WO2024064879A2 - Inhibition de l'interféron lambda (ifnl) dans des cellules épithéliales intestinales pour le traitement d'une inflammation - Google Patents

Inhibition de l'interféron lambda (ifnl) dans des cellules épithéliales intestinales pour le traitement d'une inflammation Download PDF

Info

Publication number
WO2024064879A2
WO2024064879A2 PCT/US2023/074874 US2023074874W WO2024064879A2 WO 2024064879 A2 WO2024064879 A2 WO 2024064879A2 US 2023074874 W US2023074874 W US 2023074874W WO 2024064879 A2 WO2024064879 A2 WO 2024064879A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
subject
epithelial cells
ifn
intestinal epithelial
Prior art date
Application number
PCT/US2023/074874
Other languages
English (en)
Inventor
Ivan ZANONI
Scott SNAPPER
Achille BROGGI
Original Assignee
The Children's Medical Center Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Children's Medical Center Corporation filed Critical The Children's Medical Center Corporation
Publication of WO2024064879A2 publication Critical patent/WO2024064879A2/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations

Definitions

  • Interferons encoded by humans includes type I interferons (e.g., interferon alpha (IFNA), interferon beta (IFNB), interferon kappa (IFNK), interferon omega (IFNW)), type II interferons (e.g., interferon gamma (IFNG)), and type III interferons (e.g., interferon lambda (IFNL)).
  • type I interferons e.g., interferon alpha (IFNA), interferon beta (IFNB), interferon kappa (IFNK), interferon omega (IFNW)
  • type II interferons e.g., interferon gamma (IFNG)
  • type III interferons e.g., interferon lambda (IFNL)
  • interferon signaling could potentially be used to treat inflammation caused by overactive immunity.
  • inhibitors primarily monoclonal antibodies, have been identified that specifically bind and inhibit IFNA or IFNA receptor (IFNAR).
  • IFNAR IFNA or IFNA receptor
  • no therapeutics have been developed that modulate type III interferon activity, specifically that which is mediated by IFNL and IFNL receptor (IFNLR).
  • IFNL interferon lambda
  • some aspects of the present disclosure relate to a method for treating inflammatory bowel disease (IBD) in a subject, the method comprising administering to the subject an effective amount of an agent that is sufficient to inhibit interferon lambda (IFNL) signaling in intestinal epithelial cells of the subject.
  • the agent comprises an antibody, a small molecule, a nucleic acid, or a gene editing agent.
  • the antibody binds to IFNL or interferon lambda receptor (IFNLR).
  • IFNLR interferon lambda receptor
  • the antibody specifically binds to IFNL or IFNLR.
  • the antibody binds to IFNL or IFNLR on the cell surface of intestinal epithelial cells of the subject.
  • the antibody inhibits the activity of IFNL or IFNLR in intestinal epithelial cells of the subject. In some embodiments, the antibody inhibits the activity of IFNL or IFNLR in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. In some embodiments, the small molecule binds to interferon lambda receptor (IFNLR). In some embodiments, the small molecule binds to IFNLR on the cell surface of intestinal epithelial cells of the subject. In some embodiments, the small molecule inhibits the activity of IFNLR in intestinal epithelial cells of the subject.
  • IFNLR interferon lambda receptor
  • the small molecule inhibits the activity of IFNLR in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the small molecule binds to a Janus kinase (JAK) protein that is bound to interferon lambda receptor (IFNLR) on the cell surface of intestinal epithelial cells of the subject.
  • the JAK protein is Janus kinase 2 (JAK2).
  • the small molecule does not bind to a JAK protein that is bound to interferon alpha receptor (IFNAR) on the cell surface of intestinal epithelial cells of the subject. In some embodiments, the small molecule inhibits the activity of the JAK protein in intestinal epithelial cells of the subject. In some embodiments, the small molecule inhibits the activity of the JAK protein in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. In some embodiments, the small molecule binds to a Viperin (RSAD2), protein.
  • IFNAR interferon alpha receptor
  • the small molecule inhibits the activity of the Viperin (RSAD2) protein in intestinal epithelial cells of the subject. In some embodiments, the small molecule inhibits the activity of the Viperin (RSAD2) protein in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. In some embodiments, the small molecule binds to a factor of PANoptosis signaling in intestinal epithelial cells of the subject.
  • the factor of PANoptosis signaling is Z-DNA-binding protein 1 (ZBP1), receptor-interacting serine/threonine-protein kinase 1 (RIPK1), receptor-interacting serine/threonine-protein kinase 3 (RIPK3), Fas associated via death domain (FADD), mixed lineage kinase domain-like pseudokinase (MLKL), dynamin- related protein 1 (Drp1), PGAM family member 5 (PGAM-5), a caspase protein, or a gasdermin protein.
  • the caspase protein is caspase-8, caspase-3, caspase-7, or caspase-1.
  • the gasdermin protein is Gasdermin C or Gasdermin D.
  • the factor of PANoptosis signaling is RIPK1 and the small molecule is necrostatin.
  • the small molecule inhibits the activity of the factor of PANoptosis signaling in intestinal epithelial cells of the subject.
  • the small molecule is selected from Z-VAD-FMK or Z-IETD-FMK.
  • the small molecule blocks the z-nucleic acid binding site of Z-DNA-binding protein 1 (ZBP1).
