WO2016143995A1

WO2016143995A1 - Multiplex pcr chip and multiplex pcr device comprising same

Info

Publication number: WO2016143995A1
Application number: PCT/KR2016/000304
Authority: WO
Inventors: 김성우; 김덕중; 김도희
Original assignee: 나노바이오시스 주식회사
Priority date: 2015-03-09
Filing date: 2016-01-12
Publication date: 2016-09-15
Also published as: KR20160110574A; KR101724281B1

Abstract

In accordance with an embodiment of the present invention, provided are a multiplex PCR chip, and a multiplex PCR device comprising the same. The chip comprises: a plurality of probes for use in hybridization reactions, which are specifically hybridized with different sequences of a plurality of different nucleic acid molecules in order to detect the nucleic acid molecules simultaneously, and are arranged spaced apart from each other; and a plurality of probe coupling parts which are arranged on the inner surface of the multiplex PCR chip, form a pore structure so as to increase the contact area between the probes and the nucleic acid molecules, and thereby allow the probes to be coupled to the pore structure, wherein the probes may be characterized in that a fluorescent substance and a fluorescence-inhibiting substance are combined at the terminal or the middle of a base sequence, respectively.

Description

Multiplex PCR chip and multiplex PCR device comprising the same

The present invention relates to a multiplex PCR chip and a multiplex PCR device comprising the same, more specifically, multiplex PCR chip for simultaneously detecting a plurality of nucleic acid molecules different from each other based on the position between a plurality of probes and comprising the same A multiplex PCR device.

Polymerase chain reaction (PCR), or PCR (Polymerase Chain Reaction), repeatedly heats and cools a sample solution containing a nucleic acid, thereby serially replicating a site having a specific nucleotide sequence of the nucleic acid to form a nucleic acid having the specific nucleotide sequence. As a technique of amplifying in series, it may be specifically carried out in a series of temperature enzyme reaction steps such as denaturation, annealing, and extension. PCR is widely used for analysis and diagnostic purposes in the life sciences, genetic engineering and medical fields.

On the other hand, the diagnosis through the nucleic acid amplification or a specific gene search technique has a limitation in that it searches for one template at a time. In situations where multiple molds have to be amplified, amplifying each one at a time is a cumbersome and time consuming task. For example, even if the same symptom occurs in the same patient, the cause of the onset is often caused by various kinds of infectious agents, and diagnosis of various pathogens is necessary individually. In addition, cancer and genetic defects are known to be caused by complex mutations of various genes. Genetic polymorphisms or mutations require additional screening of zygotes due to changes in loci of various genes. Since the amount of nucleic acid that can be extracted from a limited sample in a general environment is finite, it is often impossible to repeat the diagnosis through nucleic acid amplification using a limited amount of nucleic acid.

Therefore, there is a need for a technique for analyzing nucleic acids of many templates from the same sample at the same time, which may be referred to as multiplex PCR. In this regard, Figure 1 illustrates an exemplary process of conventional multiplex PCR.

Referring to FIG. 1, the conventional multiplex PCR may perform PCR by injecting a plurality of primer sets into one reaction vessel (or tube). Multiple sets of primers can be specifically hybridized to various sequences of nucleic acid molecules, so that multiple target nucleic acid sequences can be amplified at the same time. That is, multiplex PCR can identify / diagnose a plurality of genes and diseases in one experiment, thereby reducing the number of experiments and labor, and providing cost saving effects.

However, in order to monitor the amplification products of multiplex PCR in real time, special detection equipment is required, which increases the overall size and complexity of the PCR device, and as a result can be cost-effective. Specifically, the monitoring of the amplification products of multiplex PCR can be performed by irradiating excitation light and detecting the emission light generated during the amplification reaction, where the amplification for fluorescence is generated. Oligonucleotides (i.e., primers or probes) labeled with fluorescent dyes that can generate a signal indicative of the presence of the target nucleic acid sequence during the reaction are used, particularly in multiplex PCR to distinguish between multiple different nucleic acid sequences that can be amplified. To this end, various oligonucleotides specific to each nucleic acid sequence can be used. That is, in conventional multiplex PCR, multiple fluorescent dyes must be labeled for the detection of multiple target nucleic acid sequences, and also for detection of multiple fluorescences from the multiple fluorescent dyes, each in a separate wavelength band. There is a need for light sources and filters of multiple wavelengths that are optimized for the detection of fluorescent dyes. This requires multiple wavelength-specific measurement times to increase the time required to detect nucleic acid sequences, increase the overall size and complexity of the PCR device, and consequently can be cost-effective.

Therefore, there is a need for a multiplex PCR apparatus that is simple in overall structure, minimizes the overall PCR reaction time, and is capable of obtaining a reliable PCR reaction yield.

SUMMARY OF THE INVENTION The present invention has been made to solve the problem, and an object thereof is to provide a multiplex PCR device for simultaneously detecting a plurality of nucleic acid molecules different from each other based on positions between a plurality of probes.

Technical problems of the present invention are not limited to the technical problems mentioned above, and other technical problems not mentioned will be clearly understood by those skilled in the art from the following descriptions.

According to one embodiment of the present invention, a multiplex PCR chip is provided. The chip is

A plurality of hybridization probes specifically hybridized with different sequences of the nucleic acid molecules and spaced apart from each other to simultaneously detect a plurality of different nucleic acid molecules; And

A plurality of probe coupling portions disposed on an inner surface of the multiplex PCR chip to form a porous structure to increase a contact area between the probe and the nucleic acid molecule so that the probes are respectively coupled to the porous structure; Include,

The probe may be characterized in that a fluorescent substance and a fluorescent inhibitor are respectively bound to the end or the middle of the base sequence.

