WO2016143995A1 - Multiplex pcr chip and multiplex pcr device comprising same - Google Patents
Multiplex pcr chip and multiplex pcr device comprising same Download PDFInfo
- Publication number
- WO2016143995A1 WO2016143995A1 PCT/KR2016/000304 KR2016000304W WO2016143995A1 WO 2016143995 A1 WO2016143995 A1 WO 2016143995A1 KR 2016000304 W KR2016000304 W KR 2016000304W WO 2016143995 A1 WO2016143995 A1 WO 2016143995A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- multiplex pcr
- probe
- nucleic acid
- chip
- pcr chip
- Prior art date
Links
Images
Classifications
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L7/00—Heating or cooling apparatus; Heat insulating devices
- B01L7/52—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
- B01L7/00—Heating or cooling apparatus; Heat insulating devices
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Definitions
- the present invention relates to a multiplex PCR chip and a multiplex PCR device comprising the same, more specifically, multiplex PCR chip for simultaneously detecting a plurality of nucleic acid molecules different from each other based on the position between a plurality of probes and comprising the same A multiplex PCR device.
- PCR Polymerase chain reaction
- PCR Polymerase Chain Reaction
- the diagnosis through the nucleic acid amplification or a specific gene search technique has a limitation in that it searches for one template at a time.
- amplifying each one at a time is a cumbersome and time consuming task.
- cancer and genetic defects are known to be caused by complex mutations of various genes. Genetic polymorphisms or mutations require additional screening of zygotes due to changes in loci of various genes. Since the amount of nucleic acid that can be extracted from a limited sample in a general environment is finite, it is often impossible to repeat the diagnosis through nucleic acid amplification using a limited amount of nucleic acid.
- Figure 1 illustrates an exemplary process of conventional multiplex PCR.
- the conventional multiplex PCR may perform PCR by injecting a plurality of primer sets into one reaction vessel (or tube). Multiple sets of primers can be specifically hybridized to various sequences of nucleic acid molecules, so that multiple target nucleic acid sequences can be amplified at the same time. That is, multiplex PCR can identify / diagnose a plurality of genes and diseases in one experiment, thereby reducing the number of experiments and labor, and providing cost saving effects.
- the monitoring of the amplification products of multiplex PCR can be performed by irradiating excitation light and detecting the emission light generated during the amplification reaction, where the amplification for fluorescence is generated.
- Oligonucleotides i.e., primers or probes
- fluorescent dyes that can generate a signal indicative of the presence of the target nucleic acid sequence during the reaction are used, particularly in multiplex PCR to distinguish between multiple different nucleic acid sequences that can be amplified.
- oligonucleotides specific to each nucleic acid sequence can be used. That is, in conventional multiplex PCR, multiple fluorescent dyes must be labeled for the detection of multiple target nucleic acid sequences, and also for detection of multiple fluorescences from the multiple fluorescent dyes, each in a separate wavelength band. There is a need for light sources and filters of multiple wavelengths that are optimized for the detection of fluorescent dyes. This requires multiple wavelength-specific measurement times to increase the time required to detect nucleic acid sequences, increase the overall size and complexity of the PCR device, and consequently can be cost-effective.
- the present invention has been made to solve the problem, and an object thereof is to provide a multiplex PCR device for simultaneously detecting a plurality of nucleic acid molecules different from each other based on positions between a plurality of probes.
- a multiplex PCR chip is provided.
- the chip is
- a plurality of hybridization probes specifically hybridized with different sequences of the nucleic acid molecules and spaced apart from each other to simultaneously detect a plurality of different nucleic acid molecules
- the probe may be characterized in that a fluorescent substance and a fluorescent inhibitor are respectively bound to the end or the middle of the base sequence.
- a multiplex PCR device comprises the multiplex PCR chip; A light providing unit configured to irradiate excitation light toward the probe in the multiplex PCR chip; And a light detector for detecting emission light generated by the plurality of probes by the excitation light beam, wherein the light providing unit and the detection by the light detector are performed using light having a single or multiple wavelengths. It can be characterized.
- a multiplex PCR device comprises the multiplex PCR chip; And at least one heat block in contact with the multiplex PCR chip to transfer heat for multiplex PCR to the multiplex PCR chip.
- the sequences of nucleic acid molecules hybridized by the probes can be distinguished based on the positions between the probes.
- the need for different fluorescent dyes for labeling can be eliminated.
- the sequence of the nucleic acid molecule hybridized with the probe is distinguishable based on the separation position between the probes.
- multiplex real-time PCR using a single fluorescent dye is possible. This makes it possible to use only one light source and filter, thereby minimizing the size of the optical equipment and reducing the cost of the equipment, and also improving the efficiency of the operation of the multiplex PCR apparatus by reducing the time required for detection. have.
- multiple probes bind through predetermined probe bonds on the surface of the multiplex PCR chip, thereby providing more firm binding force, which is a distorted result occurring during separation and hybridization and washing of the bonds. Can be prevented.
- the probe coupling portion can form a porous structure (pore structure) and the probe is bonded to the surface of the porous structure, thereby increasing the contact area between the probe and the multiplex PCR product, it is possible to improve the reactivity. .
- FIG. 1 illustrates an exemplary process of conventional multiplex PCR.
- FIG. 2 illustrates a multiplex PCR chip according to an embodiment of the present invention.
- FIG 3 illustrates a multiplex PCR chip according to an embodiment of the present invention.
- FIG. 4 illustrates a multiplex PCR chip according to an embodiment of the present invention.
- FIG. 5 shows a multiplex PCR device according to an embodiment of the present invention.
- 6A and 6B show a multiplex PCR device according to an embodiment of the present invention.
- FIG. 7 shows a multiplex PCR device according to an embodiment of the present invention.
- FIG. 8 illustrates a fabrication of a multiplex PCR chip according to an embodiment of the present invention.
- the multiplex PCR device is a device for performing a multiplex polymerase chain reaction (PCR) to amplify various nucleic acids having a specific base sequence.
- PCR polymerase chain reaction
- the multiplex PCR apparatus heats a double strand of DNA by heating a sample solution containing a double strand of DNA to a specific temperature, for example, about 95 ° C.
- a denaturing step of separating single-stranded DNA, an oligonucleotide primer having a sequence complementary to the specific nucleotide sequence to be amplified in the sample solution, and providing a specific temperature with the isolated single-stranded DNA For example, an annealing step in which a primer is attached to a specific base sequence of a single strand of DNA by cooling to 55 ° C. to form a partial DNA-primer complex, and the sample solution is subjected to an appropriate temperature, for example, after the annealing step.
- the multiplex PCR apparatus refers to an apparatus including modules for performing steps, and detailed modules not described herein are disclosed and apparent in the prior art for performing PCR. It is assumed that it is equipped with all in the range.
- the multiplex PCR device can perform the multiplex PCR and at the same time measure and analyze the presence and extent of the multiplex PCR product generation.
- FIG. 2 illustrates a multiplex PCR chip according to an embodiment of the present invention.
- the multiplex PCR chip 200 is for performing amplification (amplification reaction) of nucleic acid molecules, detection of a target sequence (hybridization reaction), and the like. It may include.
- the fluid is a nucleic acid such as double stranded DNA, an oligonucleotide primer having a sequence complementary to the specific nucleotide sequence to be amplified, DNA polymerase, deoxyribonucleotide triphosphates (dNTP), PCR reaction buffer (PCR). sample buffer, including a reaction buffer).
- At least a part of the multiplex PCR chip 200 may be implemented with a light transmissive material, and may preferably include a light transmissive plastic material.
- Multiplex PCR chip 200 using a plastic material can increase the heat transfer efficiency only by adjusting the thickness of the plastic, it is possible to reduce the manufacturing cost because the manufacturing process is simple.
- the multiplex PCR chip 200 may have a light transmitting property as a whole, direct light irradiation is possible in a state in which it is disposed on one surface of the heat block, thereby measuring and analyzing nucleic acid amplification and amplification degree in real time. can do.
- the multiplex PCR chip 200 contacts the thermal block, the heat of the thermal block is transferred to the multiplex PCR chip 200 and included in the reaction region 224 of the multiplex PCR chip 200.
- the heated fluid may be heated or cooled to maintain a constant temperature.
- the multiplex PCR chip 200 may preferably have a planar shape as a whole, but is not limited thereto.
- the multiplex PCR chip 200 may include a probe 240 disposed therein for the hybridization reaction.
- Probe 240 is a labeled oligonucleotide capable of generating a signal indicative of the presence of a target nucleic acid sequence during an amplification reaction to detect nucleic acid to be amplified by PCR, and may specifically hybridize with the sequence of the nucleic acid molecule.
- Each probe 240 may hybridize to a different sequence of nucleic acid molecules.
- the probe 240 may be (covalently) bonded to a portion of the base sequence, that is, a fluorescent material (fluorphore) and a quencher (quencher) at the end or the middle of the base sequence, respectively.
- the fluorescent material refers to a fluorescent material such as, for example, FAM
- the fluorescent inhibitor suppresses fluorescence generation of the fluorescent material through, for example, fluorescence resonance energy transfer (FRET), for example, BHQ-1. (black hole quencher-1) and the like.
- FRET fluorescence resonance energy transfer
- the probe 240 in the annealing step of the PCR reaction, the probe 240 hybridizes specifically to the sequence (ie, template DNA) of the nucleic acid molecule, wherein the fluorescent material is fluorescent Occurrence is suppressed.
- the probe 240 in the extension step of the PCR reaction, the probe 240 is decomposed due to the activity of exonuclease of the DNA polymerase, and at this time, the fluorescent material is released from the probe or is separated from the probe, thereby suppressing the fluorescence. May occur. That is, the probe 240 may detect the target nucleic acid (or target nucleic acid sequence) through fluorescence generation through hybridization with such target nucleic acid sequence, release, and distance.
- each probe 240 may be coupled to be spaced apart from each other on the surface of the multiplex PCR chip 200. This bonding is performed by applying the probe 240 onto the surface of the multiplex PCR chip 200 using, for example, a spotter, an arrayer, an ink-jet, or the like. Can be. The separation between the probes allows identification of the detected nucleic acid only by detecting the location of the fluorescence.
- Each probe 240 may be adsorbed on the surface of the multiplex PCR chip 200 or may be coupled through a probe coupling unit.
- the probe coupling units may provide more firm binding force than adsorption between the conventional probe 240 and the multiplex PCR chip 200.
- the probe binding portions may form a porous structure, and the probe 240 is bonded to the surface of the porous structure, thereby contacting the probe 240 with the multiplex PCR product (ie, amplified nucleic acid molecule). By increasing the area, the reactivity can be improved.
- the size of the porous structure will depend on molecular weight, UV curing and washing conditions, and the size can be formed from nanometer to micrometer level, thereby controlling the reactivity between the porous structure and the multiplex PCR product.
- the porous structure is polyethylene glycol diacrylate (PEGDA), polyethylene glycol dimethacrylate (PEGDMA), 2-hydroxyethyl methacrylate (HEMA), ethylene glycol Ethylene glycol Diacrylate (EGDA), Ethylene glycol Dimethacrylate (EGDMA), Polyvinyl alcohol (PVA), agarose, silicon, and paraffin It can be formed by adding a photo initiator and a buffer to a porogen formed of at least one of a gel material, polyethylene glycol (PEG), and ethylene glycol (EG).
- the photoinitiator may be a linker or a spacer such as a PEG linker, a C linker, a TEG linker, or the like, 2-hydroxy-2-methyl-1-phenyl-1-propanone (2-Hydroxy-2-methyl- 1-phenyl-1-propanone), methylbenzoylformate, and the buffer may be Tris-EDTA buffer.
- the molecular weight of polyethylene glycol diacrylate (PEGDA) may be 10 to 50,000 MW
- the molecular weight of polyethylene glycol (PEG) may be 10 to 50,000 MW
- polyethylene glycol diacrylate ( Polyethylene glycol Diacrylate, PEGDA) is 5 to 40% by weight
- Polyethylene glycol (PEG) is 5 to 40% by weight
- 2-hydroxy-2-methyl-1-phenyl-1-propanone (2-Hydroxy- 2-methyl-1-phenyl-1-propanone) may have a concentration ratio of 1 to 10%
- the Tris-EDTA buffer may have a concentration ratio of 0.1 to 30%.
- the probe binding unit is a linker material such as hexa-ethylene glycol (18-atom hexa-ethleneglycol) or an acridite binding material (Acrydite binding material) that binds to a fluorescent material or a primer in 1 to 100 units. Porous structural binding materials such as Thiol binding material, biotin binding material, and amine binding material.
- the probe binding unit may further include a plurality of primers that specifically hybridize with different sequences of the nucleic acid molecules, such that the nucleic acid molecules hybridize to the primers and then hybridize with the probes.
- the probe 240 may be disposed on an upper surface of the reaction region 224 (or an upper inner surface of the multiplex PCR chip 200 or a lower surface of the third plate 230). Bubbles may occur during the PCR reaction, and these bubbles may cause interference in measuring the PCR reaction product. However, as shown in FIG. 2, the probe 240 is disposed on the upper surface of the reaction zone 224. Bubbles are moved around the probe 240, so that this interference can be eliminated to improve measurement efficiency.
- the same fluorescent dye may be used for the plurality of probes 240.
- probes 240 labeled with fluorescent dyes having different colors should be used to distinguish sequences of nucleic acid molecules hybridized by a plurality of probes 240, but in the present invention, Even if the same fluorescent dye is used, a plurality of probes 240 are spaced apart at predetermined intervals, and thus the sequence of nucleic acid molecules hybridized by the probes 240 can be distinguished based on the positions between these probes 240. The need for different fluorescent dyes can be eliminated.
- the present invention by using one light source and a filter, detection of a multiplex PCR product is possible, which not only reduces the size of the optical equipment and reduces the equipment cost, but also reduces the time required for detection.
- the efficiency of operation of the multiplex PCR device can be improved.
- a flat plate-shaped first plate 210 may be provided as a base of the multiplex PCR chip 200.
- the second plate 220 and the third plate 230 may be sequentially disposed on the first plate 210.
- the second plate 220 may be disposed on the first plate 210.
- the second plate 220 may include an inlet 222 through which a fluid (for example, a sample solution containing a nucleic acid to be amplified) is introduced, a reaction region through which the introduced fluid moves, and a PCR reaction and a hybridization reaction are performed ( 224 and an outlet portion 226 through which the reaction is completed is discharged.
- a fluid for example, a sample solution containing a nucleic acid to be amplified
- the reaction zone 224 of the second plate 220 is formed by recessing from the surface (eg, top and / or bottom) of the second plate 220 or through the second plate 220. Can be.
- the inlet part 222 and the outlet part 226 of the second plate 220 may pass through the second plate 220 and may protrude from the surface of the second plate 220.
- the thickness of the second plate 220 may vary, but may be selected from 0.1 mm to 2.0 mm.
- the width and length of the reaction zone 224 may vary, but preferably the width of the reaction zone 224 is selected from 0.5 mm to 3 mm, and the length of the reaction zone 224 is 20 mm to 60 mm. Can be selected from.
- the inner wall of the second plate 220 may be coated with a material such as silane-based and Bovine Serum Albumin (BSA) to prevent DNA and protein adsorption.
- BSA Bovine Serum Albumin
- the treatment can be performed according to methods known in the art.
- the inlet 222 may have various sizes, but preferably may be selected from 0.5 mm to 3.0 mm in diameter.
- the outlet portion 226 may have various sizes, but preferably may be selected from a diameter of 0.5 mm to 3.0 mm.
- the third plate 230 may be disposed on the second plate 220.
- the third plate 230 is disposed on the second plate 220, so that a portion of the reaction zone 224 of the second plate 220 (that is, the reaction zone 224 of the second plate 220) is provided.
- the PCR reaction product may be measured through at least one probe 240 spaced apart from each other on a portion of the lower surface of the third plate 230.
- the thickness of the third plate 230 may vary, but may preferably be selected from 0.1 mm to 2.0 mm.
- the shape of at least one of the first plate 210, the second plate 220 and the third plate 230 may be injection molded, hot-embossing, casting, laser ablation. It can be formed by various mechanical and chemical processing processes.
- the machining process is exemplary, and various machining processes may be applied according to the embodiment to which the present invention is applied.
- the bonding between the first plate 210 and the second plate 220 and / or the bonding between the second plate 220 and the third plate 230 may be, for example, thermal bonding, ultrasonic bonding, ultraviolet bonding, solvent, or the like. It can be carried out by various bonding methods applicable in the art, such as bonding, tape bonding.
- surface treatment may be performed on at least a portion (eg, an inner wall of the second plate 220) of the inner surface of the multiplex PCR chip 200.
- the multiplex PCR chip 200 may be coated with a material such as silane series, Bovine Serum Albumin (BSA) to prevent DNA and protein adsorption on the surface, such surface treatment is It can be performed according to various techniques known in the art.
- the multiplex PCR chip 200 is provided with separate cover means (not shown) for the inlet 222 and / or outlet 226, the inlet 222 and the outlet Contamination inside the multiplex PCR chip 200 through the unit 226 may be prevented, or leakage of fluid injected into the microfluidic chip 200 may be prevented.
- cover means may be embodied in various shapes, sizes or materials. The shape or structure of the multiplex PCR chip 200 shown in FIG.
- first plate 210, the second plate 220, or the third plate 230 may be implemented in various materials, but preferably, polymethylmethacrylate (PMMA), polycarbonate , PC), cycloolefin copolymer (COC), polyamide (PA), polyethylene (PE), polypropylene (PP), polyphenylene ether (PPE), polystyrene (polystyrene, PS), polyoxymethylene (POM), polyetheretherketone (PEEK), polytetrafluoroethylene (PTFE), polyvinylchloride (PVC), polyvinylidene fluoride (polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), fluorinated ethylene propylene (FEP), perfluoroalkoxyalkane (PFA), polydimethyl Siloxane (pol
- PMMA polymethylmethacrylate
- PC polycarbonate
- COC cycloolefin copolymer
- PA
- FIG 3 illustrates a multiplex PCR chip according to an embodiment of the present invention.