  • the small molecule inhibits the activity of the factor of PANoptosis signaling in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the nucleic acid is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).
  • the nucleic acid inhibits the expression of interferon lambda receptor (IFNLR), a Janus kinase (JAK) protein, Viperin (RSAD2), or a factor of PANoptosis signaling in intestinal epithelial cells of the subject.
  • IFNLR interferon lambda receptor
  • JAK Janus kinase
  • RSD2 Viperin
  • PANoptosis signaling in intestinal epithelial cells of the subject.
  • the JAK protein is Janus kinase 2 (JAK2).
  • the factor of PANoptosis signaling is Z-DNA-binding protein 1 (ZBP1), receptor-interacting serine/threonine-protein kinase 1 (RIPK1), receptor-interacting serine/threonine-protein kinase 3 (RIPK3), Fas associated via death domain (FADD), mixed lineage kinase domain-like pseudokinase (MLKL), dynamin- related protein 1 (Drp1), PGAM family member 5 (PGAM-5), a caspase protein, or a gasdermin protein.
  • the caspase protein is caspase-8, caspase-3, caspase-7, or caspase 1.
  • the gasdermin protein is Gasdermin C or Gasdermin D.
  • the nucleic acid blocks the z-nucleic acid binding site of Z-DNA-binding protein 1 (ZBP1).
  • ZBP1 Z-DNA-binding protein 1
  • the nucleic acid inhibits the expression of IFNLR, the JAK protein, or the factor of PANoptosis signaling in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the gene editing agent comprises a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeat (CRISPR)–Cas-associated nuclease (CRISPR/CAS).
  • the gene editing agent comprises CRISPR/CAS and further comprises a short guide RNA (sgRNA) that is complementary to a gene encoding interferon lambda receptor (IFNLR), a Janus kinase (JAK) protein, Viperin (RSAD2), or a factor of PANoptosis signaling in intestinal epithelial cells of the subject.
  • the gene editing agent binds to and modifies a gene encoding interferon lambda receptor (IFNLR), a Janus kinase (JAK) protein, or a factor of PANoptosis signaling in intestinal epithelial cells of the subject.
  • IFNLR interferon lambda receptor
  • JAK Janus kinase
  • the JAK protein is Janus kinase 2 (JAK2).
  • the factor of PANoptosis signaling is Z-DNA-binding protein 1 (ZBP1), receptor-interacting serine/threonine-protein kinase 1 (RIPK1), receptor-interacting serine/threonine-protein kinase 3 (RIPK3), Fas associated via death domain (FADD), mixed lineage kinase domain-like pseudokinase (MLKL), dynamin-related protein 1 (Drp1), PGAM family member 5 (PGAM-5), a caspase protein, or a gasdermin protein.
  • the caspase protein is caspase- 8, caspase-3, caspase-7, or caspase-1.
  • the gasdermin protein is Gasdermin C or Gasdermin D.
  • the gene editing agent reduces the expression of IFNLR, the JAK protein, or the factor of PANoptosis signaling in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the agent further comprises a delivery agent.
  • the delivery agent is a peptide, an antibody, a liposome, or a viral particle.
  • the delivery agent binds specifically to the cell surface of intestinal epithelial cells of the subject.
  • the agent and the delivery agent are covalently linked. In some embodiments, the agent and the delivery agent are linked by a cleavable linker. In some embodiments, the cleavable linker is a protease-sensitive linker, a pH- sensitive linker, or a glutathione-sensitive linker. In some embodiments, the agent and the delivery agent are linked by a non-cleavable linker. In some embodiments, the delivery agent enhances delivery of the agent to intestinal epithelial cells of the subject, as compared to delivery of the agent to intestinal epithelial cells of the subject in the absence of the delivery agent.
  • the delivery agent enhances internalization of the agent by intestinal epithelial cells of the subject, as compared to internalization of the agent by intestinal epithelial cells of the subject in the absence of the delivery agent.
  • the method results in a reduction of inflammation in intestinal epithelial cells of the subject.
  • the method results in a reduction of cell death in intestinal epithelial cells of the subject.
  • the cell death is cell death as a result of apoptosis, pyroptosis, and/or necroptosis.
  • the method results in increased proliferation of intestinal epithelial cells of the subject.
  • the method results in an enhancement of tissue repair in intestinal epithelial cells of the subject.
  • the IBD is Crohn’s disease (CD). In some embodiments, the IBD is ulcerative colitis (UC). In some embodiments, the subject is a mammal. In some embodiments, the subject is a human patient. In some embodiments, the administration is oral or via injection. In some embodiments, the administration is systemic. In some embodiments, the administration is local. In some embodiments, the administration is rectal. In some embodiments, the agent is administered to intestinal epithelial cells of the subject. In some embodiments, the agent is administered to the subject more than once.
  • CD Crohn’s disease
  • UC ulcerative colitis
  • the subject is a mammal. In some embodiments, the subject is a human patient. In some embodiments, the administration is oral or via injection. In some embodiments, the administration is systemic. In some embodiments, the administration is local. In some embodiments, the administration is rectal. In some embodiments, the agent is administered to intestinal epithelial cells of the subject. In some embodiments, the agent is administered to the subject more
  • FIGs.1A-1D show reconstitution of in vivo interferon lambda (IFNL) signaling in an in vitro organoid model.