According to one embodiment of the invention, a multiplex PCR device is provided. The apparatus comprises the multiplex PCR chip; A light providing unit configured to irradiate excitation light toward the probe in the multiplex PCR chip; And a light detector for detecting emission light generated by the plurality of probes by the excitation light beam, wherein the light providing unit and the detection by the light detector are performed using light having a single or multiple wavelengths. It can be characterized.

According to one embodiment of the invention, a multiplex PCR device is provided. The apparatus comprises the multiplex PCR chip; And at least one heat block in contact with the multiplex PCR chip to transfer heat for multiplex PCR to the multiplex PCR chip.

According to the present invention, by arranging a plurality of probes that are specifically hybridized with sequences of different nucleic acid molecules, the sequences of nucleic acid molecules hybridized by the probes can be distinguished based on the positions between the probes. The need for different fluorescent dyes for labeling can be eliminated.

Further, according to the present invention, since the sequence of the nucleic acid molecule hybridized with the probe is distinguishable based on the separation position between the probes, multiplex real-time PCR using a single fluorescent dye is possible. This makes it possible to use only one light source and filter, thereby minimizing the size of the optical equipment and reducing the cost of the equipment, and also improving the efficiency of the operation of the multiplex PCR apparatus by reducing the time required for detection. have.

In addition, according to the present invention, multiple probes bind through predetermined probe bonds on the surface of the multiplex PCR chip, thereby providing more firm binding force, which is a distorted result occurring during separation and hybridization and washing of the bonds. Can be prevented.

In addition, according to the present invention, the probe coupling portion can form a porous structure (pore structure) and the probe is bonded to the surface of the porous structure, thereby increasing the contact area between the probe and the multiplex PCR product, it is possible to improve the reactivity. .

BRIEF DESCRIPTION OF THE DRAWINGS In order to better understand the drawings cited in the detailed description of the invention, a brief description of each drawing is provided.

1 illustrates an exemplary process of conventional multiplex PCR.

2 illustrates a multiplex PCR chip according to an embodiment of the present invention.

3 illustrates a multiplex PCR chip according to an embodiment of the present invention.

4 illustrates a multiplex PCR chip according to an embodiment of the present invention.

5 shows a multiplex PCR device according to an embodiment of the present invention.

6A and 6B show a multiplex PCR device according to an embodiment of the present invention.

7 shows a multiplex PCR device according to an embodiment of the present invention.

8 illustrates a fabrication of a multiplex PCR chip according to an embodiment of the present invention.

9 to 11 are the results obtained through the experimental example according to an embodiment of the present invention.

Hereinafter, embodiments according to the present invention will be described with reference to the accompanying drawings. In adding reference numerals to the components of each drawing, it should be noted that the same reference numerals are assigned to the same components as much as possible even though they are shown in different drawings. In addition, in describing the embodiments of the present invention, if it is determined that the detailed description of the related well-known configuration or function interferes with the understanding of the embodiments of the present invention, the detailed description thereof will be omitted. In addition, embodiments of the present invention will be described below, but the technical spirit of the present invention is not limited thereto and may be variously modified and modified by those skilled in the art.

Throughout the specification, when a part is "connected" to another part, this includes not only "directly connected" but also "indirectly connected" with another element in between. . Throughout the specification, when a part is said to "include" a certain component, it means that it can further include other components, without excluding other components unless specifically stated otherwise. In addition, in describing the components of the embodiment of the present invention, terms such as first, second, A, B, (a), and (b) may be used. These terms are only for distinguishing the components from other components, and the nature, order or order of the components are not limited by the terms.

The multiplex PCR device according to the present invention is a device for performing a multiplex polymerase chain reaction (PCR) to amplify various nucleic acids having a specific base sequence. Specifically, in order to amplify deoxyribonucleic acid (DNA) having a specific nucleotide sequence, the multiplex PCR apparatus heats a double strand of DNA by heating a sample solution containing a double strand of DNA to a specific temperature, for example, about 95 ° C. A denaturing step of separating single-stranded DNA, an oligonucleotide primer having a sequence complementary to the specific nucleotide sequence to be amplified in the sample solution, and providing a specific temperature with the isolated single-stranded DNA, For example, an annealing step in which a primer is attached to a specific base sequence of a single strand of DNA by cooling to 55 ° C. to form a partial DNA-primer complex, and the sample solution is subjected to an appropriate temperature, for example, after the annealing step. It is maintained at 72 ℃ to form a double strand of DNA based on the primer of the partial DNA-primer complex by DNA polymerase DNA having a specific base sequence can be exponentially amplified by performing an extension (or amplification) step and repeating three steps, for example, 20 to 40 times. Also, in some cases, the PCR apparatus may simultaneously perform an annealing step and an extension (or amplification) step, in which case the PCR apparatus performs two steps including an extension step and an annealing and an extension (or amplification) step. 1 You can also complete a cycle. Accordingly, the multiplex PCR apparatus according to an embodiment of the present invention refers to an apparatus including modules for performing steps, and detailed modules not described herein are disclosed and apparent in the prior art for performing PCR. It is assumed that it is equipped with all in the range.

In addition, the multiplex PCR device according to the present invention can perform the multiplex PCR and at the same time measure and analyze the presence and extent of the multiplex PCR product generation.

Referring to FIG. 2, the multiplex PCR chip 200 is for performing amplification (amplification reaction) of nucleic acid molecules, detection of a target sequence (hybridization reaction), and the like. It may include. Wherein the fluid is a nucleic acid such as double stranded DNA, an oligonucleotide primer having a sequence complementary to the specific nucleotide sequence to be amplified, DNA polymerase, deoxyribonucleotide triphosphates (dNTP), PCR reaction buffer (PCR). sample buffer, including a reaction buffer).