- the third plate 230 may include a portion of the reaction region 224 of the second plate 220 (that is, the reaction region of the second plate 220). 224) can be inserted into the through region. To this end, some regions of the lower surface of the third plate 230 may protrude downward. The protruded region covers the through region of the reaction region 224 of the second plate 220 and the ease of the third plate 230 and the second plate 220 through insertion into the through region. One joint alignment can be achieved.
- the shape of the multiplex PCR chip 300 illustrated in FIG. 3 is exemplary and various shapes may be applied according to an embodiment to which the present invention is applied.
- At least one region of the inner surface of the multiplex PCR chip 300 (that is, one region of the lower surface of the third plate 230) is treated with a hydrophilic material 310 to facilitate the performance of multiplex PCR.
- Hydrophilic material 310 may be a variety of materials, but may be preferably selected from the group consisting of carboxyl group (-COOH), amine group (-NH2), hydroxy group (-OH), and sulfone group (-SH). .
- the treatment of the hydrophilic material 310 may be treated by a method selected from the group consisting of oxygen and argon plasma treatment, corona discharge treatment, and surfactant application, which is exemplary, the embodiment to which the present invention is applied Depending on the various treatment methods known in the art can be applied.
- FIG. 4 illustrates a multiplex PCR chip according to an embodiment of the present invention.
- Figure 4 (a) shows a plan view of the multiplex PCR chip 500
- Figure 4 (b) shows a cross-sectional view in the AA 'direction of the multiplex PCR chip 500
- Figure 4 (c) shows a bottom perspective view of the inner surface of the multiplex PCR chip 500 shown in Figs. 4A and 4B.
- the multiplex PCR chip 500 may further include a probe fixing part 510.
- Probe fixing portion 510 is for receiving and fixing the probe 240 for the detection of the target sequence, for example, formed in one region of the lower surface of the third plate 230 of the multiplex PCR chip 500 It may be composed of a central portion 512 and a peripheral portion 514 protruding to surround the central portion 512.
- the center portion 512 may provide an accommodation space of the probe 240, and the peripheral portion 514 may prevent the probe 240 from being separated from the center portion 512.
- the shape of the probe fixing part 510 shown in FIG. 4 is exemplary, and various shapes of the probe fixing part may be used according to an embodiment to which the present invention is applied.
- FIG. 5 shows a multiplex PCR device according to an embodiment of the present invention.
- the multiplex PCR device 1000 may be configured to drive light to provide light to a thermal block 900, multiplex PCR chips 200 to 700, and multiplex PCR chips 200 to 700.
- the display unit 1010 and the multiplex PCR chip (200 to 700) may further include a light detector 1020 is disposed to be driven to receive light.
- the light providing unit 1010 may be a module for providing light to the multiplex PCR chips 200 to 700.
- the light providing unit 1010 may include a light source for emitting light, such as a light emitting diode (LED) light source, a laser light source, a first light filter for selecting light having a predetermined wavelength from light emitted from the light source, and It may include a first optical lens for collecting the light emitted from the first optical filter to increase the intensity of the emitted light.
- the light provider 1010 may further include a first aspherical lens disposed to spread light between the light source and the first light filter. That is, by adjusting the arrangement direction of the first aspherical lens, it is possible to extend the light range emitted from the light source to reach the measurable area.
- the configuration of the light providing unit 1010 is not limited thereto.
- the light detector 1020 is a module for receiving the light emitted from the multiplex PCR chips 200 to 700 and measuring a PCR reaction product performed by the multiplex PCR chips 200 to 700. Light emitted from the light passes through or reflects through the multiplex PCR chip 200 to 700, specifically, the reaction region 224 or the probe 240 of the multiplex PCR chip 200 to 700, in this case generated by nucleic acid amplification.
- the optical detector 1020 may detect the optical signal.
- the light detector 1020 is a predetermined wavelength from the light emitted from the second optical lens, the second optical lens to collect the light emitted from the multiplex PCR chip (200 to 700) to increase the intensity of the emitted light It may include a second optical filter for selecting the light having a light analyzer for detecting an optical signal from the light emitted from the second optical filter.
- a second aspherical lens and / or a second aspherical lens disposed between the second optical filter and the optical analyzer and / or between the second aspherical lens and the optical analyzer are arranged to integrate light emitted from the second optical filter.
- a photodiode integrated circuit arranged to remove noise of the emitted light and to amplify the light emitted from the second aspherical lens.
- the light providing unit 1010 can detect the multiplex PCR product by using only one light source and the filter, without having to provide a plurality of light sources and filters.
- the light detection unit 1020 can also detect a multiplex PCR product even if only one filter is provided. This configuration of the light providing unit 1010 and the light detecting unit 1020 can reduce the size of the optical equipment and reduce the equipment cost, as well as reduce the time required for detection, compared to the conventional multiplex PCR device. Can be.
- the targets are monitored in real time by monitoring the reaction result by the amplification of the nucleic acid in the reaction region 224, particularly in the probe 240. Whether to amplify the nucleic acid sequence and the degree of amplification can be measured and analyzed in real time.
- 6A and 6B show a multiplex PCR device according to an embodiment of the present invention.
- the multiplex PCR device 1100 may include a substrate 1110; A first row block 900A disposed on the substrate 1110 and a second row block 900B spaced apart from the first row block 900A; It may include a chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted and a driving unit 1130 to move the chip holder 1120.
- the substrate 1110 has no change in its physical and / or chemical properties due to the heating and temperature maintenance of the first thermal block 900A and the second thermal block 900B, and the first thermal block 900A and the second thermal block And any material having a material such that mutual heat exchange does not occur between 900B.
- the substrate 1110 may include or consist of a material such as plastic.
- the first row block 900A and the second row block 900B are for maintaining a temperature for performing a denaturation step, an annealing step and an extension (or amplification) step for amplifying a nucleic acid, which will be described with reference to FIG. 9.
- the description is the same as the column block 900 described above, and thus redundant descriptions are omitted.
- Each of the thermal blocks 900A, 900B may be implemented to maintain an appropriate temperature for performing the denaturation step, or the annealing and extension (or amplification) steps.
- the thermal blocks 900A, 900B may maintain 50 ° C. to 100 ° C., and preferably, 90 ° C. to 100 ° C.
- the denaturation step when the denaturation step is performed in the thermal blocks 900A, 900B, preferably Preferably, it may be maintained at 95 ° C., and may be maintained at 55 ° C. to 75 ° C., preferably at 72 ° C., when performing annealing and extension (or amplification) steps in thermal blocks 900A and 900B.
- the temperature is not limited so long as the denaturation step or the annealing and extension (or amplification) step can be performed.
- the first row block 900A and the second row block 900B may be spaced apart at a predetermined distance such that mutual heat exchange does not occur.
- the denaturation step and annealing and extension are performed. Accurate temperature control of (or amplification) steps is possible.
- the multiplex PCR chips 200 to 700 are in contact with one surface of each of the row blocks 900A and 900B, the first row block 900A and the second row block 900B are the multiplex PCR chips 200 to 700.
- the contact surface with 700 may be heated and temperature maintained as a whole, so that the fluid in the multiplex PCR chips 200 to 700 may be uniformly heated and temperature maintained.
- the chip holder 1120 may be equipped with multiplex PCR chips 200 to 700.
- the inner wall of the chip holder 1120 may have a shape and structure to be fixedly mounted to the outer walls of the multiplex PCR chips 200 to 700 so that the multiplex PCR chips 200 to 700 do not separate from the chip holder 1120.
- the multiplex PCR chip 200 to 700 may be detachable to the chip holder 1120.
- the chip holder 1120 may be operably connected to the driving unit 1130.
- the driver 1130 may move the chip holder 1120 left and right and / or up and down on the thermal blocks 900A and 900B.
- the driver 1130 may include all means for allowing the chip holder 1120 to move left and right and / or up and down over the first row block 900A and the second row block 900B.
- the chip holder 1120 is capable of reciprocating between the first row block 900A and the second row block 900B, and by the vertical movement of the drive unit 1130, The holder 1120 may be in contact with and separated from the first row block 900A and the second row block 900B.
- the driving unit 1130 includes a rail 1132 extending in the left and right directions, and a connecting member 1134 slidably moved in the left and right directions through the rail 1132 and slidable in the vertical direction.
- the chip holder 1120 may be disposed at one end of the connection member 1134.
- the driver 1130 reciprocates the multiplex PCR chips 200 to 700 mounted on the chip holder 1120 while reciprocating between the first row block 900A and the second row block 900B.
- the reaction can be carried out.
- the first heat block 900A may be heated and maintained at a temperature for the denaturation step, eg, 90 ° C. to 100 ° C., preferably at 95 ° C.
- the second row block 900B may be heated and maintained at a temperature for an annealing and extension (or amplification) step, eg, 55 ° C. to 75 ° C., preferably at 72 ° C.
- the chip holder 1120 equipped with the flex PCR chips 200 to 700 may be contacted with the first row block 900A to perform the first denaturation step of the multiplex PCR (step x).
- the coupling member 1134 of the driving unit 1130 is controlled to move the multiplex PCR chips 200 to 700 upward, thereby to move the chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted.
- the first denaturation step of the multiplex PCR is terminated by separating from the thermal block 900A, and the multiplex PCR chips 200 to 700 are moved onto the second thermal block 900B through the rail 1132 of the driving unit 1130. (Y step).
- the coupling member 1134 of the driving unit 1130 is controlled to move the multiplex PCR chips 200 to 700 downward to move the chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted.
- the thermal block 900B may be contacted to perform the first annealing and extension (or amplification) step of the multiplex PCR (step z).
- the multiplex PCR chip 200 to 700 is moved upward by controlling the connection member 1134 of the driving unit 1130, so that the chip holder 1120 on which the multiplex PCR chip 200 to 700 is mounted is second. Separating from the row block 900B terminates the first annealing and extension (or amplification) step of the multiplex PCR, and passes the multiplex PCR chips 200 to 700 through the rail 1132 of the driver 1130 in a first row.
- the nucleic acid amplification reaction can be performed by repeating steps x, y, and z (circulation step).
- FIG. 7 shows a multiplex PCR device according to an embodiment of the present invention.
- the light providing unit 1010 and the light detecting unit 1020 may be disposed with the first column block 900A and the second column block 900B interposed therebetween. have.
- a through part 1136 may be formed in the driver 1130 to pass light emitted from the light providing part 1010 to measure light.
- the multiplex PCR chip 200 to 700 may be formed of a light transmissive material. It may be a light transmissive plastic material.
- nucleic acids are amplified in the multiplex PCR chips 200 to 700 during the nucleic acid amplification reaction by the multiplex PCR device 1200.
- the degree can be detected in real time.
- the multiplex PCR chip reciprocates between the first row block 900A and the second row block 900B to perform each step of the PCR reaction.
- the driving unit 1130 may stop the multiplex PCR chip 200 to 700 on the spaced space between the first row block 900A and the second row block 900B.
- the light is emitted from the light providing unit 1010, and the emitted light is the multiplex PCR chip 200 to 700, specifically, the reaction region 224 or the probe 240 of the multiplex PCR chip 200 to 700. Since it passes through, the light detector 1020 can detect the optical signal generated by the amplification of the nucleic acid.
- the reaction result of the amplification of the nucleic acid in the reaction region 224, in particular the probe 240, in real time during each cyclic step of the multiplex PCR reaction is monitored in real time.
- the amount of target nucleic acid sequence can thereby be measured and analyzed in real time.
- 6A, 6B, and 7 illustrate a multiplex PCR apparatus for performing a PCR reaction using two column blocks 900A and 900B, which are exemplary and used to perform a PCR reaction.
- the number of blocks can vary. For example, only one column block may be used for one multiplex PCR chip 200 to 700.
- a reaction probe and a probe coupling portion to be attached to the reaction region inside the chip were prepared.
- the reagent composition was positive control 1 (PC 1) containing only the probe in the porous structure of the PCR chip, positive control 2 (PC 2), positive control 3 (PC 3) in which the forward and reverse primers were added to the positive control 1 and 2 (SEQ ID NO 2: Forward primer sequence TGGTCATGGTGATGTTGATTACTATTCAG, SEQ ID NO: 3: Reverse primer sequence ACGTCTTACTTGCACTGATTGATTCA).
- Reagent composition for each group is shown in Table 1 below.
- PCR reagent composition Reagent Composition Positive control (Gel: Probe only) Positive control (Gel: Probe only) Positive Control (Gel: Primer / Probe) NBS Taqman2X master mix 10 ⁇ l 10 ⁇ l 10 ⁇ l Primer 2 ⁇ l 2 ⁇ l - Template (Target DNA) 1 ⁇ l 1 ⁇ l 1 ⁇ l DW 7 ⁇ l 7 ⁇ l 9 ⁇ l Total 20 ⁇ l 20 ⁇ l 20 ⁇ l 20 ⁇ l 20 ⁇ l
- PCR performance conditions were 95 ° C., pre-denaturation for 8 seconds, 95 ° C., denaturation for 3 seconds, and 68 ° C., 14 for the processed target sample (Taget gene sequence).
- the annealing step for 40 seconds was cycled (SEQ ID NO 4: Target gene sequence: TAA TGA CCC TAA AGG TTT TAA CCT GAA GTA CCG TTA TGA ACT CGA TGA TAA CTG GGG AGT AAT AGG TTC GTT TGC TTA) TAC TCA TCA GGG ATA TGA TTT CTT CTA TGG CAG TAA TAA GTT TGG TCA TGG TGA TGT TGA TTA CTA TTC AGT AAC AAT GGG GCC ATC TTT CCG CAT CAA CGA ATA TGT TAG CCT TTA TGG ATT ACT GGG GGC CGG TCA TGG AAA GGC ATC TGT ATT TGA TGA ATC AAT CAG TGC AAG TAA GAC G
- FIG. 9 is an electrophoretic picture of positive control 1, positive control 2, and positive control 3 from the left marker to the right. If this is different, it can be seen that PCR was successfully performed in the chip.
- FIG. 10 is a fluorescence expression photograph of the chip of the positive control 1, positive control 2, positive control 3 from the left side, according to the 40 cycles, the fluorescence expression was successfully performed specifically for the third porous structure in all 40 cycles You can see that.
- FIG. 11 is a graph of fluorescence measurements for positive control (PC 1), positive control 2 (PC 2), and positive control 3 (PC 3), with positive control 1 (PC 1) and positive control 2 (PC 2) and PCR progress was confirmed in positive control 3 (PC 3).
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Clinical Laboratory Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
In accordance with an embodiment of the present invention, provided are a multiplex PCR chip, and a multiplex PCR device comprising the same. The chip comprises: a plurality of probes for use in hybridization reactions, which are specifically hybridized with different sequences of a plurality of different nucleic acid molecules in order to detect the nucleic acid molecules simultaneously, and are arranged spaced apart from each other; and a plurality of probe coupling parts which are arranged on the inner surface of the multiplex PCR chip, form a pore structure so as to increase the contact area between the probes and the nucleic acid molecules, and thereby allow the probes to be coupled to the pore structure, wherein the probes may be characterized in that a fluorescent substance and a fluorescence-inhibiting substance are combined at the terminal or the middle of a base sequence, respectively.
Description
본 발명은 멀티플렉스 PCR 칩 및 이를 포함하는 멀티플렉스 PCR 장치에 관한 것으로서, 더 구체적으로는 다수의 프로브 간의 위치에 기초하여 서로 상이한 복수의 핵산 분자를 동시에 검출하기 위한 멀티플렉스 PCR 칩 및 이를 포함하는 멀티플렉스 PCR 장치에 관한 것이다.The present invention relates to a multiplex PCR chip and a multiplex PCR device comprising the same, more specifically, multiplex PCR chip for simultaneously detecting a plurality of nucleic acid molecules different from each other based on the position between a plurality of probes and comprising the same A multiplex PCR device.
중합효소 연쇄 반응, 즉 PCR(Polymerase Chain Reaction)은 핵산을 포함하는 샘플 용액을 반복적으로 가열 및 냉각하여 핵산의 특정 염기 서열을 갖는 부위를 연쇄적으로 복제하여 그 특정 염기 서열 부위를 갖는 핵산을 기하급수적으로 증폭하는 기술로써, 구체적으로 변성(Denaturation), 어닐링(Annealing), 및 신장(Extension) 등의 일련의 온도 효소 반응 단계로 진행될 수 있다. PCR은 생명과학, 유전공학 및 의료 분야 등에서 분석 및 진단 목적으로 널리 사용되고 있다.Polymerase chain reaction (PCR), or PCR (Polymerase Chain Reaction), repeatedly heats and cools a sample solution containing a nucleic acid, thereby serially replicating a site having a specific nucleotide sequence of the nucleic acid to form a nucleic acid having the specific nucleotide sequence. As a technique of amplifying in series, it may be specifically carried out in a series of temperature enzyme reaction steps such as denaturation, annealing, and extension. PCR is widely used for analysis and diagnostic purposes in the life sciences, genetic engineering and medical fields.
한편, 위와 같은 핵산 증폭을 통한 진단이나 특정 유전자의 검색 기법은 한번에 하나의 주형을 검색한다는 점에서 한계를 가진다. 여러 개의 주형을 증폭해야 하는 상황에서 각각의 주형을 한번에 하나씩 증폭하는 것은 번거롭고 시간을 많이 소비하는 작업이다. 예를 들면 같은 환자에게 같은 증상이 발생할지라도 발병의 원인이 여러 종류의 감염성 병원체에 의한 경우가 많아서 다양한 병원체의 진단이 개별적으로 필요하게 된다. 또한, 암이나 유전적인 결함 등은 여러 유전자의 복합적인 변이에 기인한다고 알려져 있다. 유전자 다형성(polymorphim)이나 돌연변이(mutation)는 다양한 유전자의 좌위(loci) 변화에 기인하여 추가적인 접합체(zygote)의 검사가 필요하다. 일반적인 환경에서 제한된 시료에서 추출할 수 있는 핵산의 양은 유한하므로, 제한된 양의 핵산을 이용하여 핵산 증폭을 통한 반복적인 진단이 불가능할 경우가 자주 발생할 수 있다.On the other hand, the diagnosis through the nucleic acid amplification or a specific gene search technique has a limitation in that it searches for one template at a time. In situations where multiple molds have to be amplified, amplifying each one at a time is a cumbersome and time consuming task. For example, even if the same symptom occurs in the same patient, the cause of the onset is often caused by various kinds of infectious agents, and diagnosis of various pathogens is necessary individually. In addition, cancer and genetic defects are known to be caused by complex mutations of various genes. Genetic polymorphisms or mutations require additional screening of zygotes due to changes in loci of various genes. Since the amount of nucleic acid that can be extracted from a limited sample in a general environment is finite, it is often impossible to repeat the diagnosis through nucleic acid amplification using a limited amount of nucleic acid.