  • FIG.1A shows a schematic for an in vitro assay utilizing murine or human small intestinal organoids maintained under an air-liquid interface (ALI). Submerging the cultivated organoid monolayer mimics the effects of tissue damage due to inflammation. Recombinant IFNL may be added prior to or following the submersion step to activate IFNL signaling in the monolayer.
  • ALI air-liquid interface
  • FIG.1B shows immunohistochemical staining of control intestinal organoid monolayers and monolayers treated with recombinant IFNL. Monolayers were treated with IFNL, as appropriate, prior to submersion. DAPI staining (middle panel, left) indicates the presence of nuclei, ZombieRed staining (middle panel, right) indicates the presence of dead cells, NucView staining (lower panel, left) indicates the caspase-3 activation, and Ki67 staining (lower panel, right) indicates proliferative cells.
  • FIG.1C shows quantification of indicated immunohistochemical readouts shown in FIG.1B, at 24 hours and 72 hours following treatment with recombinant IFNL to activate IFNL signaling.
  • FIG.1D shows quantification of cell survival over time in monolayers treated with the caspase-3 inhibitor Z-IETD-FMK (ZIETD).
  • Z- IETD-FMK was added to organoid cultures 30 minutes prior to treatment with recombinant IFNL. Cell survival was assessed by propidium iodide staining.
  • Right panel shows area under the curve of quantified cell survival over time. The number of surviving cells in the presence of Z-IETD-FMK did not significantly differ between untreated cultures and cultures treated with recombinant IFNL. *: p ⁇ 0.05; n.s.: not significant.
  • FIGs.2A-2I show how IFN- ⁇ inhibits tissue recovery after DSS-colitis.
  • FIGs.2A-2C show how WT mice were treated with 2.5% DSS for 7 days (the dotted line indicates the end of DSS administration).
  • mice were injected intraperitoneally (i.p.) with 50 ⁇ g kg -1 day -1 of rIFN- ⁇ for five consecutive days.
  • Weight FIG.2A
  • colon length FIG. 2B
  • histological score FIG.2C
  • FIGs.2D- 2E show how WT mice were treated with DSS for 7 days as in (FIGs.2A-2C).
  • mice were injected i.p.
  • FIGs. 2F-2G show how mice were treated with DSS as in (FIGs.2A-2C). Upon DSS withdrawal mice were injected i.p. with 50 mg kg -1 day -1 of rIFN- ⁇ or 12.5 mg kg -1 day -1 of anti-IFNAR1 antibody. Weight (FIG.2F), and colon length (FIG.2G) are depicted.
  • FIGs.2H-2I show how WT (FIG.2H) or Vil CRE Ifnlr1 fl/fl mice (FIG.2H) were treated with 2.5% DSS for seven days (dotted line). Upon DSS withdrawal mice were injected i.p. with 50 ⁇ g kg -1 day -1 of rIFN- ⁇ . Weight (FIG.2H), and colon length (FIG.2I) are depicted.
  • FIGs.2A, 2D, 2F and 2H show the mean and SEM of 5 mice per group. Two-way ANOVA with Tukey correction for multiple comparisons was utilized.
  • FIGs.2B, 2C, 2E, 2G depict box plots.
  • FIG.2I WT or Vil CRE Ifnlr1 fl/fl mice were treated as in (2B, 2E) and colon lengths were assessed on day 10 after start of DSS treatment. Each dot represents a mouse. Median, range and interquartile range are depicted.
  • FIGs.2B-2C show the statistics of an unpaired t test.
  • FIGs. 2E and 2G show a one-way ANOVA with Dunnett correction for multiple comparisons.
  • FIGs.3A-3E show how IFN- ⁇ impairs epithelial regeneration after radiation damage.
  • FIG.3A depicts WT mice and Ifnlr1 -/- received 11 Gy ionizing radiation, with lead shielding of the upper body.
  • WT mice were either administered 50 mg kg -1 day -1 of rIFN- ⁇ (WT + rIFN- ⁇ ), or the same volume of saline vehicle (WT + Veh).
  • Tissue repair in the small intestine was evaluated 96 hours after irradiation by counting the number of intact crypts per histological section (Crypts/section). Representative histological images and their corresponding quantification are shown.
  • FIG.3B shows WT, Ifnlr1 -/- , or Ifnar1 -/- mice were irradiated as in FIG.3A. Quantification of intact crypts per histological section is depicted.
  • FIG.3C Vil CRE Ifnlr1 fl/fl mice or WT mice were irradiated as in FIG.3A and treated with either 50 mg kg -1 day -1 of rIFN- ⁇ (rIFN- ⁇ ), or saline vehicle (Veh). Quantification of intact crypts per histological section is depicted.
  • FIGs.3D and 3E depict Vil CRE Ifnlr1 fl/fl mice or WT mice were irradiated with 14 Gy of ionizing radiation and treated with either 50 mg kg -1 day -1 of rIFN- ⁇ (rIFN- ⁇ ), or saline vehicle (Veh) and followed over time. Weight (FIG.3D) and survival (FIG.3E) are depicted. Statistical comparison between “WT+ Veh” and “Vil CRE Ifnlr1 fl/fl + Veh” are depicted as (*), comparison between “WT+ Veh” and “WT + rIFN- ⁇ ” is depicted as ( ⁇ ) .
  • FIGs.3A-3C depict box plots.