At least a part of the multiplex PCR chip 200 may be implemented with a light transmissive material, and may preferably include a light transmissive plastic material. Multiplex PCR chip 200 using a plastic material, can increase the heat transfer efficiency only by adjusting the thickness of the plastic, it is possible to reduce the manufacturing cost because the manufacturing process is simple. In addition, since the multiplex PCR chip 200 may have a light transmitting property as a whole, direct light irradiation is possible in a state in which it is disposed on one surface of the heat block, thereby measuring and analyzing nucleic acid amplification and amplification degree in real time. can do. For the amplification reaction, when the multiplex PCR chip 200 contacts the thermal block, the heat of the thermal block is transferred to the multiplex PCR chip 200 and included in the reaction region 224 of the multiplex PCR chip 200. The heated fluid may be heated or cooled to maintain a constant temperature. The multiplex PCR chip 200 may preferably have a planar shape as a whole, but is not limited thereto.

As shown in FIG. 2, the multiplex PCR chip 200 may include a probe 240 disposed therein for the hybridization reaction. Probe 240 is a labeled oligonucleotide capable of generating a signal indicative of the presence of a target nucleic acid sequence during an amplification reaction to detect nucleic acid to be amplified by PCR, and may specifically hybridize with the sequence of the nucleic acid molecule. Each probe 240 may hybridize to a different sequence of nucleic acid molecules.

In particular, the probe 240 may be (covalently) bonded to a portion of the base sequence, that is, a fluorescent material (fluorphore) and a quencher (quencher) at the end or the middle of the base sequence, respectively. Here, the fluorescent material refers to a fluorescent material such as, for example, FAM, and the fluorescent inhibitor suppresses fluorescence generation of the fluorescent material through, for example, fluorescence resonance energy transfer (FRET), for example, BHQ-1. (black hole quencher-1) and the like. According to the probe 240 having such a configuration, in the annealing step of the PCR reaction, the probe 240 hybridizes specifically to the sequence (ie, template DNA) of the nucleic acid molecule, wherein the fluorescent material is fluorescent Occurrence is suppressed. However, in the extension step of the PCR reaction, the probe 240 is decomposed due to the activity of exonuclease of the DNA polymerase, and at this time, the fluorescent material is released from the probe or is separated from the probe, thereby suppressing the fluorescence. May occur. That is, the probe 240 may detect the target nucleic acid (or target nucleic acid sequence) through fluorescence generation through hybridization with such target nucleic acid sequence, release, and distance.

In addition, each probe 240 may be coupled to be spaced apart from each other on the surface of the multiplex PCR chip 200. This bonding is performed by applying the probe 240 onto the surface of the multiplex PCR chip 200 using, for example, a spotter, an arrayer, an ink-jet, or the like. Can be. The separation between the probes allows identification of the detected nucleic acid only by detecting the location of the fluorescence.

Each probe 240 may be adsorbed on the surface of the multiplex PCR chip 200 or may be coupled through a probe coupling unit. The probe coupling units may provide more firm binding force than adsorption between the conventional probe 240 and the multiplex PCR chip 200. In addition, the probe binding portions may form a porous structure, and the probe 240 is bonded to the surface of the porous structure, thereby contacting the probe 240 with the multiplex PCR product (ie, amplified nucleic acid molecule). By increasing the area, the reactivity can be improved. The size of the porous structure will depend on molecular weight, UV curing and washing conditions, and the size can be formed from nanometer to micrometer level, thereby controlling the reactivity between the porous structure and the multiplex PCR product. . The porous structure is polyethylene glycol diacrylate (PEGDA), polyethylene glycol dimethacrylate (PEGDMA), 2-hydroxyethyl methacrylate (HEMA), ethylene glycol Ethylene glycol Diacrylate (EGDA), Ethylene glycol Dimethacrylate (EGDMA), Polyvinyl alcohol (PVA), agarose, silicon, and paraffin It can be formed by adding a photo initiator and a buffer to a porogen formed of at least one of a gel material, polyethylene glycol (PEG), and ethylene glycol (EG). have. The photoinitiator may be a linker or a spacer such as a PEG linker, a C linker, a TEG linker, or the like, 2-hydroxy-2-methyl-1-phenyl-1-propanone (2-Hydroxy-2-methyl- 1-phenyl-1-propanone), methylbenzoylformate, and the buffer may be Tris-EDTA buffer. In this case, the molecular weight of polyethylene glycol diacrylate (PEGDA) may be 10 to 50,000 MW, the molecular weight of polyethylene glycol (PEG) may be 10 to 50,000 MW, and polyethylene glycol diacrylate ( Polyethylene glycol Diacrylate, PEGDA) is 5 to 40% by weight, Polyethylene glycol (PEG) is 5 to 40% by weight, 2-hydroxy-2-methyl-1-phenyl-1-propanone (2-Hydroxy- 2-methyl-1-phenyl-1-propanone) may have a concentration ratio of 1 to 10%, and the Tris-EDTA buffer may have a concentration ratio of 0.1 to 30%. Meanwhile, the probe binding unit is a linker material such as hexa-ethylene glycol (18-atom hexa-ethleneglycol) or an acridite binding material (Acrydite binding material) that binds to a fluorescent material or a primer in 1 to 100 units. Porous structural binding materials such as Thiol binding material, biotin binding material, and amine binding material. In addition, the probe binding unit may further include a plurality of primers that specifically hybridize with different sequences of the nucleic acid molecules, such that the nucleic acid molecules hybridize to the primers and then hybridize with the probes. In addition, the probe 240 may be disposed on an upper surface of the reaction region 224 (or an upper inner surface of the multiplex PCR chip 200 or a lower surface of the third plate 230). Bubbles may occur during the PCR reaction, and these bubbles may cause interference in measuring the PCR reaction product. However, as shown in FIG. 2, the probe 240 is disposed on the upper surface of the reaction zone 224. Bubbles are moved around the probe 240, so that this interference can be eliminated to improve measurement efficiency.