따라서 같은 시료로부터 동시에 많은 주형의 핵산을 분석하는 기법이 필요하고, 이런 분석 기법은 멀티플렉스 PCR(multiplex PCR)로 지칭될 수 있다. 이와 관련하여, 도 1은 종래의 멀티플렉스 PCR의 예시적인 프로세스를 도시한다.Therefore, there is a need for a technique for analyzing nucleic acids of many templates from the same sample at the same time, which may be referred to as multiplex PCR. In this regard, Figure 1 illustrates an exemplary process of conventional multiplex PCR.
도 1을 참조하면, 종래의 멀티플렉스 PCR은 하나의 반응 용기(또는 튜브(tube))에 다종의 프라이머 세트를 주입하여 PCR을 수행할 수 있다. 다종의 프라이머 세트는 핵산 분자의 다양한 서열에 특이적으로 혼성화될 수 있으며, 따라서 동시에 다수의 표적 핵산 서열이 증폭될 수 있다. 즉, 멀티플렉스 PCR은 한 번의 실험으로 복수의 유전자 및 질병 확인/진단 가능하고, 이를 통해 실험 횟수 및 노동력 감소시키고, 비용 절감의 효과를 제공할 수 있다.Referring to FIG. 1, the conventional multiplex PCR may perform PCR by injecting a plurality of primer sets into one reaction vessel (or tube). Multiple sets of primers can be specifically hybridized to various sequences of nucleic acid molecules, so that multiple target nucleic acid sequences can be amplified at the same time. That is, multiplex PCR can identify / diagnose a plurality of genes and diseases in one experiment, thereby reducing the number of experiments and labor, and providing cost saving effects.
그러나 멀티플렉스 PCR의 증폭 산물을 실시간으로 모니터링하기 위해서는 특수한 검출 장비가 요구되는데, 이는 PCR 장치의 전체적인 크기 및 복잡도를 증가시키고, 결과적으로 비용-비경제적일 수 있다. 구체적으로, 멀티플렉스 PCR의 증폭 산물의 모니터링은 증폭 반응이 진행되는 동안 여기 광선(excitation light)을 조사하고 이로부터 발생하는 형광(emission light)을 검출함으로써 수행될 수 있으며, 여기서 형광 발생을 위해서는 증폭반응 동안 표적 핵산 서열의 존재를 나타내는 시그널을 발생할 수 있는 형광 염료에 의해 표지된 올리고뉴클레오타이드(즉, 프라이머 또는 프로브)를 사용하는데, 특히 멀티플렉스 PCR에서는 증폭될 수 있는 다수의 다양한 핵산 서열을 구분하기 위해, 각 핵산 서열에 특이적인 다양한 올리고뉴클레오타이드가 이용될 수 있다. 즉, 종래의 멀티플렉스 PCR에서는 다종의 표적 핵산 서열의 검출을 위해, 다종의 형광 염료가 표지되어야 하며, 또한, 다종의 형광 염료로부터의 다종의 형광 검출을 위해, 별개의 파장 대역에서의 각각의 형광 염료의 검출을 위해 최적화되는 다수의 파장의 광원 및 필터가 요구된다. 이는 다수 파장별 측정 시간을 필요로 하여 핵산 서열의 검출에 소요되는 시간을 증가시키고, PCR 장치의 전체적인 크기 및 복잡도를 증가시키고, 결과적으로 비용-비경제적일 수 있다.However, in order to monitor the amplification products of multiplex PCR in real time, special detection equipment is required, which increases the overall size and complexity of the PCR device, and as a result can be cost-effective. Specifically, the monitoring of the amplification products of multiplex PCR can be performed by irradiating excitation light and detecting the emission light generated during the amplification reaction, where the amplification for fluorescence is generated. Oligonucleotides (i.e., primers or probes) labeled with fluorescent dyes that can generate a signal indicative of the presence of the target nucleic acid sequence during the reaction are used, particularly in multiplex PCR to distinguish between multiple different nucleic acid sequences that can be amplified. To this end, various oligonucleotides specific to each nucleic acid sequence can be used. That is, in conventional multiplex PCR, multiple fluorescent dyes must be labeled for the detection of multiple target nucleic acid sequences, and also for detection of multiple fluorescences from the multiple fluorescent dyes, each in a separate wavelength band. There is a need for light sources and filters of multiple wavelengths that are optimized for the detection of fluorescent dyes. This requires multiple wavelength-specific measurement times to increase the time required to detect nucleic acid sequences, increase the overall size and complexity of the PCR device, and consequently can be cost-effective.
따라서, 전체 구조가 단순하고, 전체 PCR 반응 시간을 최소화할 뿐만 아니라, 신뢰할 수 있는 PCR 반응 수율을 얻을 수 있는 멀티플렉스 PCR 장치가 요구된다.Therefore, there is a need for a multiplex PCR apparatus that is simple in overall structure, minimizes the overall PCR reaction time, and is capable of obtaining a reliable PCR reaction yield.
본 발명은 문제점을 해결하기 위한 것으로서, 다수의 프로브 간의 위치에 기초하여 서로 상이한 복수의 핵산 분자를 동시에 검출하기 위한 멀티플렉스 PCR 장치를 제공하는 것을 목적으로 한다.SUMMARY OF THE INVENTION The present invention has been made to solve the problem, and an object thereof is to provide a multiplex PCR device for simultaneously detecting a plurality of nucleic acid molecules different from each other based on positions between a plurality of probes.
본 발명의 기술적 과제들은 이상에서 언급한 기술적 과제들로 제한되지 않으며, 언급되지 않은 또 다른 기술적 과제들은 아래의 기재들로부터 당업자에게 명확하게 이해될 수 있을 것이다.Technical problems of the present invention are not limited to the technical problems mentioned above, and other technical problems not mentioned will be clearly understood by those skilled in the art from the following descriptions.
본 발명의 일 실시예에 따라, 멀티플렉스 PCR 칩이 제공된다. 상기 칩은 According to one embodiment of the present invention, a multiplex PCR chip is provided. The chip is
서로 상이한 다수의 핵산 분자를 동시에 탐지하기 위해 상기 핵산 분자의 서로 상이한 서열과 특이적으로 혼성화되며, 서로 이격하여 배치되는 다수의 혼성화 반응용 프로브(probe); 및A plurality of hybridization probes specifically hybridized with different sequences of the nucleic acid molecules and spaced apart from each other to simultaneously detect a plurality of different nucleic acid molecules; And
상기 멀티플렉스 PCR 칩의 내부 표면에 배치되어, 상기 프로브와 상기 핵산 분자 간의 접촉 면적을 증가시키도록 다공 구조(pore structure)를 형성하여 상기 다공 구조에 상기 프로브가 각각 결합되도록 하는 다수의 프로브 결합부를 포함하며,A plurality of probe coupling portions disposed on an inner surface of the multiplex PCR chip to form a porous structure to increase a contact area between the probe and the nucleic acid molecule so that the probes are respectively coupled to the porous structure; Include,
상기 프로브는 염기 서열의 말단 또는 중간에 각각 형광 물질 및 형광 억제 물질이 결합되는 것을 특징으로 할 수 있다.The probe may be characterized in that a fluorescent substance and a fluorescent inhibitor are respectively bound to the end or the middle of the base sequence.
본 발명의 일 실시예에 따라, 멀티플렉스 PCR 장치가 제공된다. 상기 장치는 상기 멀티플렉스 PCR 칩; 상기 멀티플렉스 PCR 칩 내의 상기 프로브를 향해 여기 광선(excitation light)을 조사하는 광 제공부; 및 상기 여기 광선에 의하여 다수의 프로브에서 발생하는 형광(emission light)을 검출하는 광 검출부를 포함하고, 상기 광 제공부 및 광 검출부에 의한 검출은 단일 또는 다수의 파장의 광을 이용하여 수행되는 것을 특징으로 할 수 있다.According to one embodiment of the invention, a multiplex PCR device is provided. The apparatus comprises the multiplex PCR chip; A light providing unit configured to irradiate excitation light toward the probe in the multiplex PCR chip; And a light detector for detecting emission light generated by the plurality of probes by the excitation light beam, wherein the light providing unit and the detection by the light detector are performed using light having a single or multiple wavelengths. It can be characterized.
본 발명의 일 실시예에 따라, 멀티플렉스 PCR 장치가 제공된다. 상기 장치는 상기 멀티플렉스 PCR 칩; 및 상기 멀티플렉스 PCR 칩에 접촉하여, 상기 멀티플렉스 PCR 칩에 멀티플렉스 PCR을 위한 열을 전달하는 적어도 하나의 열 블록을 포함하는 것을 특징으로 할 수 있다.According to one embodiment of the invention, a multiplex PCR device is provided. The apparatus comprises the multiplex PCR chip; And at least one heat block in contact with the multiplex PCR chip to transfer heat for multiplex PCR to the multiplex PCR chip.
본 발명에 따르면, 서로 상이한 핵산 분자의 서열과 특이적으로 혼성화되는 다종의 프로브를 이격하여 배치함으로써, 이러한 프로브 간의 위치에 기초하여 프로브에 의해 혼성화되는 핵산 분자의 서열을 구분할 수 있기에, 상기 프로브에 표지하기 위한 상이한 형광 염료의 필요성을 제거할 수 있다.According to the present invention, by arranging a plurality of probes that are specifically hybridized with sequences of different nucleic acid molecules, the sequences of nucleic acid molecules hybridized by the probes can be distinguished based on the positions between the probes. The need for different fluorescent dyes for labeling can be eliminated.
또한, 본 발명에 따르면, 프로브 간의 이격 위치에 기초하여 프로브와 혼성화되는 핵산 분자의 서열이 구분가능하기 때문에, 단일 형광 염료(dye)를 사용하는 멀티플랙스 실시간 PCR이 가능하다. 이는 1종의 광원 및 필터만을 사용하게 함으로써, 광학 장비의 크기를 소형화하고 장비 가격을 감소시킬 수 있을 뿐만 아니라, 검출에 소요되는 시간을 감소시키는 등 멀티플렉스 PCR 장치의 동작의 효율을 향상시킬 수 있다.Further, according to the present invention, since the sequence of the nucleic acid molecule hybridized with the probe is distinguishable based on the separation position between the probes, multiplex real-time PCR using a single fluorescent dye is possible. This makes it possible to use only one light source and filter, thereby minimizing the size of the optical equipment and reducing the cost of the equipment, and also improving the efficiency of the operation of the multiplex PCR apparatus by reducing the time required for detection. have.
또한, 본 발명에 따르면, 다종의 프로브가 멀티플렉스 PCR 칩의 표면 상에서 소정의 프로브 결합부를 통해 결합함으로써, 더 견고한 결합력을 제공할 수 있으며, 이는 결합의 분리 및 혼성화와 세척 동안 발생하는 왜곡된 결과를 예방할 수 있다. In addition, according to the present invention, multiple probes bind through predetermined probe bonds on the surface of the multiplex PCR chip, thereby providing more firm binding force, which is a distorted result occurring during separation and hybridization and washing of the bonds. Can be prevented.
또한, 본 발명에 따르면, 상기 프로브 결합부는 다공 구조(pore structure)를 형성할 수 있으며 다공 구조 표면에 프로브가 결합함으로써, 프로브와 멀티플렉스 PCR 산물간의 접촉 면적을 증가시켜, 반응성을 향상시킬 수 있다.In addition, according to the present invention, the probe coupling portion can form a porous structure (pore structure) and the probe is bonded to the surface of the porous structure, thereby increasing the contact area between the probe and the multiplex PCR product, it is possible to improve the reactivity. .
본 발명의 상세한 설명에서 인용되는 도면을 보다 충분히 이해하기 위하여 각 도면의 간단한 설명이 제공된다.BRIEF DESCRIPTION OF THE DRAWINGS In order to better understand the drawings cited in the detailed description of the invention, a brief description of each drawing is provided.
도 1은 종래의 멀티플렉스 PCR의 예시적인 프로세스를 도시한다.1 illustrates an exemplary process of conventional multiplex PCR.
도 2는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 칩을 도시한다.2 illustrates a multiplex PCR chip according to an embodiment of the present invention.
도 3은 본 발명의 일 실시예에 따른 멀티플렉스 PCR 칩을 도시한다.3 illustrates a multiplex PCR chip according to an embodiment of the present invention.
도 4는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 칩을 도시한다.4 illustrates a multiplex PCR chip according to an embodiment of the present invention.
도 5는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 장치를 도시한다.5 shows a multiplex PCR device according to an embodiment of the present invention.
도 6a 및 6b는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 장치를 도시한다.6A and 6B show a multiplex PCR device according to an embodiment of the present invention.
도 7은 본 발명의 일 실시예에 따른 멀티플렉스 PCR 장치를 도시한다.7 shows a multiplex PCR device according to an embodiment of the present invention.
도 8은 본 발명의 일 실시예에 따른 멀티플렉스 PCR 칩의 제작물을 도시한다.8 illustrates a fabrication of a multiplex PCR chip according to an embodiment of the present invention.
도 9 내지 11은 본 발명의 일 실시예에 따른 실험예를 통해 얻은 결과이다.9 to 11 are the results obtained through the experimental example according to an embodiment of the present invention.
이하, 본 발명에 따른 실시예들은 첨부된 도면들을 참조하여 설명한다. 각 도면의 구성요소들에 참조부호를 부가함에 있어서, 동일한 구성요소들에 대해서는 비록 다른 도면상에 표시되더라도 가능한 한 동일한 부호를 가지도록 하고 있음에 유의해야 한다. 또한, 본 발명의 실시예를 설명함에 있어, 관련된 공지 구성 또는 기능에 대한 구체적인 설명이 본 발명의 실시예에 대한 이해를 방해한다고 판단되는 경우에는 그 상세한 설명은 생략한다. 또한, 이하에서 본 발명의 실시예들을 설명할 것이나, 본 발명의 기술적 사상은 이에 한정되거나 제한되지 않고 당업자에 의해 변형되어 다양하게 실시될 수 있다.Hereinafter, embodiments according to the present invention will be described with reference to the accompanying drawings. In adding reference numerals to the components of each drawing, it should be noted that the same reference numerals are assigned to the same components as much as possible even though they are shown in different drawings. In addition, in describing the embodiments of the present invention, if it is determined that the detailed description of the related well-known configuration or function interferes with the understanding of the embodiments of the present invention, the detailed description thereof will be omitted. In addition, embodiments of the present invention will be described below, but the technical spirit of the present invention is not limited thereto and may be variously modified and modified by those skilled in the art.
명세서 전체에서, 어떤 부분이 다른 부분과 "연결"되어 있다고 할 때, 이는 "직접적으로 연결"되어 있는 경우뿐 아니라, 그 중간에 다른 소자를 사이에 두고 "간접적으로 연결"되어 있는 경우도 포함한다. 명세서 전체에서, 어떤 부분이 어떤 구성요소를 "포함"한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성요소를 더 포함할 수 있는 것을 의미한다. 또한, 본 발명의 실시예의 구성 요소를 설명하는 데 있어서, 제 1, 제 2, A, B, (a), (b) 등의 용어를 사용할 수 있다. 이러한 용어는 그 구성 요소를 다른 구성 요소와 구별하기 위한 것일 뿐, 그 용어에 의해 해당 구성 요소의 본질이나 차례 또는 순서 등이 한정되지 않는다.Throughout the specification, when a part is "connected" to another part, this includes not only "directly connected" but also "indirectly connected" with another element in between. . Throughout the specification, when a part is said to "include" a certain component, it means that it can further include other components, without excluding other components unless specifically stated otherwise. In addition, in describing the components of the embodiment of the present invention, terms such as first, second, A, B, (a), and (b) may be used. These terms are only for distinguishing the components from other components, and the nature, order or order of the components are not limited by the terms.
