip 200 to 700, specifically, the reaction region 224 or the probe 240 of the multiplex PCR chip 200 to 700, in this case generated by nucleic acid amplification.
  • the optical detector 1020 may detect the optical signal.
  • the light detector 1020 is a predetermined wavelength from the light emitted from the second optical lens, the second optical lens to collect the light emitted from the multiplex PCR chip (200 to 700) to increase the intensity of the emitted light It may include a second optical filter for selecting the light having a light analyzer for detecting an optical signal from the light emitted from the second optical filter.
  • a second aspherical lens and / or a second aspherical lens disposed between the second optical filter and the optical analyzer and / or between the second aspherical lens and the optical analyzer are arranged to integrate light emitted from the second optical filter.
  • a photodiode integrated circuit arranged to remove noise of the emitted light and to amplify the light emitted from the second aspherical lens.
  • the light providing unit 1010 can detect the multiplex PCR product by using only one light source and the filter, without having to provide a plurality of light sources and filters.
  • the light detection unit 1020 can also detect a multiplex PCR product even if only one filter is provided. This configuration of the light providing unit 1010 and the light detecting unit 1020 can reduce the size of the optical equipment and reduce the equipment cost, as well as reduce the time required for detection, compared to the conventional multiplex PCR device. Can be.
  • the targets are monitored in real time by monitoring the reaction result by the amplification of the nucleic acid in the reaction region 224, particularly in the probe 240. Whether to amplify the nucleic acid sequence and the degree of amplification can be measured and analyzed in real time.
  • 6A and 6B show a multiplex PCR device according to an embodiment of the present invention.
  • the multiplex PCR device 1100 may include a substrate 1110; A first row block 900A disposed on the substrate 1110 and a second row block 900B spaced apart from the first row block 900A; It may include a chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted and a driving unit 1130 to move the chip holder 1120.
  • the substrate 1110 has no change in its physical and / or chemical properties due to the heating and temperature maintenance of the first thermal block 900A and the second thermal block 900B, and the first thermal block 900A and the second thermal block And any material having a material such that mutual heat exchange does not occur between 900B.
  • the substrate 1110 may include or consist of a material such as plastic.
  • the first row block 900A and the second row block 900B are for maintaining a temperature for performing a denaturation step, an annealing step and an extension (or amplification) step for amplifying a nucleic acid, which will be described with reference to FIG. 9.
  • the description is the same as the column block 900 described above, and thus redundant descriptions are omitted.
  • Each of the thermal blocks 900A, 900B may be implemented to maintain an appropriate temperature for performing the denaturation step, or the annealing and extension (or amplification) steps.
  • the thermal blocks 900A, 900B may maintain 50 ° C. to 100 ° C., and preferably, 90 ° C. to 100 ° C.
  • the denaturation step when the denaturation step is performed in the thermal blocks 900A, 900B, preferably Preferably, it may be maintained at 95 ° C., and may be maintained at 55 ° C. to 75 ° C., preferably at 72 ° C., when performing annealing and extension (or amplification) steps in thermal blocks 900A and 900B.
  • the temperature is not limited so long as the denaturation step or the annealing and extension (or amplification) step can be performed.
  • the first row block 900A and the second row block 900B may be spaced apart at a predetermined distance such that mutual heat exchange does not occur.
  • the denaturation step and annealing and extension are performed. Accurate temperature control of (or amplification) steps is possible.
  • the multiplex PCR chips 200 to 700 are in contact with one surface of each of the row blocks 900A and 900B, the first row block 900A and the second row block 900B are the multiplex PCR chips 200 to 700.
  • the contact surface with 700 may be heated and temperature maintained as a whole, so that the fluid in the multiplex PCR chips 200 to 700 may be uniformly heated and temperature maintained.
  • the chip holder 1120 may be equipped with multiplex PCR chips 200 to 700.
  • the inner wall of the chip holder 1120 may have a shape and structure to be fixedly mounted to the outer walls of the multiplex PCR chips 200 to 700 so that the multiplex PCR chips 200 to 700 do not separate from the chip holder 1120.
  • the multiplex PCR chip 200 to 700 may be detachable to the chip holder 1120.
  • the chip holder 1120 may be operably connected to the driving unit 1130.
  • the driver 1130 may move the chip holder 1120 left and right and / or up and down on the thermal blocks 900A and 900B.
  • the driver 1130 may include all means for allowing the chip holder 1120 to move left and right and / or up and down over the first row block 900A and the second row block 900B.
  • the chip holder 1120 is capable of reciprocating between the first row block 900A and the second row block 900B, and by the vertical movement of the drive unit 1130, The holder 1120 may be in contact with and separated from the first row block 900A and the second row block 900B.
  • the driving unit 1130 includes a rail 1132 extending in the left and right directions, and a connecting member 1134 slidably moved in the left and right directions through the rail 1132 and slidable in the vertical direction.
  • the chip holder 1120 may be disposed at one end of the connection member 1134.
  • the driver 1130 reciprocates the multiplex PCR chips 200 to 700 mounted on the chip holder 1120 while reciprocating between the first row block 900A and the second row block 900B.
  • the reaction can be carried out.