  • FIG.3D depicts the Mean and SEM.
  • FIGs. 3A-3B depict the statistics of a One-way ANOVA with Dunnett correction for multiple comparisons.
  • FIG.3C shows the two-way ANOVA with ⁇ idak correction for multiple comparison.
  • Vil CRE Ifnlr1 fl/fl mice or WT mice were irradiated and treated with either 50 ⁇ g kg- 1 day -1 of rIFN- ⁇ (rIFN- ⁇ ), or saline vehicle (Veh).
  • Left panel Quantification of intact crypts per histological section; right panel: Representative histological images.
  • FIG.3D shows the two- way ANOVA with Tukey correction for multiple comparisons.
  • FIGs.4A-4F show how IFN- ⁇ signaling induces an antiproliferative program in small intestine epithelia.
  • FIGs.4A-4D, and FIG.4F show that Vil CRE Ifnlr1 fl/fl mice or WT mice received 11 Gy ionizing radiation, with lead shielding of the upper extremities. Targeted transcriptomics was performed on small intestinal crypts isolated 96 hours after irradiation.
  • FIG.4A shows dot plots of Gene Ontology (GO) enrichment analysis.
  • FIGs.4B-4D show GSEA enrichment plots of the HALLMARK_IFN_ALPHA_RESPONSE (FIG.4B), REGENERATIVE SIGNATURE (as previously described (Yui, Azzolin et al.2018)) (FIG.4C), and the GO biological process Cell Population proliferation (“GOBP_CELL_POP_PROLIF) (FIG.4D) are depicted.
  • FIG.4E shows that Vil CRE Ifnlr1 fl/fl mice or WT mice were irradiated as in FIGs.4A-4D and treated with either 50 mg kg -1 day -1 of rIFN- ⁇ (rIFN- ⁇ ), or saline vehicle (Veh). After 96 hours mice were pulsed with EdU for 2 hours. Number of EdU + cells per crypt quantified by immunohistochemistry (IHC), and representative IHC sections are depicted.
  • IHC immunohistochemistry
  • FIG.4F shows the targeted transcriptomics data from WT or Vil CRE Ifnlr1 fl/fl small intestinal crypts were deconvoluted based on publicly available single-cell RNA-seq (scRNA-seq) datasets (Haber, Biton et al.2017) using CIBERSORTx (Newman, Steen et al.2019) to extrapolate the relative cellular composition of samples.
  • scRNA-seq publicly available single-cell RNA-seq datasets (Haber, Biton et al.2017) using CIBERSORTx (Newman, Steen et al.2019) to extrapolate the relative cellular composition of samples.
  • Paneth Paneth cells
  • Stem Intestinal stem cells
  • Enterocytes small intestine enterocytes
  • TA Transit amplifying cells
  • Goblet Goblet cells
  • Tuft tuft cells
  • EEC Enteroendocrine cells
  • EP Enterocyte progenitors.
  • FIG.4E depicts box plots. Each dot represents a mouse. Median, range and interquartile range are depicted.
  • FIG.4F shows the Mean and SEM of 4 samples (WT) and 3 samples (Vil CRE Ifnlr1 fl/fl ) are depicted.
  • FIG.4E used a two-way ANOVA with Turkey correction for multiple comparisons.
  • FIGs.5A-5D show how IFN- ⁇ controls the expression of ZBP1 and the activation of gasdermin C.
  • FIG.5A shows that Vil CRE Ifnlr1 fl/fl mice or WT mice were irradiated as in FIG.3A. Targeted transcriptomics was performed on freshly isolated small intestinal crypts. Volcano plot depicting differentially expressed genes (DEGs) between Vil CRE Ifnlr1 fl/fl and WT small intestinal crypts. DEGs (P ⁇ 0.005) with a fold change >2 (or ⁇ 2) are indicated; DEGs with a fold change ⁇ 2 (or > ⁇ 2) are indicated. Nonsignificant DEGs (P> 0.005) and genes not differentially expressed are indicated in green and gray, respectively.
  • DEGs differentially expressed genes
  • FIG.5B shows that RNA sequencing was performed on colon biopsies from control patients, IBD patients with inactive disease, and IBD patients with active disease, (see Materials and Methods). Square symbols represent controls, round symbols represent ulcerative colitis (UC) patients, triangles represent Crohn’s disease patients (CD). Box plots with median, range and interquartile range are depicted. Each symbol represents one patient. Expression of GSDMC, ZBP1, CASP8 expressed as normalized log2 count is depicted from left to right top to bottom.
  • FIG.5C shows a dot plot depicting the correlation between GSDMC expression and the IFN Response score performed on the same samples as FIG.5B. Each point represents a patient, solid lines represent linear regression, shaded area depicts the confidence interval. Spearman correlation coefficient (rho) and the relative p-value (pval) are indicated for each graph.
  • FIG.5D shows small intestinal crypts were isolated from Vil CRE Ifnlr1 fl/fl mice or WT mice irradiated as in FIG.3A (Irrad +) or not (Irrad -).
  • GSDMC-2/-3 FL p50 full length 50 kDa GSDMC-2/3; GSDMC-2/-3 CL p30: N-terminal 30 kDa cleaved protein; GSDMD FL p50: full length GSDMD 50 kDa; GSDMD CL p30: N-terminal 30 kDa cleaved protein; CASP-8 FL: full length CASP-8; CASP-8 p18: 18 kDa CASP-8 cleavage fragment; CASP-3 FL: full length CASP-3; CASP-3 p17: 17 kDa CASP-3 cleavage fragment; CASP-3 p12: 12 kDa CASP-3 cleavage fragment.