The same fluorescent dye may be used for the plurality of probes 240. In the conventional multiplex PCR, probes 240 labeled with fluorescent dyes having different colors should be used to distinguish sequences of nucleic acid molecules hybridized by a plurality of probes 240, but in the present invention, Even if the same fluorescent dye is used, a plurality of probes 240 are spaced apart at predetermined intervals, and thus the sequence of nucleic acid molecules hybridized by the probes 240 can be distinguished based on the positions between these probes 240. The need for different fluorescent dyes can be eliminated.

The use of such identical fluorescent dyes can simplify the optical device for detecting fluorescence by fluorescent dyes. In conventional multiplex PCR, a number of different probes 240, which can hybridize specifically with the amplified sequences of nucleic acid molecules in one reaction vessel, are labeled with different fluorescent dyes and fluorescence by such fluorescent dyes Optical devices with multiple wavelengths specific to each fluorescent dye were used to distinguish light. However, in the present invention, even if fluorescence by the same dye sample, that is, fluorescence of the same color is generated by irradiating an excitation light having one wavelength toward the multiple probes 240, the position between the probes 240 Based on the sequence of the nucleic acid molecule to be amplified can be distinguished. That is, in the present invention, by using one light source and a filter, detection of a multiplex PCR product is possible, which not only reduces the size of the optical equipment and reduces the equipment cost, but also reduces the time required for detection. The efficiency of operation of the multiplex PCR device can be improved. However, according to the user's use, it is possible to irradiate the excitation light rays having a plurality of wavelengths toward the plurality of probes 240, and it may also distinguish the sequence of the nucleic acid molecules to be amplified based on the position between the probes 240, It is possible to further maximize the efficiency of the multiplex PCR device by allowing a more accurate number of measurements.

Looking at the structure of the multiplex PCR chip 200 shown in FIG. 2 in detail, a flat plate-shaped first plate 210 may be provided as a base of the multiplex PCR chip 200. The second plate 220 and the third plate 230 may be sequentially disposed on the first plate 210. The second plate 220 may be disposed on the first plate 210. The second plate 220 may include an inlet 222 through which a fluid (for example, a sample solution containing a nucleic acid to be amplified) is introduced, a reaction region through which the introduced fluid moves, and a PCR reaction and a hybridization reaction are performed ( 224 and an outlet portion 226 through which the reaction is completed is discharged. As shown, the reaction zone 224 of the second plate 220 is formed by recessing from the surface (eg, top and / or bottom) of the second plate 220 or through the second plate 220. Can be. In addition, the inlet part 222 and the outlet part 226 of the second plate 220 may pass through the second plate 220 and may protrude from the surface of the second plate 220. In addition, the thickness of the second plate 220 may vary, but may be selected from 0.1 mm to 2.0 mm. In addition, the width and length of the reaction zone 224 may vary, but preferably the width of the reaction zone 224 is selected from 0.5 mm to 3 mm, and the length of the reaction zone 224 is 20 mm to 60 mm. Can be selected from. In addition, the inner wall of the second plate 220 may be coated with a material such as silane-based and Bovine Serum Albumin (BSA) to prevent DNA and protein adsorption. The treatment can be performed according to methods known in the art. In addition, the inlet 222 may have various sizes, but preferably may be selected from 0.5 mm to 3.0 mm in diameter. In addition, the outlet portion 226 may have various sizes, but preferably may be selected from a diameter of 0.5 mm to 3.0 mm. The third plate 230 may be disposed on the second plate 220. Specifically, the third plate 230 is disposed on the second plate 220, so that a portion of the reaction zone 224 of the second plate 220 (that is, the reaction zone 224 of the second plate 220) is provided. At the same time, the PCR reaction product may be measured through at least one probe 240 spaced apart from each other on a portion of the lower surface of the third plate 230. The thickness of the third plate 230 may vary, but may preferably be selected from 0.1 mm to 2.0 mm. The shape of at least one of the first plate 210, the second plate 220 and the third plate 230 may be injection molded, hot-embossing, casting, laser ablation. It can be formed by various mechanical and chemical processing processes. The machining process is exemplary, and various machining processes may be applied according to the embodiment to which the present invention is applied. In addition, the bonding between the first plate 210 and the second plate 220 and / or the bonding between the second plate 220 and the third plate 230 may be, for example, thermal bonding, ultrasonic bonding, ultraviolet bonding, solvent, or the like. It can be carried out by various bonding methods applicable in the art, such as bonding, tape bonding. In some embodiments, surface treatment may be performed on at least a portion (eg, an inner wall of the second plate 220) of the inner surface of the multiplex PCR chip 200. For example, it may be coated with a material such as silane series, Bovine Serum Albumin (BSA) to prevent DNA and protein adsorption on the surface, such surface treatment is It can be performed according to various techniques known in the art. In addition, according to the embodiment, the multiplex PCR chip 200 is provided with separate cover means (not shown) for the inlet 222 and / or outlet 226, the inlet 222 and the outlet Contamination inside the multiplex PCR chip 200 through the unit 226 may be prevented, or leakage of fluid injected into the microfluidic chip 200 may be prevented. Such cover means may be embodied in various shapes, sizes or materials. The shape or structure of the multiplex PCR chip 200 shown in FIG. 2 is exemplary, and microfluidic chips of various shapes or structures may be used according to the embodiment to which the present invention is applied. In addition, the first plate 210, the second plate 220, or the third plate 230 may be implemented in various materials, but preferably, polymethylmethacrylate (PMMA), polycarbonate , PC), cycloolefin copolymer (COC), polyamide (PA), polyethylene (PE), polypropylene (PP), polyphenylene ether (PPE), polystyrene (polystyrene, PS), polyoxymethylene (POM), polyetheretherketone (PEEK), polytetrafluoroethylene (PTFE), polyvinylchloride (PVC), polyvinylidene fluoride (polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), fluorinated ethylene propylene (FEP), perfluoroalkoxyalkane (PFA), polydimethyl Siloxane (polydimethylsiloxane, PDMS), polypropylene carbonate (PPC), polyether sulfone (PES), polyethylene terephthalate (PET), polypropylene carbonate (PPC), polyether Sulfone (polyether sulfone, PES), and combinations thereof.

