WO2016079321A1 - Antagonistes de setdb2 pour leur utilisation dans la thérapie de maladies infectieuses - Google Patents

Antagonistes de setdb2 pour leur utilisation dans la thérapie de maladies infectieuses Download PDF

Info

Publication number
WO2016079321A1
WO2016079321A1 PCT/EP2015/077267 EP2015077267W WO2016079321A1 WO 2016079321 A1 WO2016079321 A1 WO 2016079321A1 EP 2015077267 W EP2015077267 W EP 2015077267W WO 2016079321 A1 WO2016079321 A1 WO 2016079321A1
Authority
WO
WIPO (PCT)
Prior art keywords
infection
setdb2
superinfection
antagonist
lung
Prior art date
Application number
PCT/EP2015/077267
Other languages
English (en)
Inventor
Andreas Bergthaler
Christopher SCHLIEHE
Original Assignee
Cemm Forschungszentrum Für Molekulare Medizin Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cemm Forschungszentrum Für Molekulare Medizin Gmbh filed Critical Cemm Forschungszentrum Für Molekulare Medizin Gmbh
Publication of WO2016079321A1 publication Critical patent/WO2016079321A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52—Purines, e.g. adenine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid, pantothenic acid
    • A61K31/198—Alpha-aminoacids, e.g. alanine, edetic acids [EDTA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4995—Pyrazines or piperazines forming part of bridged ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/60—Salicylic acid; Derivatives thereof
    • A61K31/618—Salicylic acid; Derivatives thereof having the carboxyl group in position 1 esterified, e.g. salsalate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Antagonists of Setdb2 for use in the therapy of infectious diseases are Antagonists of Setdb2 for use in the therapy of infectious diseases
  • the present invention relates to an antagonist of the methyltransferase Setdb2 for use in treating an infection.
  • methods for treating, preventing or ameliorating infections comprising the administration of an antagonist of Setdb2 to a subject in need of such treatment.
  • the treatment of superinfections in particular bacterial superinfections.
  • the infection, in particular the bacterial superinfection can be preceded by a viral infection.
  • Virus-induced immune responses are thought to be involved in the pathogenesis of bacterial superinfections.
  • TLRs toll-like receptors
  • IFN type-I interferon
  • NF-KB nuclear factor kappa B
  • IFNs interferon- stimulated genes
  • ISGs interferon- stimulated genes
  • Many ISGs encode effector proteins, which mediate the defense against viruses and other pathogens ' .
  • TLRs can lead to the activation and nuclear translocation of NF- ⁇ proteins, which in turn induce the expression of proinflammatory genes involved in antibacterial defense 5 ' 9 .
  • Type-I IFN and NF- ⁇ signaling are subjected to multiple layers of regulation, which are required to maintain a balance between effective pathogen clearance, the prevention of tissue damage and disease tolerance 10, n ' 12 ' 13 .
  • Type I IFN and NF- ⁇ signaling are two important pathways for this process and are subjected to multiple layers of crosstalk, many of which are still poorly understood.
  • the therapy of infections often involves the use of drugs that target the pathogen directly.
  • fungal infections are treated by antifungal medication including macrocyclic polyenes and imidazole, thiazole and triazole derivates.
  • the therapy of viral infections includes antiviral medication including entry inhibitors and inhibitors specific to viral enzymes such as reverse transcriptase, integrase and proteases.
  • the therapy using antiprotozoal agents including metronidazole is recommended.
  • antibiotics such as penicillins, cephalosporins, chloramphenicol sulfonamides, trimethoprim-sulfamethoxazole, macrolides and quinolones.
  • the technical problem underlying the present invention is the provision of means and methods for the therapy of infections, such as superinfections, and in particular bacterial superinfections.
  • the present invention relates to an antagonist of the methyltransferase Setdb2 for use in treating an infection.
  • the present invention relates to a method for treating an infection comprising the administration of an antagonist of the methyltransferase Setdb2 to a subject in need of such a treatment.
  • the present invention relates to an antagonist of the methyltransferase Setdb2 for use in treating a bacterial superinfection.
  • bacterial superinfection is a distinct, specific type of a bacterial infection.
  • the term "bacterial superinfection” as used herein can refer to a second bacterial infection superimposed on an earlier infection.
  • the term “bacterial superinfection” can refer to a new bacterial infection occurring in a patient having an earlier or preexisting infection.
  • the "earlier infection” or “pre-existing infection” can be a viral infection, bacterial infection, a fungal infection or a protozoan infection.
  • the "earlier infection” or "pre-existing infection” is a virus infection.
  • the present invention solves the above identified technical problem, as documented herein below and in the appended examples.
  • Setdb2 was the only methyltransferase induced/upregulated upon virus infection.
  • a pathological setting i.e. a setting characterized by activation/overexpression/upregulation of Setdb2
  • the downregulation of Setdb2 can exert beneficial therapeutic effects.
  • the downregulation of Setdb2 resulted in enhanced expression/secretion of chemokine (C-X-C motif) ligand 1 (Cxcll) (and of its human ortholog chemokine (C-X-C motif) ligand 8 (CXCL8)).
  • Cxcll /CXCL8 are chemoattractants for neutrophils.
  • Setdb2 Because neutrophils are a key factor in the immune response it is believed that the enhanced Cxcll /CXCL8 expression or secretion triggered by downregulation of Setdb2 strengthens the immune response. Hence, the inhibition of Setdb2 is beneficial in a clinical setting that is characterized by Setdb2 activation/overexpression/upregulation, like viral infection, or an infection preceded by a viral infection, e.g. bacterial superinfection preceded by a viral infection.
  • mice were first infected intranasally with influenza virus (strain A/PR/8/34, or shortly PR8) and subsequently superinfected intranasally with Streptococcus pneumoniae (Sp).
  • influenza virus strain A/PR/8/34, or shortly PR8
  • Sp Streptococcus pneumoniae
  • mice showed signs of pneumonia and pulmonary edema as measured by lung wet weight two days after superinfection with Streptococcus pneumoniae (Sp).
  • the pathology of pneumonia in this model includes increased size, weight, number of affected lobes, and hemorrhagic lesions of the lung.
  • the mice are also a model for pneumonia, in particular bacterial pneumonia 16 . Consequently, it is shown herein that the loss of the methyltransferase Setdb2 in the in vivo mouse model for bacterial superinfection and pneumonia resulted in an ameliorating effect in pathogenesis.
  • Setdb2 genetrap mice show a strong reduction of the Setdb2 protein compared to wild-type (WT) mice; see Fig. 2a. Therefore, the Setdb2 genetrap mice (Setdb2 ) reflect the activity of antagonists of Setdb2.
  • the experiments show that the gross pathological appearance of the lungs (including size, weight, number of affected lobes, and hemorrhagic lesions) of Setdb2 genetrap mice (Setdb2 ) was significantly milder as compared to WT control mice upon superinfection of influenza virus-infected mice with Streptococcus pneumoniae (Sp); see Fig. 5e, f. The bacterial load (Streptococcus pneumoniae) was also significantly lower in
  • Setdb2 genetrap mice (Setdb2 ) as compared to WT mice upon superinfection; Fig. 5k. Histopathological analysis of lung sections confirmed the beneficial effect: Setdb2 mice showed reduced signs of pneumonia including bronchitis, endothelialitis and inflammatory infiltrates (Fig. 5g, h). Furthermore, Setdb2 mice at this advanced stage of bacterial superinfection showed decreased levels of mRNA and protein of the pro-inflammatory cytokine 116 (Fig. 5i, j). As a proof of principle, Setdb2 was knocked down by specific siRNAs in a human cell system, thus demonstrating the feasibility of the use of an antagonist of Setdb2 in a human model; see Example 2 and Fig. 18.
  • Setdb2 is specifically upregulated upon influenza virus infection; Fig lc. It is believed that the pronounced beneficial effect of Setdb2 inhibition in bacterial superinfection is due to the upregulation of Setdb2 induced by the preceding viral infection. Thus, it is believed that the provided therapy with Setdb2 antagonists is particularly advantageous in clinical settings that are characterized by or associated with increased expression of Setdb2 (or upregulation of Setdb2); see Example 1 and Fig. 13.
  • Setdb2 genetrap mice (Setdb2 J " i ) and wild-type mice did, upon single intranasal infection of the lung with Streptococcus pneumoniae, not exhibit significant increased expression of Setdb2 or upregulation of Setdb2 (Fig. 13), differences of Cxcll, (Fig. 14d), of the number of neutrophils (Fig. 15e,f) and of the bacterial burden (Fig. 16b).
  • the present invention demonstrates a specific and surprising effect in a therapeutic setting that involves upregulation of Setdb2, such as bacterial superinfection of the lung upon preceding viral infection.
  • Setdb2 genetrap mice exhibit increased neutrophil infiltration upon bacterial superinfection; see Fig. 5c, d.
  • Neutrophils execute multiple roles including the regulation and resolution of inflammation and the elimination of bacterial pathogens 33 ' 41 .
  • Neutrophils migrate to inflammations sites and sites of bacterial infection following chemical signals, such as CXCL8.
  • CXCL8 is the human ortholog of mouse Cxcll and plays a similar important antibacterial role as chemoattractant for neutrophils (Richmond A, Nature Reviews Immunology. 2002 Sep;2(9):664-74).
  • Cxcll is a chemoattractant for neutrophils and is important for efficient pathogen clearance as well as implicated in immunopathologies .
  • Cxcll is a chemoattractant for neutrophils and is important for efficient pathogen clearance as well as implicated in immunopathologies .
  • the depletion of Setdb2 in human haploid cells resulted consistently in strong induction and secretion of CXCL8; see Example 3 and Fig. 18.
  • Setdb2 (Setdb2 cells).
  • Setdb2 repressed the expression of the neutrophil attractant Cxcll and other NF- ⁇ target genes.
  • the inhibition of Setdb2 leads to reduced levels of the repressive histone mark, H3K9 tri-methyl at the Cxcll promoter, which consequently results in an increased Cxcll expression. This might, in turn, be useful to increase neutrophil infiltration and therefore be beneficial in the therapy of infections, in particular bacterial superinfections.
  • Cxcll is a chemoattractant for neutrophils and its upregulation strengthens the immune response and contributes to an effective therapy of infections/infectious diseases. Further, it is shown herein that NFkB target genes were differently regulated by Setdb2 knockdown in Setdb2 genetrap mice; see Fig. 2b.
  • the model used in Example 4 reflects a virus infection (the BMDM cells were treated with the TLR3 ligand and synthetic dsRNA analog polykC) and thus a clinical setting characterized by Setdb2 activation/overexpression.
  • the demonstrated upregulation/activation of Cxcll by the exemplary Setdb2 inhibitors Sinefungin and S-adenosyl-L-homocysteine (SAH) provide, as proof of principle, evidence that the inhibition of Setdb2 is indeed useful to exert a beneficial response in a setting that is characterized by increased Setdb2 expression/upregulation of Setdb2, such as a infection, like a viral infection or, in particular, a bacterial superinfection.
  • Sinefungin or S-adenosyl-L-homocysteine (SAH) in Setdb2 genetrap cells even showed a more than additive effect on Cxcll levels (compared to the effect observed in Setdb2 genetrap cells and Sinefungin in wild-type cells on Cxcll levels); see Fig. 20.
  • Setdb2 genetrap cells are "knock-down" cells that show some residual levels/residual activity of Setdb2.
  • SAH Sinefungin or S-adenosyl-L-homocysteine
  • This in turn can reflect the use of a selective Setdb2 antagonist in accordance with the present invention.
  • the model can also reflect the use of a combination therapy of an Setdb2 antagonist (e.g. a S-adenoxyl-L-methionine (SAM) analog, like Sinefungin or S-adenosyl-L- homocysteine (SAH)) and a different Setdb2 inhibitor (e.g. a selective Setdb2 inhibitor) in accordance with the present invention.
  • SAM S-adenoxyl-L-methionine
  • SAH S-adenosyl-L- homocysteine
  • this experiment shows that the use of a selective Setdb2 antagonist, or a combination therapy of an Setdb2 antagonist (e.g.
  • SAM S-adenoxyl-L- methionine
  • SAH S-adenosyl-L-homocysteine
  • Setdb2 antagonist e.g-. a selective Setdb2 antagonist
  • the present invention has, inter alia, the following advantages over conventional therapies of infections.
  • One advantage of the present invention is the fact that it strengthens the immune response against pathogens.
  • a further advantage of the invention is that it can be used as a prophylactic treatment, in particular of high risk patients.
  • a further advantage of the present invention is that it provides for a treatment option for long term treatment e.g., chronic infections.
  • the present invention has less side effects compared to conventionally used therapies e.g., killing of commensals.
  • the provided therapy of the invention can be used independently of developed resistance of the pathogens to conventional medicaments.
  • the present invention relates to the following items: An antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection.
  • a method for treating an infection comprising the administration of an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) to a subject in need of such a treatment.
  • the antagonist of item 1 , or the method of item 2 wherein said infection is a bacterial, a protozoan, a fungal infection or a viral infection.
  • the antagonist of item 9 or the method of item 9 is a bacterial infection selected from the group consisting of a Streptococcus infection, a Staphylococcus infection, a Haemophilus infection, a Mycobacterium infection, a Moraxella infection, a Pseudomonas infection, a Es
  • Streptococcus infection is a Streptococcus pneumoniae or Streptococcus pyogenes infection
  • Staphylococcus infection is a Staphylococcus aureus infection
  • Haemophilus infection is a Haemophilus influenzae infection
  • Mycobacterium infection is a Mycobacterium tuberculosis infection
  • Moraxella infection is a Moraxella catarrhalis infection
  • Pseudomonas infection is a Pseudomonas aeruginosa infection
  • said Escherichia infection is a Escherichia coli infection
  • Yersinia infection is a Yersinia enterocolitica infection
  • Treponema infection is a Treponema pallidum infection
  • Shigella infection is a Shigella flexneri infection
  • Salmonella infection is a Salmonella typhimurium infection
  • Rhodococcus infection is a Rhodococcus equi infection
  • Nocardia infection is a Nocardia asteroides infection
  • Campylobacter infection is a Campylobacter jejuni infection; or wherein said Clostridium infection is a Clostridium difficile infection.
  • Toxoplasma infection is a Toxoplasma gondii infection
  • Leishmania is a Leishmania infantum infection
  • Isospora infection is a Isospora belli infection
  • Plasmodium infection is a Plasmodium falciparum infection.
  • the antagonist of any one of items 1 and 3 to 13, or the method of any one of items 2 to 13, wherein said infection is preceded by a viral infection.
  • the antagonist of item 14, or the method of item 14, wherein said viral infection is an influenza virus infection.
  • the antagonist of item 14, or the method of item 14, wherein said viral infection is a viral infection selected from the group consisting of an orthomyxovirus infection, a herpesvirus infection, a hepadnavirus infection, a flavivirus infection, a lentivirus infection, a retrovirus infection, an arenavirus infection and a paramyxovirus infection.
  • a viral infection selected from the group consisting of an orthomyxovirus infection, a herpesvirus infection, a hepadnavirus infection, a flavivirus infection, a lentivirus infection, a retrovirus infection, an arenavirus infection and a paramyxovirus infection.
  • orthomyxovirus infection is an influenza virus infection
  • herpesvirus infection is a herpes simplex virus 1 (HSV-1), a
  • CMV cytomegalovirus
  • EBV Epstein-Barr virus
  • hepadnavirus infection is a hepatitis B virus (HBV) infection
  • said flavivirus is a hepatitis C virus (HCV) infection
  • said lentivirus infection is a human immunodeficiency virus (HIV) 1 or a human immunodeficiency virus (HIV) 2 infection;
  • retrovirus infection is a human T cell lymphotropic virus (HTLV) infection
  • arenavirus infection is a lassa virus (LASV) or a lymphocytic
  • LCMV choriomeningitis virus
  • paramyxovirus infection is a measles virus infection
  • influenza virus infection is an influenza A virus infection, influenza B virus infection or influenza C virus infection.
  • a polypeptide comprising an amino acid encoded by a nucleic acid molecule having the nucleic acid sequence as depicted in SEQ ID NO: 1 or SEQ ID NO: 3;
  • said antagonist is selected from the group consisting of small molecule drugs, binding molecules, siRNA, shRNA, miRNA, dsRNA, stRNA and antisense molecules.
  • the antagonist of item 21, or the method of item 21, wherein said small molecule drug is selected from the group consisting of
  • Sinefungin or S-adenosyl-L-homocysteine (SAH); BIX01294, UNC0321, UNC0638, NC0642, BRD4770, or UNC0224;
  • EPZ-5676 EPZ004777, or SGC0946;
  • the antagonist of item 21, or the method of item 21, wherein said binding molecule is selected from the group consisting of aptamers and intramers.
  • the antagonist of item 21 or 23, or the method of item 21 or 23, wherein said binding molecule specifically binds to methyltransferase SET domain bifurcated 2 (Setdb2), particularly methyltransferase SET domain bifurcated 2 (Setdb2) as defined in item 20.
  • the antagonist of item 21, or the method of item 21 wherein said siRNA, shRNA, miRNA, dsRNA, stRNA, or antisense molecule targets a nucleic acid molecule having a sequence encoding methyltransferase SET domain bifurcated 2 (Setdb2).
  • said nucleic acid is selected from the group consisting of
  • nucleic acid encoding a polypeptide comprising an amino acid sequence as depicted in SEQ ID NO:2 or SEQ ID NO:4;
  • nucleic acid comprising a nucleotide sequence as depicted in SEQ ID NO: 1 or SEQ ID NO: 3;
  • nucleic acid hybridizing under stringent conditions to the complementary strand of the nucleic acid as defined in (a) or (b);
  • nucleic acid comprising a nucleotide sequence with at least 65 % identity to the nucleotide sequence of the nucleic acids of any one of (a) to (c);
  • nucleic acid comprising a nucleotide sequence which is degenerate as a result of the genetic code to the nucleotide sequence of a nucleic acid of any one of (a) to (d).
  • Setdb2 is a member of the SET-domain superfamily; see Dillon (2005), Genome Biol 6:227. All members of this superfamily share the conserved SET-domain, which transfers methyl residues from S-adenosyl-methionine to the amino group of target lysine.
  • the terms "SET domain bifurcated 2”, “methyltransferase SET domain bifurcated 2”, “histone methyltransferase SET domain bifurcated 2", “Setdb2”, “methyltransferase Setdb2”, “histone methyltransferase Setdb2” and the like are used interchangeably herein.
  • Setdb2 belongs to the SUV39 gene family, a sub-family of the SET-domain superfamily.
  • the members of the SUV39 gene family share a Suvar 3-9/Enhancer-of-zeste/Trithorax (SET) domain that transfers methyl residues from S-adenosyl-methionine to the amino group of target lysines thereby catalyzing H3K9 methylation 22 ' 23 .
  • Setdbl the closest related family member of Setdb2, is involved in pro-viral silencing, genomic stability and the onset of cancer 24 ' 25 .
  • the SUV39 family members Suv39Hl , Ehmtl (alias: Glp) and Ehmt2 (alias: G9a) were shown to be involved in immunological processes such as the modulation of ISG expression, the NF- ⁇ pathway and T cell differentiation ' ' .
  • the prior art implicated functional roles for Setdb2 only in embryonic development and cell division ' ' .
  • isoforms of human Setdb2 are known. Corresponding exemplary nucleic acid sequences and amino acid sequences of isoform a and b are shown in SEQ ID NOs. 1 and 2 (isoform a) and 3 and 4 (isoform b), respectively. One isoform of murine Setdb2 is known. A corresponding exemplary nucleic acid sequence and amino acid sequence are shown in SEQ ID NOs. 5 and 6; respectively.
  • nucleic acid sequences can be retrieved in public databases like NCBI using the following accession numbers:
  • Amino acid sequences of SET domain bifurcated 2 can also be obtained from Uniprot, e.g. for mouse Setdb2 under Uniprot accession number Q8C267 and for human Setdb2 under accession number Q96T68.
  • Setdb2 refers primarily to a protein.
  • Setdb2 as defined herein and to be used in accordance with the present invention is preferably human Setdb2.
  • the Setdb2 as defined herein and to be used in accordance with the present invention can be selected from the group consisting of
  • a polypeptide comprising an amino acid encoded by a nucleic acid molecule having the nucleic acid sequence as depicted in SEQ ID NO: 1 or SEQ ID NO: 3;
  • the Setdb2 can be isoform a of Setdb2. Accordingly, the Setdb2 as defined herein and to be used in accordance with the present invention can be selected from the group consisting of a) a polypeptide comprising an amino acid encoded by a nucleic acid molecule having the nucleic acid sequence as depicted in SEQ ID NO: 1 ;
  • the Setdb2 can be isoform b of Setdb2. Accordingly, the Setdb2 as defined herein and to be used in accordance with the present invention can be selected from the group consisting of a) a polypeptide comprising an amino acid encoded by a nucleic acid molecule having the nucleic acid sequence as depicted in SEQ ID NO: 3;
  • a polypeptide comprising an amino acid encoded by a nucleic acid molecule having the nucleic acid sequence as depicted in SEQ ID NO: 1 or SEQ ID NO: 3;
  • a polypeptide comprising an amino acid encoded by a nucleic acid molecule having the nucleic acid sequence as depicted in SEQ ID NO: 1 or SEQ ID NO: 3;
  • a polypeptide comprising an amino acid encoded by a nucleic acid molecule having the nucleic acid sequence as depicted in SEQ ID NO: 1 or SEQ ID NO: 3; or
  • Setdb2 protein and related proteins/polypeptides (like variants, fragments, proteins/polypeptides having an identity of at least 65 % to the specific Setdb2 proteins provided and defined herein, and the like) have primarily the activity to methylate histone(s). However, it is also envisaged herein that Setdb2 protein and related proteins/polypeptides as defined herein can also have the activity to methylate non-histone proteins. Setdb2 protein and related proteins/polypeptides as defined herein can also have the activity, for example, to act as a scaffold or as a recruiting platform for interaction partners.
  • the nucleic acid sequence encoding for orthologous/homologous/identical (and thus related) sequences of the herein provided Setdb2 is at least 65% homologous/identical to the nucleic acid sequence as, inter alia, shown in SEQ ID NOs: 1, 3 and 5.
  • nucleic acid sequence encoding orthologous/homologous/identical (and thus related) sequences of the herein provided Setdb2 is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% homologous/identical to the nucleic acid sequence as, inter alia, shown in SEQ ID NOs: 1, 3 and 5, wherein the higher values are preferred.
  • the nucleic acid sequence encoding for orthologous/homologous/identical (and thus related) sequences of the herein provided Setdb2 is at least 99% homologous/identical to the nucleic acid sequence as, inter alia, shown in SEQ ID NOs: 1, 3 and 5.
  • the above defined orthologous/homologous/identical sequences can also be encompassed in longer or shorter isoforms, spliced variants and fusion transcripts.
  • the term "orthologous protein” or “orthologous gene” as used herein refers to proteins and genes, respectively, in different species that are similar to each other because they originated from a common ancestor.
  • Hybridization assays for the characterization of orthologs or other related sequences of known nucleic acid sequences are well known in the art; see e.g. Sambrook, Russell “Molecular Cloning, A Laboratory Manual”, Cold Spring Harbor Laboratory, N.Y. (2001); Ausubel, “Current Protocols in Molecular Biology”, Green Publishing Associates and Wiley Interscience, N.Y. (1989).
  • hybridization or “hybridizes” as used herein may relate to hybridizations under stringent or non-stringent conditions. If not further specified, the conditions are preferably non- stringent. Said hybridization conditions may be established according to conventional protocols described, e.g., in Sambrook (2001) loc. cit.; Ausubel (1989) loc. cit, or Higgins and Hames (Eds.) "Nucleic acid hybridization, a practical approach" IRL Press Oxford, Washington DC, (1985). The setting of conditions is well within the skill of the artisan and can be determined according to protocols described in the art.
  • the detection of only specifically hybridizing sequences will usually require stringent hybridization and washing conditions such as, for example, the highly stringent hybridization conditions of 0.1 x saline sodium citrate buffer (SSC), 0.1% SDS at 65°C or 2 x SSC, 60°C, 0.1 % SDS.
  • stringent hybridization and washing conditions such as, for example, the highly stringent hybridization conditions of 0.1 x saline sodium citrate buffer (SSC), 0.1% SDS at 65°C or 2 x SSC, 60°C, 0.1 % SDS.
  • Low stringent hybridization conditions for the detection of homologous or not exactly complementary sequences may, for example, be set at 6 x SSC, 1% SDS at 65°C.