본 발명에 따른 멀티플렉스 PCR 장치는 특정 염기 서열을 갖는 다양한 핵산을 증폭하는 멀티플렉스 PCR(Multiplex Polymerase Chain Reaction)을 수행하기 위한 장치이다. 구체적으로, 멀티플렉스 PCR 장치는 특정 염기 서열을 갖는 DNA(deoxyribonucleic acid)를 증폭하기 위해, 이중 가닥의 DNA를 포함하는 샘플 용액을 특정 온도, 예를 들어 약 95℃로 가열하여 이중 가닥의 DNA를 단일 가닥의 DNA로 분리하는 변성 단계(denaturing step), 샘플 용액에 증폭하고자 하는 특정 염기 서열과 상보적인 서열을 갖는 올리고뉴클레오티드(oligonucleotide) 프라이머를 제공하고, 분리된 단일 가닥의 DNA와 함께 특정 온도, 예를 들어 55℃로 냉각하여 단일 가닥의 DNA의 특정 염기 서열에 프라이머를 결합시켜 부분적인 DNA-프라이머 복합체를 형성하는 어닐링 단계(annealing step), 및 어닐링 단계 이후 샘플 용액을 적정 온도, 예를 들어 72℃로 유지하여 DNA 중합효소(polymerase)에 의해 부분적인 DNA-프라이머 복합체의 프라이머를 기초로 이중 가닥의 DNA를 형성하는 연장 (혹은 증폭) 단계(extension step)를 수행하고, 3 단계를 예를 들어, 20회 내지 40회로 반복함으로써 특정 염기 서열을 갖는 DNA를 기하급수적으로 증폭할 수 있다. 또한, 경우에 따라, PCR 장치는 어닐링 단계와 연장 (혹은 증폭) 단계를 동시에 수행할 수 있고, 이 경우 PCR 장치는 연장 단계와 어닐링 및 연장 (혹은 증폭) 단계로 구성된 2 단계를 수행함으로써, 제 1 순환을 완성할 수도 있다. 따라서, 본 발명의 일 실시예에 따른 멀티플렉스 PCR 장치는 단계들을 수행하기 위한 모듈들을 포함하는 장치를 말하며, 본 명세서에 기재되지 아니한 세부적인 모듈들은 PCR을 수행하기 위한 종래 기술 중 개시되고 자명한 범위에서 모두 구비하고 있는 것을 전제로 한다.The multiplex PCR device according to the present invention is a device for performing a multiplex polymerase chain reaction (PCR) to amplify various nucleic acids having a specific base sequence. Specifically, in order to amplify deoxyribonucleic acid (DNA) having a specific nucleotide sequence, the multiplex PCR apparatus heats a double strand of DNA by heating a sample solution containing a double strand of DNA to a specific temperature, for example, about 95 ° C. A denaturing step of separating single-stranded DNA, an oligonucleotide primer having a sequence complementary to the specific nucleotide sequence to be amplified in the sample solution, and providing a specific temperature with the isolated single-stranded DNA, For example, an annealing step in which a primer is attached to a specific base sequence of a single strand of DNA by cooling to 55 ° C. to form a partial DNA-primer complex, and the sample solution is subjected to an appropriate temperature, for example, after the annealing step. It is maintained at 72 ℃ to form a double strand of DNA based on the primer of the partial DNA-primer complex by DNA polymerase DNA having a specific base sequence can be exponentially amplified by performing an extension (or amplification) step and repeating three steps, for example, 20 to 40 times. Also, in some cases, the PCR apparatus may simultaneously perform an annealing step and an extension (or amplification) step, in which case the PCR apparatus performs two steps including an extension step and an annealing and an extension (or amplification) step. 1 You can also complete a cycle. Accordingly, the multiplex PCR apparatus according to an embodiment of the present invention refers to an apparatus including modules for performing steps, and detailed modules not described herein are disclosed and apparent in the prior art for performing PCR. It is assumed that it is equipped with all in the range.
또한, 본 발명에 따른 멀티플렉스 PCR 장치는 멀티플렉스 PCR을 수행함과 동시에 멀티플렉스 PCR 산물의 발생 유무 및 정도를 실시간으로 측정 및 분석할 수 있다. In addition, the multiplex PCR device according to the present invention can perform the multiplex PCR and at the same time measure and analyze the presence and extent of the multiplex PCR product generation.
도 2는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 칩을 도시한다.2 illustrates a multiplex PCR chip according to an embodiment of the present invention.
도 2를 참조하면, 멀티플렉스 PCR 칩(200)은 핵산 분자의 증폭(증폭 반응), 표적 서열의 탐지(혼성화 반응) 등을 수행하기 위한 것으로서, 유체가 수용되는 하나 이상의 반응 영역(224)을 포함할 수 있다. 여기서 유체는 핵산, 예를 들어 이중 가닥 DNA, 증폭하고자 하는 특정 염기 서열과 상보적인 서열을 갖는 올리고뉴클레오티드 프라이머, DNA 중합효소, 삼인산화데옥시리보뉴클레오티드 (deoxyribonucleotide triphosphates, dNTP), PCR 반응 완충액(PCR reaction buffer) 등을 포함하는 샘플 용액일 수 있다.Referring to FIG. 2, the multiplex PCR chip 200 is for performing amplification (amplification reaction) of nucleic acid molecules, detection of a target sequence (hybridization reaction), and the like. It may include. Wherein the fluid is a nucleic acid such as double stranded DNA, an oligonucleotide primer having a sequence complementary to the specific nucleotide sequence to be amplified, DNA polymerase, deoxyribonucleotide triphosphates (dNTP), PCR reaction buffer (PCR). sample buffer, including a reaction buffer).
멀티플렉스 PCR 칩(200)의 적어도 일부는 광 투과성 재질로 구현될 수 있고, 바람직하게는 광 투과성 플라스틱 재질을 포함할 수 있다. 멀티플렉스 PCR 칩(200)은 플라스틱 재질을 사용하여, 플라스틱 두께 조절만으로 열 전달 효율을 증대시킬 수 있고, 제작 공정이 단순하여 제조 비용을 절감할 수 있다. 또한, 멀티플렉스 PCR 칩(200)은 전체적으로 광 투과적인 성질을 구비할 수 있기 때문에 열 블록의 일 면에 배치된 상태에서 직접적으로 광 조사가 가능하여 실시간으로 핵산 증폭 여부 및 증폭 정도를 측정 및 분석할 수 있다. 증폭 반응을 위해, 멀티플렉스 PCR 칩(200)이 열 블록에 접촉하는 경우 열 블록의 열은 멀티플렉스 PCR 칩(200)에 전달되고, 멀티플렉스 PCR 칩(200)의 반응 영역(224)에 포함된 유체가 가열되거나 냉각되어 일정 온도가 유지될 수 있다. 멀티플렉스 PCR 칩(200)은 바람직하게는 전체적으로 평면 형상을 가질 수 있으나, 이에 제한되는 것은 아니다.At least a part of the multiplex PCR chip 200 may be implemented with a light transmissive material, and may preferably include a light transmissive plastic material. Multiplex PCR chip 200 using a plastic material, can increase the heat transfer efficiency only by adjusting the thickness of the plastic, it is possible to reduce the manufacturing cost because the manufacturing process is simple. In addition, since the multiplex PCR chip 200 may have a light transmitting property as a whole, direct light irradiation is possible in a state in which it is disposed on one surface of the heat block, thereby measuring and analyzing nucleic acid amplification and amplification degree in real time. can do. For the amplification reaction, when the multiplex PCR chip 200 contacts the thermal block, the heat of the thermal block is transferred to the multiplex PCR chip 200 and included in the reaction region 224 of the multiplex PCR chip 200. The heated fluid may be heated or cooled to maintain a constant temperature. The multiplex PCR chip 200 may preferably have a planar shape as a whole, but is not limited thereto.
도 2에서 도시되는 바와 같이, 멀티플렉스 PCR 칩(200)은 혼성화 반응을 위해 내부에 배치되는 프로브(probe, 240)를 포함할 수 있다. 프로브(240)는 PCR을 통해 증폭되는 핵산을 탐지하기 위해 증폭 반응 동안 표적 핵산 서열의 존재를 나타내는 시그널을 발생할 수 있는 표지된 올리고뉴클레오타이드로서, 핵산 분자의 서열과 특이적으로 혼성화될 수 있다. 각각의 프로브(240)는 핵산 분자의 서로 상이한 서열에 혼성화될 수 있다.As shown in FIG. 2, the multiplex PCR chip 200 may include a probe 240 disposed therein for the hybridization reaction. Probe 240 is a labeled oligonucleotide capable of generating a signal indicative of the presence of a target nucleic acid sequence during an amplification reaction to detect nucleic acid to be amplified by PCR, and may specifically hybridize with the sequence of the nucleic acid molecule. Each probe 240 may hybridize to a different sequence of nucleic acid molecules.
특히, 프로브(240)는 예를 들어, 염기 서열의 일부, 즉 염기 서열의 말단 또는 중간에 각각 형광 물질(fluorphore) 및 형광 억제 물질(quencher)이 (공유) 결합될 수 있다. 여기서 형광 물질은 예를 들어, FAM과 같은 형광 물질을 의미하며, 형광 억제 물질은 형광 물질의 형광 발생을 예를 들어, FRET(fluorescence resonance energy transfer)를 통해 억제하는 것으로서, 예를 들어 BHQ-1(black hole quencher-1) 등을 포함할 수 있다. 이와 같은 구성의 프로브(240)에 의하면, PCR 반응 중 어닐링 단계에서, 프로브(240)는 핵산 분자의 서열(즉, 주형 DNA)에 특이적으로 혼성화되며, 이때 형광 억제 물질에 의해 형광 물질의 형광 발생이 억제된다. 그러나, 이후 PCR 반응 중 연장 단계에서 프로브(240)는 DNA 중합효소가 갖는 엑소뉴클리아제(exonuclease)의 활성으로 인하여 분해되며, 이때 형광 물질이 프로브에서 유리되거나 거리가 멀어져 억제가 해제됨으로써 형광이 발생할 수 있다. 즉, 프로브(240)는 이와 같은 표적 핵산 서열과의 혼성화, 유리, 멀어짐을 통한 형광 발생을 통해 표적 핵산(또는 표적 핵산 서열)을 탐지할 수 있다.In particular, the probe 240 may be (covalently) bonded to a portion of the base sequence, that is, a fluorescent material (fluorphore) and a quencher (quencher) at the end or the middle of the base sequence, respectively. Here, the fluorescent material refers to a fluorescent material such as, for example, FAM, and the fluorescent inhibitor suppresses fluorescence generation of the fluorescent material through, for example, fluorescence resonance energy transfer (FRET), for example, BHQ-1. (black hole quencher-1) and the like. According to the probe 240 having such a configuration, in the annealing step of the PCR reaction, the probe 240 hybridizes specifically to the sequence (ie, template DNA) of the nucleic acid molecule, wherein the fluorescent material is fluorescent Occurrence is suppressed. However, in the extension step of the PCR reaction, the probe 240 is decomposed due to the activity of exonuclease of the DNA polymerase, and at this time, the fluorescent material is released from the probe or is separated from the probe, thereby suppressing the fluorescence. May occur. That is, the probe 240 may detect the target nucleic acid (or target nucleic acid sequence) through fluorescence generation through hybridization with such target nucleic acid sequence, release, and distance.
또한, 각각의 프로브(240)는 멀티플렉스 PCR 칩(200)의 표면 상에 서로 이격하여 결합될 수 있다. 이러한 결합은 예를 들어, 스포터(spotter), 어레이어(arrayer), 잉크-제트(ink-jet) 등을 이용하여 프로브(240)를 멀티플렉스 PCR 칩(200)의 표면 상에 도포함으로써 수행될 수 있다. 프로브 간의 이격을 통해 형광의 위치를 탐지하는 것만으로 탐지되는 핵산을 식별할 수 있다.In addition, each probe 240 may be coupled to be spaced apart from each other on the surface of the multiplex PCR chip 200. This bonding is performed by applying the probe 240 onto the surface of the multiplex PCR chip 200 using, for example, a spotter, an arrayer, an ink-jet, or the like. Can be. The separation between the probes allows identification of the detected nucleic acid only by detecting the location of the fluorescence.
각각의 프로브(240)는 멀티플렉스 PCR 칩(200)의 표면 상에 흡착되거나, 프로브 결합부를 통해 결합할 수 있다. 상기 프로브 결합부들은 종래의 프로브(240)와 멀티플렉스 PCR 칩(200) 간의 흡착에 비해 더 견고한 결합력을 제공할 수 있다. 또한, 상기 프로브 결합부들은 다공 구조(pore structure)를 형성할 수 있는데, 다공 구조 표면에 프로브(240)가 결합함으로써, 프로브(240)와 멀티플렉스 PCR 산물(즉, 증폭된 핵산 분자) 간의 접촉 면적을 증가시켜, 반응성을 향상시킬 수 있다. 다공 구조의 크기는 분자량, UV 경화 및 세척 조건 등에 따라 달라지게 되며, 그 크기는 나노미터 수준에서 마이크로미터 수준까지 형성될 수 있으며, 그로 인해 다공 구조와 멀티플랙스 PCR 산물 간의 반응성을 조절시킬 수 있다. 상기 다공 구조는 폴리에틸렌 글리콜 디아크릴레이트(Polyethylene glycol Diacrylate, PEGDA), 폴리에틸렌 글리콜 디메타아크릴레이트(Polyethylene glycol Dimethacrylate, PEGDMA), 2-하이드록시에틸 메타아크릴레이트(2-hydroxyethyl methacrylate, HEMA), 에틸렌 글리콜 디아크릴레이트(Ethylene glycol Diacrylate, EGDA), 에틸렌 글리콜 메타아크릴레이트(Ethylen glycol Dimethacrylate, EGDMA), 폴리비닐 알코올(Polyvinyl alcohol, PVA), 아가로스(agarose), 실리콘(silicone), 및 파라핀(paraffin) 중 적어도 하나로 구성된 겔 형성 물질(gel material), 폴리에틸렌 글리콜(Polyethylene glycol, PEG) 및 에틸렌 글리콜(Ethylene glycol, EG) 중 적어도 하나로 구성된 포어 형성 물질(porogen)에 광 개시제와 버퍼를 첨가하여 형성될 수 있다. 상기 광 개시제는 PEG 링커, C 링커, TEG 링커 등과 같은 링커(linker) 또는 스페이서(spacer), 2-하이드록시-2-메틸-1-페닐-1-프로파논(2-Hydroxy-2-methyl-1-phenyl-1-propanone), 메틸벤조일포르메이트(Methylbenzoylformate)를 포함하고, 버퍼는 Tris-EDTA 버퍼일 수 있다. 이 경우 폴리에틸렌 글리콜 디아크릴레이트(Polyethylene glycol Diacrylate, PEGDA)의 분자량은 10 내지 50,000 MW일 수 있고, 폴리에틸렌 글리콜(Polyethylene glycol, PEG)의 분자량은 10 내지 50,000 MW일 수 있으며, 폴리에틸렌 글리콜 디아크릴레이트(Polyethylene glycol Diacrylate, PEGDA)는 농도비 5 내지 40%, 폴리에틸렌 글리콜(Polyethylene glycol, PEG)은 중량비 5 내지 40%, 2-하이드록시-2-메틸-1-페닐-1-프로파논(2-Hydroxy-2-methyl-1-phenyl-1-propanone)은 농도비 1 내지 10%, Tris-EDTA 버퍼는 농도비 0.1 내지 30%일 수 있다. 한편, 상기 프로브 결합부는 형광 물질 또는 프라이머에 1 내지 100 단위로 결합하는, 헥사-에틸렌글리콜(18-atom hexa-ethleneglycol)과 같은 링커(linker) 물질 또는 아크리디트 결합 물질(Acrydite binding material) 티올 결합 물질(Thiol binding material), 비오틴 결합 물질(biotin binding material), 및 아민 결합 물질(amine binding material)과 같은 다공 구조 결합 물질을 포함할 수 있다. 또한, 상기 프로브 결합부는 핵산 분자의 서로 상이한 서열과 특이적으로 혼성화되는 다수의 프라이머를 더 포함할 수 있어서 상기 핵산 분자가 프라이머에 혼성화 결합을 한 후 프로브와 혼성화되도록 할 수 있다. 또한, 프로브(240)는 반응 영역(224)의 상면(또는 멀티플렉스 PCR 칩(200)의 상부 내면 또는 제 3 판(230)의 하부 표면)에 배치될 수 있다. PCR 반응 중에는 기포가 발생할 수 있으며, 이러한 기포는 PCR 반응 산물을 측정하는 데 있어 간섭을 일으킬 수 있으나, 도 2에서 도시되는 바와 같이, 프로브(240)가 반응 영역(224)의 상면에 배치됨으로써, 기포가 프로브(240) 주변으로 이동하게 되며, 따라서 이러한 간섭을 제거하여 측정 효율을 향상시킬 수 있다.Each probe 240 may be adsorbed on the surface of the multiplex PCR chip 200 or may be coupled through a probe coupling unit. The probe coupling units may provide more firm binding force than adsorption between the conventional probe 240 and the multiplex PCR chip 200. In addition, the probe binding portions may form a porous structure, and the probe 240 is bonded to the surface of the porous structure, thereby contacting the probe 240 with the multiplex PCR product (ie, amplified nucleic acid molecule). By increasing the area, the reactivity can be improved. The size of the porous structure will depend on molecular weight, UV curing and washing conditions, and the size can be formed from nanometer to micrometer level, thereby controlling the reactivity between the porous structure and the multiplex PCR product. . The porous structure is polyethylene glycol diacrylate (PEGDA), polyethylene glycol dimethacrylate (PEGDMA), 2-hydroxyethyl methacrylate (HEMA), ethylene glycol Ethylene glycol Diacrylate (EGDA), Ethylene glycol Dimethacrylate (EGDMA), Polyvinyl alcohol (PVA), agarose, silicon, and paraffin It can be formed by adding a photo initiator and a buffer to a porogen formed of at least one of a gel material, polyethylene glycol (PEG), and ethylene glycol (EG). have. The photoinitiator may be a linker or a spacer such as a PEG linker, a C linker, a TEG linker, or the like, 2-hydroxy-2-methyl-1-phenyl-1-propanone (2-Hydroxy-2-methyl- 1-phenyl-1-propanone), methylbenzoylformate, and the buffer may be Tris-EDTA buffer. In this case, the molecular weight of polyethylene glycol diacrylate (PEGDA) may be 10 to 50,000 MW, the molecular weight of polyethylene glycol (PEG) may be 10 to 50,000 MW, and polyethylene glycol diacrylate ( Polyethylene glycol Diacrylate, PEGDA) is 5 to 40% by weight, Polyethylene glycol (PEG) is 5 to 40% by weight, 2-hydroxy-2-methyl-1-phenyl-1-propanone (2-Hydroxy- 2-methyl-1-phenyl-1-propanone) may have a concentration ratio of 1 to 10%, and the Tris-EDTA buffer may have a concentration ratio of 0.1 to 30%. Meanwhile, the probe binding unit is a linker material such as hexa-ethylene glycol (18-atom hexa-ethleneglycol) or an acridite binding material (Acrydite binding material) that binds to a fluorescent material or a primer in 1 to 100 units. Porous structural binding materials such as Thiol binding material, biotin binding material, and amine binding material. In addition, the probe binding unit may further include a plurality of primers that specifically hybridize with different sequences of the nucleic acid molecules, such that the nucleic acid molecules hybridize to the primers and then hybridize with the probes. In addition, the probe 240 may be disposed on an upper surface of the reaction region 224 (or an upper inner surface of the multiplex PCR chip 200 or a lower surface of the third plate 230). Bubbles may occur during the PCR reaction, and these bubbles may cause interference in measuring the PCR reaction product. However, as shown in FIG. 2, the probe 240 is disposed on the upper surface of the reaction zone 224. Bubbles are moved around the probe 240, so that this interference can be eliminated to improve measurement efficiency.