Referring to FIG. 3, in the multiplex PCR chip 300, the third plate 230 may include a portion of the reaction region 224 of the second plate 220 (that is, the reaction region of the second plate 220). 224) can be inserted into the through region. To this end, some regions of the lower surface of the third plate 230 may protrude downward. The protruded region covers the through region of the reaction region 224 of the second plate 220 and the ease of the third plate 230 and the second plate 220 through insertion into the through region. One joint alignment can be achieved. The shape of the multiplex PCR chip 300 illustrated in FIG. 3 is exemplary and various shapes may be applied according to an embodiment to which the present invention is applied. On the other hand, at least one region of the inner surface of the multiplex PCR chip 300 (that is, one region of the lower surface of the third plate 230) is treated with a hydrophilic material 310 to facilitate the performance of multiplex PCR. have. Hydrophilic material 310 may be a variety of materials, but may be preferably selected from the group consisting of carboxyl group (-COOH), amine group (-NH2), hydroxy group (-OH), and sulfone group (-SH). . In addition, the treatment of the hydrophilic material 310 may be treated by a method selected from the group consisting of oxygen and argon plasma treatment, corona discharge treatment, and surfactant application, which is exemplary, the embodiment to which the present invention is applied Depending on the various treatment methods known in the art can be applied.

Specifically, Figure 4 (a) shows a plan view of the multiplex PCR chip 500, Figure 4 (b) shows a cross-sectional view in the AA 'direction of the multiplex PCR chip 500, Figure 4 (c) shows a bottom perspective view of the inner surface of the multiplex PCR chip 500 shown in Figs. 4A and 4B.

Referring to FIG. 4, the multiplex PCR chip 500 may further include a probe fixing part 510. Probe fixing portion 510 is for receiving and fixing the probe 240 for the detection of the target sequence, for example, formed in one region of the lower surface of the third plate 230 of the multiplex PCR chip 500 It may be composed of a central portion 512 and a peripheral portion 514 protruding to surround the central portion 512. Here, the center portion 512 may provide an accommodation space of the probe 240, and the peripheral portion 514 may prevent the probe 240 from being separated from the center portion 512.

The shape of the probe fixing part 510 shown in FIG. 4 is exemplary, and various shapes of the probe fixing part may be used according to an embodiment to which the present invention is applied.

Referring to FIG. 5, the multiplex PCR device 1000 may be configured to drive light to provide light to a thermal block 900, multiplex PCR chips 200 to 700, and multiplex PCR chips 200 to 700. The display unit 1010 and the multiplex PCR chip (200 to 700) may further include a light detector 1020 is disposed to be driven to receive light.

The light providing unit 1010 may be a module for providing light to the multiplex PCR chips 200 to 700. In one embodiment, the light providing unit 1010 may include a light source for emitting light, such as a light emitting diode (LED) light source, a laser light source, a first light filter for selecting light having a predetermined wavelength from light emitted from the light source, and It may include a first optical lens for collecting the light emitted from the first optical filter to increase the intensity of the emitted light. According to an additional embodiment, the light provider 1010 may further include a first aspherical lens disposed to spread light between the light source and the first light filter. That is, by adjusting the arrangement direction of the first aspherical lens, it is possible to extend the light range emitted from the light source to reach the measurable area. However, the configuration of the light providing unit 1010 is not limited thereto.

The light detector 1020 is a module for receiving the light emitted from the multiplex PCR chips 200 to 700 and measuring a PCR reaction product performed by the multiplex PCR chips 200 to 700. Light emitted from the light passes through or reflects through the multiplex PCR chip 200 to 700, specifically, the reaction region 224 or the probe 240 of the multiplex PCR chip 200 to 700, in this case generated by nucleic acid amplification. The optical detector 1020 may detect the optical signal. In one embodiment, the light detector 1020 is a predetermined wavelength from the light emitted from the second optical lens, the second optical lens to collect the light emitted from the multiplex PCR chip (200 to 700) to increase the intensity of the emitted light It may include a second optical filter for selecting the light having a light analyzer for detecting an optical signal from the light emitted from the second optical filter. According to a further embodiment, a second aspherical lens and / or a second aspherical lens disposed between the second optical filter and the optical analyzer and / or between the second aspherical lens and the optical analyzer are arranged to integrate light emitted from the second optical filter. And a photodiode integrated circuit arranged to remove noise of the emitted light and to amplify the light emitted from the second aspherical lens.