  • the first heat block 900A may be heated and maintained at a temperature for the denaturation step, eg, 90 ° C. to 100 ° C., preferably at 95 ° C.
  • the second row block 900B may be heated and maintained at a temperature for an annealing and extension (or amplification) step, eg, 55 ° C. to 75 ° C., preferably at 72 ° C.
  • the chip holder 1120 equipped with the flex PCR chips 200 to 700 may be contacted with the first row block 900A to perform the first denaturation step of the multiplex PCR (step x).
  • the coupling member 1134 of the driving unit 1130 is controlled to move the multiplex PCR chips 200 to 700 upward, thereby to move the chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted.
  • the first denaturation step of the multiplex PCR is terminated by separating from the thermal block 900A, and the multiplex PCR chips 200 to 700 are moved onto the second thermal block 900B through the rail 1132 of the driving unit 1130. (Y step).
  • the coupling member 1134 of the driving unit 1130 is controlled to move the multiplex PCR chips 200 to 700 downward to move the chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted.
  • the thermal block 900B may be contacted to perform the first annealing and extension (or amplification) step of the multiplex PCR (step z).
  • the multiplex PCR chip 200 to 700 is moved upward by controlling the connection member 1134 of the driving unit 1130, so that the chip holder 1120 on which the multiplex PCR chip 200 to 700 is mounted is second. Separating from the row block 900B terminates the first annealing and extension (or amplification) step of the multiplex PCR, and passes the multiplex PCR chips 200 to 700 through the rail 1132 of the driver 1130 in a first row.
  • the nucleic acid amplification reaction can be performed by repeating steps x, y, and z (circulation step).
  • FIG. 7 shows a multiplex PCR device according to an embodiment of the present invention.
  • the light providing unit 1010 and the light detecting unit 1020 may be disposed with the first column block 900A and the second column block 900B interposed therebetween. have.
  • a through part 1136 may be formed in the driver 1130 to pass light emitted from the light providing part 1010 to measure light.
  • the multiplex PCR chip 200 to 700 may be formed of a light transmissive material. It may be a light transmissive plastic material.
  • nucleic acids are amplified in the multiplex PCR chips 200 to 700 during the nucleic acid amplification reaction by the multiplex PCR device 1200.
  • the degree can be detected in real time.
  • the multiplex PCR chip reciprocates between the first row block 900A and the second row block 900B to perform each step of the PCR reaction.
  • the driving unit 1130 may stop the multiplex PCR chip 200 to 700 on the spaced space between the first row block 900A and the second row block 900B.
  • the light is emitted from the light providing unit 1010, and the emitted light is the multiplex PCR chip 200 to 700, specifically, the reaction region 224 or the probe 240 of the multiplex PCR chip 200 to 700. Since it passes through, the light detector 1020 can detect the optical signal generated by the amplification of the nucleic acid.
  • the reaction result of the amplification of the nucleic acid in the reaction region 224, in particular the probe 240, in real time during each cyclic step of the multiplex PCR reaction is monitored in real time.
  • the amount of target nucleic acid sequence can thereby be measured and analyzed in real time.
  • 6A, 6B, and 7 illustrate a multiplex PCR apparatus for performing a PCR reaction using two column blocks 900A and 900B, which are exemplary and used to perform a PCR reaction.
  • the number of blocks can vary. For example, only one column block may be used for one multiplex PCR chip 200 to 700.
  • a reaction probe and a probe coupling portion to be attached to the reaction region inside the chip were prepared.
  • the reagent composition was positive control 1 (PC 1) containing only the probe in the porous structure of the PCR chip, positive control 2 (PC 2), positive control 3 (PC 3) in which the forward and reverse primers were added to the positive control 1 and 2 (SEQ ID NO 2: Forward primer sequence TGGTCATGGTGATGTTGATTACTATTCAG, SEQ ID NO: 3: Reverse primer sequence ACGTCTTACTTGCACTGATTGATTCA).
  • Reagent composition for each group is shown in Table 1 below.
  • PCR reagent composition Reagent Composition Positive control (Gel: Probe only) Positive control (Gel: Probe only) Positive Control (Gel: Primer / Probe) NBS Taqman2X master mix 10 ⁇ l 10 ⁇ l 10 ⁇ l Primer 2 ⁇ l 2 ⁇ l - Template (Target DNA) 1 ⁇ l 1 ⁇ l 1 ⁇ l DW 7 ⁇ l 7 ⁇ l 9 ⁇ l Total 20 ⁇ l 20 ⁇ l 20 ⁇ l 20 ⁇ l 20 ⁇ l
  • PCR performance conditions were 95 ° C., pre-denaturation for 8 seconds, 95 ° C., denaturation for 3 seconds, and 68 ° C., 14 for the processed target sample (Taget gene sequence).
  • the annealing step for 40 seconds was cycled (SEQ ID NO 4: Target gene sequence: TAA TGA CCC TAA AGG TTT TAA CCT GAA GTA CCG TTA TGA ACT CGA TGA TAA CTG GGG AGT AAT AGG TTC GTT TGC TTA) TAC TCA TCA GGG ATA TGA TTT CTT CTA TGG CAG TAA TAA GTT TGG TCA TGG TGA TGT TGA TTA CTA TTC AGT AAC AAT GGG GCC ATC TTT CCG CAT CAA CGA ATA TGT TAG CCT TTA TGG ATT ACT GGG GGC CGG TCA TGG AAA GGC ATC TGT ATT TGA TGA ATC AAT CAG TGC AAG TAA GAC G
  • FIG. 9 is an electrophoretic picture of positive control 1, positive control 2, and positive control 3 from the left marker to the right. If this is different, it can be seen that PCR was successfully performed in the chip.
  • FIG. 10 is a fluorescence expression photograph of the chip of the positive control 1, positive control 2, positive control 3 from the left side, according to the 40 cycles, the fluorescence expression was successfully performed specifically for the third porous structure in all 40 cycles You can see that.
  • FIG. 11 is a graph of fluorescence measurements for positive control (PC 1), positive control 2 (PC 2), and positive control 3 (PC 3), with positive control 1 (PC 1) and positive control 2 (PC 2) and PCR progress was confirmed in positive control 3 (PC 3).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Clinical Laboratory Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