다수의 프로브(240)에는 동일한 형광 염료가 이용될 수 있다. 종래의 멀티플렉스 PCR에서 다수의 프로브(240)에 의해 혼성화되는 핵산 분자의 서열을 구분하기 위해 서로 상이한 색을 갖는 형광 염료(dye)에 의해 표지된 프로브(240)가 이용되어야 했으나, 본 발명에서는 동일한 형광 염료가 이용되더라도, 다수의 프로브(240)가 소정의 간격으로 이격하여 배치되며, 따라서 이러한 프로브(240) 간의 위치에 기초하여 프로브(240)에 의해 혼성화되는 핵산 분자의 서열을 구분할 수 있기에, 상이한 형광 염료의 필요성을 제거할 수 있다.The same fluorescent dye may be used for the plurality of probes 240. In the conventional multiplex PCR, probes 240 labeled with fluorescent dyes having different colors should be used to distinguish sequences of nucleic acid molecules hybridized by a plurality of probes 240, but in the present invention, Even if the same fluorescent dye is used, a plurality of probes 240 are spaced apart at predetermined intervals, and thus the sequence of nucleic acid molecules hybridized by the probes 240 can be distinguished based on the positions between these probes 240. The need for different fluorescent dyes can be eliminated.
이와 같은 동일한 형광 염료의 사용은 형광 염료에 의한 형광을 검출하기 위한 광학 장치를 단순화시킬 수 있다. 종래의 멀티플렉스 PCR에서는, 하나의 반응 용기 내에 핵산 분자의 증폭된 서열과 특이적으로 혼성화될 수 있는 다수의 상이한 프로브(240)가 상이한 형광 염료에 의해 표지되고, 이러한 형광 염료에 의한 형광(emission light)을 구분하기 위해 각 형광 염료에 특이적인 다수의 파장을 갖는 광학 장치가 이용되었다. 그러나, 본 발명에서는, 다종의 프로브(240)를 향해 하나의 파장을 갖는 여기 광선(excitation light)을 조사하여 동일한 염색 시료에 의한 형광, 즉 동일한 색의 형광이 발생하더라도, 프로브(240) 간의 위치에 기초하여 증폭되는 핵산 분자의 서열을 구분할 수 있다. 즉, 본 발명에서는, 1종의 광원 및 필터를 사용함으로써, 멀티플렉스 PCR 산물의 검출이 가능하며, 이는 광학 장비의 크기를 소형화하고 장비 가격을 감소시킬 수 있을 뿐만 아니라, 검출에 소요되는 시간을 감소시키는 등 멀티플렉스 PCR 장치의 동작의 효율을 향상시킬 수 있다. 다만, 사용자의 용도에 따라, 다종의 프로브(240)를 향해 다수의 파장을 갖는 여기 광선을 조사할 수 있고, 이를 프로브(240) 간의 위치에 기초하여 증폭되는 핵산 분자의 서열을 구분할 수도 있으므로, 더욱 정확한 다수의 측정이 가능하여 멀티플랙스 PCR 장치의 동작의 효율을 더욱 극대화할 수 있음은 물론이다.The use of such identical fluorescent dyes can simplify the optical device for detecting fluorescence by fluorescent dyes. In conventional multiplex PCR, a number of different probes 240, which can hybridize specifically with the amplified sequences of nucleic acid molecules in one reaction vessel, are labeled with different fluorescent dyes and fluorescence by such fluorescent dyes Optical devices with multiple wavelengths specific to each fluorescent dye were used to distinguish light. However, in the present invention, even if fluorescence by the same dye sample, that is, fluorescence of the same color is generated by irradiating an excitation light having one wavelength toward the multiple probes 240, the position between the probes 240 Based on the sequence of the nucleic acid molecule to be amplified can be distinguished. That is, in the present invention, by using one light source and a filter, detection of a multiplex PCR product is possible, which not only reduces the size of the optical equipment and reduces the equipment cost, but also reduces the time required for detection. The efficiency of operation of the multiplex PCR device can be improved. However, according to the user's use, it is possible to irradiate the excitation light rays having a plurality of wavelengths toward the plurality of probes 240, and it may also distinguish the sequence of the nucleic acid molecules to be amplified based on the position between the probes 240, It is possible to further maximize the efficiency of the multiplex PCR device by allowing a more accurate number of measurements.
도 2에서 도시되는 멀티플렉스 PCR 칩(200)의 구조를 구체적으로 살펴보면, 멀티플렉스 PCR 칩(200)의 베이스로서 평판 형상의 제 1 판(210)이 제공될 수 있다. 제 1 판(210) 상에 제 2 판(220) 및 제 3 판(230)이 순차적으로 배치될 수 있다. 제 1 판(210) 상에 제 2 판(220)이 배치될 수 있다. 제 2 판(220)은 유체(예를 들어, 증폭하고자 하는 핵산을 포함하는 샘플 용액 등)가 유입되는 유입부(222), 유입된 유체가 이동하고 PCR 반응 및 혼성화 반응이 수행되는 반응 영역(224) 및 반응이 종료된 유체가 배출되는 유출부(226)를 포함할 수 있다. 도시된 바와 같이, 제 2 판(220)의 반응 영역(224)은 제 2 판(220)의 표면(예를 들어, 상면 및/또는 하면)으로부터 함몰되거나 제 2 판(220)을 관통되어 형성될 수 있다. 또한, 제 2 판(220)의 유입부(222) 및 유출부(226)는 제 2 판(220)을 관통함과 동시에, 제 2 판(220)의 표면으로부터 돌출되어 형성될 수 있다. 또한, 제 2 판(220)의 두께는 다양할 수 있으나, 0.1 mm 내지 2.0 mm에서 선택될 수 있다. 또한, 반응 영역(224)의 폭과 길이는 다양할 수 있으나, 바람직하게는 반응 영역(224)의 폭은 0.5 mm 내지 3 mm에서 선택되고, 반응 영역(224)의 길이는 20 mm 내지 60 mm에서 선택될 수 있다. 또한, 제 2 판(220)의 내벽은 DNA, 단백질(protein) 흡착을 방지하기 위해 실란(silane) 계열, 보바인 시럼 알부민(Bovine Serum Albumin, BSA) 등의 물질로 코팅할 수 있고, 물질의 처리는 당 업계에 공지된 방법에 따라 수행될 수 있다. 또한, 유입부(222)는 다양한 크기를 구비할 수 있으나, 바람직하게는 지름 0.5 mm 내지 3.0 mm에서 선택될 수 있다. 또한, 유출부(226)는 다양한 크기를 구비할 수 있으나, 바람직하게는 지름 0.5 mm 내지 3.0 mm에서 선택될 수 있다. 제 2 판(220) 상에 제 3 판(230)은 배치될 수 있다. 구체적으로, 제 3 판(230)은 제 2 판(220) 상에 배치되어, 제 2 판(220)의 반응 영역(224) 중 일부 영역(즉, 제 2 판(220)의 반응 영역(224) 중 관통 영역)을 커버함과 동시에, 제 3 판(230)의 하면 중 일부 영역 상에 서로 이격 배치된 적어도 하나의 프로브(240)를 통해, PCR 반응 산물을 측정할 수 있다. 제 3 판(230)의 두께는 다양할 수 있으나, 바람직하게는 0.1 mm 내지 2.0 mm에서 선택될 수 있다. 제 1 판(210), 제 2 판(220) 및 제 3 판(230) 중 적어도 하나의 형상은 사출성형, 핫-엠보싱(hot-embossing), 캐스팅(casting), 레이저 어블레이션(laser ablation) 등 다양한 기계적, 화학적 가공 공정에 의해 형성될 수 있다. 상기 가공 공정은 예시적인 것으로서, 본 발명이 적용되는 실시예에 따라 다양한 가공 공정이 적용될 수 있다. 또한, 제 1 판(210)과 제 2 판(220) 간의 접합 및/또는 제 2 판(220)과 제 3 판(230) 간의 접합은 예를 들어, 열 접합, 초음파 접합, 자외선 접합, 용매 접합, 테이프 접합 등의 당해 분야에서 적용 가능한 다양한 접합 방법에 의해 수행될 수 있다. 실시예에 따라, 멀티플렉스 PCR 칩(200)의 내부 표면 중 적어도 일부(예를 들어, 제 2 판(220)의 내벽 등)에는 표면 처리가 수행될 수 있다. 예를 들어, 표면 상에 DNA, 단백질(protein) 흡착을 방지하기 위해 실란(silane) 계열, 보바인 시럼 알부민(Bovine Serum Albumin, BSA) 등의 물질로 코팅될 수 있으며, 이러한 표면 처리는 당해 기술 분야에 공지된 다양한 기술에 따라 수행될 수 있다. 또한, 실시예에 따라, 멀티플렉스 PCR 칩(200)은 유입부(222) 및/또는 유출부(226)를 위한 별도의 커버 수단(도시되지 않음)이 구비되어, 유입부(222) 및 유출부(226)를 통한 멀티플렉스 PCR 칩(200) 내부의 오염을 방지하거나, 미세유체 칩(200)에 주입된 유체의 누출 등을 방지할 수 있다. 이러한 커버 수단은 다양한 형상, 크기 또는 재질로서 구현될 수 있다. 도 2에서 도시되는 멀티플렉스 PCR 칩(200)의 형상이나 구조는 예시적인 것으로서, 본 발명이 적용되는 실시예에 따라 다양한 형상이나 구조의 미세유체 칩이 이용될 수 있다. 아울러, 제 1 판(210), 제 2 판(220), 또는 제 3 판(230)은 다양한 재질로 구현될 수 있으나, 바람직하게는 폴리메틸메타크릴레이트(polymethylmethacrylate, PMMA), 폴리카보네이트(polycarbonate, PC), 사이클로올레핀 코폴리머(cycloolefin copolymer, COC), 폴리아미드(polyamide, PA), 폴리에틸렌(polyethylene, PE), 폴리프로필렌(polypropylene, PP), 폴리페닐렌 에테르(polyphenylene ether, PPE), 폴리스티렌(polystyrene, PS), 폴리옥시메틸렌(polyoxymethylene, POM), 폴리에테르에테르케톤(polyetheretherketone, PEEK), 폴리테트라프로오르에틸렌(polytetrafluoroethylene, PTFE), 폴리비닐클로라이드(polyvinylchloride, PVC), 폴리비닐리덴 플로라이드(polyvinylidene fluoride, PVDF), 폴리부틸렌테레프탈레이트(polybutyleneterephthalate, PBT), 불소화에틸렌프로필렌(fluorinated ethylenepropylene, FEP), 퍼플로로알콕시알칸(perfluoralkoxyalkane, PFA), 폴리디메틸실옥산(polydimethylsiloxane, PDMS), 폴리프로필렌카보네이트(polypropylene carbonate, PPC), 폴리에테르설폰(polyether sulfone, PES), 폴리에틸렌텔레프탈레이트(polyethylene terephthalate, PET), 폴리프로필렌카보네이트(polypropylene carbonate, PPC), 폴리에테르설폰(polyether sulfone, PES), 및 그의 조합물로 구성된 군으로부터 선택되는 재질일 수 있다.Looking at the structure of the multiplex PCR chip 200 shown in FIG. 2 in detail, a flat plate-shaped first plate 210 may be provided as a base of the multiplex PCR chip 200. The second plate 220 and the third plate 230 may be sequentially disposed on the first plate 210. The second plate 220 may be disposed on the first plate 210. The second plate 220 may include an inlet 222 through which a fluid (for example, a sample solution containing a nucleic acid to be amplified) is introduced, a reaction region through which the introduced fluid moves, and a PCR reaction and a hybridization reaction are performed ( 224 and an outlet portion 226 through which the reaction is completed is discharged. As shown, the reaction zone 224 of the second plate 220 is formed by recessing from the surface (eg, top and / or bottom) of the second plate 220 or through the second plate 220. Can be. In addition, the inlet part 222 and the outlet part 226 of the second plate 220 may pass through the second plate 220 and may protrude from the surface of the second plate 220. In addition, the thickness of the second plate 220 may vary, but may be selected from 0.1 mm to 2.0 mm. In addition, the width and length of the reaction zone 224 may vary, but preferably the width of the reaction zone 224 is selected from 0.5 mm to 3 mm, and the length of the reaction zone 224 is 20 mm to 60 mm. Can be selected from. In addition, the inner wall of the second plate 220 may be coated with a material such as silane-based and Bovine Serum Albumin (BSA) to prevent DNA and protein adsorption. The treatment can be performed according to methods known in the art. In addition, the inlet 222 may have various sizes, but preferably may be selected from 0.5 mm to 3.0 mm in diameter. In addition, the outlet portion 226 may have various sizes, but preferably may be selected from a diameter of 0.5 mm to 3.0 mm. The third plate 230 may be disposed on the second plate 220. Specifically, the third plate 230 is disposed on the second plate 220, so that a portion of the reaction zone 224 of the second plate 220 (that is, the reaction zone 224 of the second plate 220) is provided. At the same time, the PCR reaction product may be measured through at least one probe 240 spaced apart from each other on a portion of the lower surface of the third plate 230. The thickness of the third plate 230 may vary, but may preferably be selected from 0.1 mm to 2.0 mm. The shape of at least one of the first plate 210, the second plate 220 and the third plate 230 may be injection molded, hot-embossing, casting, laser ablation. It can be formed by various mechanical and chemical processing processes. The machining process is exemplary, and various machining processes may be applied according to the embodiment to which the present invention is applied. In addition, the bonding between the first plate 210 and the second plate 220 and / or the bonding between the second plate 220 and the third plate 230 may be, for example, thermal bonding, ultrasonic bonding, ultraviolet bonding, solvent, or the like. It can be carried out by various bonding methods applicable in the art, such as bonding, tape bonding. In some embodiments, surface treatment may be performed on at least a portion (eg, an inner wall of the second plate 220) of the inner surface of the multiplex PCR chip 200. For example, it may be coated with a material such as silane series, Bovine Serum Albumin (BSA) to prevent DNA and protein adsorption on the surface, such surface treatment is It can be performed according to various techniques known in the art. In addition, according to the embodiment, the multiplex PCR chip 200 is provided with separate cover means (not shown) for the inlet 222 and / or outlet 226, the inlet 222 and the outlet Contamination inside the multiplex PCR chip 200 through the unit 226 may be prevented, or leakage of fluid injected into the microfluidic chip 200 may be prevented. Such cover means may be embodied in various shapes, sizes or materials. The shape or structure of the multiplex PCR chip 200 shown in FIG. 2 is exemplary, and microfluidic chips of various shapes or structures may be used according to the embodiment to which the present invention is applied. In addition, the first plate 210, the second plate 220, or the third plate 230 may be implemented in various materials, but preferably, polymethylmethacrylate (PMMA), polycarbonate , PC), cycloolefin copolymer (COC), polyamide (PA), polyethylene (PE), polypropylene (PP), polyphenylene ether (PPE), polystyrene (polystyrene, PS), polyoxymethylene (POM), polyetheretherketone (PEEK), polytetrafluoroethylene (PTFE), polyvinylchloride (PVC), polyvinylidene fluoride (polyvinylidene fluoride (PVDF), polybutylene terephthalate (PBT), fluorinated ethylene propylene (FEP), perfluoroalkoxyalkane (PFA), polydimethyl Siloxane (polydimethylsiloxane, PDMS), polypropylene carbonate (PPC), polyether sulfone (PES), polyethylene terephthalate (PET), polypropylene carbonate (PPC), polyether Sulfone (polyether sulfone, PES), and combinations thereof.
도 3은 본 발명의 일 실시예에 따른 멀티플렉스 PCR 칩을 도시한다.3 illustrates a multiplex PCR chip according to an embodiment of the present invention.
도 3을 참조하면, 멀티플렉스 PCR 칩(300)에서, 제 3 판(230)은 제 2 판(220)의 반응 영역(224) 중 일부 영역(즉, 제 2 판(220)의 반응 영역(224) 중 관통 영역)에 삽입 배치될 수 있다. 이를 위해 제 3 판(230)의 하면 중 일부 영역은 하부 방향으로 돌출 형성될 수 있다. 이와 같이 돌출 형성되는 영역이 제 2 판(220)의 반응 영역(224) 중 관통 영역을 커버함과 동시에, 관통 영역으로의 삽입을 통한 제 3 판(230)과 제 2 판(220)의 용이한 접합 정렬을 달성할 수 있다. 도 3에서 도시되는 멀티플렉스 PCR 칩(300)의 형상은 예시적인 것으로서 본 발명이 적용되는 실시예에 따라 다양한 형상이 적용될 수 있다. 한편, 멀티플렉스 PCR 칩(300)의 내부 표면 중 적어도 일 영역(즉, 제 3 판(230)의 하면 중 일 영역)에는 친수성 물질(310)이 처리되어 멀티플렉스 PCR의 수행을 원활하게 할 수 있다. 친수성 물질(310)은 다양한 물질일 수 있으나, 바람직하게는 카르복시기(-COOH), 아민기(-NH2), 히드록시기(-OH), 및 술폰기(-SH)로 구성된 군으로부터 선택되는 것일 수 있다. 또한, 친수성 물질(310)의 처리는 산소 및 아르곤 플라즈마 처리, 코로나 방전 처리, 및 계면 활성제 도포로 구성된 군으로부터 선택되는 방법에 의해 처리될 수 있으나, 이는 예시적인 것으로서, 본 발명이 적용되는 실시예에 따라 당해 기술분야에 공지된 다양한 처리 방법이 적용될 수 있다.Referring to FIG. 3, in the multiplex PCR chip 300, the third plate 230 may include a portion of the reaction region 224 of the second plate 220 (that is, the reaction region of the second plate 220). 224) can be inserted into the through region. To this end, some regions of the lower surface of the third plate 230 may protrude downward. The protruded region covers the through region of the reaction region 224 of the second plate 220 and the ease of the third plate 230 and the second plate 220 through insertion into the through region. One joint alignment can be achieved. The shape of the multiplex PCR chip 300 illustrated in FIG. 3 is exemplary and various shapes may be applied according to an embodiment to which the present invention is applied. On the other hand, at least one region of the inner surface of the multiplex PCR chip 300 (that is, one region of the lower surface of the third plate 230) is treated with a hydrophilic material 310 to facilitate the performance of multiplex PCR. have. Hydrophilic material 310 may be a variety of materials, but may be preferably selected from the group consisting of carboxyl group (-COOH), amine group (-NH2), hydroxy group (-OH), and sulfone group (-SH). . In addition, the treatment of the hydrophilic material 310 may be treated by a method selected from the group consisting of oxygen and argon plasma treatment, corona discharge treatment, and surfactant application, which is exemplary, the embodiment to which the present invention is applied Depending on the various treatment methods known in the art can be applied.