Even if the light providing unit 1010 irradiates excitation light having one wavelength toward the various probes 240 in the multiplex PCR chips 200 to 700 to generate fluorescence by the same dye sample, that is, fluorescence of the same color, The sequence of the nucleic acid molecule to be amplified can be distinguished based on the position between the probes 240. Therefore, the light providing unit 1010 can detect the multiplex PCR product by using only one light source and the filter, without having to provide a plurality of light sources and filters. Similarly, the light detection unit 1020 can also detect a multiplex PCR product even if only one filter is provided. This configuration of the light providing unit 1010 and the light detecting unit 1020 can reduce the size of the optical equipment and reduce the equipment cost, as well as reduce the time required for detection, compared to the conventional multiplex PCR device. Can be.

In addition, during each circulation step of the multiplex PCR in the multiplex PCR chip 200 to 700, the targets are monitored in real time by monitoring the reaction result by the amplification of the nucleic acid in the reaction region 224, particularly in the probe 240. Whether to amplify the nucleic acid sequence and the degree of amplification can be measured and analyzed in real time.

Referring to FIG. 6A, the multiplex PCR device 1100 may include a substrate 1110; A first row block 900A disposed on the substrate 1110 and a second row block 900B spaced apart from the first row block 900A; It may include a chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted and a driving unit 1130 to move the chip holder 1120.

The substrate 1110 has no change in its physical and / or chemical properties due to the heating and temperature maintenance of the first thermal block 900A and the second thermal block 900B, and the first thermal block 900A and the second thermal block And any material having a material such that mutual heat exchange does not occur between 900B. For example, the substrate 1110 may include or consist of a material such as plastic.

The first row block 900A and the second row block 900B are for maintaining a temperature for performing a denaturation step, an annealing step and an extension (or amplification) step for amplifying a nucleic acid, which will be described with reference to FIG. 9. The description is the same as the column block 900 described above, and thus redundant descriptions are omitted. Each of the

thermal blocks

900A, 900B may be implemented to maintain an appropriate temperature for performing the denaturation step, or the annealing and extension (or amplification) steps. For example, the

thermal blocks

900A, 900B may maintain 50 ° C. to 100 ° C., and preferably, 90 ° C. to 100 ° C. when the denaturation step is performed in the

thermal blocks

900A, 900B, preferably Preferably, it may be maintained at 95 ° C., and may be maintained at 55 ° C. to 75 ° C., preferably at 72 ° C., when performing annealing and extension (or amplification) steps in

thermal blocks

900A and 900B. However, the temperature is not limited so long as the denaturation step or the annealing and extension (or amplification) step can be performed. The first row block 900A and the second row block 900B may be spaced apart at a predetermined distance such that mutual heat exchange does not occur. Accordingly, since no heat exchange occurs between the first heat block 900A and the second heat block 900B, in the nucleic acid amplification reaction that may be significantly affected by minute temperature changes, the denaturation step and annealing and extension are performed. Accurate temperature control of (or amplification) steps is possible. In addition, when the multiplex PCR chips 200 to 700 are in contact with one surface of each of the row blocks 900A and 900B, the first row block 900A and the second row block 900B are the multiplex PCR chips 200 to 700. The contact surface with 700 may be heated and temperature maintained as a whole, so that the fluid in the multiplex PCR chips 200 to 700 may be uniformly heated and temperature maintained. Conventional multiplex PCR devices using a single row block have a rate of change of temperature in a single row block within a range of 3 to 7 ° C. per second, whereas the multiplex PCR device 1100 includes two row blocks, thus each The rate of temperature change in the

thermal blocks

900A and 900B may be within a range of 20 to 40 ° C. per second to significantly shorten the multiplex PCR reaction time.

The chip holder 1120 may be equipped with multiplex PCR chips 200 to 700. The inner wall of the chip holder 1120 may have a shape and structure to be fixedly mounted to the outer walls of the multiplex PCR chips 200 to 700 so that the multiplex PCR chips 200 to 700 do not separate from the chip holder 1120. . In addition, the multiplex PCR chip 200 to 700 may be detachable to the chip holder 1120. The chip holder 1120 may be operably connected to the driving unit 1130.

The driver 1130 may move the chip holder 1120 left and right and / or up and down on the

thermal blocks

900A and 900B. In detail, the driver 1130 may include all means for allowing the chip holder 1120 to move left and right and / or up and down over the first row block 900A and the second row block 900B. By the left and right movement of the drive unit 1130, the chip holder 1120 is capable of reciprocating between the first row block 900A and the second row block 900B, and by the vertical movement of the drive unit 1130, The holder 1120 may be in contact with and separated from the first row block 900A and the second row block 900B. To this end, the driving unit 1130 includes a rail 1132 extending in the left and right directions, and a connecting member 1134 slidably moved in the left and right directions through the rail 1132 and slidable in the vertical direction. The chip holder 1120 may be disposed at one end of the connection member 1134.

Referring to FIG. 6B, the driver 1130 reciprocates the multiplex PCR chips 200 to 700 mounted on the chip holder 1120 while reciprocating between the first row block 900A and the second row block 900B. The reaction can be carried out.

First, the first heat block 900A may be heated and maintained at a temperature for the denaturation step, eg, 90 ° C. to 100 ° C., preferably at 95 ° C. In addition, the second row block 900B may be heated and maintained at a temperature for an annealing and extension (or amplification) step, eg, 55 ° C. to 75 ° C., preferably at 72 ° C.

After mounting the multiplex PCR chip 200 to 700 to the chip holder 1120 or at the same time by controlling the connecting member 1134 of the drive unit 1130 to move the multiplex PCR chip 200 to 700 downward, The chip holder 1120 equipped with the flex PCR chips 200 to 700 may be contacted with the first row block 900A to perform the first denaturation step of the multiplex PCR (step x).