  • FIGs.6A-6I show how IFN- ⁇ inhibits epithelial proliferation and survival in intestinal organoids in vitro.
  • FIG.6A shows that mouse small intestinal organoids were seeded from freshly isolated crypts and allowed to grow for 48 hours.
  • Organoids were then treated with 200ng/ml of rIFN- ⁇ in the presence of 1ug/ml propidium iodide (PI) and imaged every 12 hours over 72 hours. Percentage of live organoids was calculated as percentage of PI- organoids over the total number of live organoids in each well. Representative image of 3 independent experiments is depicted.
  • FIG.6B shows small intestinal organoids derived from WT or Stat1 -/- mice were seeded from freshly isolated crypts and allowed to grow for 48 hours. Organoids were treated with 200ng/ml of rIFN- ⁇ in the presence of 1 ⁇ g/ml propidium iodide (PI) for 72 hours. Organoids were treated as in FIG.6A.
  • FIG.6C shows that small intestinal organoids were seeded and treated as in FIG.6A for 72 hours. Organoids were pulsed with EdU for 6 hours. Organoids were stained for EdU incorporation, and DAPI. Mean fluorescence of EdU staining (left), relative organoid growth (middle) and representative images (right), are depicted. The relative growth of organoids is measured as the % of their area over untreated control organoids.
  • FIG.6D shows the small intestinal organoids derived from WT or Zbp1 -/- mice were seeded and treated with 200ng/ml of rIFN- ⁇ and imaged at 48 hours.
  • FIG.6E shows that the small intestinal organoids were treated as in FIG.6A for 24, 48 and 72 hours. Immunoblot analysis of the indicated proteins was performed.
  • GSDMC-2/-3 FL p50 full length 50kDa GSDMC-2/-3;
  • GSDMC- 2/-3 CL p30 N-terminal 30kDa cleaved protein;
  • c-CASP-8 p43 43 kDa CASP-8 cleavage fragment;
  • c-CASP-8 p18 18 kDa CASP-8 cleavage fragment.
  • FIG.6F shows that the small intestinal organoids were seeded as in FIG.6A and either treated with 200ng/ml of rIFN- ⁇ alone (rIFN- ⁇ ) or with rIFN- ⁇ in the presence of the pan caspase inhibitor Z-VAD-FMK (40uM). Organoids were then followed for 72 hours and % of live organoids was evaluated as in FIG.6A. Statistical comparison between “rIFN- ⁇ ” and “Veh” are depicted (*), comparison between “rIFN- ⁇ + Z-VAD-FMK” and “rIFN- ⁇ ” is depicted ( ⁇ ).
  • FIG.6G shows that the small intestinal organoids were either left untreated (WT) or infected with a lentivirus expressing GFP and either a Gasdermin-2/Gasdermin-3 targeting (Gsdmc2, 3 KD ) small harpin (sh)RNA, or a scrambled control shRNA (Scramble). Organoids were grown for 5 days and then treated with 200ng/ml of rIFN- ⁇ or vehicle control for 48h. Survival of WT controls or lentiviral-infected GFP + cells was assessed by cytofluorimetry by staining with Zombie dye and calcein. % of dead cells represent cells positive for Zombie dye staining and negative for calcein.
  • FIG.6H shows the experimental scheme for the establishment of 2D Air Liquid Interface (ALI) organoid cultures and modeling of damage and repair responses.
  • Organoids were seeded in transwells and grown to confluence. The apical side was then exposed to air up to 14 days, which favored differentiation of a homeostatic monolayer. Organoids were then submerged for 7 days to induce damage responses. After 7 days they were re-exposed to air to stimulate repair responses. Concomitantly with re-exposure to air, organoids were treated with 200ng/ml of rIFN- ⁇ for 3 days.
  • FIG.6I shows the organoids treated as in FIG.6H were pulsed with EdU for 2 hours to mark proliferating cells.
  • FIGs.6A and FIG.6F show the Mean and SEM of 3 (FIG.6A) and 5 (FIG.6F) biological replicates per group are depicted.
  • FIGs.6B-6C depict box plots. Each dot represents a biological replicate. Median, range and interquartile range are depicted.
  • FIGs.6D, 6G, and 6I depict scatter plots. Each dot represents a biological replicate.
  • FIGs.6A and 6F depict the statistics of the two-way ANOVA with Tukey correction for multiple comparisons.
  • FIGs.6B, 6C, 6D, 6G, and 6I depict the two-way ANOVA with ⁇ idak correction for multiple comparison.
  • FIGs.7A-7C show how IFN- ⁇ inhibits tissue recovery after DSS-colitis.
  • FIG.7A shows that WT mice were treated with 2.5% DSS for 7 days. Upon DSS withdrawal mice were injected i.p.
  • FIG.7B shows that mice were treated with DSS as in FIG.7A. Upon DSS withdrawal mice were injected i.p. with either 50 mg kg -1 day -1 of rIFN- ⁇ or 12.5 mg kg -1 day -1 of anti-IFNAR1 antibody. Rsad2 relative mRNA expression in colonocytes on Day 14 is depicted.