도 4는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 칩을 도시한다.4 illustrates a multiplex PCR chip according to an embodiment of the present invention.
구체적으로, 도 4의 (a)는 멀티플렉스 PCR 칩(500)의 평면도를 도시하고, 도 4의 (b)는 멀티플렉스 PCR 칩(500)의 A-A' 방향의 단면도를 도시하며, 도 4의 (c)는 도 4의 (a) 및 (b)에서 도시되는 멀티플렉스 PCR 칩(500)의 내부 표면의 저면 사시도를 도시한다. Specifically, Figure 4 (a) shows a plan view of the multiplex PCR chip 500, Figure 4 (b) shows a cross-sectional view in the AA 'direction of the multiplex PCR chip 500, Figure 4 (c) shows a bottom perspective view of the inner surface of the multiplex PCR chip 500 shown in Figs. 4A and 4B.
도 4를 참조하면, 멀티플렉스 PCR 칩(500)은 프로브 고정부(510)를 더 포함할 수 있다. 프로브 고정부(510)는 표적 서열의 탐지를 위한 프로브(240)를 수용 및 고정하기 위한 것으로서, 예를 들어, 멀티플렉스 PCR 칩(500)의 제 3 판(230)의 하면 중 일 영역에 형성되는 중심부(512) 및 중심부(512)를 둘러싸도록 돌출되는 주변부(514)로 구성될 수 있다. 여기서 중심부(512)는 프로브(240)의 수용 공간을 제공할 수 있으며, 주변부(514)는 중심부(512)에 수용된 프로브(240)의 이탈을 방지할 수 있다.Referring to FIG. 4, the multiplex PCR chip 500 may further include a probe fixing part 510. Probe fixing portion 510 is for receiving and fixing the probe 240 for the detection of the target sequence, for example, formed in one region of the lower surface of the third plate 230 of the multiplex PCR chip 500 It may be composed of a central portion 512 and a peripheral portion 514 protruding to surround the central portion 512. Here, the center portion 512 may provide an accommodation space of the probe 240, and the peripheral portion 514 may prevent the probe 240 from being separated from the center portion 512.
도 4에서 도시되는 프로브 고정부(510)의 형상은 예시적인 것으로서 본 발명이 적용되는 실시예에 따라 다양한 형상의 프로브 고정부가 이용될 수 있다.The shape of the probe fixing part 510 shown in FIG. 4 is exemplary, and various shapes of the probe fixing part may be used according to an embodiment to which the present invention is applied.
도 5는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 장치를 도시한다.5 shows a multiplex PCR device according to an embodiment of the present invention.
도 5를 참조하면, 멀티플렉스 PCR 장치(1000)는 열 블록(900), 멀티플렉스 PCR 칩(200 내지 700), 멀티플렉스 PCR 칩(200 내지 700)에 광을 제공하도록 구동 가능하게 배치된 광 제공부(1010) 및 멀티플렉스 PCR 칩(200 내지 700)으로부터 방출되는 광을 수용하도록 구동 가능하게 배치된 광 검출부(1020)를 더 포함할 수 있다. Referring to FIG. 5, the multiplex PCR device 1000 may be configured to drive light to provide light to a thermal block 900, multiplex PCR chips 200 to 700, and multiplex PCR chips 200 to 700. The display unit 1010 and the multiplex PCR chip (200 to 700) may further include a light detector 1020 is disposed to be driven to receive light.
광 제공부(1010)는 멀티플렉스 PCR 칩(200 내지 700)에 광을 제공하기 위한 모듈일 수 있다. 일 실시예에서 광 제공부(1010)는 LED(Light Emitting Diode) 광원, 레이저 광원 등과 같이 광을 발출하는 광원, 광원으로부터 방출되는 광 중에서 미리 결정된 파장을 갖는 광을 선택하는 제 1 광 필터, 및 제 1 광 필터로부터 방출되는 광을 포집하여 방출광의 강도를 증가시키는 제 1 광 렌즈를 포함할 수 있다. 부가적인 실시예에 따라, 광 제공부(1010)는 광원과 제 1 광 필터 사이에 빛을 퍼지게 하도록 배치된 제 1 비구면 렌즈를 더 포함할 수 있다. 즉, 제 1 비구면 렌즈의 배치 방향을 조정함으로써, 광원으로부터 방출되는 광 범위를 확장하여 측정 가능한 영역에 도달하게 할 수 있다. 다만, 광 제공부(1010)의 구성은 이에 한정되지 않는다. The light providing unit 1010 may be a module for providing light to the multiplex PCR chips 200 to 700. In one embodiment, the light providing unit 1010 may include a light source for emitting light, such as a light emitting diode (LED) light source, a laser light source, a first light filter for selecting light having a predetermined wavelength from light emitted from the light source, and It may include a first optical lens for collecting the light emitted from the first optical filter to increase the intensity of the emitted light. According to an additional embodiment, the light provider 1010 may further include a first aspherical lens disposed to spread light between the light source and the first light filter. That is, by adjusting the arrangement direction of the first aspherical lens, it is possible to extend the light range emitted from the light source to reach the measurable area. However, the configuration of the light providing unit 1010 is not limited thereto.
광 검출부(1020)는 멀티플렉스 PCR 칩(200 내지 700)으로부터 방출되는 광을 수용하여 멀티플렉스 PCR 칩(200 내지 700)에서 수행되는 PCR 반응 산물을 측정하기 위한 모듈로서, 광 제공부(1010)로부터 방출된 광은 멀티플렉스 PCR 칩(200 내지 700), 구체적으로 멀티플렉스 PCR 칩(200 내지 700)의 반응 영역(224) 또는 프로브(240)를 통과하거나 반사하고, 이 경우 핵산 증폭에 의해 발생하는 광신호를 광 검출부(1020)가 검출할 수 있다. 일 실시예에서, 광 검출부(1020)는 멀티플렉스 PCR 칩(200 내지 700)으로부터 방출되는 광을 포집하여 방출광의 강도를 증가시키는 제 2 광 렌즈, 제 2 광 렌즈로부터 방출되는 광에서 미리 결정된 파장을 갖는 광을 선택하는 제 2 광 필터 및 제 2 광 필터로부터 방출되는 광으로부터 광신호를 검출하는 광 분석기를 포함할 수 있다. 부가적인 실시예에 따라, 제 2 광 필터와 광 분석기 사이에 제 2 광 필터로부터 방출되는 광을 집적하도록 배치된 제 2 비구면 렌즈 및/또는 제 2 비구면 렌즈와 광 분석기 사이에 제 2 비구면 렌즈로부터 방출되는 광의 노이즈(noise)를 제거하고 제 2 비구면 렌즈로부터 방출되는 광을 증폭하도록 배치된 광다이오드 집적소자(photodiode integrated circuit)를 더 포함할 수 있다. The light detector 1020 is a module for receiving the light emitted from the multiplex PCR chips 200 to 700 and measuring a PCR reaction product performed by the multiplex PCR chips 200 to 700. Light emitted from the light passes through or reflects through the multiplex PCR chip 200 to 700, specifically, the reaction region 224 or the probe 240 of the multiplex PCR chip 200 to 700, in this case generated by nucleic acid amplification. The optical detector 1020 may detect the optical signal. In one embodiment, the light detector 1020 is a predetermined wavelength from the light emitted from the second optical lens, the second optical lens to collect the light emitted from the multiplex PCR chip (200 to 700) to increase the intensity of the emitted light It may include a second optical filter for selecting the light having a light analyzer for detecting an optical signal from the light emitted from the second optical filter. According to a further embodiment, a second aspherical lens and / or a second aspherical lens disposed between the second optical filter and the optical analyzer and / or between the second aspherical lens and the optical analyzer are arranged to integrate light emitted from the second optical filter. And a photodiode integrated circuit arranged to remove noise of the emitted light and to amplify the light emitted from the second aspherical lens.
광 제공부(1010)가 멀티플렉스 PCR 칩(200 내지 700) 내의 다종의 프로브(240)를 향해 하나의 파장을 갖는 여기 광선을 조사하여 동일한 염색 시료에 의한 형광, 즉 동일한 색의 형광이 발생하더라도, 프로브(240) 간의 위치에 기초하여 증폭되는 핵산 분자의 서열을 구분할 수 있다. 따라서, 광 제공부(1010)는 다종의 광원 및 필터를 구비할 필요 없이, 1종의 광원 및 필터만을 사용함으로써, 멀티플렉스 PCR 산물의 검출이 가능하다. 마찬가지로 광 검출부(1020) 또한 1종의 필터만 구비하고도 멀티플렉스 PCR 산물의 검출이 가능하다. 광 제공부(1010) 및 광 검출부(1020)의 이러한 구성은 종래의 멀티플렉스 PCR 장치에 비해, 광학 장비의 크기를 소형화하고 장비 가격을 감소시킬 수 있을 뿐만 아니라, 검출에 소요되는 시간을 감소시킬 수 있다.Even if the light providing unit 1010 irradiates excitation light having one wavelength toward the various probes 240 in the multiplex PCR chips 200 to 700 to generate fluorescence by the same dye sample, that is, fluorescence of the same color, The sequence of the nucleic acid molecule to be amplified can be distinguished based on the position between the probes 240. Therefore, the light providing unit 1010 can detect the multiplex PCR product by using only one light source and the filter, without having to provide a plurality of light sources and filters. Similarly, the light detection unit 1020 can also detect a multiplex PCR product even if only one filter is provided. This configuration of the light providing unit 1010 and the light detecting unit 1020 can reduce the size of the optical equipment and reduce the equipment cost, as well as reduce the time required for detection, compared to the conventional multiplex PCR device. Can be.
또한, 멀티플렉스 PCR 칩(200 내지 700)에서 멀티플렉스 PCR의 각 순환 단계가 진행되는 동안 반응 영역(224) 내에서, 특히 프로브(240)에서 핵산의 증폭에 의한 반응 결과를 실시간으로 모니터링함으로써 표적 핵산 서열의 증폭 여부 및 증폭 정도를 실시간으로 측정 및 분석할 수 있다. In addition, during each circulation step of the multiplex PCR in the multiplex PCR chip 200 to 700, the targets are monitored in real time by monitoring the reaction result by the amplification of the nucleic acid in the reaction region 224, particularly in the probe 240. Whether to amplify the nucleic acid sequence and the degree of amplification can be measured and analyzed in real time.
도 6a 및 6b는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 장치를 도시한다.6A and 6B show a multiplex PCR device according to an embodiment of the present invention.
도 6a를 참조하면, 멀티플렉스 PCR 장치(1100)는 기판(1110); 기판(1110) 상에 배치된 제 1 열 블록(900A)과 제 1 열 블록(900A)과 이격 배치된 제 2 열 블록(900B); 멀티플렉스 PCR 칩(200 내지 700)가 장착되는 칩 홀더(1120) 및 칩 홀더(1120)를 이동시키는 구동부(1130)를 포함할 수 있다.Referring to FIG. 6A, the multiplex PCR device 1100 may include a substrate 1110; A first row block 900A disposed on the substrate 1110 and a second row block 900B spaced apart from the first row block 900A; It may include a chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted and a driving unit 1130 to move the chip holder 1120.
기판(1110)은 제 1 열 블록(900A) 및 제 2 열 블록(900B)의 가열 및 온도 유지로 인해 그 물리적 및/또는 화학적 성질이 변하지 않고, 제 1 열 블록(900A) 및 제 2 열 블록(900B) 사이에서 상호 열 교환이 일어나지 않도록 하는 재질을 갖는 모든 물질을 포함할 수 있다. 예를 들어, 기판(1110)은 플라스틱 등의 재질을 포함하거나 그러한 재질로 구성될 수 있다.The substrate 1110 has no change in its physical and / or chemical properties due to the heating and temperature maintenance of the first thermal block 900A and the second thermal block 900B, and the first thermal block 900A and the second thermal block And any material having a material such that mutual heat exchange does not occur between 900B. For example, the substrate 1110 may include or consist of a material such as plastic.
제 1 열 블록(900A) 및 제 2 열 블록(900B)은 핵산을 증폭하기 위한 변성 단계, 어닐링 단계 및 연장 (혹은 증폭) 단계를 수행하기 위한 온도를 유지하기 위한 것으로서, 도 9를 참조하여 설명된 열 블록(900)과 마찬가지로 설명되며, 따라서 중복되는 설명은 생략된다. 열 블록(900A, 900B) 각각은 변성 단계, 또는 어닐링 및 연장 (혹은 증폭) 단계를 수행하기 위한 적정 온도를 유지하도록 구현될 수 있다. 예를 들어, 열 블록(900A, 900B)은 50℃ 내지 100℃를 유지할 수 있고, 바람직하게는 열 블록(900A, 900B)에서 변성 단계를 수행하는 경우 90℃ 내지 100℃를 유지할 수 있고, 바람직하게는 95℃를 유지할 수 있으며, 열 블록(900A, 900B)에서 어닐링 및 연장 (혹은 증폭) 단계를 수행하는 경우에는 55℃ 내지 75℃를 유지할 수 있고, 바람직하게는 72℃를 유지할 수 있다. 다만, 변성 단계, 또는 어닐링 및 연장 (혹은 증폭) 단계를 수행할 수 있는 온도라면 이에 제한되는 것은 아니다. 제 1 열 블록(900A)과 제 2 열 블록(900B)은 상호 열 교환이 일어나지 않도록 미리 결정된 거리로 이격 배치될 수 있다. 이에 따라, 제 1 열 블록(900A)과 제 2 열 블록(900B) 사이에서 열 교환이 일어나지 않기 때문에, 미세한 온도 변화에 의해서도 중대한 영향을 받을 수 있는 핵산 증폭 반응에 있어서, 변성 단계와 어닐링 및 연장 (혹은 증폭) 단계의 정확한 온도 제어가 가능하다. 또한, 멀티플렉스 PCR 칩(200 내지 700)이 각 열 블록(900A, 900B)의 일 면에 접촉되는 경우 제 1 열 블록(900A) 및 제 2 열 블록(900B)은 멀티플렉스 PCR 칩(200 내지 700)과의 접촉면을 전체적으로 가열 및 온도 유지할 수 있어서, 멀티플렉스 PCR 칩(200 내지 700) 내의 유체를 균일하게 가열 및 온도 유지할 수 있다. 종래 단일 열 블록을 사용하는 멀티플렉스 PCR 장치는 단일 열 블록에서의 온도 변화율이 초당 3 내지 7℃ 범위 내에서 이루어지는데 반해, 멀티플렉스 PCR 장치(1100)는 2개의 열 블록을 포함하며, 따라서 각각의 열 블록(900A, 900B)에서의 온도 변화율이 초당 20 내지 40℃ 범위 내에서 이루어져 멀티플렉스 PCR 반응 시간을 크게 단축시킬 수 있다.The first row block 900A and the second row block 900B are for maintaining a temperature for performing a denaturation step, an annealing step and an extension (or amplification) step for amplifying a nucleic acid, which will be described with reference to FIG. 9. The description is the same as the column block 900 described above, and thus redundant descriptions are omitted. Each of the thermal blocks 900A, 900B may be implemented to maintain an appropriate temperature for performing the denaturation step, or the annealing and extension (or amplification) steps. For example, the thermal blocks 900A, 900B may maintain 50 ° C. to 100 ° C., and preferably, 90 ° C. to 100 ° C. when the denaturation step is performed in the thermal blocks 900A, 900B, preferably Preferably, it may be maintained at 95 ° C., and may be maintained at 55 ° C. to 75 ° C., preferably at 72 ° C., when performing annealing and extension (or amplification) steps in thermal blocks 900A and 900B. However, the temperature is not limited so long as the denaturation step or the annealing and extension (or amplification) step can be performed. The first row block 900A and the second row block 900B may be spaced apart at a predetermined distance such that mutual heat exchange does not occur. Accordingly, since no heat exchange occurs between the first heat block 900A and the second heat block 900B, in the nucleic acid amplification reaction that may be significantly affected by minute temperature changes, the denaturation step and annealing and extension are performed. Accurate temperature control of (or amplification) steps is possible. In addition, when the multiplex PCR chips 200 to 700 are in contact with one surface of each of the row blocks 900A and 900B, the first row block 900A and the second row block 900B are the multiplex PCR chips 200 to 700. The contact surface with 700 may be heated and temperature maintained as a whole, so that the fluid in the multiplex PCR chips 200 to 700 may be uniformly heated and temperature maintained. Conventional multiplex PCR devices using a single row block have a rate of change of temperature in a single row block within a range of 3 to 7 ° C. per second, whereas the multiplex PCR device 1100 includes two row blocks, thus each The rate of temperature change in the thermal blocks 900A and 900B may be within a range of 20 to 40 ° C. per second to significantly shorten the multiplex PCR reaction time.
칩 홀더(1120)에는 멀티플렉스 PCR 칩(200 내지 700)이 장착될 수 있다. 멀티플렉스 PCR 칩(200 내지 700)이 칩 홀더(1120)로부터 이탈하지 않도록 칩 홀더(1120)의 내벽은 멀티플렉스 PCR 칩(200 내지 700)의 외벽과 고정 장착되기 위한 형상 및 구조를 가질 수 있다. 또한, 멀티플렉스 PCR 칩(200 내지 700)은 칩 홀더(1120)에 착탈 가능할 수 있다. 칩 홀더(1120)는 구동부(1130)에 구동 가능하게 연결될 수 있다. The chip holder 1120 may be equipped with multiplex PCR chips 200 to 700. The inner wall of the chip holder 1120 may have a shape and structure to be fixedly mounted to the outer walls of the multiplex PCR chips 200 to 700 so that the multiplex PCR chips 200 to 700 do not separate from the chip holder 1120. . In addition, the multiplex PCR chip 200 to 700 may be detachable to the chip holder 1120. The chip holder 1120 may be operably connected to the driving unit 1130.