Subsequently, the coupling member 1134 of the driving unit 1130 is controlled to move the multiplex PCR chips 200 to 700 upward, thereby to move the chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted. The first denaturation step of the multiplex PCR is terminated by separating from the thermal block 900A, and the multiplex PCR chips 200 to 700 are moved onto the second thermal block 900B through the rail 1132 of the driving unit 1130. (Y step).

Subsequently, the coupling member 1134 of the driving unit 1130 is controlled to move the multiplex PCR chips 200 to 700 downward to move the chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted. The thermal block 900B may be contacted to perform the first annealing and extension (or amplification) step of the multiplex PCR (step z).

Lastly, the multiplex PCR chip 200 to 700 is moved upward by controlling the connection member 1134 of the driving unit 1130, so that the chip holder 1120 on which the multiplex PCR chip 200 to 700 is mounted is second. Separating from the row block 900B terminates the first annealing and extension (or amplification) step of the multiplex PCR, and passes the multiplex PCR chips 200 to 700 through the rail 1132 of the driver 1130 in a first row. After moving up block 900A, the nucleic acid amplification reaction can be performed by repeating steps x, y, and z (circulation step).

Referring to FIG. 7, in the multiplex PCR apparatus 1200, the light providing unit 1010 and the light detecting unit 1020 may be disposed with the first column block 900A and the second column block 900B interposed therebetween. have. A through part 1136 may be formed in the driver 1130 to pass light emitted from the light providing part 1010 to measure light. The multiplex PCR chip 200 to 700 may be formed of a light transmissive material. It may be a light transmissive plastic material.

By arranging the light providing unit 1010 and the light detecting unit 1020 shown in FIG. 7, nucleic acids are amplified in the multiplex PCR chips 200 to 700 during the nucleic acid amplification reaction by the multiplex PCR device 1200. The degree can be detected in real time. In detail, the multiplex PCR chip reciprocates between the first row block 900A and the second row block 900B to perform each step of the PCR reaction. In this process, the driving unit 1130 may stop the multiplex PCR chip 200 to 700 on the spaced space between the first row block 900A and the second row block 900B. In this case, the light is emitted from the light providing unit 1010, and the emitted light is the multiplex PCR chip 200 to 700, specifically, the reaction region 224 or the probe 240 of the multiplex PCR chip 200 to 700. Since it passes through, the light detector 1020 can detect the optical signal generated by the amplification of the nucleic acid.

As described above, according to the multiplex PCR device 1100, the reaction result of the amplification of the nucleic acid in the reaction region 224, in particular the probe 240, in real time during each cyclic step of the multiplex PCR reaction is monitored in real time. The amount of target nucleic acid sequence can thereby be measured and analyzed in real time. 6A, 6B, and 7 illustrate a multiplex PCR apparatus for performing a PCR reaction using two

column blocks

900A and 900B, which are exemplary and used to perform a PCR reaction. The number of blocks can vary. For example, only one column block may be used for one multiplex PCR chip 200 to 700.

Experimental Example

1. Chip Manufacturing Process

A reaction probe and a probe coupling portion to be attached to the reaction region inside the chip were prepared. Polyethylene glycol Diacrylate (PEGDA) 5% to 40%, Polyethylene glycol (PEG) 5% to 40%, 2-hydroxy-2-methyl-1-phenyl to form a porous structure 1% to 10% of -1-propanone (2-Hydroxy-2-methyl-1-phenyl-1-propanone) at a concentration ratio, but prepolymer solution was prepared by adding TE buffer, 70% to 99.9 1X TE buffer Washing buffer was prepared at a concentration ratio of 0.1% to 30% of% and Tween-20, and the probe was prepared using 90% of the prepolymer solution and 10% of single-stranded DNA in which acrite and PEG linker were combined. Prepared (SEQ ID NO 1: Probe sequence: ACAGATGCCTTAACCTTTCCATGAGCGG). Thereafter, a multiplex PCR chip structure as shown in FIG. 2 was prepared, and a reaction probe and a probe coupling complex were attached to the porous structure formed in the reaction region inside the chip, and the polyethylene glycol was removed using a washing buffer to remove the porous structure. Was produced. The final prepared PCR chip is shown in FIG. 8.

2. PCR Reagent Composition

The reagent composition was positive control 1 (PC 1) containing only the probe in the porous structure of the PCR chip, positive control 2 (PC 2), positive control 3 (PC 3) in which the forward and reverse primers were added to the positive control 1 and 2 (SEQ ID NO 2: Forward primer sequence TGGTCATGGTGATGTTGATTACTATTCAG, SEQ ID NO: 3: Reverse primer sequence ACGTCTTACTTGCACTGATTGATTCA). Reagent composition for each group is shown in Table 1 below.

PCR 시약 조성PCR reagent composition
시약 조성Reagent Composition	양성 대조군(Gel: Probe only)Positive control (Gel: Probe only)	양성 대조군(Gel: Probe only)Positive control (Gel: Probe only)	양성 대조군(Gel: Primer / Probe)Positive Control (Gel: Primer / Probe)
NBS Taqman2X master mixNBS Taqman2X master mix	10㎕10 μl	10㎕10 μl	10㎕10 μl
PrimerPrimer	2㎕2 μl	2㎕2 μl	--
Template(Target DNA)Template (Target DNA)	1㎕1 μl	1㎕1 μl	1㎕1 μl
DWDW	7㎕7 μl	7㎕7 μl	9㎕9 μl
TotalTotal	20㎕20 μl	20㎕20 μl	20㎕20 μl