  • FIG.7C shows WT (left panel) or Mrp8 CRE Ifnlr1 fl/fl mice (right panel) were treated with 2.5% DSS for seven days. Upon DSS withdrawal mice were injected i.p. with 50 ⁇ g kg -1 day -1 of rIFN- ⁇ . Weight is depicted.
  • FIGs. 7A-7B depict box plots. Each dot represents a mouse. Median, range and interquartile range are shown.
  • FIG.7C depicts the Mean and SEM of 5 mice per group are depicted.
  • FIGs.7A-7B show the statistics of a one-way ANOVA with Dunnett correction for multiple comparisons.
  • FIG.7C shows the two-way ANOVA with Tukey correction for multiple comparisons.
  • FIGs.8A-8D show how IFN- ⁇ impairs epithelial regeneration after radiation damage.
  • FIG.8A shows WT, Ifnlr1 -/- , or Ifnar1 -/- mice received 11 Gy ionizing radiation, with lead shielding of the upper body. Rsad2 relative mRNA expression in small intestinal crypt cells was evaluated 96 hours after irradiation.
  • FIG.8B shows Vil CRE Ifnlr1 fl/fl mice or WT mice were irradiated and treated with either 50 mg kg -1 day -1 of rIFN- ⁇ (rIFN- ⁇ ), or saline vehicle (Veh). Tissue repair in the small intestine was evaluated 96 hours after irradiation. Representative histological images of the small intestine are depicted.
  • FIG.8C shows WT mice and Mrp8 CRE Ifnlr1 fl/fl were irradiated as in FIG.8A. Tissue repair in the small intestine was evaluated 96 hours after irradiation by counting the number of intact crypts per histological section (Crypts/section).
  • FIG.8D shows the number of small intestinal intact crypts per histological section (Crypts/section) was evaluated in WT and Ifnlr1 -/- (left panel) and WT and Vil CRE Ifnlr1 fl/fl (right panel) mice at homeostasis.
  • FIG.8A depicts box plots. Each dot represents a mouse. Median, range and interquartile range are depicted.
  • FIGs.8C-8D depict scatter plots. Each dot represents a mouse. Mean with SEM are depicted.
  • FIG.8A shows the statistics of the one-way ANOVA with Dunnett correction for multiple comparisons.
  • FIG.8B shows the unpaired t test.
  • FIGs.9A-9E show how IFN- ⁇ signaling induces an antiproliferative program in small intestine epithelia.
  • FIGs.9A-9D show that Vil CRE Ifnlr1 fl/fl mice or WT mice received 11 Gy ionizing radiation, with lead shielding of the upper body.
  • FIGs.9A-9B show targeted transcriptomics was performed on small intestinal crypts isolated 96 hours after irradiation.
  • FIG.9A shows a heatmap depicting expression of genes in the leading edge of the enriched HALLMARK_IFN_ALPHA_RESPONSE gene set. The color is proportional to the Z Score.
  • FIG.9B shows a heatmap depicting expression of genes in the leading edge of the REGENERATION SIGNATURE gene set. The grayscale is proportional to the Z Score.
  • FIG. 9C shows a heatmap depicting expression of genes in the leading edge of the enriched GOBP_CELL_POPULATION_PROLIFERATION gene set. The grayscale is proportional to the Z Score.
  • FIG.9D shows Lgr5, Lyz1, Muc2, Chga relative mRNA expression in small intestinal crypt cells was evaluated 96 hours after irradiation.
  • FIG.9E shows Lgr5, Lyz1, Muc2, Chga relative mRNA expression in small intestinal crypt cells isolated from Vil CRE Ifnlr1 fl/fl mice or WT mice at irradiation (FIG.9D) or at homeostasis (FIG.9E) was evaluated.
  • FIGs.10A-10B show how IFN- ⁇ controls the expression of ZBP1 and the activation of Gasdermin C.
  • FIG.10A shows that Vil CRE Ifnlr1 fl/fl mice or WT mice were treated with either 50 mg kg -1 day -1 of rIFN- ⁇ (rIFN- ⁇ ), or saline vehicle (Veh). Immunoblot analysis of the indicated proteins was performed. Each lane represents one mouse.
  • GSDMC-2/-3 FL p50 full length 50 kDa GSDMC-2/-3; GSDMC-2/-3 CL p30: N- terminal 30 kDa cleaved protein; GSDMD FL p50: full length 50 kDa GSDMD; GSDMD CL p30: N-terminal 30 kDa cleaved protein; CASP- 8 FL: full length CASP-8; CASP-8 p18: 18 kDa cleavage fragment.
  • FIG.10B shows the expression (defined by normalized transcript counts; Transcripts Per Kilobase Million [TPM] for PROTECT cohort and Reads Per Kilobase Million [RPKM] for RISK cohort) of the indicated genes was assessed in bulk RNA-seq data from the PROTECT (pediatric UC) and RISK (pediatric ileal CD) cohorts and comparisons made between control patients, uninflamed IBD and inflamed IBD patients. P-values are based on non-parametric t-testing between assessed groups (Wilcoxon test).
  • FIGs.11A-11D shows how IFN- ⁇ inhibits epithelial proliferation and survival in intestinal organoids in vitro.