  • the length of the probe and the composition of the nucleic acid to be determined constitute further parameters of the hybridization conditions.
  • the terms "homology” or “percent homology” or “identical” or “percent identity” or “percentage identity” or “sequence identity” in the context of two or more nucleic acid sequences refers to two or more sequences or subsequences that are the same, or that have a specified percentage of nucleotides that are the same (preferably at least 65% identity, more preferably at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% identity, most preferably at least 99% identity), when compared and aligned for maximum correspondence over a window of comparison (preferably over the full length), or over a designated region as measured using a sequence comparison algorithm as known in the art, or by manual alignment and visual inspection.
  • Sequences having, for example, 70% to 90% or greater sequence identity may be considered to be substantially identical. Such a definition also applies to the complement of a test sequence. Preferably the described identity exists over a region that is at least about 15 to 25 nucleotides in length, more preferably, over a region that is at least about 50 to 100 nucleotides in length and most preferably, over a region that is at least about 800 to 1200 nucleotides in length. Those having skill in the art will know how to determine percent identity between/among sequences using, for example, algorithms such as those based on CLUSTALW computer program (Thompson Nucl. Acids Res. 2 (1994), 4673-4680) or FASTDB (Brutlag Comp. App. Biosci. 6 (1990), 237-245), as known in the art.
  • CLUSTALW computer program Thimpson Nucl. Acids Res. 2 (1994), 4673-4680
  • FASTDB Brutlag Comp. App. Biosci. 6
  • BLAST 2.0 which stands for Basic Local Alignment Search Tool BLAST (Altschul (1997), loc. cit; Altschul (1993), loc. cit; Altschul (1990), loc. cit), can be used to search for local sequence alignments.
  • BLAST as discussed above, produces alignments of nucleotide sequences to determine sequence similarity.
  • HSP High-scoring Segment Pair
  • An HSP consists of two sequence fragments of arbitrary but equal lengths whose alignment is locally maximal and for which the alignment score meets or exceeds a threshold or cut-off score set by the user.
  • the BLAST approach is to look for HSPs between a query sequence and a database sequence, to evaluate the statistical significance of any matches found, and to report only those matches which satisfy the user-selected threshold of significance.
  • the parameter E establishes the statistically significant threshold for reporting database sequence matches. E is interpreted as the upper bound of the expected frequency of chance occurrence of an HSP (or set of HSPs) within the context of the entire database search. Any database sequence whose match satisfies E is reported in the program output.
  • the polypeptide to be used in accordance with the present invention has at least 65 % homology/identity to a Setdb2 protein/polypeptide having the amino acid sequence as, for example, depicted in SEQ ID NOs: 2, 4 and 6. More preferably, the polypeptide has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% homology/identity to a Setdb2 protein/polypeptide having the amino acid sequence as, for example, depicted in SEQ ID NOs: 2, 4 and 6, respectively, wherein the higher values are preferred. Most preferably, the polypeptide has at least 99% homology to a Setdb2 protein/polypeptide having the amino acid sequence as, for example, depicted in SEQ ID NO: 2, 4 and 6.
  • complement For sequence 5'AGTGAAGT3', the complement is 3 CACTTCA5', the reverse complement is 3'ACTTCACT5' and the reverse sequence is 5 GAAGTGA3'.
  • the present invention provides antagonists of Setdb2 for the therapy of infections. These antagonists can be used as a medicament, i.e. the antagonists of Setdb2 provided and described herein are for use in medicine (e.g. for use in the therapy/treatment of a disease, in particular a disease associated with Setdb2 activation, like infections/infectious disease).
  • the terms “medicament” and “pharmaceutical composition” are used interchangeably herein. Accordingly, definitions and explanations provided herein in relation to “pharmaceutical compositions”, apply, mutatis mutandis, to the term “medicament”.
  • treatment “treating” and the like are used herein to generally mean obtaining a desired pharmacological and/or physiological effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of partially or completely curing a disease and/or adverse effect (e.g. a symptom) attributed to the disease, in particular an infectious disease.
  • treatment covers any treatment of an infectious disease in a subject and includes: (a) preventing an infectious disease related in a subject, which may be predisposed to the infectious disease; (b) inhibiting the infectious disease, i.e. arresting its development; or (c) relieving the infectious disease, i.e. causing regression of the infectious disease.
  • Treating an infection can refer to (a) preventing the infection in a subject, which may be predisposed to the infection (e.g. preventing a bacterial infection in a subject that has an earlier or pre-existing virus infection); (b) inhibiting the infection, i.e. arresting its development (e.g. inhibiting the increase of the load of the pathogen in a subject, e.g. the viral load or bacterial load); or (c) relieving the infection, i.e. causing regression of the infection (e.g. reducing the load of the pathogen in a subject, e.g. reducing the viral load or bacterial load).
  • a complete regression of the infection can refer to a complete reduction of the load of the pathogen in a subject, e.g. a complete reduction of the viral load or bacterial load.
  • no or essentially no residual pathogen can be detected in such a complete regression of the infection.
  • an “individual”, “patient” or “subject” for the purposes of the present invention includes both humans and other animals, particularly mammals, and other organisms. Thus, the methods are applicable to both human therapy and veterinary applications.
  • the "individual”, “patient” or “subject” is a mammal, and most preferably the “individual", “patient” or “subject” is human.
  • the following relates to "antagonist of Setdb2" provided and to be used in accordance with the present invention.
  • the terms "antagonist of Setdb2” and “inhibitor of Setdb2” are used interchangeably herein.
  • the terms "antagonist of Setdb2” or “inhibitor of Setdb2” means in context of the present invention a compound capable of fully or partially preventing or reducing the physiologic activity and/or expression level of Setdb2.
  • the terms “antagonist” or “inhibitor” are used interchangeably herein. It is envisaged herein that the antagonist of Setdb2 is a selective antagonist of Setdb2.
  • said antagonist may, therefore, prevent, reduce, inhibit or inactivate the physiological activity of Setdb2 e.g. upon binding of said compound/substance (i.e. antagonist/inhibitor) to said Setdb2.
  • the term "antagonist” also encompasses competitive antagonists, (reversible) non-competitive antagonists or irreversible antagonist, as described, inter alia, in Mutschler, "Arzneistoff Sablagsgesellschaft mbH, Stuttgart, Germany. Such an inhibition can be measured by determining substrate turnover.
  • An "antagonist” or “inhibitor” of Setdb2 may also be capable of preventing the function of Setdb2 by preventing/reducing the expression of the nucleic acid molecule encoding for said Setdb2.
  • an antagonist/inhibitor of Setdb2 may lead to a decreased expression level of Setdb2 (e.g. decreased level of Setdb2 mRNA and/or of Setdb2 protein); this may be reflected in a decreased Setdb2 activity.
  • the decreased activity and/or expression level can be measured/detected by known methods, which are also described herein.
  • an "antagonist/inhibitor of Setdb2” may, for example, interfere with transcription of (an) Setdb2 gene(s), processing (e.g. splicing, export from the nucleus and the like) of the gene product(s) (e.g. unspliced or partially spliced mRNA) and/or translation of the gene product (e.g. mature mRNA).
  • the "antagonist/inhibitor of Setdb2” may also interfere with further modification (like glycosylation or phosphorylation) of the polypeptide/protein encoded by the Setdb2 gene(s) and thus completely or partially inhibit the activity of the Setdb2 protein(s) as described herein above.
  • the "antagonist/inhibitor of a Setdb2" may interfere with interactions of the Setdb2 protein(s) with other proteins (thus, for example, interfering with the activity of complexes involving Setdb2 protein(s)) or, in general, with its synthesis, e.g. by interfering with upstream steps of Setdb2 expression or with signalling pathways in which the Setdb2 is involved.
  • antagonists may, for example, be denoted “sequestering antagonists” or “signaling antagonists”.
  • the herein described Setdb2 antagonist/inhibitor will, accordingly, lead to a decrease or reduction of Setdb2 expression level and/or activity, and thereby reduce its contribution to the development, proliferation or progress of a disease associated with Setdb2 activation as defined herein, such as an infection, in particular a bacterial superinfection.
  • the antagonist of Setdb2 targets, preferably specifically targets, the methyltransferase SET domain bifurcated 2 (Setdb2).
  • the term "targeting" refers in this context to the binding to Setdb2 (and here in particular to the SET domain of Setdb2) and/or the inhibition of the activity of Setdb2, in particular the inhibition of the methyltransferase activity of Setdb2.
  • Setdb2 can primarily have the activity to methylate histone(s). It is envisaged herein that Setdb2 can have the activity to methylate non-histone proteins.
  • the inhibition of the activity of Setdb2 can also refer, for example, to the interference with/inhibition of the activity of Setdb2 to act as a scaffold or as a recruiting platform for interaction partners.
  • the methyltransferase SET domain bifurcated 2 (Setdb2) is human methyltransferase SET domain bifurcated 2 (Setdb2) as defined above.
  • the antagonist(s) may be (a) small molecule drug(s), siRNA, shRNA, miRNA, dsRNA, small temporal RNA (stRNA), antisense molecules or (a) (small) binding molecule.
  • Antagonists to be used herein can be (a) small molecule drug(s).
  • small molecule drug and “small molecule compound” are used interchangeably herein.
  • (A) small molecule drug(s) to be used herein as antagonist of Setdb2 can refer to an (organic) low molecular weight ( ⁇ 900 Daltons) compound. Small molecules can help to regulate a biological process and have usually a size in the order of 1(T 9 m.
  • Antagonists to be used herein, like small molecules (drugs), can, for example, be identified by screening compound libraries, for example Enamine, Chembridge or Prestwick chemical libraries.
  • one or more of the following small molecule drug(s) can be used as Setdb2 inhibitors in accordance with the present invention:
  • Pan-methyltransferase inhibitors such as DZNep, Neplanocin A, CHEMBL61824, CHEMBL468927, or Pan-methyltransferase inhibitors, such as an SAM analog like Sinefungin or S-adenosyl-L-homocysteine (SAH));
  • G9A-inhibitors like BIX01294, UNC0321, UNC0638, NC0642, BRD4770, and/or U C0224;
  • Dual G9A/SUV39H1 inhibitors like BIX-01338, and/or Chaetocin;
  • EZH2 inhibitors like Ell, UNC1999, EPZ-6438, EPZ005687, GSK126, and/or GS 343;
  • DOT1L inhibitors like EPZ-5676, EPZ004777, and/or SGC0946;
  • PRMT4 inhibitors like 17b, MethylGene and/orl7f; and/or
  • SMYD2 inhibitors like AZ505,
  • Setdb2 antagonists/inhibitors can, in addition to Setdb2, also antagonize/inhibit another compound/other compounds, like G9A, SUV39H1, EZH2, DOT1 L, PRMT3, PRMT4 and/or SMYD2 (and optionally further compounds).
  • another compound/other compounds like G9A, SUV39H1, EZH2, DOT1 L, PRMT3, PRMT4 and/or SMYD2 (and optionally further compounds).
  • small molecule drugs like BIX01294, UNC0321, UNC0638, NC0642, BRD4770, and/or UNC0224 are known to inhibit G9A.
  • they can be used as Setdb2 antagonists.
  • the use of dual G9A/Setdb2 inhibitors/antagonists is envisaged in accordance with the present invention.
  • Small molecule drugs like BIX-01338, and/or Chaetocin are known to inhibit G9A and SUV39H1. In accordance with the present invention they can be used as Setdb2 antagonists.
  • the use of trial G9A/SUV39H1/Setdb2 inhibitors/antagonists is envisaged in accordance with the present invention.
  • Small molecule drags like Ell, UNC1999, EPZ-6438, EPZ005687, GSK126, and/or GSK343 are known to inhibit EZH2. In accordance with the present invention they can be used as Setdb2 antagonists.
  • the use of dual EZH2/Setdb2 inhibitors/antagonists is envisaged in accordance with the present invention.
  • Small molecule drags like EPZ-5676, EPZ004777, and/or SGC0946 are known to inhibit DOTIL. In accordance with the present invention they can be used as Setdb2 antagonists.
  • the use of dual DOTIL /Setdb2 inhibitors/antagonists is envisaged in accordance with the present invention.
  • Small molecule drugs like 14u are known to inhibit PRMT3. In accordance with the present invention they can be used as Setdb2 antagonists. The use of dual PRMT3/Setdb2 inhibitors/antagonists is envisaged in accordance with the present invention.
  • Small molecule drugs like 17b, Methyl Gene and/orl7f are known to inhibit PRMT4. In accordance with the present invention they can be used as Setdb2 antagonists.
  • the use of dual PRMT4 /Setdb2 inhibitors/antagonists is envisaged in accordance with the present invention.
  • Small molecule drugs like AZ505 are known to inhibit SMYD2. In accordance with the present invention they can be used as Setdb2 antagonists. The use of dual SMYD2/Setdb2 inhibitors/ antagonists is envisaged in accordance with the present invention.
  • the small molecule drug is one ore more of
  • a pan-methyltransferase inhibitor such as DZNep, Neplanocin A, CHEMBL61824, CHEMBL468927;
  • SAM analog like Sinefungin and/or S-adenosyl-L-homocysteine (SAH)
  • the small molecule drug is one or more of
  • pan-methyltransferase inhibitor such as DZNep, Neplanocin A, CHEMBL61824, CHEMBL468927;
  • SAM S-adenosyl-L-homocysteine
  • the small molecule drug is an SAM analog (like Sinefungin or S-adenosyl-L-homocysteine (SAH)) or phamiaceutically acceptable salts, solvates, and/or hydrates of the drug.
  • SAM analog like Sinefungin or S-adenosyl-L-homocysteine (SAH)
  • SAH S-adenosyl-L-homocysteine
  • Vendor Angene Chemical (SID 136514883 - External ID: AG-J-15319)
  • Vendor Angene Chemical (SID 181278197 - External ID: AGN-PC-046XPQ)
  • KODBDIFHMBDFOH-LBPRGKRZSA-N S-adenosyl-L-methionine (SAM) analoga can be used herein as antagonists of Setdb2.
  • preferred antagonists of Setdb2 are the SAM analoga Sinefungin and/or S- adenosylhomocysteine. Particularly preferred is Sinefungin.
  • Adenosylomithine Compound 57926, Antibiotic A 9145, Sinefiingina,
  • S-adenosylhomocysteine S-adenosyl-L-homocysteine
  • AdoHcy AdoHcy
  • adenosylhomocysteine Formycinylhomocysteine
  • Sinefungin is described in the prior art as an antifungal antibiotic and as a compound having antiparasitic activity (plasmodium, leishmania, trypanosome). Also some effects of Sinefungin on viruses (e.g. VSV, flavivirases) have been suggested. Yet, the use of Sinefungin in a therapy of infections associated with Setdb2 upregulation, like bacterial superinfections as defined herein, has not been disclosed.
  • Vaulaubeix (J Biol Chem (2009) 284, 19321-19330) is concerned with the design of potential drugs against tubercle bacilli. To this end, Vau ceremonies (loc. cit.) investigates the effect of Sinefungin, S-adenosyl-L-homocysteine and S-Adenosyl-N-decyl-aminoethyl on mycolic acid methyltransferases which are characteristic of tubercle bacilli.
  • Sinefungin and S- adenosyl-L-homocysteine are general inhibitors of S-Adenosylmethionine- (SAM) dependent methyltransferases
  • SAM S-Adenosylmethionine-
  • Vaubourgeix found that Sinefungin and S-adenosyl-L-homocysteine do not inhibit mycolic acid methyltransferases (paralogs of SAM-dependent methyltransferases) of tubercle bacilli and are therefore not useful in the treatment of tubercle bacilli infection.
  • Vaulaubeix does therefore not envision that a Setdb2 antagonist might be beneficial in a setting wherein Setdb2 is upregulated, in particular in a bacterial superinfection of the lung (like Streptococcus pneumoniae superinfection) that may be preceded by a viral infection (like influenza virus A infection).
  • Vau Louiseix teaches even away from the use of Setdb2 inhibitors like Sinefungin and S-adenosyl-L-homocysteine.
  • Yadav (BioMed Research International 2014, Article ID 156987) discloses that Sinefungin might inhibit Streptococcus pneumoniae biofilm growth. Yet, there is no proposal that a Setdb2 antagonist might be beneficial in a setting wherein Setdb2 is upregulated, in particular in a bacterial superinfection that may be preceded by a viral infection. Yadav investigates, inter alia, the effect of Sinefungin on pneumococcal infection of the ear without preceding viral infection. Yet, the authors of Yadav (loc. cit.) only draw the conclusion that Sinefungin might at most be used as a lead compound for developing antibiofilm agents. Hence, Yadav does not suggest that the data of that paper might provide a basis for the use of Sinefungin in the therapy of bacterial infections.
  • Vendor EMD Biosciences (SID 57571250 - External ID: 382190)
  • Vendor Angene Chemical (SID 188092173 - External ID: AGN-PC-080NC7)
  • Vendor Angene Chemical (SID 187406086 - External ID: AGN-PC-07NHBT)
  • UNC0642 Also known as: UNC0642; AGN-PC-09QG2O; GTPL7017; UNC 0642; IN2221 ; NCGC00189140-01 ; B-146019; 1481677-78-4
  • Vendor Angene Chemical (SID 191713283 - External ID: AGN-PC-09QG2O)
  • Vendor EMD Millipore (SID 170474678 - External ID: 382194)
  • Vendor Angene Chemical (SID 186512787 - External ID: AGN-PC-073VDJ)
  • Vendor Angene Chemical (SID 172813026 - External ID: AGN-PC-00BO57)
  • Vendor A Selleckchem (SID 172121846 - External ID: UNC1999)
  • Vendor A Selleckchem (SID 171061163 - External ID: EPZ-6438 (E7438))
  • Vendor A Selleckchem (SID 164178278 - External ID: EPZ005687)
  • Vendor A Selleckchem (SID 164178301 - External ID: EPZ-5676) E
  • Vendor A Selleckchem (SID 164178290 - External ID: EPZ004777)
  • Vendor Selleckchem (SID 164178309 - External ID: SGC 0946)
  • Vendor Angene Chemical (SID 186787438 - External ID: AGN-PC-079OCP)
  • Vendor Angene Chemical (SID 182564262 - External ID: AGN-PC-04UPWA)
  • Antagonists of Setdb2 in general including the above exemplary small molecule drugs are believed to exert their antagonizing effect, inter alia, by interfering with/inhibiting the methyltransferase activity of Setdb2.
  • the methyltransferase activity of methyltransferases that are members of the SET-domain protein superfamily (including the SUV39 family to which Setdb2 belongs) is believed to be mediated by the conserved SET-domain.
  • antagonists of Setdb2 can exert their antagonizing effect by targeting the conserved SET-domain of Setdb2.
  • targeting refers in this context to the binding to the SET-domain (e.g.
  • the above exemplary small molecule drugs can be used as antagonists of Setdb2 in accordance with the present invention.
  • antagonists of Setdb2 can be used herein, wherein said antagonists are competitive inhibitors/competitive antagonists of Setdb2.
  • Such competitive inhibitors/antagonists of Setdb2 are, e.g. substrate analoga (like S-adenosylmethionine (SAM) analoga, such as Sinefungin and S-adenosyl-L-homocysteine.
  • SAM S-adenosylmethionine
  • SAM S- adenosylmethionine
  • SAM S- adenosylmethionine
  • SAM S- adenosylmethionine
  • These competitive inhibitors/antagonists of Setdb2 bind to Setdb2 (in particular to the SET domain thereof).
  • SAM S-adenosylmethionine
  • Antagonists of Setdb2 can also exert their antagonizing effect, inter alia, by interfering witlVinhibiting the activity of Setdb2 to act as a scaffold or as a recruiting platform for interaction partners.
  • compounds can be used as antagonists of Setdb2 that are known in the prior art as inhibitors of methyltransferases, such as S-adenosylmethionine (SAM)- dependent methyltransferases, and/or of members of the SET-domain protein superfamily. It is believed that these known compounds can be used herein, because they target the methyltransferase activity of Setdb2 and/or because they target the conserved SET-domain of Setdb2.
  • SAM S-adenosylmethionine
  • the "SET” domain of Setdb2 consists of a "pre-SET domain” and a “bifurcated SET Domain” (herein designated as “SET1" and "SET2", respectively).
  • the SET domain of Setdb2 (or of related proteins) can be analyzed by appropriate computer programs, like world wide web at ncbi .nlm.rdh.gov/Stracture/cdd/wrpsb . cgi?
  • An exemplary nucleic acid sequence encoding a SET domain of Setdb2 can comprise the region encoding the "pre-SET domain" ranging from position 1639 to position 1983 of SEQ ID NO: 1, the region encoding SET1 ranging from position 2005 to position 2190 of SEQ ID NO: 1, and/or the region encoding SET2 ranging from position 2794 to position 2994 of SEQ ID NO: 1.
  • An exemplary amino acid sequence of a SET domain of Setdb2 can comprise the "pre-SET domain" having an amino acid sequence of from position 245 to 359 of SEQ ID NO: 2, SET1 having an amino acid sequence of from position 367 to 428 of SEQ ID NO: 2, and/or SET2 having an amino acid sequence of from position 630 to 696 of of SEQ ID NO: 2.
  • An exemplary nucleic acid sequence encoding a SET domain of Setdb2 can comprise the region encoding the "pre-SET domain" ranging from position 1039 to position 1383of SEQ ID NO: 3, the region encoding SET1 ranging from position 1405 to position 1590 of SEQ ID NO: 3, and/or the region encoding SET2 ranging from position 2194 to position 2394 of SEQ ID NO: 3.
  • An exemplary amino acid sequence of a SET domain of Setdb2 can comprise the "pre-SET domain" having an amino acid sequence of from position 233 to 347 of SEQ ID NO: 4, SET1 having an amino acid sequence of from position 355 to 416 of SEQ ID NO: 4, and/or SET2 having an amino acid sequence of from position 618 to 684 of SEQ ID NO: 4.
  • an antagonist of Setdb2 is to be used, wherein said antagonist binds to/inhibits the activity of/targets methyltransferases. In certain aspects of the present invention an antagonist of Setdb2 is to be used, wherein said antagonist binds to/inhibits the activity of/targets SAM-dependent methyltransferases. In certain aspects of the present invention an antagonist of Setdb2 is to be used, wherein said antagonist binds to/inhibits the activity of/targets histone methyltransferases. In certain aspects of the present invention an antagonist of Setdb2 is to be used, wherein said antagonist binds to/inhibits the activity of/targets histone lysine methyltransferases.
  • an antagonist of Setdb2 is to be used, wherein said antagonist binds to/inhibits the activity of/targets SAM-dependent histone methyltransferases. In certain aspects of the present invention an antagonist of Setdb2 is to be used, wherein said antagonist binds to/inhibits the activity of/targets SAM-dependent histone lysine methyltransferases.
  • an antagonist of Setdb2 is to be used, wherein said antagonist binds to/inhibits the activity of/targets SET domain-containing proteins. In certain aspects of the present invention an antagonist of Setdb2 is to be used, wherein said antagonist binds to/inhibits the activity of/targets the SET domain of SET domain containing proteins. In certain aspects of the present invention, the antagonist binds to/inhibits the activity of/targets SET domain containing proteins which are methyltransferases. In certain aspects of the present invention, the antagonist binds to/inhibits the activity of/targets SET domain containing proteins which are SAM-dependent methyltransferases.
  • the antagonist binds to/inhibits the activity of/targets SET domain containing proteins which are histone methyltransferases. In certain aspects of the present invention the antagonist binds to/inhibits the activity of/targets SET domain containing proteins which are histone lysine methyltransferases. In certain aspects of the present invention the antagonist binds to SET domain containing proteins of the SUV39 family which are histone lysine methyltransferases. In certain aspects of the present invention, the antagonist binds to/inhibits the activity of/targets SET domain containing proteins which are SAM-dependent histone methyltransferases.
  • the antagonist binds to/inhibits the activity of/targets SET domain containing proteins which are SAM-dependent histone lysine methyltransferases. In certain aspects of the present invention the antagonist binds to SET domain containing proteins of the SUV39 family which are SAM-dependent histone lysine methyltransferases.
  • compounds that broadly inhibit methyltransferases can be used herein as Setdb2 antagonists.
  • Such broad-spectrum or pan-methyltransferase inhibitors are, for example, DZNep, Neplanocin A, CHEMBL61824, CHEMBL468927; or SAM analoga like Sinefungin or S- adenosyl-L-homocysteine (SAH).
  • DOT1L (Gene ID: 84444, Uniprot: Q8TEK3), G9A (Gene ID: 10919, Uniprot: Q96KQ7 ), EZH2 (Gene ID: 2146, Uniprot: Q15910), SUV39H1 (Gene ID: 6839, Uniprot: 043463), PRMT3 (Gene ID: 10196, Uniprot: 060678) and PRMT4 (Gene ID: 10498, Uniprot: Q86X55) are SAM-dependent methyltransferases.
  • DOT1L, G9A, SUV39H1, EZH2, PRMT3 and PRMT4 are SAM-dependent histone methyltransferases.
  • DOT1L G9A, SUV39H1 and EZH2 are SAM-dependent histone lysine methyltransferases (KMTs).
  • PRMT3 and PRMT4 are SAM-dependent histone arginine methyltransferases (PRMTs).
  • G9A, SUV39H1 EZH2, PRMT3 and PRMT4 belong to the SET-domain protein superfamily.
  • DOT1L belongs to the DOT1 family members of which methylate K79 in the globular region of histone H3 and which are structurally not related to SET-domain proteins.
  • Inhibitors of DOT1L, G9A, SUV39H1 , EZH2, PRMT3 and/or PRMT4 can be used as antagonists of Setdb2 in accordance with the present invention.