3. PCR Execution Conditions

PCR performance conditions were 95 ° C., pre-denaturation for 8 seconds, 95 ° C., denaturation for 3 seconds, and 68 ° C., 14 for the processed target sample (Taget gene sequence). The annealing step for 40 seconds was cycled (SEQ ID NO 4: Target gene sequence: TAA TGA CCC TAA AGG TTT TAA CCT GAA GTA CCG TTA TGA ACT CGA TGA TAA CTG GGG AGT AAT AGG TTC GTT TGC TTA) TAC TCA TCA GGG ATA TGA TTT CTT CTA TGG CAG TAA TAA GTT TGG TCA TGG TGA TGT TGA TTA CTA TTC AGT AAC AAT GGG GCC ATC TTT CCG CAT CAA CGA ATA TGT TAG CCT TTA TGG ATT ACT GGG GGC CGG TCA TGG AAA GGC ATC TGT ATT TGA TGA ATC AAT CAG TGC AAG TAA GAC GTC AAT GGC ATA CGG GGC AGG GGT GCA ATT CAA CCC ACT TCC AAA TTT TGT CAT TGA CGC TTC ATA TGA ATA CTC CAA ACT CGA TAG CAT AAA AGT TGG CAC TGG TGC AGG GTA TCG ATT CTA A).

4. Result of PCR

PCR performance was confirmed by three methods. 9 is an electrophoretic picture of positive control 1, positive control 2, and positive control 3 from the left marker to the right. If this is different, it can be seen that PCR was successfully performed in the chip. In addition, FIG. 10 is a fluorescence expression photograph of the chip of the positive control 1, positive control 2, positive control 3 from the left side, according to the 40 cycles, the fluorescence expression was successfully performed specifically for the third porous structure in all 40 cycles You can see that. FIG. 11 is a graph of fluorescence measurements for positive control (PC 1), positive control 2 (PC 2), and positive control 3 (PC 3), with positive control 1 (PC 1) and positive control 2 (PC 2) and PCR progress was confirmed in positive control 3 (PC 3). Through these results, it is confirmed that the porous structure-based multiplex PCR device according to the embodiment of the present invention not only can perform PCR faster than the conventional method, but also can perform real-time PCR that is more precise and accurate to maximize reliability. Can be.

As described above, optimal embodiments have been disclosed in the drawings and the specification. Although specific terms have been used herein, they are used only for the purpose of describing the present invention and are not intended to limit the scope of the invention as defined in the claims or the claims. Therefore, those skilled in the art will understand that various modifications and equivalent other embodiments are possible from this. Therefore, the true technical protection scope of the present invention will be defined by the technical spirit of the appended claims.

Claims

As a multiplex polymerase chain reaction (PCR) chip,

A plurality of hybridization probes specifically hybridized with different sequences of the nucleic acid molecules and spaced apart from each other to simultaneously detect a plurality of different nucleic acid molecules; And

A plurality of probe coupling portions disposed on an inner surface of the multiplex PCR chip to form a porous structure to increase a contact area between the probe and the nucleic acid molecule so that the probes are respectively coupled to the porous structure; Include,

The probe is a multiplex PCR chip, characterized in that the fluorescent material and the fluorescence inhibitor is bound to the end or the middle of the base sequence, respectively.
The method of claim 1, wherein the probe is specifically hybridized to the sequence of the nucleic acid molecule, the fluorescence generation of the fluorescent material is inhibited by the fluorescent inhibitor, and the probe is degraded by double-stranded hybridization of the nucleic acid molecule. When the fluorescent material is released from the probe or the distance is far multiplex PCR chip, characterized in that the fluorescence occurs.
The multiplex PCR chip of claim 1, wherein the probe binding unit further comprises a plurality of primers that specifically hybridize to different sequences of the nucleic acid molecule.
The method of claim 1, wherein the porous structure is polyethylene glycol diacrylate (PEGDA), polyethylene glycol dimethacrylate (PEGDMA), 2-hydroxyethyl methacrylate (2-hydroxyethyl methacrylate , HEMA), ethylene glycol diacrylate (EGDA), ethylene glycol methacrylate (EGDMA), polyvinyl alcohol (PVA), agarose, silicon (silicone) And a photoinitiator and a buffer in a porogen comprising at least one of a gel material, polyethylene glycol (PEG), and ethylene glycol (EG), which are composed of at least one of paraffin and paraffin. Multiplex PCR chip, characterized in that formed by the addition.
The multiplex PCR chip of claim 1, wherein the probe binding unit comprises a linker material and a porous structure binding material that bind to the fluorescent material.
The multiplex PCR chip of claim 3, wherein the probe binding unit comprises a linker material and a porous structure binding material that bind to the primer.
According to claim 1, wherein the multiplex PCR chip, The plate-shaped first plate; A second plate disposed on the first plate and including an inlet, a reaction zone and an outlet; And a third plate disposed on the second plate to cover the reaction region and spaced apart from the probe on a lower surface thereof, the third plate protruding adjacent to the center so as to surround the center and the center where the probe is disposed. Multiplex PCR chip further comprises a probe fixing portion consisting of a peripheral portion formed.
A multiplex PCR chip according to any one of claims 1 to 7;

A light providing unit configured to irradiate excitation light toward the probe in the multiplex PCR chip; And

It includes a light detection unit for detecting the fluorescence (emission light) generated by a plurality of probes by the excitation light,

The multiplex PCR device, characterized in that the detection by the light providing unit and the light detector is performed using light of a single or multiple wavelengths.
A multiplex PCR chip according to any one of claims 1 to 7; And

And at least one thermal block in contact with the multiplex PCR chip to transfer heat for multiplex PCR to the multiplex PCR chip.