Un mode de réalisation de la présente invention concerne une puce de PCR multiplexe et un dispositif de PCR multiplexe la comprenant. La puce comprend : une pluralité de sondes pour une utilisation dans des réactions d'hybridation, qui sont spécifiquement hybridées avec différentes séquences d'une pluralité de différentes molécules d'acide nucléique afin de détecter les molécules d'acide nucléique simultanément, et sont agencées espacées les unes des autres; et une pluralité de parties de couplage de sonde qui sont disposées sur la surface interne de la puce de PCR multiplexe, forment une structure de pores de manière à augmenter la zone de contact entre les sondes et les molécules d'acide nucléique, et permettent ainsi aux sondes d'être couplées à la structure de pores, les sondes pouvant être caractérisées en ce qu'une substance fluorescente et une substance inhibant la fluorescence sont combinées au niveau de l'extrémité ou au milieu d'une séquence de base, respectivement.
PCT/KR2016/000304 2015-03-09 2016-01-12 Puce de pcr multiplexe et dispositif de pcr multiplexe la comprenant WO2016143995A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2015-0032228 2015-03-09
KR1020150032228A KR101724281B1 (ko) 2015-03-09 2015-03-09 멀티플렉스 ｐｃｒ 칩 및 이를 포함하는 멀티플렉스 ｐｃｒ 장치