  • FIG.11A shows that human duodenoids were seeded and treated (rIFN- ⁇ ), or not (Veh) with 200ng/ml of human IFN- ⁇ 2 for 72h. Cell viability was measured with CellTiter- Blue. Percentage of live organoids in rIFN- ⁇ treated wells compared to Veh is depicted.
  • FIG. 11B shows that mouse small intestinal organoids were grown for 6 days and then treated with mouse recombinant IFN- ⁇ 2 (rIFN- ⁇ ) at the indicated concentrations. Lgr5 relative mRNA expression is depicted.
  • FIG.11C shows that human duodenoids were seeded and treated with 200ng/ml of IFN- ⁇ 2 for 72 hours. Organoids were pulsed with EdU for 6 hours.
  • FIG.11D shows that colon organoids derived from WT or Zbp1 -/- mice were seeded and treated with 200ng/ml of rIFN- ⁇ and imaged at 24 hours, 48 hours and 72 hours. The number of formed organoids is depicted.
  • FIG.11C depicts box plots. Each dot represents a biological replicate. Median, range and interquartile range are depicted.
  • FIG. 11D depicts a scatter box with bars. Each dot represents a biological replicate. Mean and SEM are depicted.
  • FIG.11C shows the statistics of the unpaired t-test.
  • FIGs.12A-12C show the experimental design (FIG.12A) immunofluorescent staining (FIG. 12B) and quantification of immunofluorescence (FIG.12C) of small intestine organoids isolated from WT, Ripk1D138N mutant (kinase dead), Ripk3 KO, Ripk3/Caspase 8 dKO.
  • FIGs.13A-13C show the experimental design (FIG.13A) immunofluorescent staining (FIG. 13B) and quantification of immunofluorescence (FIG.13C) of colon organoids isolated from WT or Zbp1 ⁇ Z ⁇ / ⁇ Z ⁇ 2 .
  • FIGS.14A-14C show IFN- ⁇ delays tissue repair during colitis.
  • FIGs.14A-14 show mice of indicated genotypes were administered 2.5 % DSS in the drinking water for seven days. DSS was withdrawn on day 7 and mice were followed over time up to 12 days.
  • FIG.14A shows the weight change relative to baseline (left) and colon length (right) of Ifnlr1 fl/fl or Vil CRE Ifnlr1 fl/fl mice 10 days after start of DSS treatment are depicted.
  • FIGs.14B-14C show colon lengths (FIG. 14B) and histology (FIG.14C) were assessed on days 8, 10, and 12 after start of DSS treatment in Ifnlr1 fl/fl or Vil CRE Ifnlr1 fl/fl mice.
  • FIG.15 shows IFN- ⁇ acts on IECs and delays tissue repair upon irradiation.
  • FIGs.16A-16G show IFN- ⁇ controls the expression of Z-DNA Binding Protein 1 (ZBP1) and the activation of Gasdermin C (GSDMC) upon irradiation damage or during colitis.
  • FIGs.16A-16B show plasmid DNA encoding full length human GSDMC (hGSDMC FL) or the N-terminal domain of human GSDMC (hGSDMC NT) was transfected in HEK293T cells at the indicated concentrations.
  • FIG.16A depicts the cell viability (left) and LDH release (right) were quantified 24 hours after transfection.
  • FIG.16B shows the plasma membrane integrity was assessed by monitoring Sytox Orange incorporation over time.
  • FIGs.16C-16D show small intestinal crypts were isolated from Vil CRE Ifnlr1 fl/fl mice or WT mice irradiated (Irrad +) or not (Irrad -).
  • FIG.16C shows immunoblot analysis of the indicated proteins was performed.
  • GSDMC-2/-3 FL p50 full length protein 50 kDa
  • GSDMC-2/-3 CL p30 N-terminal p30 cleaved protein
  • GSDMD FL p50 full length protein 50 kDa
  • GSDMD CL p30 N-terminal 30kDa cleaved protein
  • CL-CASP-8 p18 18 kDa cleaved protein.
  • FIG.16D show graphs that indicate the densitometry quantification of the band intensity from the image depicted in (FIG.16C) and each dot represents one lane.
  • FIG.16E and 16G show colonocytes were isolated on day 10 (FIG.16E) or days 8, 10, and 12 (FIG.12G) from Vil CRE Ifnlr1 fl/fl mice or WT mice treated with DSS as in FIG.14A (DSS +) or not (DSS -). Immunoblot analysis of the indicated proteins was performed.
  • FIG.16F are e graphs indicating the densitometry quantification of the band intensity from the image depicted in (FIG.16E) and each dot represents one mouse.
  • FIG.16A-16B shoe the mean and SEM of 3 independent experiments. In FIGs.16C-16F each lane represents one mouse. Representative data of 3 independent experiments is depicted.
  • FIG.16A used a one way ANOVA with Dunnett correction for multiple comparisons (FIG.16B) area under curve (AUC) was calculated for each treatment and One way ANOVA with Dunnett correction for multiple comparisons was performed on AUC values and variance.
  • FIGs.17A-17B show the ZBP-1/Casp-8/GSDMC pathway is active in IBD patients.
  • FIG.17A shows western blot analyses of the indicated proteins were performed on cell lysates of human colon biopsies derived from ascending or transverse colons of healthy controls (HC), or of Crohn’s disease (CD) or ulcerative colitis (UC) patients.3 representative samples per group are shown.