구동부(1130)는 열 블록(900A, 900B) 상으로 칩 홀더(1120)를 좌우 및/또는 상하 이동시킬 수 있다. 구체적으로, 구동부(1130)는 칩 홀더(1120)를 제 1 열 블록(900A) 및 제 2 열 블록(900B) 위로 좌우 및/또는 상하 이동 가능하게 하는 모든 수단을 포함할 수 있다. 구동부(1130)의 좌우 이동에 의해, 칩 홀더(1120)는 제 1 열 블록(900A)과 제 2 열 블록(900B) 사이에서 왕복 운동이 가능하고, 구동부(1130)의 상하 이동에 의해, 칩 홀더(1120)는 제 1 열 블록(900A)과 제 2 열 블록(900B)에 접촉 및 분리될 수 있다. 이를 위해, 구동부(1130)는 좌우 방향으로 연장된 레일(1132), 및 레일(1132)을 통해 좌우 방향으로 슬라이딩 이동 가능하게 배치되고, 상하 방향으로 슬라이딩 이동 가능한 연결 부재(1134)를 포함하고, 연결 부재(1134)의 일 단부에 칩 홀더(1120)가 배치될 수 있다.The driver 1130 may move the chip holder 1120 left and right and / or up and down on the thermal blocks 900A and 900B. In detail, the driver 1130 may include all means for allowing the chip holder 1120 to move left and right and / or up and down over the first row block 900A and the second row block 900B. By the left and right movement of the drive unit 1130, the chip holder 1120 is capable of reciprocating between the first row block 900A and the second row block 900B, and by the vertical movement of the drive unit 1130, The holder 1120 may be in contact with and separated from the first row block 900A and the second row block 900B. To this end, the driving unit 1130 includes a rail 1132 extending in the left and right directions, and a connecting member 1134 slidably moved in the left and right directions through the rail 1132 and slidable in the vertical direction. The chip holder 1120 may be disposed at one end of the connection member 1134.
도 6b를 참조하면, 구동부(1130)는 칩 홀더(1120)에 장착된 멀티플렉스 PCR 칩(200 내지 700)을 제 1 열 블록(900A) 및 제 2 열 블록(900B) 사이에서 왕복 이동시키면서 PCR 반응을 수행할 수 있다.Referring to FIG. 6B, the driver 1130 reciprocates the multiplex PCR chips 200 to 700 mounted on the chip holder 1120 while reciprocating between the first row block 900A and the second row block 900B. The reaction can be carried out.
먼저, 제 1 열 블록(900A)을 변성 단계를 위한 온도, 예를 들어, 90℃ 내지 100℃로 가열 및 유지하고, 바람직하게는 95℃로 가열 및 유지할 수 있다. 또한, 제 2 열 블록(900B)을 어닐링 및 연장 (혹은 증폭) 단계를 위한 온도, 예를 들어, 55℃ 내지 75℃로 가열 및 유지하고, 바람직하게는 72℃로 가열 및 유지할 수 있다.First, the first heat block 900A may be heated and maintained at a temperature for the denaturation step, eg, 90 ° C. to 100 ° C., preferably at 95 ° C. In addition, the second row block 900B may be heated and maintained at a temperature for an annealing and extension (or amplification) step, eg, 55 ° C. to 75 ° C., preferably at 72 ° C.
멀티플렉스 PCR 칩(200 내지 700)을 칩 홀더(1120)에 장착한 후 또는 이와 동시에 구동부(1130)의 연결 부재(1134)를 제어하여 멀티플렉스 PCR 칩(200 내지 700)을 하향 이동시켜, 멀티플렉스 PCR 칩(200 내지 700)이 장착된 칩 홀더(1120)를 제 1 열 블록(900A)에 접촉시켜 멀티플렉스 PCR의 제 1 변성 단계를 수행할 수 있다(x 단계).After mounting the multiplex PCR chip 200 to 700 to the chip holder 1120 or at the same time by controlling the connecting member 1134 of the drive unit 1130 to move the multiplex PCR chip 200 to 700 downward, The chip holder 1120 equipped with the flex PCR chips 200 to 700 may be contacted with the first row block 900A to perform the first denaturation step of the multiplex PCR (step x).
계속해서, 구동부(1130)의 연결 부재(1134)를 제어하여 멀티플렉스 PCR 칩(200 내지 700)을 상향 이동시켜, 멀티플렉스 PCR 칩(200 내지 700)이 장착된 칩 홀더(1120)를 제 1 열 블록(900A)으로부터 분리시켜 멀티플렉스 PCR의 제 1 변성 단계를 종료하고, 구동부(1130)의 레일(1132) 통해 멀티플렉스 PCR 칩(200 내지 700)을 제 2 열 블록(900B) 상으로 이동시킬 수 있다(y 단계).Subsequently, the coupling member 1134 of the driving unit 1130 is controlled to move the multiplex PCR chips 200 to 700 upward, thereby to move the chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted. The first denaturation step of the multiplex PCR is terminated by separating from the thermal block 900A, and the multiplex PCR chips 200 to 700 are moved onto the second thermal block 900B through the rail 1132 of the driving unit 1130. (Y step).
계속해서, 구동부(1130)의 연결 부재(1134)를 제어하여 멀티플렉스 PCR 칩(200 내지 700)을 하향 이동시켜, 멀티플렉스 PCR 칩(200 내지 700)이 장착된 칩 홀더(1120)를 제 2 열 블록(900B)에 접촉시켜 멀티플렉스 PCR의 제 1 어닐링 및 연장 (혹은 증폭) 단계를 수행할 수 있다(z 단계).Subsequently, the coupling member 1134 of the driving unit 1130 is controlled to move the multiplex PCR chips 200 to 700 downward to move the chip holder 1120 on which the multiplex PCR chips 200 to 700 are mounted. The thermal block 900B may be contacted to perform the first annealing and extension (or amplification) step of the multiplex PCR (step z).
마지막으로, 구동부(1130)의 연결 부재(1134)를 제어하여 멀티플렉스 PCR 칩(200 내지 700)을 상향 이동시켜, 멀티플렉스 PCR 칩(200 내지 700)이 장착된 칩 홀더(1120)를 제 2 열 블록(900B)으로부터 분리시켜 멀티플렉스 PCR의 제 1 어닐링 및 연장 (혹은 증폭) 단계를 종료하고, 구동부(1130)의 레일(1132)을 통하여 멀티플렉스 PCR 칩(200 내지 700)을 제 1 열 블록(900A)의 위로 이동시킨 후 x, y, z 단계를 반복함으로써, 핵산 증폭 반응을 수행할 수 있다(순환 단계).Lastly, the multiplex PCR chip 200 to 700 is moved upward by controlling the connection member 1134 of the driving unit 1130, so that the chip holder 1120 on which the multiplex PCR chip 200 to 700 is mounted is second. Separating from the row block 900B terminates the first annealing and extension (or amplification) step of the multiplex PCR, and passes the multiplex PCR chips 200 to 700 through the rail 1132 of the driver 1130 in a first row. After moving up block 900A, the nucleic acid amplification reaction can be performed by repeating steps x, y, and z (circulation step).
도 7는 본 발명의 일 실시예에 따른 멀티플렉스 PCR 장치를 도시한다.7 shows a multiplex PCR device according to an embodiment of the present invention.
도 7을 참조하면, 멀티플렉스 PCR 장치(1200)에서는, 제 1 열 블록(900A) 및 제 2 열 블록(900B)을 사이에 두고 광 제공부(1010)와 광 검출부(1020)가 배치될 수 있다. 광 측정을 위해 구동부(1130)에는 광 제공부(1010)으로부터 방출되는 광을 통과시키기 위한 관통부(1136)가 형성될 수 있으며, 멀티플렉스 PCR 칩(200 내지 700)은 광투과성 재질, 구체적으로 광투과성 플라스틱 재질일 수 있다.Referring to FIG. 7, in the multiplex PCR apparatus 1200, the light providing unit 1010 and the light detecting unit 1020 may be disposed with the first column block 900A and the second column block 900B interposed therebetween. have. A through part 1136 may be formed in the driver 1130 to pass light emitted from the light providing part 1010 to measure light. The multiplex PCR chip 200 to 700 may be formed of a light transmissive material. It may be a light transmissive plastic material.
도 7에서 도시되는 광 제공부(1010) 및 광 검출부(1020)의 배치에 의해, 멀티플렉스 PCR 장치(1200)에 의한 핵산 증폭 반응 중에 멀티플렉스 PCR 칩(200 내지 700) 내에서 핵산이 증폭되는 정도를 실시간으로 검출할 수 있다. 구체적으로, 멀티플렉스 PCR 칩은 PCR 반응의 각 단계를 수행하기 위해 제 1 열 블록(900A) 및 제 2 열 블록(900B) 사이를 왕복하게 된다. 이러한 과정에서, 구동부(1130)는 멀티플렉스 PCR 칩(200 내지 700)을 제 1 열 블록(900A)과 제 2 열 블록(900B) 사이의 이격된 공간 상에 정지시킬 수 있다. 이때, 광 제공부(1010)으로부터 광을 방출시키고, 방출된 광은 멀티플렉스 PCR 칩(200 내지 700), 구체적으로 멀티플렉스 PCR 칩(200 내지 700)의 반응 영역(224) 또는 프로브(240)를 통과하게 되므로, 핵산의 증폭에 의해 발생하는 광신호를 광 검출부(1020)가 검출할 수 있다. By arranging the light providing unit 1010 and the light detecting unit 1020 shown in FIG. 7, nucleic acids are amplified in the multiplex PCR chips 200 to 700 during the nucleic acid amplification reaction by the multiplex PCR device 1200. The degree can be detected in real time. In detail, the multiplex PCR chip reciprocates between the first row block 900A and the second row block 900B to perform each step of the PCR reaction. In this process, the driving unit 1130 may stop the multiplex PCR chip 200 to 700 on the spaced space between the first row block 900A and the second row block 900B. In this case, the light is emitted from the light providing unit 1010, and the emitted light is the multiplex PCR chip 200 to 700, specifically, the reaction region 224 or the probe 240 of the multiplex PCR chip 200 to 700. Since it passes through, the light detector 1020 can detect the optical signal generated by the amplification of the nucleic acid.
이와 같이, 멀티플렉스 PCR 장치(1100)에 따르면, 멀티플렉스 PCR 반응의 각 순환 단계가 진행되는 동안 반응 영역(224) 내에서, 특히 프로브(240)에서 핵산의 증폭에 의한 반응 결과를 실시간으로 모니터링함으로써 표적 핵산 서열의 양을 실시간으로 측정 및 분석할 수 있다. 한편, 도 6a, 6b 및 도 7에서는 두 개의 열 블록(900A, 900B)을 이용하여 PCR 반응을 수행하는 멀티플렉스 PCR 장치가 도시되고 있지만, 이는 예시적인 것으로서, PCR 반응을 수행하는 데 이용되는 열 블록의 개수는 다양할 수 있다. 예를 들어, 하나의 멀티플렉스 PCR 칩(200 내지 700)에 대해 하나의 열 블록만이 이용될 수 있다.As described above, according to the multiplex PCR device 1100, the reaction result of the amplification of the nucleic acid in the reaction region 224, in particular the probe 240, in real time during each cyclic step of the multiplex PCR reaction is monitored in real time. The amount of target nucleic acid sequence can thereby be measured and analyzed in real time. 6A, 6B, and 7 illustrate a multiplex PCR apparatus for performing a PCR reaction using two column blocks 900A and 900B, which are exemplary and used to perform a PCR reaction. The number of blocks can vary. For example, only one column block may be used for one multiplex PCR chip 200 to 700.
<실험예>Experimental Example
1. 칩 제조 과정1. Chip Manufacturing Process
칩 내부 반응 영역에 부착할 반응용 프로브 및 프로브 결합부를 제작하였다. 다공 구조를 형성하기 위하여 폴리에틸렌 글리콜 디아크릴레이트(Polyethylene glycol Diacrylate, PEGDA) 5% 내지 40%, 폴리에틸렌 글리콜(Polyethylene glycol, PEG) 5% 내지 40%, 2-하이드록시-2-메틸-1-페닐-1-프로파논(2-Hydroxy-2-methyl-1-phenyl-1-propanone) 1% 내지 10%를 농도비로 하되, TE 버퍼를 첨가하여 Prepolymer 용액을 제조하였고, 1X TE 버퍼 70% 내지 99.9% 및 Tween-20 0.1% 내지 30%를 농도비로 하여 세척 버퍼(washing buffer)를 제조하였으며, 상기 Prepolymer 용액 90%, 및 아크리디트과 PEG 링커가 결합된 단일가닥 DNA 10%를 농도비로 하여 프로브를 제조하였다(서열번호 1: Probe sequence: ACAGATGCCTTAACCTTTCCATGAGCGG). 그 후, 도 2와 같은 멀티플렉스 PCR 칩 구조를 제작하고, 칩 내부의 반응 영역에 형성된 다공 구조에 반응용 프로브 및 프로브 결합부 복합물을 부착하였으며, 세척 버퍼를 사용하여 폴리에틸렌 글리콜을 제거하여 다공 구조를 제작하였다. 최종 제조된 PCR 칩은 도 8과 같다.A reaction probe and a probe coupling portion to be attached to the reaction region inside the chip were prepared. Polyethylene glycol Diacrylate (PEGDA) 5% to 40%, Polyethylene glycol (PEG) 5% to 40%, 2-hydroxy-2-methyl-1-phenyl to form a porous structure 1% to 10% of -1-propanone (2-Hydroxy-2-methyl-1-phenyl-1-propanone) at a concentration ratio, but prepolymer solution was prepared by adding TE buffer, 70% to 99.9 1X TE buffer Washing buffer was prepared at a concentration ratio of 0.1% to 30% of% and Tween-20, and the probe was prepared using 90% of the prepolymer solution and 10% of single-stranded DNA in which acrite and PEG linker were combined. Prepared (SEQ ID NO 1: Probe sequence: ACAGATGCCTTAACCTTTCCATGAGCGG). Thereafter, a multiplex PCR chip structure as shown in FIG. 2 was prepared, and a reaction probe and a probe coupling complex were attached to the porous structure formed in the reaction region inside the chip, and the polyethylene glycol was removed using a washing buffer to remove the porous structure. Was produced. The final prepared PCR chip is shown in FIG. 8.
2. PCR 시약 조성2. PCR Reagent Composition
시약 조성은 PCR 칩의 다공 구조에 프로브만을 포함하는 양성 대조군 1(PC 1)과 양성 대조군 2(PC 2), 양성 대조군 1과 2에 정방향 및 역방향 프라이머를 추가한 양성 대조군 3(PC 3)으로 구성하였다(서열번호 2: Forward primer sequence TGGTCATGGTGATGTTGATTACTATTCAG, 서열번호 3: Reverse primer sequence ACGTCTTACTTGCACTGATTGATTCA). 각 군별 시약 조성은 아래 표 1과 같다.The reagent composition was positive control 1 (PC 1) containing only the probe in the porous structure of the PCR chip, positive control 2 (PC 2), positive control 3 (PC 3) in which the forward and reverse primers were added to the positive control 1 and 2 (SEQ ID NO 2: Forward primer sequence TGGTCATGGTGATGTTGATTACTATTCAG, SEQ ID NO: 3: Reverse primer sequence ACGTCTTACTTGCACTGATTGATTCA). Reagent composition for each group is shown in Table 1 below.
PCR 시약 조성PCR reagent composition | |||
시약 조성Reagent Composition | 양성 대조군(Gel: Probe only)Positive control (Gel: Probe only) | 양성 대조군(Gel: Probe only)Positive control (Gel: Probe only) | 양성 대조군(Gel: Primer / Probe)Positive Control (Gel: Primer / Probe) |
NBS Taqman2X master mixNBS |
10㎕10 |
10㎕10 |
10㎕10 μl |
PrimerPrimer | 2㎕2 μl | 2㎕2 μl | -- |
Template(Target DNA)Template (Target DNA) | 1㎕1 μl | 1㎕1 μl | 1㎕1 μl |
DWDW | 7㎕7 μl | 7㎕7 μl | 9㎕9 μl |
TotalTotal |
20㎕20 |
20㎕20 |
20㎕20 μl |
3. PCR 수행 조건3. PCR Execution Conditions
PCR 수행 조건은 가공된 표적 샘플(Taget gene sequence)에 대해 95℃, 8초 동안의 사전-변성 단계(Pre-Denaturation), 95℃, 3초 동안의 변성 단계(Denaturation), 및 68℃, 14초 동안의 어닐링(Annealing) 단계를 40 순환(cycles)하였다(서열번호 4: Target gene sequence : TAA TGA CCC TAA AGG TTT TAA CCT GAA GTA CCG TTA TGA ACT CGA TGA TAA CTG GGG AGT AAT AGG TTC GTT TGC TTA TAC TCA TCA GGG ATA TGA TTT CTT CTA TGG CAG TAA TAA GTT TGG TCA TGG TGA TGT TGA TTA CTA TTC AGT AAC AAT GGG GCC ATC TTT CCG CAT CAA CGA ATA TGT TAG CCT TTA TGG ATT ACT GGG GGC CGC TCA TGG AAA GGT TAA GGC ATC TGT ATT TGA TGA ATC AAT CAG TGC AAG TAA GAC GTC AAT GGC ATA CGG GGC AGG GGT GCA ATT CAA CCC ACT TCC AAA TTT TGT CAT TGA CGC TTC ATA TGA ATA CTC CAA ACT CGA TAG CAT AAA AGT TGG CAC CTG GAT GCT TGG TGC AGG GTA TCG ATT CTA A).PCR performance conditions were 95 ° C., pre-denaturation for 8 seconds, 95 ° C., denaturation for 3 seconds, and 68 ° C., 14 for the processed target sample (Taget gene sequence). The annealing step for 40 seconds was cycled (SEQ ID NO 4: Target gene sequence: TAA TGA CCC TAA AGG TTT TAA CCT GAA GTA CCG TTA TGA ACT CGA TGA TAA CTG GGG AGT AAT AGG TTC GTT TGC TTA) TAC TCA TCA GGG ATA TGA TTT CTT CTA TGG CAG TAA TAA GTT TGG TCA TGG TGA TGT TGA TTA CTA TTC AGT AAC AAT GGG GCC ATC TTT CCG CAT CAA CGA ATA TGT TAG CCT TTA TGG ATT ACT GGG GGC CGG TCA TGG AAA GGC ATC TGT ATT TGA TGA ATC AAT CAG TGC AAG TAA GAC GTC AAT GGC ATA CGG GGC AGG GGT GCA ATT CAA CCC ACT TCC AAA TTT TGT CAT TGA CGC TTC ATA TGA ATA CTC CAA ACT CGA TAG CAT AAA AGT TGG CAC TGG TGC AGG GTA TCG ATT CTA A).