  • DOT1L compounds inhibiting SAM-dependent histone lysine methyltransferases, which do not belong to the SET-domain protein family, like the DOT1 family (e.g. DOT1L), can be used herein as Setdb2 antagonists.
  • Such exemplary inhibitors are EPZ-5676, EPZ004777, SGC0946.
  • Setdb2 antagonists compounds that inhibit members of the SET-domain protein superfamily, such as the SUV39-family, and preferably compounds that inhibit members that are closely related to Setdb2, can be used herein as Setdb2 antagonists.
  • PRMT3 or PRMT4 are SAM-dependent histone arginine methyltransferases and members of SET-domain protein superfamily.
  • compounds inhibiting PRMT3 or PRMT4 can be used herein as Setdb2 antagonists.
  • Exemplary inhibitors are PRMT3 inhibitors like 14u; or PRMT4 inhibitors like 17b, MethylGene and/or 17f.
  • EZH2 is a SAM-dependent histone lysine methyltransferase and belongs to the EZ family of the SET-domain protein superfamily.
  • compounds inhibiting EZH2 can be used herein as Setdb2 antagonists.
  • Exemplary inhibitors are Ell, U C1999, EPZ-6438, EPZ005687, GSK126, or GSK343.
  • the antagonist to be used herein binds to SET domain containing proteins of the SUV39 family which are histone lysine methyltransferases and which are closely related to Setdb2, like G9A.
  • the phylogenetically closest-related family member of Setdb2 is Setdbl ; see Arrowsmith CH et al. Nat Rev Drug Discov 2012).
  • G9a and SUV39H1 are members of the SUV39 family that are closely related to Setdb2.
  • G9A and SUV39H1 are, like Setdb2, SAM-dependent histone lysine methyltransferases (KMT).
  • Exemplary inhibitors of G9A that can be used herein as antagonists of Setdb2 are BEX01294, UNC0321, U C0638, NC0642, BRD4770 or UNC0224. Also the use of dual G9A/SUV39H1 inhibitors like ⁇ -01338, or Chaetocin is envisaged herein.
  • SMYD2 is a SAM-dependent histone lysine methyltransferase and belongs to Smyd (SET and MYND domain containing protein) family of the SET-domain protein superfamily.
  • Smyd SET and MYND domain containing protein
  • Exemplary inhibitors of SMYD2, like AZ505, can be used in accordance with the present invention.
  • an antagonist of Setdb2 can be a binding molecule(s), such as be (an) aptamer(s) and/or (an) intramer(s).
  • peptides particularly cyclic peptides can be used as antagonists of Setdb2.
  • Cyclic peptides are polypeptide chains, wherein the amino termini and carboxyl termini, amino termini and side chain, carboxyl termini and side chain, or side chain and side chain are linked with a covalent bond that generates the ring.
  • biological selection technology such as phage display is used in order to select peptide ligands tethered to synthetic molecular structures. These peptide ligands show specificity to target Setdb2.
  • monomeric monocyclic peptide inhibitors and dimeric bicyclic peptide inhibitors of Setdb2 are used.
  • Exemplary antagonists of Setdb2 are siRNA, shRNA, miRNA, dsR A, stRNA, or antisense molecule(s). These molecules target a nucleic acid molecule having a sequence encoding Setdb2.
  • the nucleic acid molecule having a sequence encoding Setdb2 is especially mR A as defined herein.
  • Exemplary nucleic acid molecules having a sequence encoding Setdb2 are shown in SEQ ID NOs: 1, 3 and 5.
  • Exemplary mRNA molecules have a sequence corresponding to the sequences shown in SEQ ID NOs: 1, 3 and 5, respectively, with the exception that the thymidine (T) residue(s) of the sequences shown in SEQ ID NOs: 1 , 3 and 5, respectively, is/are replaced by (a) uracil (U) residue(s), if necessary.
  • genome-editing techniques like TALEN, Zinc fingers and/or CrispR/Cas9 technique can be used to antagonize Setdb2.
  • the present invention relates to and provides in particular for the use of (an) siRNA(s) as antagonists of Setdb2, wherein said siRNA(s) specifically target the nucleic acid encoding the Setdb2 protein(s), whereby the nucleic is especially mRNA as defined herein.
  • Antagonist(s)/inhibitor(s) of Setdb2 which are nucleic acids, such as siRNAs, shRNAs, antisense molecules and the like can readily be prepared by known techniques using, for example, the following target sequences.
  • siRNAs and the like to be employed herein can comprise an RNA sequence corresponding to one of the target sequences further described below.
  • the term "RNA sequence corresponding to" means in this context that the RNA sequence is (partially) identical to one of the target sequences below, if necessary with the exception that the thymidine (T) residues of the target sequence is replaced by a uracil (U) residue.
  • siRNAs usually comprise a first strand that is (partially) complementary to the target sequence and a second strand that is (partially) complementary to the first strand (and, hence, (partially) identical to the target sequence).
  • the siRNA can comprise a nucleic acid molecule comprising at least eight (or ten) contiguous bases.
  • the siRNA and the like can comprise at least eight (or ten) contiguous bases of an RNA sequence corresponding to one of the target sequences as defined herein.
  • the siRNA and the like can comprise at least eight (or ten) contiguous bases of an RNA sequence corresponding to one of the target sequences as defined herein.
  • an antagonizing siRNA to be used herein can comprise at least eight (or ten) contiguous bases of an RNA sequence corresponding to one of the target sequences as shown in the sequence of SEQ ID NOs: 7 or 8.
  • RNA sequence corresponding to means that the RNA sequence is identical to one of the target sequences as defined herein, if necessary with the exception that the thymidine (T) residues of the target sequence is replaced by a uracil (U) residue.
  • siRNAs can be non-complementary (to the target sequence).
  • the siRNA can further comprise at least one base at the 5' end and/or at least one base at the 3' end of the first strand and/or of the second strand.
  • the siRNA can comprise or consist of an RNA molecule having an RNA sequence corresponding to the target sequences as shown in SEQ ID NOs: 7 and/or an RNA molecule having an RNA sequence (partially) complementary to the sequence as shown in SEQ ID NOs: 7.
  • the siRNA can comprise or consist of an RNA molecule having an RNA sequence corresponding to the target sequences as shown in SEQ ID NOs: 8 and/or an RNA molecule having an RNA sequence (partially) complementary to the sequence as shown in SEQ ID NOs: 8.
  • the siRNA consists of an RNA molecule having an RNA sequence corresponding to the target sequences as shown in SEQ ID NOs: 7 and an RNA molecule having an RNA sequence (partially) complementary to the sequence as shown in SEQ ID NOs: 7.
  • the siRNA consists of an RNA molecule having an RNA sequence corresponding to the target sequences as shown in SEQ ID NOs: 8 and an RNA molecule having an RNA sequence (partially) complementary to the sequence as shown in SEQ ID NOs: 8.
  • the human embryonic kidney cell line Hek293T cell was used to deplete hSETDB2 by specific siRNAs (Qiagen) ( Figure 17).
  • Cells were transfected with a control siRNA, 2 different SETDB2-specific siRNAs (siRNA 1+2), a pool of both siRNAs (siRNA pool), or were left untreated as control (control siRNA).
  • control siRNA 2 different SETDB2-specific siRNAs
  • siRNA 1 alone or in combination is contemplated herein:
  • siRNA 1 targets SETDB2 at nt position 2481-2501 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 1.
  • siRNA 1 targets SETDB2 at nt position 1881-1901 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 3.
  • siRNA2 targets SETDB2 at nt position 2843-2863 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 1.
  • siRNA2 targets SETDB2 at nt position 2243-2261 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 3.
  • a preferred target sequence of the nucleic acids antagonists as defined above e.g. siRNA, shRNA, miRNA, dsRNA, stRNA, or antisense molecule targets a nucleic acid molecule having a sequence encoding methyltransferase SET domain bifurcated 2 (Setdb2)
  • nucleic acid encoding a polypeptide comprising an amino acid sequence as depicted in SEQ ID NO:2 or SEQ ID NO:4;
  • nucleic acid comprising a nucleotide sequence as depicted in SEQ ID NO: 1 or SEQ ID NO: 3;
  • nucleic acid hybridizing under stringent conditions to the complementary strand of the nucleic acid as defined in (a) or (b);
  • nucleic acid comprising a nucleotide sequence with at least 65 % identity to the nucleotide sequence of the nucleic acids of any one of (a) to (c);
  • target sequence to be used herein can be any of the can sequences encoding Setdb2 as defined above, and in particular fragments/portions of (or comprised in) the nucleotide sequence of the nucleic acids of any one of items (a) to (e) above.
  • fragments/portions of a length of 15 to 30, preferably 17 to 25, more preferably 18, 19, 20, 21, 22, 23 or 24 are contemplated herein as target sequence(s).
  • RNA sequence corresponding to means that the RNA sequence is identical to one of the target sequences as defined herein, if necessary with the exception that the tymidine (T) residues of the target sequence is replaced by a uracil (U) residue.
  • target sequences are shown in SEQ ID NO. 7 or SEQ ID NO. 8. These target sequences correspond to nt position 2481-2501 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 1 or nt position 1881-1901 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 3; and to nt position 2843-2863 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 1 or nt position 2243-2261 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 3, respectively.
  • sequences represent target sequence of the nucleic acids to be used as antagonists of Setdb2 as defined above (e.g. siRNA and the like, preferably siRNA).
  • siRNAs described above can be used alone or in combination with each other as antagonists of Setdb2 in accordance with the present invention.
  • a strand of an siRNA is of a length of 19 to 21 nt.
  • each strand of the siRNA is of a length of 19 to 21 bp.
  • the antagonist is preferably a selective antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2).
  • the above provided and herein used siRNAs are selective inhibitors of Setdb2.
  • Selectivity expresses the biologic fact that at a given compound concentration enzymes (or proteins) are affected to different degrees.
  • selective inhibition can be defined as preferred inhibition by a compound at a given concentration.
  • an enzyme (or protein) is selectively inhibited over another enzyme (or protein) when there is a concentration, which results in inhibition of the first enzyme (or protein) whereas the second enzyme (or protein) is not, or not substantially, affected.
  • the inhibitors to be used herein are preferably specific for Setdb2, i.e. the compounds specifically inhibit Setdb2.
  • the Setdb2 inhibitors/antagonists are preferably selective Setdb2 inhibitors/antagonists.
  • selective Setdb2 antagonist(s) refers to (a) Setdb2 antagonist(s) as defined herein (in particular (a) small molecule drug(s)) that inhibit(s) or display(s) antagonism towards Setdb2 without displaying substantial inhibition or antagonism towards another protein or enzyme, in particular another methyltransferase as defined herein above (e.g.
  • SAM S- adenosylmethionine
  • SAM-dependent methyltransferase like DOT1L, G9A, EZH2, PRMT3 or PRMT4
  • another histone methyltransferase another lysine methyltransferase
  • another SAM- dependent histone methyltransferase another SAM-dependent histone lysine methyltransferases
  • another SET domain containing protein another member of the SET- domain protein superfamily or another SET domain containing protein of the SUV39 family.
  • an Setdb2 antagonist that is selective for Setdb2 exhibits an Setdb2 selectivity of greater than about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold or greater than about 100-fold with respect to inhibition or antagonism of another protein or enzyme (in particular another methyltransferase as defined herein above, like another another S-adenosylmethionine (SAM)-dependent methyltransferase, e.g. DOT1L, G9A, EZH2, PRMT3 or PRMT4)).
  • SAM S-adenosylmethionine
  • pan-methyltransferase inhibitors i.e. compounds that broadly inhibit substantially any methyltransferase, like Sinefungin or S-adenosyl-L-homocysteine
  • selective Setdb2 antagonists are not considered herein as selective Setdb2 antagonists.
  • “Selectivity for Setdb2" can also be determined or defined by IC50 values.
  • the IC50 value of selective Setdb2inhibitors in relation to Setdb2 is low, preferably below 0.2 ⁇ , more preferably, below 0.15 ⁇ , 0.14 ⁇ , 0.13 ⁇ , 0.12 ⁇ or even lower.
  • the IC50 value is below 0.1 ⁇ , 0.095 ⁇ , 0.090 ⁇ , 0.085 ⁇ , 0.080 ⁇ , 0.075 ⁇ , 0.070 ⁇ , 0.065 ⁇ , 0.060 ⁇ , 0.055 ⁇ , 0.050 ⁇ , 0.045 ⁇ , 0.040 ⁇ , 0.035 ⁇ , 0.030 ⁇ , or even below 0.025 ⁇ , wherein the lower values are preferred over the higher values.
  • the IC50 value is below 0.024 ⁇ , 0.023 ⁇ , 0.022 ⁇ , 0.021 ⁇ , 0.020 ⁇ , 0.019 ⁇ , 0.018 ⁇ , 0.017 ⁇ , 0.016 ⁇ , 0.015 ⁇ , 0.014 ⁇ , 0.013 ⁇ , 0.012 ⁇ , or 0.011 ⁇ .
  • the IC50 value may even be lower, for example, below 0.010 ⁇ , 0.009 ⁇ , 0.008 ⁇ , 0.007 ⁇ , 0.006 ⁇ , or 0.005 ⁇ . Generally, the lower values are preferred herein over the higher values.
  • Selective Setdb2 inhibitors in accordance with the present invention can, in the alternative, or in addition to the IC50 value in relation to Setdb2, be defined by IC50 value in relation to another protein or enzyme (in particular another methyltransferase as defined herein above, like another another S-adenosylmethionine (SAM)-dependent methyltransferase, e.g. DOT1L, G9A, EZH2, PRMT3 or PRMT4)).
  • SAM S-adenosylmethionine
  • the IC50 value of selective Setdb2 inhibitors in relation to another protein or enzyme is high, preferably higher than 0.001 ⁇ , 0.002 ⁇ , 0.003 ⁇ , 0.004 ⁇ , 0.005 ⁇ , 0.006 ⁇ , 0.007 ⁇ , 0.008 ⁇ , 0.009 ⁇ , or 0.010 ⁇ .
  • the IC50 value is higher than 0.011 ⁇ , 0.012 ⁇ , 0.013 ⁇ , 0.014 ⁇ , , 0.015 ⁇ , 0.016 ⁇ , 0.017 ⁇ , 0.018 ⁇ , 0.019 ⁇ , 0.020 ⁇ , 0.021 ⁇ , 0.022 ⁇ , 0.023 ⁇ , or 0.024 ⁇ .
  • the IC50 value is higher than 0.025 ⁇ , 0.030 ⁇ , 0.035 ⁇ , 0.040 ⁇ , 0.045 ⁇ , 0.050 ⁇ , 0.055 ⁇ , 0.060 ⁇ , 0.065 ⁇ , 0.070 ⁇ , 0.075 ⁇ , 0.080 ⁇ , 0.085 ⁇ , 0.090 ⁇ , 0.095 ⁇ , 0.1 ⁇ , or even higher, wherein the higher values are preferred over the lower values. Even more preferably, the IC50 value is higher than 0.12 ⁇ , 0.13 ⁇ , 0.14 ⁇ , 0.15 ⁇ , 0.2 ⁇ or even higher.
  • IC50 values for G9a inhibitors in relation to G9a are e.g. as follows:
  • G9A inhibitors i.e. one or more of ⁇ 01294, UNC0224, UNC0638, U C0321, UNC0646, UNC0642, UNC0123, UNC0558 and/or SGC A-366) can be used as Setdb2 antagonists in accordance with the present invention.
  • IC50 value of selective Setdb2 inhibitors in relation to G9A are higher than IC50 values of such known G9A inhibitors, i.e. are higher than, for example, 3 nM, 6 nM, 43 nM, 64 nM, 81 nM, 1 10 nM, 180 nM or 230 nM in relation to G9A.
  • the ratio of IC50 values of selective Setdb2-inhibitors in relation to Setdb2 and IC50 values of another protein or enzyme in particular another methyltransferase as defined herein above, like another another S-adenosylmethionine (SAM)-dependent methyltransferase, e.g. DOT1L, G9A, EZH2, PRMT3 or PRMT4)) in relation to Setdb2, preferably determined according to the same assay, is about 1 :10 or lower.
  • a ratio of 1:10 or lower also indicates selectivity of the inhibitor for Setdb2. More preferred is a ratio of 1 :10, 1 :20, 1 :30, 1 :40, 1 :50, 1 :60, 1 :70, 1 :80, 1 :90 or 1 :100 or even lower.
  • Binding molecules are also envisaged herein as antagonists of Setdb2. It is envisaged herein that the binding molecule antagonizing Setdb2 specifically binds to Setdb2 as defined herein. It is envisaged herein that the aptamers/intramers can specifically target/bind to (functional) fragments or (functional) derivatives of the Setdb2 proteins as defined herein, for example also to polypeptides having at least 65% or more identity to herein provided Setdb2 protein(s). Accordingly, the present invention relates to the use of these aptamers/intramers in particular in the therapeutic methods of the present invention.
  • Inhibitors for use in accordance with the present invention are described and provided herein. Also the use of inhibitors yet to be generated or known compounds to be tested for their inhibiting activity is envisaged in context of the present invention.
  • the present invention provides a method for assessing the activity of a candidate molecule suspected of being an antagonist of Setdb2 as defined and provided herein comprising the steps of:
  • a decrease of the methyltransferase SET domain bifurcated 2 (Setdb2) activity can indicate the capacity of the selected molecule to antagonize Setdb2.
  • the activity of Setdb2 can be reflected in e.g. methylation of histones and/or methylation of histone peptides in the presence of S-adenosyl-methionine (SAM), increase of histone marks,cytokine secretion (e.g. Cxcll/CXCL8) or methylation of non-histone proteins and/or methylation of non-histone peptides in the presence of S-adenosyl-methionine (SAM).
  • SAM S-adenosyl-methionine
  • the present invention relates to a method for assessing the (expression) level of a candidate molecule suspected of being an antagonist of Setdb2 as defined and provided herein comprising the steps of:
  • a decrease of the methyltransferase SET domain bifurcated 2 (Setdb2) (expression) level can indicate the capacity of the selected molecule to antagonize Setdb2.
  • the Setdb2 can be any of the Setdb2 proteins/polypeptides as defined herein above or any of the nucleic acids (particularly mRNAs) as defined herein, which encode the Setdb2 proteins/polypeptides.
  • the following exemplary assays can be used in the determination that a candidate molecule is indeed an antagonist of Setdb2 to be used in accordance with the present invention: assays quantifying specific histone modifications after compound treatment by high throughput microscopy; assays comparing specific histone modifications and production of cytokines by cells either proficient or deficient of Setdb2 expression; and assays screening the activity of purified Setdb2 in the presence or absence of an inhibitor.
  • Posttranslational modification of histones can be quantified by immunofluorescence using antibodies that are specific for the respective histone mark.
  • Overexpression of histone methyltransferases in cell culture leads to an increase of histone marks that are specific to the respective activity of the overexpressed enzyme. a) Setdb2-overexpression as readout for methyltransferase activity
  • the abundance of histone marks (e.g. H3K9mel , H3K9me2, H3K9me3, H3K4me3) in cell lines that overexpress human or mouse Setdb2 are quantified by immunofluorescence and compared to wild type cell lines.
  • As a positive control cell lines overexpressing methyltransferases of the SUV39 family with known activity (e.g. G9a, SUV39H1) are used. Cells are plated in pretreated 384 well plates (Corning, #3904) (5000 cells/well). After 48 h the cells are fixed for 20 min in 1% paraformaldehyde solution and than treated with 0.1% TritonX-100 for 1 h for permeabilization.
  • the difference in histone modification between wild type cells and cells overexpressing Setdb2 is used to screen for Setdb2-specific antagonists.
  • Wild type as well as Setdb2 overexpressing cell lines are subjected to a 384 well plate based robotic platform.
  • a drug library of epigenetic compounds including histone methyltransferase inhibitors, acetyltransferase inhibitors, and histone deacetylase inhibitors can be screened.
  • this system can be used to screen an unbiased library. ECHO acoustic transfer technology can be used to transfer compounds into 384 well tissue cultures. Different concentrations of compounds can also be tested. Quantification of histone marks can be performed as described in a). Histone marks in wild type and Setdb2-overexpressing cell lines are compared in order to identify molecules that show predominant effects specifically after overexpression of Setdb2, but not in wild type cells.
  • Wild type and Setdb2 knockout cell lines are plated into 384 well plates and then subjected to our robotic screening platform. Firstly, a drug library of epigenetic compounds can be screened, then, in a second step an unbiased screen can be performed. Treatment of cells can be done as described above. After treatment, cells are fixed and stained for histone marks as described above. This screen identifies compounds that turn the wild type phenotype into a situation observed in Setdb2 knockout cells. b) Identification of Setdb2 antagonists by alteration of cytokine secretion:
  • Setdb2 is a negative regulator of Cxcll in primary mouse macrophages as well as in lungs of influenza infected mice. Reduced expression of Setdb2 leads to increased production and secretion of the neutrophil chemoattractant Cxcll .
  • cells can be plated into 384 well plates and subjected to a robotic screening platform as described above. The secretion of Cxcll into the supernatant of the cell culture of treated cells is quantified as readout for Setdb2 activity. Compounds are screened, which increase, for example, the Cxcll expression in wild type cells.
  • These compounds can be identified as Setdb2 antagonists and used in accordance with the invention as Setdb2 antagonists. If compounds are screened, which increase, for example, the Cxcll expression in wild type cells, but not in Setdb2 knockout cells, these compounds can be identified as selective Setdb2 antagonists and used in accordance with the invention as selective Setdb2 antagonists.
  • Cxcll ELISA kits R&D systems
  • robotics platform For the detection of Cxcll ELISA kits (R&D systems) can be used with a robotics platform.
  • Setdb2 is purified from different expression systems, including E. coli, insect cell culture and mammalian cell culture.
  • Setdb2 is incubated with the methyl group donor SAM and purified chromatin, purified histones, respectively histone tail peptides, in a suitable buffer allowing peptide methylation.
  • methylated histones and histone tail peptides can be detected by SDS-PAGE and exposure of the dried gel to radiosensitive films (radioactive H 3 -SAM), by mass spectrometry, or western blot analysis using methyl- specific primary antibodies.
  • Radiosensitive films radiosensitive H 3 -SAM
  • Small molecules of a library are screened which interfere with Setdb2-specific methyltransferase activity.
  • Cell lines that can be used herein in the screening assays are, inter alia, human cell lines, such as human embryonic kidney cell line HEK293, or human haploid cell lines, like human haploid KMB7 cells, or murine cell lines/cells, such as primary murine macrophages.
  • the cell lines that can be used herein, like the exemplified cell lines above, can be either wild type or Setdb2 knockout/knockdown cells lines (or they can be derived from wild type or Setdb2 knockout/knockdown animals/animal models, like mice or rats).
  • candidate inhibitors of Setdb2 can be used to treat wild-type mice in in vivo animal experiments in order to confirai that the candidate inhibitors/antagonists are indeed useful in the treatment of an infection, such as a viral infection or a bacterial superinfection.
  • the wild-type mice to be used can, for example, be a model for an infection (e.g. a model for bacterial superinfection, like superinfection with Streptococcus pneumoniae upon infection with influenza virus (such as influenza virus A)).
  • wild-type mice can be first infected intranasally with influenza virus (strain A/PR/8/34, or shortly PR8) and subsequently superinfected intranasally with Streptococcus pneumoniae (Sp). These mice represent a model of bacterial superinfection, in particular bacterial superinfection of the lung.
  • influenza virus strain A/PR/8/34, or shortly PR8
  • Sp Streptococcus pneumoniae
  • An inhibitor/antagonist of Setdb2 significantly reduces the overall pathological symptoms of infected mice, e.g. pathology in the lungs of infected mice, like a reduced bacterial burden.
  • Antibodies, in particular monoclonal antibodies, that specifically bind to Setdb2 as defined herein can be used in the herein provided screening assays in order to detect the expression level of Setdb2.
  • such antibodies can be used in techniques like global ChlP-seq, imaging/co-localisations, immunoprecipitation to find new interaction partners by mass-spec, and the like.
  • Such antibodies are valuable research tools.
  • the present application relates in certain aspects to an antibody specifically binding to Setdb2, in particular an antibody specifically binding to murine Setdb2 (e.g. as shown in SEQ ID NO: 6) or a fragment thereof.
  • the antibody is a monoclonal antibody.
  • a C-terminal 60 amino acid long sequence (amino acid position 541-600 of the amino acid sequence of murine Setdb2, e.g. as shown in SEQ ID NO: 6) can be fused into a hepatitis B carrier protein as immunogen.
  • This region can be amplified by PC and inserted into a 6x histidine-tagged pB-His HBcAg_Linker plasmid 56 .
  • the fusion protein can be expressed in E. coli BL21 and purified on 1ml HisTrap HP columns (GE Healthcare) followed by a linear imidazole gradient on an A TA FPLC system (GE Healthcare).
  • the fractions can be analyzed by SDS-Page and concentrated with Amicon Ultra 15-3K Centrifugal Filter Devices (Millipore).
  • the immunization and generation of monoclonal B-cell hybridomas can be performed by challenging Setdb2 mice 3 times (every 2 weeks) with 50 ⁇ g of purified fusion protein antigen mixed 1 :1 with adjuvant subcutaneously, before a final immunization intravenously with 50 ⁇ g purified antigen (adjuvant-free).
  • Mouse sera and clone pools can be tested by western blot against overexpressed and endogenous mouse Setdb2.
  • An exemplary monoclonal antibody provided herein is that of clone 7H7F11 which yielded the best signal-to-noise performance.