Publications (1)

Publication Number Publication Date
WO2016143995A1 true WO2016143995A1 (fr) 2016-09-15

Family

ID=56880099

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/000304 WO2016143995A1 (fr) 2015-03-09 2016-01-12 Puce de pcr multiplexe et dispositif de pcr multiplexe la comprenant

Country Status (2)

Country Link
KR (1) KR101724281B1 (fr)
WO (1) WO2016143995A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3944896A1 (fr) * 2020-07-30 2022-02-02 Genesystem Co., Ltd. Puce à pcr multiplexe et dispositif de pcr multiplexe la comprenant

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102105558B1 (ko) * 2018-03-23 2020-04-28 (주)바이오니아 고속 중합효소 연쇄반응 분석 플레이트
KR102426788B1 (ko) 2019-06-30 2022-07-29 주식회사 진시스템 Pcr 전처리 방법 및 이를 위한 멀티플렉스 pcr 칩
KR102400907B1 (ko) 2019-06-30 2022-05-24 주식회사 진시스템 휴대용 멀티플렉스 pcr 장치
KR102263837B1 (ko) * 2020-11-05 2021-06-11 주식회사 미코바이오메드 현장진단용 다중 초고속 핵산 추출 및 증폭이 가능한 통합칩

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006271216A (ja) * 2005-03-28 2006-10-12 Dainippon Ink & Chem Inc 特定の塩基配列を有する核酸の有無を判定するシステムおよび判定方法
US20060263799A1 (en) * 2005-02-18 2006-11-23 Infineon Technologies Ag Macroporous support for chemical amplification reactions
KR101019952B1 (ko) * 2008-05-27 2011-03-11 박민구 뇌졸중 조기진단 칩 그리고 이를 이용한 뇌졸중 스크리닝검사
KR20110118572A (ko) * 2010-04-23 2011-10-31 나노바이오시스 주식회사 2개의 열 블록을 포함하는 ｐｃｒ 장치
KR20140028431A (ko) * 2012-08-29 2014-03-10 나노바이오시스 주식회사 히터 유닛이 반복 배치된 열 블록을 포함하는 전기화학적 신호를 검출하기 위한 ｐｃｒ 칩, 이를 포함하는 ｐｃｒ 장치, 및 이를 이용한 실시간 ｐｃｒ 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060263799A1 (en) * 2005-02-18 2006-11-23 Infineon Technologies Ag Macroporous support for chemical amplification reactions
JP2006271216A (ja) * 2005-03-28 2006-10-12 Dainippon Ink & Chem Inc 特定の塩基配列を有する核酸の有無を判定するシステムおよび判定方法
KR101019952B1 (ko) * 2008-05-27 2011-03-11 박민구 뇌졸중 조기진단 칩 그리고 이를 이용한 뇌졸중 스크리닝검사
KR20110118572A (ko) * 2010-04-23 2011-10-31 나노바이오시스 주식회사 2개의 열 블록을 포함하는 ｐｃｒ 장치
KR20140028431A (ko) * 2012-08-29 2014-03-10 나노바이오시스 주식회사 히터 유닛이 반복 배치된 열 블록을 포함하는 전기화학적 신호를 검출하기 위한 ｐｃｒ 칩, 이를 포함하는 ｐｃｒ 장치, 및 이를 이용한 실시간 ｐｃｒ 방법