4. PCR 수행 결과4. Result of PCR
PCR 수행 결과는 3가지 방법으로 확인하였다. 도 9는 좌측 마커(marker)에서 우측으로 양성 대조군 1, 양성 대조군 2, 양성 대조군 3에 관한 전기 영동 사진인데, 이에 다르면 칩 내부에서 PCR이 모두 성공적으로 수행된 것을 확인할 수 있다. 또한, 도 10은 좌측으로부터 양성 대조군 1, 양성 대조군 2, 양성 대조군 3에 관한 칩의 형광 발현 사진인데, 이에 따르면 40 순환을 통해 모두 PCR이 3번째 다공 구조에만 특이적으로 형광 발현이 성공적으로 수행된 것을 확인할 수 있다. 도 11은 양성 대조군 (PC 1), 양성 대조군 2 (PC 2), 및 양성 대조군 3 (PC 3)에 관한 형광도 측정 그래프인데, 양성 대조군 1 (PC 1)과 양성 대조군 2 (PC 2) 그리고 양성 대조군 3 (PC 3)에서 PCR 진행이 확인되었다. 이러한 결과를 통해, 본 발명의 실시예에 따른 다공 구조 기반 멀티플렉스 PCR 장치는 종래보다 신속하게 PCR을 수행할 수 있을 뿐만 아니라 더욱 정밀하고 정확하여 신뢰성을 극대화한 실시간 PCR을 수행할 수 있음을 확인할 수 있다.PCR performance was confirmed by three methods. 9 is an electrophoretic picture of positive control 1, positive control 2, and positive control 3 from the left marker to the right. If this is different, it can be seen that PCR was successfully performed in the chip. In addition, FIG. 10 is a fluorescence expression photograph of the chip of the positive control 1, positive control 2, positive control 3 from the left side, according to the 40 cycles, the fluorescence expression was successfully performed specifically for the third porous structure in all 40 cycles You can see that. FIG. 11 is a graph of fluorescence measurements for positive control (PC 1), positive control 2 (PC 2), and positive control 3 (PC 3), with positive control 1 (PC 1) and positive control 2 (PC 2) and PCR progress was confirmed in positive control 3 (PC 3). Through these results, it is confirmed that the porous structure-based multiplex PCR device according to the embodiment of the present invention not only can perform PCR faster than the conventional method, but also can perform real-time PCR that is more precise and accurate to maximize reliability. Can be.
이상에서와 같이 도면과 명세서에서 최적 실시예가 개시되었다. 여기서 특정한 용어들이 사용되었으나, 이는 단지 본 발명을 설명하기 위한 목적에서 사용된 것이지 의미한정이나 특허청구범위에 기재된 본 발명의 범위를 제한하기 위하여 사용된 것은 아니다. 그러므로 본 기술 분야의 통상의 지식을 가진 자라면 이로부터 다양한 변형 및 균등한 타 실시예가 가능하다는 점을 이해할 것이다. 따라서 본 발명의 진정한 기술적 보호범위는 첨부된 특허청구범위의 기술적 사상에 의해 정해져야 할 것이다.As described above, optimal embodiments have been disclosed in the drawings and the specification. Although specific terms have been used herein, they are used only for the purpose of describing the present invention and are not intended to limit the scope of the invention as defined in the claims or the claims. Therefore, those skilled in the art will understand that various modifications and equivalent other embodiments are possible from this. Therefore, the true technical protection scope of the present invention will be defined by the technical spirit of the appended claims.
Claims (9)
- 멀티플렉스 PCR(Multiplex Polymerase Chain Reaction) 칩으로서, As a multiplex polymerase chain reaction (PCR) chip,서로 상이한 다수의 핵산 분자를 동시에 탐지하기 위해 상기 핵산 분자의 서로 상이한 서열과 특이적으로 혼성화되며, 서로 이격하여 배치되는 다수의 혼성화 반응용 프로브(probe); 및A plurality of hybridization probes specifically hybridized with different sequences of the nucleic acid molecules and spaced apart from each other to simultaneously detect a plurality of different nucleic acid molecules; And상기 멀티플렉스 PCR 칩의 내부 표면에 배치되어, 상기 프로브와 상기 핵산 분자 간의 접촉 면적을 증가시키도록 다공 구조(pore structure)를 형성하여 상기 다공 구조에 상기 프로브가 각각 결합되도록 하는 다수의 프로브 결합부를 포함하며,A plurality of probe coupling portions disposed on an inner surface of the multiplex PCR chip to form a porous structure to increase a contact area between the probe and the nucleic acid molecule so that the probes are respectively coupled to the porous structure; Include,상기 프로브는 염기 서열의 말단 또는 중간에 각각 형광 물질 및 형광 억제 물질이 결합되는 것을 특징으로 하는 멀티플렉스 PCR 칩.The probe is a multiplex PCR chip, characterized in that the fluorescent material and the fluorescence inhibitor is bound to the end or the middle of the base sequence, respectively.
- 제 1 항에 있어서, 상기 프로브는 상기 핵산 분자의 서열에 특이적으로 혼성화되며, 상기 형광 억제 물질에 의해 상기 형광 물질의 형광 발생이 억제되며, 상기 핵산 분자의 이중가닥 혼성화에 의해 상기 프로브가 분해되면, 상기 형광 물질이 상기 프로브에서 유리되거나 거리가 멀어져 형광이 발생하는 것을 특징으로 하는 멀티플렉스 PCR 칩.The method of claim 1, wherein the probe is specifically hybridized to the sequence of the nucleic acid molecule, the fluorescence generation of the fluorescent material is inhibited by the fluorescent inhibitor, and the probe is degraded by double-stranded hybridization of the nucleic acid molecule. When the fluorescent material is released from the probe or the distance is far multiplex PCR chip, characterized in that the fluorescence occurs.
- 제 1 항에 있어서, 상기 프로브 결합부는 상기 핵산 분자의 서로 상이한 서열과 특이적으로 혼성화되는 다수의 프라이머를 더 포함하는 것을 특징으로 하는 멀티플렉스 PCR 칩.The multiplex PCR chip of claim 1, wherein the probe binding unit further comprises a plurality of primers that specifically hybridize to different sequences of the nucleic acid molecule.
- 제 1 항에 있어서, 상기 다공 구조는 폴리에틸렌 글리콜 디아크릴레이트(Polyethylene glycol Diacrylate, PEGDA), 폴리에틸렌 글리콜 디메타아크릴레이트(Polyethylene glycol Dimethacrylate, PEGDMA), 2-하이드록시에틸 메타아크릴레이트(2-hydroxyethyl methacrylate, HEMA), 에틸렌 글리콜 디아크릴레이트(Ethylene glycol Diacrylate, EGDA), 에틸렌 글리콜 메타아크릴레이트(Ethylen glycol Dimethacrylate, EGDMA), 폴리비닐 알코올(Polyvinyl alcohol, PVA), 아가로스(agarose), 실리콘(silicone), 및 파라핀(paraffin) 중 적어도 하나로 구성된 겔 형성 물질(gel material), 폴리에틸렌 글리콜(Polyethylene glycol, PEG) 및 에틸렌 글리콜(Ethylene glycol, EG) 중 적어도 하나로 구성된 포어 형성 물질(porogen)에 광 개시제와 버퍼를 첨가하여 형성되는 것을 특징으로 하는 멀티플렉스 PCR 칩.The method of claim 1, wherein the porous structure is polyethylene glycol diacrylate (PEGDA), polyethylene glycol dimethacrylate (PEGDMA), 2-hydroxyethyl methacrylate (2-hydroxyethyl methacrylate , HEMA), ethylene glycol diacrylate (EGDA), ethylene glycol methacrylate (EGDMA), polyvinyl alcohol (PVA), agarose, silicon (silicone) And a photoinitiator and a buffer in a porogen comprising at least one of a gel material, polyethylene glycol (PEG), and ethylene glycol (EG), which are composed of at least one of paraffin and paraffin. Multiplex PCR chip, characterized in that formed by the addition.
- 제 1 항에 있어서, 상기 프로브 결합부는 상기 형광 물질에 결합하는 링커 물질 및 다공 구조 결합 물질을 포함하는 것을 특징으로 하는 멀티플렉스 PCR 칩.The multiplex PCR chip of claim 1, wherein the probe binding unit comprises a linker material and a porous structure binding material that bind to the fluorescent material.
- 제 3 항에 있어서, 상기 프로브 결합부는 상기 프라이머에 결합하는 링커 물질 및 다공 구조 결합 물질을 포함하는 것을 특징으로 하는 멀티플렉스 PCR 칩.The multiplex PCR chip of claim 3, wherein the probe binding unit comprises a linker material and a porous structure binding material that bind to the primer.
- 제 1 항에 있어서, 상기 멀티플렉스 PCR 칩은, 평판 형상의 제 1 판; 상기 제 1 판 상에 배치되고, 유입부, 반응 영역 및 유출부를 포함하는 제 2 판; 및 상기 제 2 판 상에 배치되어 상기 반응 영역을 커버하고, 하부 표면에 상기 프로브가 이격 배치되는 제 3 판을 포함하되, 상기 프로브가 배치되는 중심부 및 상기 중심부를 둘러싸도록 상기 중심부에 인접하여 돌출 형성되는 주변부로 구성되는 프로브 고정부를 더 포함하는 것을 특징으로 하는 멀티플렉스 PCR 칩.According to claim 1, wherein the multiplex PCR chip, The plate-shaped first plate; A second plate disposed on the first plate and including an inlet, a reaction zone and an outlet; And a third plate disposed on the second plate to cover the reaction region and spaced apart from the probe on a lower surface thereof, the third plate protruding adjacent to the center so as to surround the center and the center where the probe is disposed. Multiplex PCR chip further comprises a probe fixing portion consisting of a peripheral portion formed.
- 제 1 항 내지 제 7 항 중 어느 한 항에 따른 멀티플렉스 PCR 칩;A multiplex PCR chip according to any one of claims 1 to 7;상기 멀티플렉스 PCR 칩 내의 상기 프로브를 향해 여기 광선(excitation light)을 조사하는 광 제공부; 및 A light providing unit configured to irradiate excitation light toward the probe in the multiplex PCR chip; And상기 여기 광선에 의하여 다수의 프로브에서 발생하는 형광(emission light)을 검출하는 광 검출부를 포함하고, It includes a light detection unit for detecting the fluorescence (emission light) generated by a plurality of probes by the excitation light,상기 광 제공부 및 상기 광 검출부에 의한 검출은 단일 또는 다수의 파장의 광을 이용하여 수행되는 것을 특징으로 하는 멀티플렉스 PCR 장치.The multiplex PCR device, characterized in that the detection by the light providing unit and the light detector is performed using light of a single or multiple wavelengths.
- 제 1 항 내지 제 7 항 중 어느 한 항에 따른 멀티플렉스 PCR 칩; 및A multiplex PCR chip according to any one of claims 1 to 7; And상기 멀티플렉스 PCR 칩에 접촉하여, 상기 멀티플렉스 PCR 칩에 멀티플렉스 PCR을 위한 열을 전달하는 적어도 하나의 열 블록을 포함하는 것을 특징으로 하는 멀티플렉스 PCR 장치.And at least one thermal block in contact with the multiplex PCR chip to transfer heat for multiplex PCR to the multiplex PCR chip.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150032228A KR101724281B1 (en) | 2015-03-09 | 2015-03-09 | Multiplex pcr chip and multiplex pcr device comprising the same |
KR10-2015-0032228 | 2015-03-09 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2016143995A1 true WO2016143995A1 (en) | 2016-09-15 |
Family
ID=56880099
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2016/000304 WO2016143995A1 (en) | 2015-03-09 | 2016-01-12 | Multiplex pcr chip and multiplex pcr device comprising same |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR101724281B1 (en) |
WO (1) | WO2016143995A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3944896A1 (en) * | 2020-07-30 | 2022-02-02 | Genesystem Co., Ltd. | Multiplex pcr chip and multiplex pcr method using same |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102105558B1 (en) * | 2018-03-23 | 2020-04-28 | (주)바이오니아 | Analysis Plate For Polymerase Chain Reaction |
KR102426788B1 (en) | 2019-06-30 | 2022-07-29 | 주식회사 진시스템 | Pcr pretreatmet method and multiplex pcr chip thereof |
KR102400907B1 (en) | 2019-06-30 | 2022-05-24 | 주식회사 진시스템 | Multiplex pcr apparatus |
KR102263837B1 (en) * | 2020-11-05 | 2021-06-11 | 주식회사 미코바이오메드 | Integrated chip with multiple ultra-high-speed extracting and amplifying nucleic acids for point-of-care testing |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2006271216A (en) * | 2005-03-28 | 2006-10-12 | Dainippon Ink & Chem Inc | System for judging presence or absence of nucleic acid having specific nucleic acid sequence and method of the judgement |
US20060263799A1 (en) * | 2005-02-18 | 2006-11-23 | Infineon Technologies Ag | Macroporous support for chemical amplification reactions |
KR101019952B1 (en) * | 2008-05-27 | 2011-03-11 | 박민구 | Stroke early diagnosing chip and screening analysis thereof |
KR20110118572A (en) * | 2010-04-23 | 2011-10-31 | 나노바이오시스 주식회사 | Device for amplify nucleic acid comprising two heating block |
KR20140028431A (en) * | 2012-08-29 | 2014-03-10 | 나노바이오시스 주식회사 | Pcr chip for detecting electrochemcial signal comprising heating block of repetitively disposed heater unit, real-time pcr device comprising the same, and real-time pcr using the same |
-
2015
- 2015-03-09 KR KR1020150032228A patent/KR101724281B1/en active IP Right Grant
-
2016
- 2016-01-12 WO PCT/KR2016/000304 patent/WO2016143995A1/en active Application Filing
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060263799A1 (en) * | 2005-02-18 | 2006-11-23 | Infineon Technologies Ag | Macroporous support for chemical amplification reactions |
JP2006271216A (en) * | 2005-03-28 | 2006-10-12 | Dainippon Ink & Chem Inc | System for judging presence or absence of nucleic acid having specific nucleic acid sequence and method of the judgement |
KR101019952B1 (en) * | 2008-05-27 | 2011-03-11 | 박민구 | Stroke early diagnosing chip and screening analysis thereof |
KR20110118572A (en) * | 2010-04-23 | 2011-10-31 | 나노바이오시스 주식회사 | Device for amplify nucleic acid comprising two heating block |
KR20140028431A (en) * | 2012-08-29 | 2014-03-10 | 나노바이오시스 주식회사 | Pcr chip for detecting electrochemcial signal comprising heating block of repetitively disposed heater unit, real-time pcr device comprising the same, and real-time pcr using the same |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3944896A1 (en) * | 2020-07-30 | 2022-02-02 | Genesystem Co., Ltd. | Multiplex pcr chip and multiplex pcr method using same |
Also Published As
Publication number | Publication date |
---|---|
KR20160110574A (en) | 2016-09-22 |
KR101724281B1 (en) | 2017-04-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2016013770A1 (en) | Multiplex pcr chip and multiplex pcr device comprising same | |
WO2016143995A1 (en) | Multiplex pcr chip and multiplex pcr device comprising same | |
WO2011132977A2 (en) | Pcr device including two heating blocks | |
CA2864260C (en) | Apparatus and method for automatically analyzing biological samples | |
WO2016105073A1 (en) | Pcr apparatus comprising repeated sliding means, and pcr method using same | |
WO2014148877A1 (en) | Primer set for detecting food poisoning, pcr apparatus using same, and method for detecting food poisoning using same | |
WO2017123533A1 (en) | Detection apparatus having a microfluorometer, a fluidic system, and a flow cell latch clamp module | |
KR101813870B1 (en) | Automatic analysis device for molecular diagnosis | |
WO2005028110A2 (en) | Microplates useful for conducting thermocycled nucleotide amplification | |
EP3954458A1 (en) | Polymerase chain reaction system | |
WO2014022700A2 (en) | Functionally integrated device for multiplex genetic identification and method for separation and detection of dna fragments | |
WO2015102379A1 (en) | Ultra-high speed and real-time pcr device on basis of lab-on-a-chip for detecting food poisoning bacteria of agricultural food, and food poisoning detection method using same | |
WO2019182407A1 (en) | High-speed polymerase chain reaction analysis plate | |
WO2022025381A1 (en) | Multiplex pcr chip and multiplex pcr method using same | |
WO2014104771A1 (en) | Micro-pcr chip comprising primer set for detecting food poisoning, real-time pcr device comprising same, and method for detecting food poisoning using same | |
WO2014104770A1 (en) | Primer set for detecting food poisoning, pcr apparatus using same, and method for detecting food poisoning therewith | |
WO2013180406A1 (en) | Primer set for detecting foot and mouth disease according to serum type, pcr device using same, and method for detecting foot and mouth disease by using same | |
CN111560310A (en) | Random access type digital nucleic acid detection device and use method | |
WO2014062033A1 (en) | Micro pcr chip and real-time pcr device comprising same | |
KR20180023545A (en) | Primer and Probe Set for Detecting Atypical Pneumonia, PCR Device Using Same, and Method for Detecting Atypical Pneumonia | |
KR20180023544A (en) | Primer and Probe Set for Detecting Typical Pneumonia, PCR Device Using Same, and Method for Detecting Typical Pneumonia | |
CN113512606A (en) | Honeycomb chip-based kit for high-throughput detection of intestinal protozoa and detection method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16761882 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 16761882 Country of ref document: EP Kind code of ref document: A1 |