  • the present invention relates, inter alia, to the following aspects.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection.
  • said bacterial infection is a Streptococcus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is a Streptococcus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial infection is a Streptococcus infection.
  • said Streptococcus infection is a Streptococcus pneumoniae infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is Streptococcus pneumoniae infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial superinfection is Streptococcus pneumoniae superinfection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the infection is preceded by a viral infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection, wherein the infection is preceded by a viral infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection is preceded by a viral infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection is a Streptococcus infection that is preceded by a viral infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by a viral infection.
  • said Streptococcus infection is a Streptococcus pneumoniae infection that is preceded by a viral infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection, wherein the infection is preceded by a viral infection.
  • a Streptococcus pneumoniae superinfection is preceded by a viral infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection, wherein the infection is preceded by a viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the viral infection or viral superinfection is an influenza virus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein said viral infection is an influenza virus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein said viral infection is an influenza virus infection.
  • the infection is preceded by an influenza virus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection, wherein the infection is preceded by an influenza virus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein the infection is preceded by an influenza virus viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein the infection is preceded by an influenza virus viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan, wherein the infection is preceded by an influenza virus viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection, wherein the infection is preceded by an influenza virus viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection is preceded by an influenza virus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection, wherein the infection is preceded by an influenza virus infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein the infection is preceded by an influenza virus infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein the infection is preceded by an influenza virus infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection, wherein the infection is preceded by an influenza virus infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection, wherein the infection is preceded by an influenza virus infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection is a Streptococcus infection that is preceded by an influenza virus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus infection.
  • said Streptococcus infection is a Streptococcus pneumoniae infection that is preceded by a viral infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection, wherein the infection is preceded by an influenza virus infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a Streptococcus pneumoniae superinfection is preceded by an influenza virus infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection, wherein the infection is preceded by an influenza virus infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the viral infection is an influenza virus A infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein said viral infection is an influenza virus A infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein said viral infection is an influenza virus A infection.
  • the infection is preceded by an influenza virus A infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection, wherein the infection is preceded by an influenza virus A infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein the infection is preceded by an influenza virus viral infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection is preceded by an influenza virus A infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection is a Streptococcus infection that is preceded by an influenza virus A infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said Streptococcus infection is a Streptococcus pneumoniae infection that is preceded by an influenza virus A infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a Streptococcus pneumoniae superinfection is preceded by an influenza virus A infection.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection, wherein the infection is preceded by an influenza virus A infection.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the infection is an infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection of the lung.
  • said bacterial infection or superinfection is a Streptococcus infection or superinfection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is a Streptococcus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial infection is a Streptococcus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said Streptococcus infection or superinfection is a Streptococcus pneumoniae infection or superinfection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is Streptococcus pneumoniae infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial superinfection is Streptococcus pneumoniae superinfection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the infection of the lung is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the infection is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection of the lung is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein the infection is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein the infection is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection of the lung is a Streptococcus infection of the lung that is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection of the lung, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection of the lung, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection is a Streptococcus infection that is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by a viral infection of the lung.
  • said Streptococcus infection is a Streptococcus pneumoniae infection of the lung that is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said Streptococcus infection is a Streptococcus pneumoniae infection that is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a Streptococcus pneumoniae superinfection of the lung is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection of the lung, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a Streptococcus pneumoniae superinfection is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection, wherein the infection is preceded by a viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said viral infection or viral superinfection is an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein said viral infection is an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein said viral infection is an influenza virus infection of the lung.
  • the infection of the lung is preceded by an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection of the lung, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection of the lung, wherein the infection is preceded by an influenza virus viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection of the lung, wherein the infection is preceded by an influenza virus viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection of the lung , wherein the infection is preceded by an influenza virus viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection of the lung, wherein the infection is preceded by an influenza virus viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the infection is preceded by an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein the infection is preceded by an influenza virus viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein the infection is preceded by an influenza virus viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection, wherein the infection is preceded by an influenza virus viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection, wherein the infection is preceded by an influenza virus viral infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection of the lung is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection of the lung, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection of the lung, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection of the lung, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection of the lung, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection of the lung, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection, wherein the infection is preceded by an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection of the lung is a Streptococcus infection of the lung that is preceded by an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection of the lung, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection of the lung, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection is a Streptococcus infection that is preceded by an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said Streptococcus infection is a Streptococcus pneumoniae infection of the lung that is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection of the lung, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said Streptococcus infection is a Streptococcus pneumoniae infection that is preceded by a viral infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a Streptococcus pneumoniae superinfection of the lung is preceded by an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection of the lung, wherein the infection is preceded by an influenza virus infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a Streptococcus pneumoniae superinfection is preceded by an influenza virus infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection, wherein the infection is preceded by an influenza virus infection of the lung.
  • said viral infection is an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein said viral infection is an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein said viral infection is an influenza virus A infection of the lung.
  • the infection of the lung is preceded by an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • the infection is preceded by an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection of the lung is preceded by an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a superinfection is preceded by an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a superinfection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral superinfection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan superinfection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal superinfection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection of the lung is a Streptococcus infection of the lung that is preceded by an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection of the lung, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection of the lung, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the bacterial infection or superinfection is a Streptococcus infection that is preceded by an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial superinfection, wherein said bacterial infection is a Streptococcus infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said Streptococcus infection is a Streptococcus pneumoniae infection of the lung that is preceded by a influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said Streptococcus infection is a Streptococcus pneumoniae infection of the lung that is preceded by a influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • said Streptococcus infection is a Streptococcus pneumoniae infection that is preceded by a influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae infection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • a Streptococcus pneumoniae superinfection of the lung is preceded by an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection of the lung, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • a Streptococcus pneumoniae superinfection is preceded by an influenza virus A infection of the lung.
  • the invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a Streptococcus pneumoniae superinfection, wherein the infection is preceded by an influenza virus A infection of the lung.
  • Setdb2 methyltransferase SET domain bifurcated 2
  • the antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection or the method for treating an infection comprising the administration of an antagonist of Setdb2.
  • the antagonist of Setdb2 can be of use to treat infections, infectious disease or superinfections.
  • a superinfection is generally defined as a second infection superimposed on a previous one.
  • the bacterial infection or superinfection to be treated in accordance with the present invention can, for example, be a Streptococcus infection (e.g. Streptococcus pneumoniae or Streptococcus pyogenes, wheien Streptococcus pneumoniae is preferred), a Staphylococcus infection (e.g. Staphylococcus aureus), a Haemophilus infection (e.g. Haemophilus influenza), a Mycobacterium infection (e.g. Mycobacterium tuberculosis), a Moraxella infection (e.g. Moraxella catarrhalis), a Pseudomonas infection (e.g.
  • Pseudomonas aeruginosa a Escherichia infection (e.g. Escherichia coli), a Yersinia infection (e.g. Yersinia enterocolitica), a Treponema infection (e.g. Treponema pallidum), a Shigella infection (e.g. Shigella flexneri), a Salmonella infection (e.g. Salmonella typhimurium), a Rhodococcus infection (e.g. Rhodococcus equi), a Nocardia infection (e.g. Nocardia asteroides), a Campylobacter infection (e.g. Campylobacter jejuni) and a Clostridium infection (e.g. Clostridium difficile).
  • Escherichia infection e.g. Escherichia coli
  • a Yersinia infection e.g. Yersinia enterocolitica
  • the present invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a bacterial infection or bacterial superinfection, for example a Streptococcus infection (e.g. Streptococcus pneumoniae or Streptococcus pyogenes), a Staphylococcus infection (e.g. Staphylococcus aureus), a Haemophilus infection (e.g. Haemophilus influenza), a Mycobacterium infection (e.g. Mycobacterium tuberculosis), a Moraxella infection (e.g. Moraxella catarrhalis), a Pseudomonas infection (e.g.
  • a Streptococcus infection e.g. Streptococcus pneumoniae or Streptococcus pyogenes
  • Staphylococcus infection e.g. Staphylococcus aureus
  • a Escherichia infection e.g. Escherichia coli
  • a Yersinia infection e.g. Yersinia enterocolitica
  • a Treponema infection e.g. Treponema pallidum
  • Shigella infection e.g. Shigella flexneri
  • Salmonella infection e.g. Salmonella typhimurium
  • Rhodococcus infection e.g. Rhodococcus equi
  • a Nocardia infection e.g. Nocardia asteroides
  • Campylobacter infection e.g. Campylobacter jejuni
  • Clostridium infection e.g. Clostridium difficile
  • the protozoan infection or superinfection to be treated in accordance with the present invention can, for example, be a Toxoplasma infection (e.g. Toxoplasma gondii), a Leishmania infection (e.g. Leishmania infantum), an Isospora infection (e.g. Isospora belli) and/or a Plasmodium infection (e.g. Plasmodium falciparum).
  • a Toxoplasma infection e.g. Toxoplasma gondii
  • Leishmania infection e.g. Leishmania infantum
  • an Isospora infection e.g. Isospora belli
  • Plasmodium infection e.g. Plasmodium falciparum
  • the present invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a protozoan infection, for example a Toxoplasma infection (e.g. Toxoplasma gondii), a Leishmania infection (e.g. Leishmania infantum), an Isospora infection (e.g. Isospora belli) and a Plasmodium infection (e.g. Plasmodium falciparum).
  • a protozoan infection for example a Toxoplasma infection (e.g. Toxoplasma gondii), a Leishmania infection (e.g. Leishmania infantum), an Isospora infection (e.g. Isospora belli) and a Plasmodium infection (e.g. Plasmodium falciparum).
  • a protozoan infection for example a Toxoplasma infection (e.g. Toxoplasma gondii),
  • the fungal infection or superinfection to be treated in accordance with the present invention can, for example, be a Candida infection, a Microsporidia infection, a Aspergillus infection, a Scedosporium infection, a Mucor infection, a Cryptococcus infection, a Coccidioides infection, a Histoplasma infection and a Pneumocystis infection.
  • the present invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a fungal infection, for example a Candida infection, a Microsporidia infection, a Aspergillus infection, a Scedosporium infection, a Mucor infection, a Cryptococcus infection, a Coccidioides infection, a Histoplasma infection and/or a Pneumocystis infection.
  • a fungal infection for example a Candida infection, a Microsporidia infection, a Aspergillus infection, a Scedosporium infection, a Mucor infection, a Cryptococcus infection, a Coccidioides infection, a Histoplasma infection and/or a Pneumocystis infection.
  • the infection or superinfection to be treated in accordance with the present invention can be preceded by a viral infection, for example, an orthomyxovirus infection (e.g. influenza virus), a herpesvirus infection (e.g. herpes simplex virus 1 (HSV-1), a cytomegalovirus (CMV) or a Epstein-Barr virus (EBV)), a hepadnavirus infection (e.g. hepatitis B virus (HBV)), a flavivirus infection (e.g. hepatitis C virus (HCV)), a lentivirus infection (e.g.
  • an orthomyxovirus infection e.g. influenza virus
  • a herpesvirus infection e.g. herpes simplex virus 1 (HSV-1), a cytomegalovirus (CMV) or a Epstein-Barr virus (EBV)
  • HBV-1 herpes simplex virus 1
  • CMV cytomegalovirus
  • EBV Epstein-Barr virus
  • human immunodeficiency virus 1 or a human immunodeficiency virus (HIV) 2), a retrovirus infection (e.g. human T cell lymphotropic virus (HTLV)), an arenavirus infection (e.g. lassa virus (LASV) or a lymphocytic choriomeningitis virus (LCMV)) and a paramyxovirus infection (e.g. measles virus).
  • said viral infection is an influenza virus infection, particularly preferred an influenza virus A infection.
  • the present invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infection, wherein said infection is preceded by a viral infection.
  • said viral infection an influenza virus infection, particularly preferred an influenza virus A infection.
  • the viral infection or superinfection to be treated in accordance with the present invention can, for example, be an orthomyxovirus infection (e.g. influenza virus), a herpesvirus infection (e.g. herpes simplex virus 1 (HSV-1), a cytomegalovirus (CMV) or a Epstein-Barr virus (EBV)), a hepadnavirus infection (e.g. hepatitis B virus (HBV)), a flavivirus infection (e.g. hepatitis C virus (HCV)), a lentivirus infection (e.g. human immunodeficiency virus (HIV) 1 or a human immunodeficiency virus (HIV) 2), a retrovirus infection (e.g.
  • an orthomyxovirus infection e.g. influenza virus
  • a herpesvirus infection e.g. herpes simplex virus 1 (HSV-1), a cytomegalovirus (CMV) or a Epstein-Barr virus (EBV)
  • HTLV human T cell lymphotropic virus
  • an arenavirus infection e.g. lassa virus (LASV) or a lymphocytic choriomeningitis virus (LCMV)
  • a paramyxovirus infection e.g. measles virus
  • said viral infection an influenza virus infection, particularly preferred an influenza virus A infection.
  • the present invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating a viral infection, for example an orthomyxovirus infection (e.g. influenza virus), a herpesvirus infection (e.g. herpes simplex virus 1 (HSV-1), a cytomegalovirus (CMV) or a Epstein-Barr virus (EBV)), a hepadnavirus infection (e.g. hepatitis B virus (HBV)), a flavivirus infection (e.g. hepatitis C virus (HCV)), a lentivirus infection (e.g.
  • an orthomyxovirus infection e.g. influenza virus
  • a herpesvirus infection e.g. herpes simplex virus 1 (HSV-1), a cytomegalovirus (CMV) or a Epstein-Barr virus (EBV)
  • HBV-1 herpes simplex virus 1
  • CMV cytomegal
  • human immunodeficiency virus 1 or a human immunodeficiency virus (HIV) 2
  • a retrovirus infection e.g. human T cell lymphotropic virus (HTLV)
  • an arenavirus infection e.g. lassa virus (LASV) or a lymphocytic choriomeningitis virus (LCMV)
  • a paramyxovirus infection e.g. measles virus.
  • the present invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an orthomyxovirus infection, wherein said orthomyxovirus infection is an influenza A virus infection, influenza B virus infection or influenza C virus infection, preferably an influenza A virus infection,.
  • said orthomyxovirus infection is an influenza A virus infection, influenza B virus infection or influenza C virus infection, preferably an influenza A virus infection,.
  • the Setdb2 knockout mouse model showed ameliorated pathogenesis upon superinfection of influenza virus-infected mice with Streptococcus pneumoniae.
  • the antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) can be used in treating a superinfection preceded by an influenza virus infection. It is envisaged herein that said superinfection is a bacterial infection, wherein said bacterial infection is a Streptococcus infection.
  • One advantage of the present invention is the fact that it strengthens the immune response against pathogens.
  • a further advantage of the invention is that it is a prophylactic treatment of high risk patients.
  • a further advantage of the present invention is that it is a better option for long term treatment e.g., chronic infections.
  • the present invention has less side effects compared to conventional used therapies e.g., killing of commensals.
  • the invention is independent of developed resistance of the pathogens.
  • the antagonist of Setdb2 can share characteristics of medicaments (like antibiotics) that are conventionally used in the treatment of infections. Yet, the antagonist of Setdb2 to be used herein exerts its therapeutic effect primarily (and preferably solely) by strengthening the immune response.
  • an antagonist of Setdb2 to be used in accordance with the present invention is not cytotoxic/non-toxic.It is envisaged herein that an antagonist of Setdb2 to be used in accordance with the present invention is not an anti-biofilm agent.lt is envisaged herein that an antagonist of Setdb2 to be used in accordance with the present invention is not bacteristatic.lt is envisaged herein that an antagonist of Setdb2 to be used in accordance with the present invention is not bactericidal.
  • the antagonist for use in treating an infection in accordance with the present invention can be used to strengthen the immune response against pathogens.
  • the infection/infectious disease to be treated in accordance with the present invention can be characterized by/associated with activation/overexpression/upregulation of Setdb2 as defined herein. It is believed that the herein provided therapy with Setdb2 antagonists is particularly advantageous in clinical settings/pathological conditions that are characterized by or associated with increased expression of Setdb2 (or upregulation of Setdb2); see Example 1 and Fig. 13.
  • Such clinical settings e.g. pathological conditions, like the infections/infectious diseases as defined herein
  • characterized by/associated with an increased expression of Setdb2 or upregulation of Setdb2 can be determined, e.g.
  • a sample for example, a sample from a patient suffering or suspected of suffering from an infection (as defined herein, e.g. the exemplary infections explained and defined herein), and comparing the measured (expression) level or activity of Setdb2 with a control (e.g. control values, such as (expression) level or activity of Setdb2 in a sample from a healthy person).
  • a control e.g. control values, such as (expression) level or activity of Setdb2 in a sample from a healthy person.
  • the (increased) production or presence of interferons in a sample from a patient suffering or suspected of suffering from an infection as defined herein can also be indicative of a clinical setting/pathological conditions (like infections/infectious diseases, like virus infections or bactierla infections, as defined herein) that are characterized by or associated with increased expression of Setdb2.
  • an antagonist of the present invention can be used in a prophylactic treatment e.g. of high risk patients.
  • an antagonist of the present invention can be used as a long term treatment in e.g., chronic infections.
  • an antagonist of the present invention can be used in the early phase of an infection, such as the early phase of a viral infection or the early phase of a bacterial superinfection as defined herein.
  • an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) is for use in treating an infection, wherein said treatment has less side effects (compared to conventional therapy, like conventional antibiotics) e.g., the treatment is associated with/leads to a reduced killing of commensals.
  • the present invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use use in treating an infection, wherein said treatment is independent of developed resistance of the pathogens (to conventional therapy, like conventional antibiotics).
  • infection can refer to the invasion of a host organism's (e.g. subject's/patient's) body/body tissues/body organs by (a) disease-causing agent(s), their multiplication, and the reaction of the host organism's (e.g. subject's/patient's) body/body tissues/body organs to these disease-causing agent(s) and, optionally, the reaction of the host organism's (e.g. subject's/patient's) body/body tissues/body organs to the toxin(s) that the disease-causing agent(s) produce.