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3944896A1 (fr) * 2020-07-30 2022-02-02 Genesystem Co., Ltd. Puce à pcr multiplexe et dispositif de pcr multiplexe la comprenant

Also Published As

Publication number Publication date
KR20160110574A (ko) 2016-09-22
KR101724281B1 (ko) 2017-04-10

Similar Documents

Publication Publication Date Title
WO2016143995A1 (fr) Puce de pcr multiplexe et dispositif de pcr multiplexe la comprenant
WO2016013770A1 (fr) Puce à pcr multiplexe et dispositif de pcr multiplexe la comprenant
WO2011132977A2 (fr) Dispositif de pcr comprenant deux blocs de colonne
US9765383B2 (en) Apparatus and method for automatically analyzing biological samples
WO2016105073A1 (fr) Appareil de pcr comprenant des moyens de coulissement répété et procédé pcr l'utilisant
WO2014148877A1 (fr) Ensemble d'amorces pour détecter un empoisonnement alimentaire, appareils de pcr utilisant celui-ci, et procédé pour détecter un empoisonnement alimentaire utilisant celui-ci
WO2017123533A1 (fr) Appareil de détection à microfluoromètre, système fluidique et module bride de verrouillage de cuve à circulation
KR101813870B1 (ko) 분자진단 자동분석장치
EP1670945A2 (fr) Microplaques utilisees pour effectuer une amplification nucleotidique par cyclage thermique
EP3954458A1 (fr) Dispositif d'amplification en chaîne par polymérase
WO2015102379A1 (fr) Dispositif de pcr en temps réel et ultra-rapide basé sur un laboratoire sur puce pour la détection de bactéries responsables d'intoxications alimentaires dans des denrées alimentaires agricoles et procédé de détection d'intoxication alimentaire utilisant celui-ci
WO2014022700A2 (fr) Dispositif fonctionnellement intégré pour identification génétique multiplexe et procédé de séparation et de détection de fragments d'adn
WO2019182407A1 (fr) Plaque d'analyse de réaction en chaîne par polymérase à grande vitesse
WO2022025381A1 (fr) Puce pcr multiplex et procédé de pcr multiplex l'utilisant
WO2014104771A1 (fr) Micro-puce pcr comprenant un ensemble d'amorces pour détecter une intoxication alimentaire, dispositif pcr en temps réel la comprenant et procédé permettant de détecter une intoxication alimentaire au moyen du dispositif
WO2014104770A1 (fr) Ensemble d'amorces pour la détection d'une intoxication alimentaire, appareil de pcr à l'aide de celui-ci, et procédé de détection d'une intoxication alimentaire à l'aide de ceux-ci
WO2013180406A1 (fr) Ensemble d'amorces pour la détection de la fièvre aphteuse selon le type de sérum, dispositif pcr l'utilisant et procédé de détection de la fièvre aphteuse par l'utilisation de celui-ci
CN111560310A (zh) 一种随机访问式数字核酸检测装置及使用方法
WO2014062033A1 (fr) Micro puce à pcr et dispositif de pcr en temps réel la comprenant
KR20180023545A (ko) 비정형 폐렴균 검출용 프라이머 및 프로브 세트, 이를 이용한 pcr 장치 및 비정형 폐렴균 검출 방법
KR20180023544A (ko) 정형성 폐렴균 검출용 프라이머 및 프로브 세트, 이를 이용한 pcr 장치 및 정형성 폐렴균 검출 방법
CN113512606A (zh) 基于蜂巢芯片的高通量检测肠道原虫的试剂盒及检测方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16761882

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16761882

Country of ref document: EP

Kind code of ref document: A1