  • Disease-causing agents such as bacteria, viruses, and parasites
  • Infections are normally caused by disease-causing agents.
  • disease-causing agents are infectious agents such as viruses, viroids, and prions; microorganisms such as bacteria; protozoans, such as Plasmodium or Trypanosoma species;nematodes such as roundworms and pinworms; arthropods such as ticks, mites, fleas, and lice; fungi such as ringwomi; and other macroparasites such as tapeworms.
  • infectious agents such as viruses, viroids, and prions
  • microorganisms such as bacteria
  • protozoans such as Plasmodium or Trypanosoma species
  • nematodes such as roundworms and pinworms
  • arthropods such as ticks, mites, fleas, and lice
  • fungi such as ringwomi
  • other macroparasites such as tapeworms.
  • the term "infection” can refer to a bacterial infection, a viral infection, a protozoan infection
  • an infection may cause no symptoms and be subclinical, or it may cause symptoms and be clinically apparent.
  • the tern 'infection as used herein can refer to symptoms of the infection (e.g. in case the disease-causing agent is no longer detectable) and/or to the presence of the disease-causing agent in the subject/patient.
  • a patient/subject to be treated in accordance with the invention that has/suffers from an infection (or superinfection as defined herein) has either symptoms that are characteristic of the infection (or superinfection) or does not have symptoms characteristic of the infection (or superinfection).
  • Subjects/patients without symptoms may be in the recovery phase or they may be in an early phase of an infection.
  • Whether a subject/patient suffers from/has an infection can be determined by routine tests in accordance with clinical practice. For example, tests for the presence of antigen characteristic of the disease- causing agent (like ELISA tests) can be performed, for example, to confirm whether a disease- causing agent is present in a subject/patient. Such tests can be used to identify patients/subject that show no symptoms (or no symptoms characteristic of an infection).
  • An infection may remain localized, or it may spread through the blood or lymphatic vessels to become systemic (bodywide).
  • Microorganisms that live naturally in the body are normally not considered infections.
  • bacteria that normally live within the mouth and intestine are normally not considered to be infections.
  • the term "superinfection” as used herein can be defined as a second infection or a new infection superimposed on an earlier infection or a pre-existing infection.
  • the term “superinfection” can refer to a new/second infection occurring in a patient or subject having/suffering from an earlier infection or a pre-existing infection, such as bacterial superinfection in viral respiratory disease or a superinfection of a chronic hepatitis B carrier with hepatitis D virus.
  • Patients suffering from an infection, in particular a superinfection, like a bacterial superinfection, or being at risk to suffer from an infection, in particular a superinfection, like a bacterial superinfection can have a suppressed immune system.
  • cancer patients e.g.
  • HIV patients undergoing chemo- and/or radiotherapy
  • HIV patients have a suppressed immune system.
  • the therapy of such patients (like patients with a suppressed immune system) with Setdb2 antagonists in accordance with the present invention is contemplated herein.
  • Such patients can especially benefit from the herein provided therapy because one advantage of the provided therapy is, inter alia, its stimulation of the immune system e.g. by increasing the infiltration of neutrophils.
  • the new/second infection can especially be caused by a different disease-causing agent (such as a microbial agent) that is resistant to the treatment used against the first infection.
  • the "superinfection”, “second infection” or “new infection” and the like can be a bacterial superinfection, a viral superinfection, a fungal superinfection or a protozoan superinfection.
  • the "superinfection” is a "bacterial superinfection”.
  • the terms “superinfection”, “second infection” or “new infection” and other terms used in the art in this context are used interchangeably herein.
  • the "earlier infection” or “pre-existing infection” can be a bacterial infection, a viral infection, a fungal infection or a protozoan infection.
  • the "earlier infection'V'pre-existing infection” is a virus infection.
  • the terms “earlier infection” or “preexisting infection” and other terms used in the art in this context are used interchangeably herein.
  • the terms "earlier infection” or "pre-existing infection” as used herein can refer to an infection occurring in a patient prior to a superinfection/second infection/new infection.
  • the earlier/pre-existing infection has started prior to the superinfection/second infection/new infection and both the earlier/pre-existing infection and the superinfection/second infection/new infection then occur simultaneously in the subject/patient.
  • the earlier/pre-existing infection has started prior to the superinfection/second infection/new infection and the earlier/pre-existing infection e.g. in its active phase (like replicative phase of the disease-causing agent) no longer occurs/has ceased in the subject/patient at the time the superinfection/second infection/new infection occurs in the subject/patient.
  • the subject/patient can still have symptoms of the earlier/pre-existing infection, although the disease-causing agent(s) is/are no longer detectable in the subject/patient.
  • infection can refer to one or multiple infections or superinfections.
  • one, two or more (earlier/pre-existing) infections (or superinfections) can occur simultaneously in a subject/patient.
  • a subject/patient may, for example, suffer from one (earlier/pre-existing) infection, such as a viral infection (like influenza virus A).
  • the (earlier/pre-existing) infection may be followed by one superinfection (like a bacterial superinfection, such as Streptococcus pneumoniae infection).
  • an infection can refer to symptoms of the infection (e.g. in case the disease-causing agent is no longer detectable) and/or to the presence of the disease-causing agent in the subject/patient.
  • a subject/patient may, for example, suffer from two (earlier/pre-existing) infections, such as viral infections, e.g. one infection caused by one disease-causing agent (e.g. a first virus) and another infection caused by a different disease-causing agent (e.g. a second virus that differs from the first virus, like another viral strain).
  • the two or more (earlier/preexisting) infections may be followed by one, two or more superinfections that can occur simultaneously in the subject/patient.
  • bacterial pneunomia can involve simultaneous infection with Streptococcus pneumonia, Haemophilus influenza, Klebsiella pneumonia and/or Staphylococcus aureus.
  • an infection can refer to a complete or partial overlap of the infections (or superinfections) occuring in the subject/patient.
  • an infection can refer to symptoms of the infection (e.g. the disease-causing agent is no longer detectable) and/or to the presence of the disease-causing agent in the subject/patient.
  • a subject/patient may, for example, suffer from one (earlier/preexisting) infection, such as a viral infection (like influenza virus A).
  • the (earlier/pre-existing) infection may be followed by one, two or more superinfections that can occur simultaneously in the subject/patient.
  • the term "simultaneous" can refer to a complete or partial overlap of the infections (or superinfections) occuring in the subject/patient.
  • an infection can refer to symptoms of the infection (e.g. the disease-causing agent is no longer detectable) and/or to the presence of the disease-causing agent in the subject/patient.
  • the present invention relates to an antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) for use in treating an infectious disease, preferably bacterial pneumonia, in particular bacterial pneumonia associated with or characterized by Streptococcus pneumoniae infection.
  • said infectious disease is preceded by a viral infection, preferably influenza virus infection, and most preferably influenza virus A infection.
  • Infectious diseases also known as transmissible or communicable diseases, comprise clinically evident illness (i.e., characteristic medical signs and/or symptoms of disease) resulting from the infection, presence and growth of pathogenic biological agents in an individual host organism.
  • the treatment of an "infection" in accordance with the present invention can encompass the treatment of an associated infectious disease or an infectious diseases resulting from the infection in particular in cases when characteristic medical signs and/or symptoms of the disease are manifest.
  • the resulting/associated infectious disease is likewise treated.
  • the therapy of a patient/subject suffering from an infection by antagonists of Setdb2 if the patient does no longer suffer from the associated infectious disease, for example, because the characteristic medical signs and/or symptoms of the disease have already disappeared, decreased or ameliorated e.g. because the infectious disease was treated by conventional therapy.
  • the therapy of bacterial pneumonia is contemplated herein.
  • the treatment of an infection in particular a bacterial superinfection (such as Streptococcus pneumoniae superinfection)
  • Bacterial pneumonia can be (or be caused by) an infection (preferably a superinfection) with one or more of Streptococcus pneumoniae, Haemophilus influenza, Klebsiella pneumonia, and/or Staphylococcus aureus.
  • bacterial pneumonia is (or is cause by) an infection (preferably a superinfection) with Streptococcus pneumoniae.
  • Bacterial pneumonia is (or is caused by) an infection in one or both lungs.
  • the bacteria cause the lung's air sacs (alveoli) to become inflamed and engorged with pus, fluid, and cellular debris. This often impairs the body's ability to exchange oxygen and carbon dioxide. If a patient/subject has/suffers from bacterial pneumonia he/she might experience breathlessness or pain as he/she struggles to take in oxygen. Bacterial pneumonia can be mild or serious, even leading to respiratory failure or death. How a subject/patient will be affected depends on the potency of the bacterial agent and his/her age, health, and immune status. Early treatment of the infection with the Setdb2 antagonists may significantly reduce the danger of acute respiratory distress.
  • Bacterial pneumonia is classified based on where you acquire it— outside or inside a hospital. This is generally known as community-acquired pneumonia (CAP) and hospital-acquired pneumonia (HAP), respectively.
  • CAP community-acquired pneumonia
  • HAP hospital-acquired pneumonia
  • the therapy of community-acquired pneumonia (CAP) is preferred herein.
  • An infection that occurs in a healthcare setting (like and hospital-acquired pneumonia (HAP)) is usually more serious because the patient/ subject is already sick.
  • CAP Community-acquired pneumonia
  • bacteria that commonly cause bacterial pneumonia include:
  • Streptococcus pneumoniae This is the leading cause of bacterial pneumonia. This bacterium lives in the noses and throats of healthy people. It can enter lungs through inhalation, or it can travel to the bloodstream from a wound or infection site within the body.
  • Haemophilus influenzae This bacterium may live in the upper respiratory tract and does not cause harm or illness until opportunity strikes, such as after a viral infection or when immune function is impaired. It is the second most common cause of bacterial pneumonia.
  • Klebsiella pneumoniae It is found in the mouth, skin, and digestive tract. This bacterium is more prone to infect those with weakened immunity.
  • Staphylococcus aureus Infection from this bacterium occurs more frequently among intravenous drug abusers, patients with chronic illness, or young children with immature immune systems. Approximately 1 in 4 healthy individuals carries the staph germ. It usually lives on skin or within the pharynx or intestine. About 2 in 100 individuals carry an antibiotic-resistant strain of the bacterium known as methicillin-resistant Staphylococcus aureus (MRSA). MRSA occurs more commonly in medical settings but is becoming increasingly common within the general community. It is spread by the sharing of personal items or through contact sports such as rugby or wrestling.
  • MRSA methicillin-resistant Staphylococcus aureus
  • HAP hospital-acquired pneumonia
  • Those who are at higher risk for developing bacterial pneumonia include infants and children, adults over age 65, individuals who are ill or have impaired immunity, long-term users of immunosuppressant drugs, chronic obstructive pulmonary disease (COPD) patients who use inhaled corticosteroids for lengthy periods or smokers.
  • COPD chronic obstructive pulmonary disease
  • the most common symptoms of bacterial pneumonia are cough with yellow, green, or blood-tinged mucus, chest pain that worsens when coughing or breathing, sudden onset of chills, fever of 102 degrees Fahrenheit or above (corresponding to about 38.9 °C or above) or above (lower than 102 degrees Fahrenheit/38.9 °C in older persons), headache, muscle pain, breathlessness or rapid breathing, lethargy, moist, pale skin, confusion (especially among the elderly), or loss of appetite.
  • bacterial pneumonia To diagnose bacterial pneumonia, one can listen for abnormal chest sounds that indicate heavy mucus secretion and/or possible obstruction of the airways, take a blood sample to get a white blood cell count (a high count usually indicates infection), take blood and/or mucus samples to identify the infection-causing pathogen, or order chest X-rays to confirm the presence and extent of infection.
  • Therapy of bacterial pneumonia involves in accordance with the present invention the use of one or more antagonists of Setdb2.
  • the therapy may, in addition to Setdb2 antagonists, involve conventional therapeutic approaches, like (an) antibiotic that fights the specific bacterium causing the infection, a cough medicine to calm the cough and to help expectorate sputum and/or fever medication to reduce temperature.
  • the inhibitor/antagonist of Setdb2 can be used herein as a single agent (i.e., in form of a monotherapy) or in form of a combination therapy, for example, in combination with other antagonist(s) of Setdb2 and/or in combination with conventional therapies like antibacterial treatment (e.g., antibiotics such as penicillins, cephalosporins, chloramphenicol sulfonamides, trimethoprim-sulfamethoxazole, macrolides and quinolones), antifungal treatment (e.g., macrocyclic polyenes, imidazole, thiazole and triazole derivates), antiprotozoal treatment (e.g., metronidazole) and/or antiviral treatment (e.g., entry inhibitors and inhibitors specific to viral enzymes such as reverse transcriptase, integrase and proteases).
  • antibacterial treatment e.g., antibiotics such as penicillins, cephalosporins, chlor
  • the combination therapy can, for example, comprise the use of an Setdb2 antagonist (e.g. a competitive substrate analog of a methyltransferase, like a S-adenoxyl-L-methionine (SAM) analog, such as Sinefungin or S-adenosyl-L-homocysteine (SAH)) and of a different Setdb2 inhibitor (e.g. a selective Setdb2 inhibitor) in accordance with the present invention.
  • SAM S-adenoxyl-L-methionine
  • SAH S-adenosyl-L-homocysteine
  • the present invention relates in certain aspects, to an inhibitor/antagonist of Setdb2 (e.g.
  • a competitive substrate analog of a methyltransferase like a S-adenoxyl-L-methionine (SAM) analog, such as Sinefungin or S-adenosyl-L-homocysteine (SAH)
  • SAM S-adenoxyl-L-methionine
  • SAH S-adenosyl-L-homocysteine
  • an infection e.g. a viral infection, such as influenza virus infection (like influenza virus A infection) or a bacterial superinfection e.g. of Streptococcus pneumoniae as defined herein
  • a different Setdb2 inhibitor e.g. a selective Setdb2 inhibitor
  • the infection/infectious disease can affect various organs/organ systems, tissues or cells of an organism.
  • organs/organ systems can be affected:
  • Cardiovascular system pumping and channeling blood to and from the body and lungs with heart, blood and blood vessels.
  • Digestive system digestion and processing food with salivary glands, esophagus, stomach, liver, gallbladder, pancreas, intestines, colon, rectum and anus.
  • Endocrine system communication within the body using hormones made by endocrine glands such as the hypothalamus, pituitary gland, pineal body or pineal gland, thyroid, parathyroids and adrenals, i.e., adrenal glands.
  • Excretory system kidneys, ureters, bladder and urethra involved in fluid balance, electrolyte balance and excretion of urine.
  • Immune System structures involved in the transfer of lymph between tissues and the blood stream, the lymph and the nodes and vessels that transport it including the Immune system: defending against disease-causing agents with leukocytes, tonsils, adenoids, thymus and spleen.
  • Muscular system movement with muscles.
  • Nervous system collecting, transferring and processing information with brain, spinal cord and nerves.
  • sex organs such as ovaries, fallopian tubes, uterus, vagina, mammary glands, testes, vas deferens, seminal vesicles, prostate and penis.
  • Respiratory system the organs used for breathing, the pharynx, larynx, trachea, bronchi, lungs and diaphragm.
  • Skeletal system structural support and protection with bones, cartilage, ligaments and tendons.
  • the respiratory system (including the organs used for breathing, the pharynx, larynx, trachea, bronchi, lungs and diaphragm) is affected by the infection(s)/infectious disease(s) to be treated in accordance with the present invention.
  • the infection(s)/infectious disease(s) to be treated herein is preferably an infection(s)/infectious disease(s) of the respiratory system, particularly preferably of the lung.
  • Pneumonia in particular bacterial pneumonia
  • the antagonist of the methyltransferase SET domain bifurcated 2 (Setdb2) can be used herein for the treatment of an infection, in particular a bacterial superinfection.
  • the antagonist of Setdb2 can be comprised in or formulated as a pharmaceutical composition.
  • the pharmaceutical composition will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient, the site of delivery of the pharmaceutical composition, the method of administration, the scheduling of administration, and other factors known to practitioners.
  • the "effective amount" of the pharmaceutical composition for purposes herein is thus determined by such considerations.
  • the total (pharmaceutically) effective amount of the inhibitor in the pharmaceutical composition administered orally per dose will be in the range of about 50 mg inhibitor per day to 1000 mg inhibitor per day of patient, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 50 mg inhibitor per day, and most preferably for humans between about 50mg and 600 mg inhibitor per day.
  • an inhibitor may be administered at a dose of 15 mg kg body weigth per day. If given continuously, the inhibitor is typically administered at a dose rate of about 50 mg per day to about 600 mg per day.
  • An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
  • compositions may, inter alia, comprise an administration twice daily, every day, every other day, every third day, every forth day, every fifth day, once a week, once every second week, once every third week, once every month, etc.
  • the total pharmaceutically effective amount of pharmaceutical composition administered parenterally per dose will be in the range of about 1 ⁇ g protein /kg/day to 15 mg protein /kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg protein /kg/day, and most preferably for humans between about 0.01 and 1 mg protein /kg/day.
  • the pharmaceutical composition is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.
  • the length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect. The particular amounts may be determined by conventional tests which are well known to the person skilled in the art.
  • compositions of the invention may be administered orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdemial patch), bucally, intratrachially, intranasally or as an oral or nasal spray.
  • compositions of the invention preferably comprise a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intratracheal, intranasal, intrastemal, subcutaneous and intraarticular injection and infusion.
  • sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules.
  • Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma- ethyl-L-glutamate (Sidman, U. et al, Biopolymers 22:547-556 (1983)), poly (2-hydroxyethyl methacrylate) (R. Langer et al, J. Biomed. Mater. Res. 15:167-277 (1981), and R.
  • Sustained release pharmaceutical composition also include liposomally entrapped compound.
  • Liposomes containing the pharmaceutical composition are prepared by methods known per se: DE 3,218,121 ; Epstein et al, Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal therapy.
  • the pharmaceutical composition is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulations are prepared by contacting the components of the pharmaceutical composition uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) (polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG.
  • buffers such as phosphate
  • the components of the pharmaceutical composition to be used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
  • Therapeutic components of the pharmaceutical composition generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • the components of the pharmaceutical composition ordinarily will be stored in unit or multi- dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized compound(s) using bacteriostatic Water-for-Injection.
  • the term “consisting essentially of” means that specific further components (or likewise features, integers, steps and the like) can be present, namely those not materially affecting the essential characteristics of the composition, device or method.
  • the term “consisting essentially of (which can be interchangeably used herein with the term “comprising substantially”) allows the presence of other components in the composition, device or method in addition to the mandatory components (or likewise features, integers, steps and the like), provided that the essential characteristics of the device or method are not materially affected by the presence of other components.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, biological and biophysical arts.
  • Figure 1 Setdb2 is induced upon influenza virus infection and TLR stimulation in an Ifnarl dependent manner,
  • WT mice were intranasally infected with influenza virus or mock treated. 18 hours later lung sections were stained using an H IN 1 -specific antibody. H1N1 infected areas are indicated by arrowheads. Scale bar, 250 ⁇ .
  • (b) Gene ontology enrichment analysis of up-regulated genes in lungs of influenza virus-infected mice (n 6 per group from two pooled experiments),
  • PKMTs protein lysine methyltransferases
  • BMDMs from Ifna 1' and WT mice were either left untreated (control), (e) infected with influenza virus (PR8, MOI 10), (f) stimulated with IFNp, IFNy or IFN , or (g) stimulated with the indicated TLR agonists polyI:C, PAM3 and LPS.
  • Setdb2 mRNA expression was quantified by real-time PCR 8 hours after stimulation. Biological triplicates of one out of two similar independent experiments are shown. For protein detection, Setdb2 expression was analyzed (e) 8 hours respectively (f, g) 24 hours after stimulation by western blot using the Setdb2-specific mAb clone 7H7F11.
  • Antibodies specific for the IFN-stimulated protein Zbpl and actin served as controls for induction and loading, respectively, (e, f) Western blots show results of one out of two representative experiments, (d-g) Statistical significance was calculated by unpaired t-test.
  • FIG. 2 Setdb2 GT/GT macrophages show increased expression of a subset of NF-KB target genes including Cxcll.
  • BMDMs bone marrow-derived macrophages
  • FIG. 2 Shows increased expression of a subset of NF-KB target genes including Cxcll.
  • BMDMs were treated with polyI:C for 0, 2 and 8 hours and expression profiling was performed by RNAseq using biological triplicates for each condition.
  • FIG. 3 Setdb2 binds to the Cxcll promoter region and associates with H3K9 tri- methylation.
  • (a-c) WT or Setdb2 GT/GT BMDMs were stimulated with polyl.C for 2 hours or left untreated (control) before cells were prepared for chromatin immunoprecipitation (ChIP). Specific enrichment of indicated promoter elements was quantified by real-time PCR. Data are depicted as normalized recovery to the highest response in WT of two independent experiments (a, b), and one experiment (c). Empty beads were used as control (Mock), (a) ChIP for endogenous Setdb2 using the Setdb2-specific mAb clone 7H7F11. (b) ChIP for H3K9me3. (c) ChIP for H3K9ac. Statistical significance was calculated by unpaired t-test.
  • FIG. 4 Setdb2 G1[IGT mice show exacerbated lung inflammation in a model of LPS- induced neutrophilia.
  • WT and Setdb2 mice were intranasally challenged with LPS for 4 hours or mock treated (control).
  • BAL Bronchoalveolar lavage
  • BAL Bronchoalveolar lavage
  • c-e Total BAL fluid cells as well as neutrophils and macrophages were quantified.
  • Streptococcus pneumoniae WT and Setdb2 mice were either left untreated (control), infected with a sublethal dose of influenza virus (PR8) or superinfected with Streptococcus pneumoniae (Sp) 5 days after PR8 infection, (a) Cxcl 1 RNA was quantitified by real-time PCR from lung tissue 5 days after influenza virus infection, (b-d) WT and Setdb2 mice were harvested 16 hours after Sp superinfection. Superinfected mice received ⁇ 2xl0 4 CFU of Sp.
  • a dotted line depicts the average lung weight to body weight ratio of three uninfected lungs,
  • H/E histological staining of representative sections of the left lung lobes of WT and Setdb2 mice are shown. Scale bar of low magnification is 200 ⁇ , high magnification 50 ⁇ .
  • Histopathological scoring of lung sections was determined by real-time PCR.
  • Expression of 116 in lung tissue was determined by real-time PCR.
  • Levels of 116 were detected by ELISA.
  • Bacterial burden was determined as CFU in tissue homogenates of the right lung lobes.
  • Scatter blots represent individual mice from (a, e-k) one or (b-d) two pooled experiments, (f, k) show one out of two similar experiments. Statistical significance was calculated by unpaired t-test. *P 0.05, **P 0.01 , ***P 0.001 and ****p 0.0001.
  • FIG. 6 PAM3 induction of Setdb2 and Zbpl is TLR2 dependent.
  • WT and Tlrl 1 ⁇ Cd36 ' ' ⁇ BMDMs were treated with PAM3 (two different batches from Invivogen), LPS or left untreated (control), (a) Setdb2 or (b) Zbpl mRNA expression was quantified by real-time PCR 8 hours after stimulation. Statistical significance was calculated by unpaired t-test.
  • FIG. 7 Expression kinetics of PKMTs in bone marrow-derived macrophages (BMDMs) upon stimulation with polyI:C.
  • WT BMDMs were stimulated with polyLC and gene expression levels were determined at the indicated time points by microarray. The top three up- regulated genes are highlighted. The data is derived from systemsimmunology.org.
  • Figure 8 Generation of Setdbl mice, (a) Schematic of recombinant Setdb2 genetrap targeting strategy, (b) Southern blot of transfected ES cells, (c) Genotyping PCR of Setdb2 genetrap mice.
  • FIG. 10 Blockade of IFNARl leads to increased Cxcll expression upon polyLC stimulation.
  • WT and Setdb2 GllGX BMDMs were treated with 2( ⁇ g/ml IFNARl -specific antibody (clone MAR 1-5 A3, anti-Ifnar) or with isotype control followed by polyLC stimulation, (a) Setdbl and (b) Cxcll expression were quantified by real-time PCR after 2 hours of stimulation. One out of two similar experiments is shown. Statistical significance was calculated by unpaired t-test.
  • FIG 11 Time kinetics of Cxcll and Setdb2 expression in BMDMs upon stimulation with polyI:C.
  • WT BMDMs were stimulated with polyLC and Cxcll and Setdb2 mRNA expression was determined by microarray at the indicated time points. The data was derived from systemsimmunology.org.
  • FIG. 12 Setdbl alveolar macrophages express increased levels of Cxcll upon infection with influenza virus.
  • Alveolar macrophages from BAL of naive WT and Setdbl mice were seeded on 96-well tissue culture plates and subsequently infected with influenza virus (PR8) (MOI 100). 12 hours after stimulation, (a) Cxcll mRNA expression was quantified by real-time PCR and (b) Cxcll protein was quantified by ELISA. Results from one out of two similar experiments are shown. Statistical significance was calculated by unpaired t- test.
  • Figure 13 Comparison of Setdb2 induction in the lungs of mice infected with either Streptococcus pneumoniae or influenza virus.
  • WT as well as Setdbl mice were either infected with SP, PR8, or left untreated as control (Ctrl) and lungs were harvested at indicated time points. Total RNA was extracted from lungs and real-time PCR was used to measure Setdbl expression. Interestingly, SP infection did not induce Setdbl expression at any of the time points investigated. In contrast, Setdb2 was strongly induced 5 days (5d) after influenza virus infection, the time point used to perform superinfection experiments (see previous figures). Setdb2 expression is displayed as fold induction compared to uninfected mice. Scatter blot indicate individual mice pooled from different experiments. Statistical analysis was performed by unpaired t-test. **** p ⁇ 0.0001.
  • FIG. 14 Cytokine profiling of mice infected with either influenza virus, Sp or superinfected with both pathogens.
  • WT and Setdbl mice were either left untreated (control), infected with Streptococcus pneumoniae (Sp) ( ⁇ 2xl 0 4 CFU), infected with a sublethal dose of influenza virus (PR8), or superinfected with Sp ( ⁇ 2xl 0 4 CFU) (PR8+5p) on day 5 after PR8 infection.
  • BAL was harvested 16 hours after Sp infection respectively 5 days and 16 hours for the groups infected with PR8 or PR8+,3 ⁇ 4?.
  • FIG. 15 Cellular lung profiling of WT and Setdb2 GTIGT mice.
  • WT and Set ⁇ 3 ⁇ 42 GT/GT mice were either (a-b) left untreated, (c-d) infected with influenza virus for 5 days and 16 hours, (e- f) infected with Sp for 16 hours, or (g-h) superinfected with Sp for 16 hours on day 5 after influenza virus infection (compare Fig. 14 legend for respective infectious doses), (a, c, e, g) Representative FACS plots with gating strategies for neutrophils (Neutr), monocytes/macrophages/dendritic cells (Mac/DC), alveolar macrophages (AM), NK cells (N ), T cells and B cells are shown.
  • Neutr neutrophils
  • Mac/DC monocytes/macrophages/dendritic cells
  • AM alveolar macrophages
  • N T cells and B cells are shown.
  • Scatter plots represent total cell numbers per lung from individual mice, (b, d, f, h) Scatter plots represent relative percentages of live CD45 + cells in BAL from individual mice, (i) Representative backgating plot of the population of AMs from CD45 + live lung cells, (a-d, f-h) Pooled data of two or more experiments are shown. Statistical significance was calculated by unpaired t-test.
  • FIG. 17 Working model: The role of Setdb2 in mediating virus-induced susceptibility to bacterial superinfection.
  • the illustration highlights three important stages of superinfection, comparing the situation in a WT and a Setdb2-deficient lung,
  • IFN type-I interferon
  • ISGs IFN-stimulated genes
  • NF- ⁇ signaling initiates the expression of genes such as the neutrophil chemoattractant Cxcll .
  • Example 1 A Setdb2-knockdown animal model provides evidence that an antagonist of Setdb2 can be used in the therapy of infections
  • C57BL/6J mice (WT) were obtained from The Jackson Laboratory and IfnarF ⁇ 48 , Irf7 ⁇ 49 , Statr 50 and TlrZ ⁇ CdS ⁇ - 51 ' 52 mice were on a C57BL/6J background.
  • the targeting vector pEKF106 was made by recombineering using Lambda RED system in E. coli strain EL350 53 .
  • a genomic PAC library i.e. from the 129/SvevTACfBr genetic background, RPCI mouse PAC library 21 ; MRC Geneservice was screened for the full-length Setdbl gene using specific cDNA probes.
  • a 2.9kb genomic fragment harboring the frt-loxP flanked gene trap cassette and a heterologous BamHI restriction site was generated by recombineering using pLTM330.
  • the gene trap cassette contains a pGK/EM7 dual promoter, a strong splice acceptor site from the engrailed 2 gene, and Neo reporter gene, followed by a strong polyadenylation signal (Fig. 8A).
  • Notl linearized targeting vector D A was transfected into v6.4 embryonic stem (ES) cells, a hybrid of the C57BL/6J x 129/SvJae lineages. Transfected ES cells were selected for neomycin resistance with G418 and positive clones were tested by Southern blot analysis of EcoRV-digested DNA (Fig. 8B). Positive ES cell clones were microinjected into blastulae and transferred to pseudopregnant female mice, following standard methods.
  • mice were genotyped for the presence of the gene trap cassette by Southern blot hybridization (not shown) and by PCR amplification of genomic DNA using primers 5 '-AATGGGCCATATTAGTAGAAGC-3 ' and 5 ' -G ATCTTGCTC AA AGGTC ACCA-3 ' (Fig. 8C).
  • the WT allele amplicon was a 422 bp PCR product, while the knocked-in gene trap amplicon was a 516 bp PCR product.
  • mice used in this study were backcrossed for >10 generations onto a C57BL/6J background. All mice were kept under specific pathogen-free conditions at the Institute of Molecular Biotechnology (1MB A) of the Austrian Academy of Sciences, the Medical University of Vienna, National Cancer institute, the Ohio State University, and/or the Institute for Systems Biology, Seattle. For all experiments sex- and age-matched mice were used. The animal protocols were approved by the Institutional Animal Care and Use Committees of the National Cancer Institute-Frederick, the Ohio State University, the Institute of Systems Biology in Seattle respectively by the ethical committee of the Medical University of Vienna and the Austrian Federal Ministry of Science and Research.
  • 1MB A Institute of Molecular Biotechnology
  • Bone marrow-derived macrophages Bone marrow-derived macrophages.
  • BMDMs Bone marrow-derived macrophages
  • BMDMs were stimulated with PAM3CS 4 (PAM3) (500ng/ml, Invivogen tlrl-pms), polyFC (6 ⁇ ⁇ 1, Invivogen tlrl-pic), LPS (20ng/ml, Salmonella enterica serotype Minnesota, Sigma #L4641), mouse IFN (1000 IU/ml, PBL Interferon Source #12400-1), mouse IFNy (lOOng ml, Peptrotech #315-05) or IFN 2 (lOOng/ml, Biomedica 4635-ML-025).
  • PAM3CS 4 PAM3CS 4
  • PAM3CS 4 500ng/ml, Invivogen tlrl-pms
  • polyFC 6 ⁇ ⁇ 1, Invivogen tlrl-pic
  • LPS (20ng/ml, Salmonella enterica serotype Minnesota, Sigma #L4641
  • mouse IFN 1000 IU/ml, PBL Interferon Source #12400-1
  • mouse IFNy lOOng
  • publicly available array expression data derived from polyI:C stimulated BMDMs was downloaded from the website http://www.systemsimmunology.org.
  • RNAseq For the experiments in Fig. 2b, we performed expression analysis by RNAseq. Briefly, BMDMs from each genotype were prepared and stimulated with polyI:C for the indicated time points. RNA was extracted by QIAzol lysis reagent (Qiagen) and the libraries were prepared with the Truseq RNA sample preparation kit v2 according to the manufacturer's instructions (Illumina). Quality control analysis was performed by Experion DNA Analysis chip (Biorad) and Qubit Fluorometric Quantitation (Life Technologies). The samples were multiplexed with 9 samples per lane and run on a 50bp single-end flow cell in a Hiseq2000 sequencer (Illumina).
  • RNA-Seq reads were aligned to the mouse genome assembly GRCm38 (UCSC mmlO) with the TopHat splice junction mapper (version 2.0.12) utilizing the mouse gene and transcript annotation from Ensembl version 70 as reference transcriptome.
  • the TopHat max-multihits option were set to 100, while the length (-L) of the seed substrings of the underlying Bowtie 2 aligner (version 2. 2.3) were reduced from 20 to 15.
  • Programs from the Cufflinks package (version 2._2.1) were used to assemble transcripts, merge transcript assemblies of replicates and samples before finally testing for differential expression with the Cuffdiff program.
  • the default false discovery rate (FDR) of 0.05 was left unchanged.
  • Cuffdiff comparisons were post- processed, and quality assessment plots were drawn with the Bioconductor package cummeRbund (version 2.6.1).
  • GSEA Gene ontology enrichment analyses were done by DAVID Bioinformatics Resources 6.7 and the Molecular Signatures Database of Gene Set Enrichment Analysis (GSEA).
  • GSEA Gene Set Enrichment Analysis
  • SAM Significance Analysis of Microanalysis
  • Heatmaps were plotted in R.
  • the raw data from our array and RNAseq data are deposited at ArrayExpress (http://www.ebi.ac.uk/arrayexpress/) with accession numbers E-MTAB-2845 and_E-MTAB- 2263.
  • NF-KB target genes were compiled using resources from the website of The Gilmore Lab, Boston University (http://www.bu.edu/nf-kb/gene-resources/target-genes/), from the website of the Institut de Biologie de Lille et LIFL (http://bioinfo.lifl.fr/NF- KB/#haut%20de%20page) as well as from recent literature.
  • the resulting total list of 373 NF- KB target genes was used to calculate the hypergeometric distribution (assuming a total number of 24561 coding genes, source: MGI informatics.jax.org) of overlapping genes within the protein-coding genes that were significantly upregulated > 1.5-fold at ⁇ one time point (p ⁇ 0.001).
  • a C-terminal 60 amino acid long sequence (amino acid position 541-600) was fused into a hepatitis B carrier protein as immunogen. This region was amplified by PCR and inserted into a 6x histidine-tagged pB-His HBcAg_Linker plasmid 56 .
  • the fusion protein was expressed in E. coli BL21 and purified on 1ml HisTrap HP columns (GE Healthcare) followed by a linear imidazole gradient on an AKTA FPLC system (GE Healthcare). The fractions were analyzed by SDS-Page and concentrated with Amicon Ultra 15-3K Centrifugal Filter Devices (Millipore).
  • Protein concentration of cell lysates and organs were determined with a Coomassie Protein Assay kit (Thermo Scientific). Proteins were analyzed by SDS-Page using NuPAGE® Novex 4-12% Bis-Tris Gels (Life Technologies), Westran® Clear signal PVDF membranes (Whatman) and the following antibodies: anti-Zbpl (kindly provided by the Superti-Furga laboratory), anti-Setdb2 (clone 7H7F11, described in this study), anti- ⁇ (Santa Cruz Biotechnology sc-371 clone C-21, respectively, Cell Signaling n.4814 clone L35A5) and anti- actin (Sigma #A2066).
  • the protein size was determined with the PageRulerTM Prestained Protein Ladder (Thermo Scientific). Detection was done with Pierce ECL Western blotting substrate (Thermo Scientific) or Amersham ECL select Western blotting detection reagent (GE Healthcare Life Sciences). Gels were visualized with the chemiluminescent gel documentation system F-ChemiBIS 3.2 (DNR Bio-Imaging Systems).
  • Protein concentrations were determined using the Mouse CXCLl/KC Quantikine ELISA Kit (#MKC00B) or the Mouse CXCLl/KC DuoSet (#DY453), the Mouse CXCL2/MIP-2 DuoSet (#DY452), the Mouse IL-6 DuoSet (#DY406) or the Mouse BD OptEIA IL-10 kit (BD Biosciences, #555252).
  • the ELISAs were performed according to the manufacturer's instructions. Chromatin immunoprecipitation analysis.
  • BMDMs derived from WT or Setdb2 GVGT mice were either treated with polyI:C for 2h or left untreated. The same number of cells was subsequently harvested, fixed with 1% formaldehyde for lOmin at RT, and lysed in 1% SDS buffer. Chromatin was sheared to an average size of 300bp using S2X Focused-ultrasonicator (Covaris), and the amount was adjusted using ND- 1000 spectrophotometer (NanoDrop) measurement to match WT and Setdb2 GT/GT samples before histone mark ChlPs.
  • S2X Focused-ultrasonicator Covaris
  • the prepared chromatin of WT or WT and Setdb2 samples were subjected to ChIP with anti-Setdb2 clone 7H7F11 (see above), anti-H3 9me3 (Abeam Ab8898) or anti-H3K9acetyl (Millipore #07-352) respectively following a procedure as described previously 57 that was modified by the use of magnetic Dynabeads Protein-G beads (Life Technologies).
  • For mock ChIP controls empty beads were used.
  • the medium used for culturing the hybridoma 7H7F11 was added instead.
  • ChIP efficiency was controlled by quantitative real-time PCR analysis using the primers for: Cxcll promoter region, F 5'-CCTCTTCACATGCCTCCCTG-3' (SEQ ID NO: 12) and R 5'- CGGGGATGGAAGCTTGTCTT-3 ' (SEQ ID NO.
  • Cxcll exon 1 region F 5'- GTTCCAGCACTCCAGACTCC-3' (SEQ ID NO: 14) and R 5'- AGTGGCGAGACCTACCTGT-3 ' (SEQ ID NO: 15); Actb promoter region, F 5'- CCTCTGGGTGTGGATGTCAC-3 ' (SEQ ID NO: 16) and R 5'- TGTCCATTCAATCC AGGCCC-3 ' (SEQ ID NO: 17).
  • mice were anesthetized with ketamine/xylazine and intranasally administered with 0.4 ⁇ g of LPS (E. coli serotype 01 1 1 :B4, Sigma #L4391) as described previously 58 .
  • LPS E. coli serotype 01 1 1 :B4, Sigma #L4391
  • mice were sacrificed and bronchoalveolar lavage (BAL) was taken by washing the lungs 3 times with PBS in a total volume of 1 ml. The total number of cells in the BAL was enumerated with an improved Neubauer hemocytometer.
  • Cytocentrifuged preparations (Cytospin-4, Shandon Instruments) were stained with Kwik-Diff Stains (Thermo Fisher Scientific) and the percentage of inflammatory cells was determined by morphological examination of at least 300 cells per sample. Infection models.
  • mice were anesthetized with ketamine/xylazine and intranasally infected with 15 ⁇ 1 or 50 ⁇ 1 of PBS containing ⁇ 10 5 plaque forming units (PFU) of influenza virus A/PR/8/34 (PR8) (originally obtained from Charles River Laboratories).
  • PFU plaque forming units
  • PR8 ⁇ 10 2 PFU
  • Sp Streptococcus pneumoniae
  • Mice for the 16h samples in Fig. 5 were harvested in the time span corresponding to 14-16h after superinfection.
  • Bacterial titers were determined from lung homogenates by plating 10- fold serial dilutions on blood agar plates 59 . The lung wet weights were determined with a Pioneer precision balance (Ohaus).
  • Lung tissue was harvested as indicated and single cell suspension were prepared using a metal mesh. Absolute cell numbers were counted with a Neubauer chamber. Single-cell suspensions of the lungs respectively collected BAL cells were incubated with CD16/CD32 Fc block (BioLegend, 101310) to inhibit unspecific antibody binding.
  • Lung tissue was fixed with either 4% paraformaldehyde or 10% formalin and embedded in paraffin. Immunohistochemistry was performed on 3-4 ⁇ thick sections. Endogenous peroxidase was neutralized (PBS/3% H202) and unspecific binding blocked (PBS/10% FCS). Sections were then incubated with goat-anti influenza antibody (Serotec, Product Code 5315- 0064) overnight at 4°C. Bound primary antibody was visualized by a biotin technique with 3,3' diaminobenzidine as chromogen (haemalaun counterstaining of nuclei).
  • histology scores were obtained by a trained pathologist, blinded for groups, from lung sections stained with hematoxylin and eosin 59 .
  • the severity of inflammation and pneumonia was evaluated based on the presence of interstitial inflammation, alveolar inflammation, pleuritis, bronchitis and endothelitis with 0 representing absent, 1 mild, 2 moderate, and 3 severe. Additionally, 1 point was added for the presence of pneumonia, edema or thrombi formation, and 0.5 point for every infiltrate covering 10% of the lung area. The sum of all parameters indicates the total histology score.
  • Results are indicated as line graph, bar graph or scatter plot with the mean +/- standard error of the mean as indicated.
  • Statistical differences between experimental groups were determined with either paired or unpaired t-test as detailed in the figure legends. Significant p- values were indicated as follows: * p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001, **** p ⁇ 0.0001. Graphs and statistical tests were done with GraphPad Prism version 5 and 6.
  • Type-I interferon signaling drives Setdb2 expression
  • IFN-stimulated protein Zbpl Detection of the known IFN-stimulated protein Zbpl (alias Dai) served as a control 31 .
  • the induction of Setdb2 by type II IFN was partially dependent on Ifnarl, indicating a secondary requirement for endogenous type I IFN 32 .
  • Cxcll encodes a key chemoattractant for neutrophils, a type of leukocyte shown to be critically involved in bacterial clearance in superinfection 14 ' 15 ' 16 .
  • TLR agonists resulted in the induction of significantly more Cxcll transcripts in Setdb2" Ji jl BMDMs as compared to WT controls (Fig. 2c). This finding was confirmed at the level of secreted protein (Fig. 2d).
  • Methyltransferases of the SUV39 family preferentially methylate the histone substrate H3K9 22 ' .
  • Setdb2 was shown to catalyze the repressive mark H3K9me3 ' .
  • Setdb2 would inhibit Cxcll expression by introducing repressive marks in the Cxcll promoter region.
  • Setdb2-specific mAb clone 7H7F11 was used to perform chromatin immunoprecipitation (ChIP) experiments.
  • BMDMs were treated with polyI:C for two hours and Setdb2-specific enrichment of genomic DNA was quantified by real-time PCR.
  • Setdb2 mediates influenza virus-induced susceptibility to superinfection by Streptococcus pneumoniae
  • Cxcll is secreted by multiple cell types including alveolar macrophages 35 .
  • influenza virus infection of alveolar macrophages taken ex vivo from BAL of Setdb2 mice expressed more Cxcll compared to WT controls (Fig. 12), implicating this cell population as one source of Cxcll in our infection model in vivo.
  • the levels of other inflammatory mediators such as Cxcl2, 116 and 1110 were similar in BAL of Setdb2 GVGT and WT mice (Fig. 14a-c).
  • Setdb2 induction in the lungs of mice infected with either Streptococcus pneumoniae or influenza virus we compared Setdb2 induction in the lungs of mice infected with either Streptococcus pneumoniae or influenza virus.
  • Setdbl mice express decreased amounts of Setdb2 and are less sensitive to bacterial superinfection after primary influenza virus infection, compared to wild-type WT mice. This is in contrast to the situation after infection with Streptococcus pneumoniae (SP) only, where no difference in bacterial clearance and overall pathology can be observed between the two genotypes.
  • SP Streptococcus pneumoniae
  • PR8 infection we measured the induction of Setdb2 after SP and influenza virus (PR8) infection. We show that influenza virus, but not SP infection was able to induce Setdb2 expression. This highlights the crucial importance of Setdb2 induction in the context of infections, such as viral infections or, in particular, bacterial superinfections.
  • WT as well as Setdb2 mice were either infected with SP, PR8, or left untreated as control (Ctrl) and lungs were harvested at indicated time points. Total RNA was extracted from lungs and real-time PCR was used to measure Setdb2 expression. Interestingly, SP infection did not induce Setdbl expression at any of the time points investigated, see Fig. 13. In contrast, Setdb2 was strongly induced 5 days (5d) after influenza virus infection, the time point used to perform superinfection experiments (see e.g. Fig. 5). Setdb2 expression is displayed as fold inducion compared to uninfected mice. Scatter blot indicate individual mice pooled from different experiments. Statistical analysis was performed by unpaired t-test.
  • the Setdbl genetrap mice show a residual expression of about 20 % of that of the wild-type mice. Nevertheless Setdbl mice can show an induction of Setdb2 upon influenza virus infection relative to non-infected Setdbl genetrap mice. This induction of Setdb2 in Setdbl mice can be due to the presence of the wild-type promoter of the Setdb2 gene in W 201
  • Setdb2 mice The expression of Setdb2 can be increased by stimuli of the promoter like interferons, TLR ligands etc.
  • the Setdb2 mice represent a model for antagonists of Setdb2. They can also be used as a model for a clinical setting characterized by upregulation of Setdb2, e.g. upon influenza infection, for example, relative to non-infected Setdb2 mice.
  • influenza virus-induced Setdb2 expression had a detrimental effect on the early recruitment of neutrophils, the subsequently delayed pathogen clearance and the impaired tissue integrity during bacterial superinfection.
  • Setdb2 induction/upregulation, e.g. upon viral infection.
  • Setdb2 is upregulated in such a setting, it can serve as a target for Setdb2 antagonists.
  • the antagonists in turn induce, by downregulation of Setdb2, the upregulation/secretion/activation/enhanced infilitration of chemoattractans for neutrophils, like Cxcll/CXCL8.
  • the enhanced/stimulated immune response (involving the upregulation etc. of neutrophils) has a beneficial therapeutic effect on the infection/infectious disease.
  • Type I IFN and NF- ⁇ signaling are two important pathways for this process and are subjected to multiple layers of crosstalk, many of which are still poorly understood.
  • Setdb2 as a crucial part of the IFN-mediated immune response that provides a hitherto unknown layer of regulatory crosstalk between the type I IFN and NF- ⁇ signaling pathways.
  • ISG interferon-stimulated gene
  • This evolutionary strategy may turn into a double-edged sword during bacterial superinfection, by causing impaired bacterial clearance and severe tissue damage (Fig. 17).
  • type I IFN signaling was shown to have a detrimental role in the pathogenesis of virus-induced susceptibility to bacterial superinfection 14 ' 15, 16 . Accordingly, Setdb2 may be responsible and mediate at least parts of this important type I IFN-dependent mechanism.
  • Chromatin modifiers can be recruited to their targets through specific interactions with transcriptional regulators and/or chromatin-associated factors. We hypothesize that a similar mechanism facilitates the specific recruitment of Setdb2 to its target gene promoters to introduce repressive H3 9me3 chromatin marks. Yet, we cannot exclude the possibility that Setdb2 may recruit other methyltransferases or transcription factors. Likewise, the function of Setdb2 may be determined by mutually non-exclusive cellular and immunological parameters (e.g. cell type, inflammatory state, pathogen type) as well as by the complex epigenetic context of multivalent chromatin modifications 38 . Independent of direct histone methylation and in analogy to other PKMTs, Setdb2 may also methylate non-histone protein targets 36 ' 39 ' 0 .
  • mutually non-exclusive cellular and immunological parameters e.g. cell type, inflammatory state, pathogen type
  • Setdb2 an important regulatory role in the IFN-mediated immune response and in the pathogenesis of virus-induced susceptibility to bacterial superinfection.
  • PKMTs Several inhibitors for PKMTs are currently in clinical trials 41 .
  • Setdb2 is an attractive therapeutic target for the treatment of superinfections and other inflammatory conditions.
  • siRNA 1 The human embryonic kidney cell line Hek293T cell was used to deplete hSETDB2 by specific siRNAs (Qiagen) ( Figure 17). Cells were transfected with a control siRNA, 2 different SETDB2-specific siRNAs (siRNA 1+2), a pool of both siRNAs (siRNA pool), or were left untreated as control (control siRNA).
  • siRNA 1 2 different SETDB2-specific siRNAs
  • siRNA pool a pool of both siRNAs
  • Target sequence CCGAGAGCATCTGAACTCTAA (SEQ ID NO: 7)
  • siRNA 1 targets SETDB2 at nt position 2481-2501 of a nucleic acid molecule having a sequence encoding Setdb2 as shown in SEQ ID NO: 1.
  • siRNA 1 targets SETDB2 at nt position W 201
  • siRNA2 targets SETDB2 at nt position 2843-2863of a nucleic acid molecule having a sequence encoding Setdb2 asshown in SEQ ID NO: 1.
  • siRNA2 targets SETDB2 at nt position 2243-2261 of a nucleic acid molecule having a sequence encoding Setdb2 asshown in SEQ ID NO: 3.
  • Example 3 Induction of CXCL8 in human SET.Di?2-knockdown cell lines

Abstract

La présente invention concerne un antagoniste de la méthyltransférase Setdb2 pour son utilisation dans le traitement d'une infection. L'invention concerne également des procédés de traitement, de prévention ou d'amélioration d'infections, comprenant l'administration d'un antagoniste de Setdb2 à un sujet ayant besoin de ce type de traitement. Dans la présente invention on préfère le traitement des surinfections, en particulier des surinfections bactériennes. L'infection, en particulier la surinfection bactérienne, peut être précédée d'une infection virale.
PCT/EP2015/077267 2014-11-20 2015-11-20 Antagonistes de setdb2 pour leur utilisation dans la thérapie de maladies infectieuses WO2016079321A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP14194146 2014-11-20
EP14194146.8 2014-11-20

Publications (1)

Publication Number Publication Date
WO2016079321A1 true WO2016079321A1 (fr) 2016-05-26

Family

ID=51947191

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/077267 WO2016079321A1 (fr) 2014-11-20 2015-11-20 Antagonistes de setdb2 pour leur utilisation dans la thérapie de maladies infectieuses

Country Status (1)

Country Link
WO (1) WO2016079321A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180071284A1 (en) * 2015-05-01 2018-03-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Serv Preventing or treating viral infection by inhibition of the histone methyltransferase ezh1 or ezh2
WO2019036466A1 (fr) * 2017-08-14 2019-02-21 Epizyme, Inc. Procédés de traitement de cancer par inhibition de setd2
EP3952874A4 (fr) * 2019-04-05 2022-12-28 Prelude Therapeutics, Incorporated Inhibiteurs sélectifs de la protéine arginine méthyltransférase 5

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
EP0036676A1 (fr) 1978-03-24 1981-09-30 The Regents Of The University Of California Procédé de préparation de liposomes de taille identique et les liposomes ainsi obtenus
EP0052322A2 (fr) 1980-11-10 1982-05-26 Gersonde, Klaus, Prof. Dr. Méthode de préparation de vésicules lipidiques par traitement aux ultra-sons, utilisation de ce procédé et l'appareillage ainsi utilisé
EP0058481A1 (fr) 1981-02-16 1982-08-25 Zeneca Limited Compositions pharmaceutiques pour la libération continue de la substance active
EP0088046A2 (fr) 1982-02-17 1983-09-07 Ciba-Geigy Ag Lipides en phase aqueuse
DE3218121A1 (de) 1982-05-14 1983-11-17 Leskovar, Peter, Dr.-Ing., 8000 München Arzneimittel zur tumorbehandlung
EP0102324A2 (fr) 1982-07-29 1984-03-07 Ciba-Geigy Ag Lipides et composés tensio-actifs en phase aqueuse
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
EP0133988A2 (fr) 1983-08-02 1985-03-13 Hoechst Aktiengesellschaft Préparations pharmaceutiques contenant des peptides régulateurs à libération retardée et procédé pour leur préparation
EP0142641A2 (fr) 1983-09-26 1985-05-29 Udo Dr. Ehrenfeld Moyen et produit pour le diagnostic et la thérapie de tumeurs ainsi que pour le traitement de déficiences du système immunitaire cellulaire et humoral
EP0143949A1 (fr) 1983-11-01 1985-06-12 TERUMO KABUSHIKI KAISHA trading as TERUMO CORPORATION Composition pharmaceutique contenant de l'urokinase
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
EP0036676A1 (fr) 1978-03-24 1981-09-30 The Regents Of The University Of California Procédé de préparation de liposomes de taille identique et les liposomes ainsi obtenus
EP0052322A2 (fr) 1980-11-10 1982-05-26 Gersonde, Klaus, Prof. Dr. Méthode de préparation de vésicules lipidiques par traitement aux ultra-sons, utilisation de ce procédé et l'appareillage ainsi utilisé
EP0058481A1 (fr) 1981-02-16 1982-08-25 Zeneca Limited Compositions pharmaceutiques pour la libération continue de la substance active
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
EP0088046A2 (fr) 1982-02-17 1983-09-07 Ciba-Geigy Ag Lipides en phase aqueuse
DE3218121A1 (de) 1982-05-14 1983-11-17 Leskovar, Peter, Dr.-Ing., 8000 München Arzneimittel zur tumorbehandlung
EP0102324A2 (fr) 1982-07-29 1984-03-07 Ciba-Geigy Ag Lipides et composés tensio-actifs en phase aqueuse
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
EP0133988A2 (fr) 1983-08-02 1985-03-13 Hoechst Aktiengesellschaft Préparations pharmaceutiques contenant des peptides régulateurs à libération retardée et procédé pour leur préparation
EP0142641A2 (fr) 1983-09-26 1985-05-29 Udo Dr. Ehrenfeld Moyen et produit pour le diagnostic et la thérapie de tumeurs ainsi que pour le traitement de déficiences du système immunitaire cellulaire et humoral
EP0143949A1 (fr) 1983-11-01 1985-06-12 TERUMO KABUSHIKI KAISHA trading as TERUMO CORPORATION Composition pharmaceutique contenant de l'urokinase

Non-Patent Citations (109)

* Cited by examiner, † Cited by third party
Title
"Nucleic acid hybridization, a practical approach", 1985, IRL PRESS OXFORD
ADEREM A; ULEVITCH RJ: "Toll-like receptors in the induction of the innate immune response", NATURE, vol. 406, no. 6797, 2000, pages 782 - 787
ALLAN M ET AL., BIOORG MED CHEM LETT, 2009
ALLAN RS; ZUEVA E; CAMMAS F; SCHREIBER HA; MASSON V; BELZ GT ET AL.: "An epigenetic silencing pathway controlling T helper 2 cell lineage commitment", NATURE, vol. 487, no. 7406, 2012, pages 249 - 253
ALTSCHUL, J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL, J. MOL. EVOL., vol. 36, 1993, pages 290 - 300
ALTSCHUL, NUCL. ACIDS RES., vol. 25, 1997, pages 3389 - 3402
AMATANGELO MD ET AL., CELL CYCLE, 2013
ARREDOUANI M; YANG Z; NING Y; QIN G; SOININEN R; TRYGGVASON K ET AL.: "The scavenger receptor MARCO is required for lung defense against pneumococcal pneumonia and inhaled particles", JEXP MED, vol. 200, no. 2, 2004, pages 267 - 272
ARROWSMITH CH ET AL., NAT REV DRUG DISCOV, 2012
AUSUBEL: "Current Protocols in Molecular Biology", 1989, GREEN PUBLISHING ASSOCIATES AND WILEY INTERSCIENCE
BLACK JC; VAN RECHEM C; WHETSTINE JR: "Histone lysine methylation dynamics: establishment, regulation, and biological impact", MOL CELL, vol. 48, no. 4, 2012, pages 491 - 507
BORCHARDT RT ET AL., J BIOL CHEM, 1984
BRUTLAG, COMP. APP. BIOSCI., vol. 6, 1990, pages 237 - 245
CAI S; BATRA S; LIRA SA; KOLLS JK; JEYASEELAN S: "CXCL1 regulates pulmonary host defense to Klebsiella Infection via CXCL2, CXCL5, NF-kappaB, and MAPKs", J IMMUNOL, vol. 185, no. 10, 2010, pages 6214 - 6225
CEOL CJ; HOUVRAS Y; JANE-VALBUENA J; BILODEAU S; ORLANDO DA; BATTISTI V ET AL.: "The histone methyltransferase SETDBI 1 is recurrently amplified in melanoma and accelerates its onset", NATURE, vol. 471, no. 7339, 2011, pages 513 - 517
CHERBLANC FL ET AL., NAT CHEM BIOL, 2013
CHRISTOPHER SCHLIEHE ET AL: "The methyltransferase Setdb2 mediates virus-induced susceptibility to bacterial superinfection", NATURE IMMUNOLOGY, vol. 16, no. 1, 24 November 2014 (2014-11-24), pages 67 - 74, XP055187534, ISSN: 1529-2908, DOI: 10.1038/ni.3046 *
DAIGLE SR ET AL., BLOOD, 2013
DAIGLE SR ET AL., CANCER CELL, 2011
DANIELA DAMJANOVIC ET AL: "Marked Improvement of Severe Lung Immunopathology by Influenza-Associated Pneumococcal Superinfection Requires the Control of Both Bacterial Replication and Host Immune Responses", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 183, no. 3, 1 September 2013 (2013-09-01), pages 868 - 880, XP055187645, ISSN: 0002-9440, DOI: 10.1016/j.ajpath.2013.05.016 *
DELA CRUZ CS; LIU W; HE CH; JACOBY A; GORNITZKY A; MA B ET AL.: "Chitinase 3-like-l promotes Streptococcus pneumoniae killing and augments host tolerance to lung antibacterial responses", CELL HOST & MICROBE, vol. 12, no. 1, 2012, pages 34 - 46
DILLON SC; ZHANG X; TRIEVEL RC; CHENG X: "The SET-domain protein superfamily: protein lysine methyltransferases", GENOME BIOL, vol. 6, no. 8, 2005, pages 227
DILLON SHANE C ET AL: "The SET-domain protein superfamily: protein lysine methyltransferases", GENOME BIOLOGY (ONLINE), BIOMED CENTRAL LTD, GB, vol. 6, no. 8, 1 January 2005 (2005-01-01), pages 227, XP002496742, ISSN: 1465-6914, DOI: 10.1186/GB-2005-6-8-227 *
DURBIN JE; HACKENMILLER R; SIMON MC; LEVY DE: "Targeted disruption of the mouse Statl gene results in compromised innate immunity to viral disease", CELL, vol. 84, no. 3, 1996, pages 443 - 450
EPSTEIN ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 82, 1985, pages 3688 - 3692
FALANDRY C; FOUREL G; GALY V; RISTRIANI T; HORARD B; BENSIMON E ET AL.: "CLLD8/KMTIF is a lysine methyltransferase that is important for chromosome segregation", JBIOL CHEM, vol. 285, no. 26, 2010, pages 20234 - 20241
FANG TC; SCHAEFER U; MECKLENBRAUKER I; STIENEN A; DEWELL S; CHEN MS ET AL.: "Histone H3 lysine 9 di-methylation as an epigenetic signature of the interferon response", J EXP MED, vol. 209, no. 4, 2012, pages 661 - 669
FEBBRAIO M; PODREZ EA; SMITH JD; HAJJAR DP; HAZEN SL; HOFF HF: "Targeted disruption of the class B scavenger receptor CD36 protects against atherosclerotic lesion development in mice", J CLIN INVEST, vol. 105, no. 8, 2000, pages 1049 - 1056
FERGUSON AD ET AL., STRUCTURE, 2011
FOSTER SL; HARGREAVES DC; MEDZHITOV R: "Gene-specific control of inflammation by TLR-induced chromatin modifications", NATURE, vol. 447, no. 7147, 2007, pages 972 - 978
FUJIWARA T ET AL., J BIO CHEM, 2014
GILCHRIST M; THORSSON V; LI B; RUST AG; KORB M; ROACH JC,: "Systems biology approaches identify ATF3 as a negative regulator of Toll-like receptor 4", NATURE, vol. 441, no. 7090, 2006, pages 173 - 178
HELIN K; DHANAK D: "Chromatin proteins and modifications as drug targets", NATURE, vol. 502, no. 7472, 2013, pages 480 - 488
HENIKOFF, PNAS, vol. 89, 1989, pages 10915
HOGARTH CA; MITCHELL D; EVANOFF R; SMALL C; GRISWOLD M: "Identification and expression of potential regulators of the mammalian mitotic-to-meiotic transition", BIOL REPROD, vol. 84, no. 1, 2011, pages 34 - 42
HONDA K; YANAI H; NEGISHI H; ASAGIRI M; SATO M; MIZUTANI T ET AL.: "IRF-7 is the master regulator of type-I interferon-dependent immune responses", NATURE, vol. 434, no. 7034, 2005, pages 772 - 777
HUYNH T ET AL., BIOOORG MED CHEM LETT, 2009
HWANG ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 77, 1980, pages 4030 - 4034
JAMIESON AM; PASMAN L; YU S; GAMRADT P; HOMER RJ; DECKER T: "Role of tissue protection in lethal respiratory viral-bacterial coinfection", SCIENCE, vol. 340, no. 6137, 2013, pages 1230 - 1234
KAWAI T; AKIRA S: "The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors", NAT IMMUNOL, vol. 11, no. 5, 2010, pages 373 - 384
KNUTSON SK ET AL., NATURE CHEM BIOL, 2012
KNUTSON SK ET AL., PNAS, 2013
KONZE KD ET AL., ACS CHEM BIOL, 2013
KRATZ PA; BOTTCHER B; NASSAL M: "Native display of complete foreign protein domains on the surface of hepatitis B virus capsids", PROC NATL ACAD SCI U S A, vol. 96, no. 5, 1999, pages 1915 - 1920
KUBICEK S ET AL., MOL CELL, 2007
LEE EC; YU D; MARTINEZ DE VELASCO J; TESSAROLLO L; SWING DA; COURT DL: "A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA", GENOMICS, vol. 73, no. 1, 2001, pages 56 - 65
LEVY D; KUO AJ; CHANG Y; SCHAEFER U; KITSON C; CHEUNG P ET AL.: "Lysine methylation of the NF-kappaB subunit RelA by SETD6 couples activity of the histone methyltransferase GLP at chromatin to tonic repression of NF-kappaB signaling", NAT IMMUNOL, vol. 12, no. 1, 2011, pages 29 - 36
LITVAK V; RAMSEY SA; RUST AG; ZAK DE; KENNEDY KA; LAMPANO AE ET AL.: "Function of C/EBPdelta in a regulatory circuit that discriminates between transient and persistent TLR4-induced signals", NATLMMUNOL, vol. 10, no. 4, 2009, pages 437 - 443
LITVAK V; RATUSHNY AV; LAMPANO AE; SCHMITZ F; HUANG AC; RAMAN A ET AL.: "A FOX03-IRF7 gene regulatory circuit limits inflammatory sequelae of antiviral responses.", NATURE, vol. 490, no. 7420, 2012, pages 421 - 425
LIU F ET AL., J MED CHEM, 2010
LIU F ET AL., J MED CHEM, 2013
MANTOVANI A; CASSATELLA MA; COSTANTINI C; JAILLON S: "Neutrophils in the activation and regulation of innate and adaptive immunity", NAT REV IMMUNOL, vol. 11, no. 8, 2011, pages 519 - 531
MARAZZI I; HO JS; KIM J; MANICASSAMY B; DEWELL S; ALBRECHT RA ET AL.: "Suppression of the antiviral response by an influenza histone mimic", NATURE, vol. 483, no. 7390, 2012, pages 428 - 433
MATSUI T; LEUNG D; MIYASHITA H; MAKSAKOVA IA; MIYACHI H; KIMURA H ET AL.: "Proviral silencing in embryonic stem cells requires the histone methyltransferase ESET", NATURE, vol. 464, no. 7290, 2010, pages 927 - 931
MCCABE MT ET AL., NATURE, 2012
MCNAMEE LA; HARMSEN AG.: "Both influenza-induced neutrophil dysfunction and neutrophil-independent mechanisms contribute to increased susceptibility to a secondary Streptococcus pneumoniae infection", INFECT IMMUN, vol. 74, no. 12, 2006, pages 6707 - 6721
MEDZHITOV R; SCHNEIDER DS; SOARES MP: "Disease tolerance as a defense strategy", SCIENCE, vol. 335, no. 6071, 2012, pages 936 - 941
MOLINARI NA; ORTEGA-SANCHEZ IR; MESSONNIER ML; THOMPSON WW; WORTLEY PM; WEINTRAUB E ET AL.: "The annual impact of seasonal influenza in the US: measuring disease burden and costs", VACCINE, vol. 25, no. 27, 2007, pages 5086 - 5096
MORENS DM; TAUBENBERGER JK; FAUCI AS: "Predominant role of bacterial pneumonia as a cause of death in pandemic influenza: implications for pandemic influenza preparedness", THE JOURNAL OF INFECTIOUS DISEASES, vol. 198, no. 7, 2008, pages 962 - 970
MUKESH KUMAR YADAV ET AL: "Sinefungin, a Natural Nucleoside Analogue of S-Adenosylmethionine, Inhibits Streptococcus pneumoniae Biofilm Growth", BIOMED RESEARCH INTERNATIONAL, vol. 24, no. 16, 23 June 2014 (2014-06-23), pages 3267 - 10, XP055187639, ISSN: 2314-6133, DOI: 10.1086/598483 *
MULLER U; STEINHOFF U; REIS LF; HEMMI S; PAVLOVIC J; ZINKERNAGEL RM: "Functional role of type I and type II interferons in antiviral defense", SCIENCE, vol. 264, no. 5167, 1994, pages 1918 - 1921
MUTSCHLER: "Arzneimittelwirkungen", 1986, WISSENSCHAFTLICHE VERLAGSGESELLSCHAFT MBH
NAKAMURA S; DAVIS KM; WEISER JN: "Synergistic stimulation of type I interferons during influenza virus coinfection promotes Streptococcus pneumoniae colonization in mice", J CLIN INVEST, vol. 121, no. 9, 2011, pages 3657 - 3665
NAT, vol. 5, no. 6, 2005, pages 446 - 458
NAUSEEF WM; BORREGAARD N: "Neutrophils at work", NAT IMMUNOL, vol. 15, no. 7, 2014, pages 602 - 611
NAVARINI AA; RECHER M; LANG KS; GEORGIEV P; MEURY S; BERGTHALER A: "Increased susceptibility to bacterial superinfection as a consequence of innate antiviral responses", PROC NATL ACAD SCI USA, vol. 103, no. 42, 2006, pages 15535 - 15539
NUTT SL; FAIRFAX KA; KALLIES A: "BLIMP guides the fate of effector B and T cells", NAT REV IMMUNOL, vol. 7, no. 12, 2007, pages 923 - 927
OECKINGHAUS A; GHOSH S.: "The NF-kappaB family of transcription factors and its regulation", COLD SPRING HARBOR PERSPECTIVES IN BIOLOGY, vol. 1, no. 4, 2009, pages A000034
QI W ET AL., PNAS, 2012
R. LANGER ET AL., J. BIOMED. MATER. RES., vol. 15, 1981, pages 167 - 277
R. LANGER, CHEM. TECH, vol. 12, 1982, pages 98 - 105
RAQUIL MA; ANCERIZ N; ROULEAU P, TESSIER PA: "Blockade of antimicrobial proteins S100A8 and S 100A9 inhibits phagocyte migration to the alveoli in streptococcal pneumonia", JLMMUNOL, vol. 180, no. 5, 2008, pages 3366 - 3374
RICHMOND A, NATURE REVIEWS IMMUNOLOGY, 2002
RICHMOND A, NATURE REVIEWS IMMUNOLOGY, vol. 2, no. 9, September 2002 (2002-09-01), pages 664 - 674
RICHON VM; JOHNSTON D; SNEERINGER CJ; JIN L; MAJER CR; ELLISTON K ET AL.: "Chemogenetic analysis of human protein methyltransferases", CHEM BIOL DRUG DES, vol. 78, no. 2, 2011, pages 199 - 210
ROUSE BT; SEHRAWAT S.: "Immunity and immunopathology to viruses: what decides the outcome?", NAT REV IMMUNOL, vol. 10, no. 7, 2010, pages 514 - 526
RUTHENBURG AJ; LI H; PATEL DJ; ALLIS CD: "Multivalent engagement of chromatin modifications by linked binding modules", NAT REV MOL CELL BIOL, vol. 8, no. 12, 2007, pages 983 - 994
SACK JS ET AL., BIOCHEM J, 2011
SADLER AJ; WILLIAMS BR: "Interferon-inducible antiviral effectors", NAT REV IMMUNOL, vol. 8, no. 7, 2008, pages 559 - 568
SAMBROOK; RUSSELL: "Molecular Cloning, A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY
SATOH T; TAKEUCHI 0; VANDENBON A; YASUDA K; TANAKA Y; KUMAGAI Y ET AL.: "The Jmjd3-Irf4 axis regulates M2 macrophage polarization and host responses against helminth infection", NAT IMMUNOL, vol. 11, 2010, pages 936 - 944
SCHEBESTA A; MCMANUS S; SALVAGIOTTO G; DELOGU A; BUSSLINGER GA; BUSSLINGER M: "Transcription factor Pax5 activates the chromatin of key genes involved in B cell signaling, adhesion, migration, and immune function", IMMUNITY, vol. 27, no. 1, 2007, pages 49 - 63
SCHOGGINS JW; MACDUFF DA; IMANAKA N; GAINEY MD; SHRESTHA B; EITSON JL ET AL.: "Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity", NATURE, 2013
SGC: "Chemical Probes", STRUCTURAL GENOMICS CONSORTIUM, 2013
SHAHANGIAN A; CHOW EK; TIAN X; KANG JR; GHAFFARI A; LIU SY: "Type I IFNs mediate development of postinfluenza bacterial pneumonia in mice", J CLIN INVEST, vol. 119, no. 7, 2009, pages 1910 - 1920
SHEEHAN KC; LAI KS; DUNN GP; BRUCE AT; DIAMOND MS; HEUTEL JD: "Blocking monoclonal antibodies specific for mouse IFN-alpha/beta receptor subunit 1 (IFNAR-1) from mice immunized by in vivo hydrodynamic transfection", J INTERFERON CYTOKINE RES, vol. 26, no. 11, 2006, pages 804 - 819
SIDMAN, U. ET AL., BIOPOLYMERS, vol. 22, 1983, pages 547 - 556
SPANNHOFF A ET AL., BIOORG MED CHEM LETT, 2007
SUN K; METZGER DW: "Inhibition of pulmonary antibacterial defense by interferon-gamma during recovery from influenza infection", NAT MED, vol. 14, no. 5, 2008, pages 558 - 564
SZARKA RJ; WANG N; GORDON L; NATION PN; SMITH RH: "A murine model of pulmonary damage induced by lipopolysaccharide via intranasal instillation", JOURNAL OF IMMUNOLOGICAL METHODS, vol. 202, no. 1, 1997, pages 49 - 57
TAKAOKA A; MITANI Y; SUEMORI H; SATO M; YOKOCHI T; NOGUCHI S ET AL.: "Cross talk between interferon-gamma and -alpha/beta signaling components in caveolar membrane domains", SCIENCE, vol. 288, no. 5475, 2000, pages 2357 - 2360
TAKAOKA A; WANG Z; CHOI MK; YANAI H; NEGISHI H; BAN T ET AL.: "DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response", NATURE, vol. 448, no. 7152, 2007, pages 501 - 505
TAKEUCHI 0; HOSHINO K; KAWAI T; SANJO H; TAKADA H; OGAWA T ET AL.: "Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components", IMMUNITY, vol. 11, no. 4, 1999, pages 443 - 451
TANIGUCHI T; OGASAWARA K; TAKAOKA A; TANAKA N: "IRF family of transcription factors as regulators of host defense", ANNU REV IMMUNOL, vol. 19, 2001, pages 623 - 655
THOMPSON, NUCL. ACIDS RES, vol. 2, 1994, pages 4673 - 4680
THOMPSON, NUCL. ACIDS RES., vol. 2, 1994, pages 4673 - 4680
VAN DER SLUIJS KF; VAN DER POLL T; LUTTER R; J; UFFERMANS NP; SCHULTZ MJ.: "Bench-to-bedside review: bacterial pneumonia with influenza - pathogenesis and clinical implications", CRITICAL CARE, vol. 14, no. 2, 2010, pages 219
VAUBOURGEIX, J BIOL CHEM, vol. 284, 2009, pages 19321 - 19330
VEDADI M ET AL., NATURE CHEM BIOL, 2011
WAN H ET AL., BIOORG MED CHEM LETT, 2009
WAN H ET AL., BIOORGANIC MED CHEM LETTERS, 2009
WARSZAWSKA JM; GAWISH R; SHARIF 0; SIGEL S; DONINGER B; LAKOVITS K ET AL.: "Lipocalin 2 deactivates macrophages and worsens pneumococcal pneumonia outcomes", J CLIN INVEST, 2013
XU PF; ZHU KY; JIN Y; CHEN Y; SUN XJ; DENG M ET AL.: "Setdb2 restricts dorsal organizer territory and regulates left-right asymmetry through suppressing fgf8 activity", PROC NATL ACAD SCI U S A, vol. 107, no. 6, 2010, pages 2521 - 2526
YADAV, BIOMED RESEARCH INTERNATIONAL, 2014
YANG XD; HUANG B; LI M; LAMB A; KELLEHER NL; CHEN LF: "Negative regulation of NF-kappaB action by Set9-mediated lysine methylation of the RelA subunit", EMBO J, vol. 28, no. 8, 2009, pages 1055 - 1066
YU W ET AL., NATURE COMMUN, 2012
YUAN Y ET AL., ACS CHEM BIOL, 2012
ZHANG Y; LEAVES NI; ANDERSON GG; PONTING CP; BROXHOLME J; HOLT R ET AL.: "Positional cloning of a quantitative trait locus on chromosome 13q14 that influences immunoglobulin E levels and asthma", NAT GENET, vol. 34, no. 2, 2003, pages 181 - 186

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180071284A1 (en) * 2015-05-01 2018-03-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Serv Preventing or treating viral infection by inhibition of the histone methyltransferase ezh1 or ezh2
WO2019036466A1 (fr) * 2017-08-14 2019-02-21 Epizyme, Inc. Procédés de traitement de cancer par inhibition de setd2
CN111094568A (zh) * 2017-08-14 2020-05-01 Epizyme股份有限公司 通过抑制setd2治疗癌症的方法
EP3669279A4 (fr) * 2017-08-14 2021-05-05 Epizyme, Inc. Procédés de traitement de cancer par inhibition de setd2
US11952572B2 (en) 2017-08-14 2024-04-09 Epizyme, Inc. Methods of treating cancer by inhibiting SETD2
EP3952874A4 (fr) * 2019-04-05 2022-12-28 Prelude Therapeutics, Incorporated Inhibiteurs sélectifs de la protéine arginine méthyltransférase 5

Similar Documents

Publication Publication Date Title
JP7379428B2 (ja) Ｎｋ細胞におけるサイトカイン誘導性ｓｈ２タンパク質の阻害
US11793814B2 (en) Compositions and methods for treating, preventing or reversing age associated inflammation and disorders
Li et al. RNF111-facilitated neddylation potentiates cGAS-mediated antiviral innate immune response
US10821141B2 (en) HSV-1 oncolytic virus therapies that specifically kill ALT dependent cancers
Li et al. Critical role of alternative M2 skewing in miR-155 deletion-mediated protection of colitis
US20190055563A1 (en) Polymerase q as a target in hr-deficient cancers
WO2010022236A2 (fr) Inhibition de la progression de l’obésité par inhibition de la différenciation des adipocytes avec un inhibiteur de l’autophagie des préadipocytes
WO2017214463A1 (fr) Compositions et procédés pour le traitement du cancer et biomarqueurs pour détecter la reprogrammation et la progression de cellules souches cancéreuses
US20240016890A1 (en) Methods and compositions for preventing or treating cancer
WO2016079321A1 (fr) Antagonistes de setdb2 pour leur utilisation dans la thérapie de maladies infectieuses
US20220054548A1 (en) Mirna for use in therapy
US20230310421A1 (en) Molecules for use in the treatment of viral infections
Burnet et al. Hemin treatment drives viral reactivation and plasma cell differentiation of EBV latently infected B cells
WO2020249710A1 (fr) Traitement et prévention d'une maladie médiée par wwp2
US8686127B2 (en) Apoptosis inducer
US20180258428A1 (en) Methods and compositions for the treatment of a metabolic disorder
RU2812903C2 (ru) Композиции и способы лечения, предотвращения и обращения связанного с возрастом воспаления и расстройств
OA20735A (en) Compositions and methods for treating, preventing or reversing age-associated inflammation and disorders.
Wottawa Epithelial endoplasmic reticulum stress predisposes for CMV infection by suppression of cGAS/STING/type I interferon-signalling
WO2024064879A2 (fr) Inhibition de l'interféron lambda (ifnl) dans des cellules épithéliales intestinales pour le traitement d'une inflammation
Nguyen KAT2A and KAT2B Prevent Double-Stranded RNA Accumulation and Interferon Signaling to Maintain Intestinal Stem Cell Renewal
Ge et al. A hnRNPA2B1 agonist effectively inhibits HBV and SARS-CoV-2 omicron in vivo
McMahon BET Protein Regulation of Myocardial Injury and SARS-CoV-2 Infection
KR20160061423A (ko) 감염성 질환 및 소화관 염증에 대한 약물 표적으로서 퍼포린-2 활성화제 및 억제제
CN117683877A (zh) 一种诊断或治疗免疫系统疾病的生物标志物或靶点

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15813697

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15813697

Country of ref document: EP

Kind code of ref document: A1