  • FIG.17B shows the box plots indicate the densitometry quantification of the band intensity from western blot analyses images for 7 HC and 8 CD or UC patients. Each dot represents one sample. Median, range and interquartile range are depicted.
  • FIG.18A-18F show IFN- ⁇ drives pyroptosis of IECs.
  • FIG.18A shows small intestinal organoids were treated as in (FIG.6A) for 24, 48 and 72 hours. Immunoblot analysis of the indicated proteins was performed.
  • GSDMC-2/-3 FL p50 full length protein 50kDa
  • GSDMC-2/- 3 CL p30 N-terminal p30 cleaved protein
  • CL-CASP-8 p43/41 43 and 41 kDa cleaved protein
  • CL-CASP-8 p18 18 kDa cleaved protein.
  • FIG.18B depicts the experimental scheme for the establishment of 2D Air Liquid Interface (ALI) organoid cultures and modeling of damage and repair responses.
  • Organoids were seeded in transwells and grown to confluence. The apical side was then exposed to air up to 14 days, which favored differentiation of a homeostatic monolayer (Homeostasis). Organoids were then submerged for 7 days to induce damage responses (Re-sub/Damage). After 7 days they were re- exposed to air to stimulate repair responses (Repair). Organoids were then treated at different steps of the culture with 200ng/ml of rIFN- ⁇ for 3 days.
  • ALI 2D Air Liquid Interface
  • FIGs.18C and 18F show organoids treated during Re-sub/Damage (FIG.18C, FIG.18D) or Repair (FIG.18E, 18F) as described in (FIG.18B) were pulsed with Zombie dye for 30 minutes to mark dead cells and stained for Ki67 to mark proliferating cells), CL-Casp-8 and DAPI. Representative image of 3 independent experiments.
  • FIGs.18D and 18F show the quantification of the staining depicted in (FIGs. 18Cand 18E) respectively.
  • FIGs.18D and 18F show (the mean and SEM of 3 independent experiments are depicted.
  • FIGs.18D and 18F are scatter plots. Each square represents an independent experiment.
  • FIGs.19A-19J show the ZBP-1/Casp-8/GSDMC axis mediates IEC pyroptosis in response to damage and IFN- ⁇ encounter.
  • FIG.19A-19B show organoids transduced with non-targeting gRNA (NT) or a gRNA targeting Zbp1 (Zbp1 KD ) were seeded in transwells and grown to confluence.
  • NT non-targeting gRNA
  • Zbp1 KD gRNA targeting Zbp1
  • FIG.19A shows the quantification of Zombie-positive cells (left) and CL-Casp-8-positive cells (right) are depicted.
  • FIG.19B shows representative images of 3 independent experiments are depicted.
  • FIG.19C shows small intestine NT or Zbp1 KD organoids that were seeded and allowed to grow for 48 hours.
  • Organoids were then treated with 200ng/ml of rIFN- ⁇ in the presence of 1 ⁇ g/ml propidium iodide (PI) and imaged every 12 hours over 48 hours. Percentage of live organoids was calculated as percentage of PI- organoids over the total number of organoids in each well.
  • FIG.19D-19G show organoids were treated with 200ng/ml of rIFN- ⁇ or left untreated (Veh) either during Re-sub (FIGs.19D and 19E) or during Repair (FIGs.19F and 19G) with rIFN- ⁇ as described in (FIG.18B). Additionally, organoids were treated with 40 ⁇ M of Z-VAD-FMK (Z-VAD) or left untreated (NT) as indicated.
  • Z-VAD Z-VAD
  • NT left untreated
  • FIGs.19D and 19F show the quantification of Zombie-positive cells (left), CL-Casp-8- positive cells (middle l, only FIG.19D), and Ki67-positive cells (right) are depicted.
  • FIG.19E and 19G are representative images of 3 independent experiments are depicted.
  • FIGs.19H and 19I showCas9 expressing organoids transduced with non-targeting gRNA (NT) or gRNAs targeting Gsdmc 2 and 3 (Gsdmc2,3 KD ) were treated during Re-sub as described in (FIG.19A), pulsed with Zombie dye for 30 minutes then stained with CL-Casp-8 and DAPI.
  • FIG.19H shows the quantification of Zombie-positive cells (left) and CL-Casp-8-positive cells (right).
  • FIG.19I shows representative images of 3 independent experiments are depicted.
  • FIG.19J shows NT or Gsdmc2,3 KD organoids were treated as in (FIG.19C) and percentage of live organoids over time is depicted.
  • the scale bars in FIGs.19B, 19E, 19G, and 19I are 20 ⁇ m.
  • FIGs.20A-20E show IFN- ⁇ delays tissue repair during colitis.
  • FIGs.20A-20E show mice of the indicated genotypes were administered 2.5 % DSS in the drinking water for seven days. DSS was withdrawn on day 7 and mice were followed over time up to 12 days.
  • FIG.20A shows the weight change relative to baseline (left) and colon length (right) of Ifnlr1 fl/fl or MRP8 CRE Ifnlr1 fl/fl mice 10 days after start of DSS treatment are depicted.
  • FIG.20D shows the weight change from baseline was assessed over time in Vil CRE Ifnlr1 fl/fl or Ifnlr1 fl/fl littermates.
  • FIG.20D are the colon histology scores at days 8, 10, and 12 after start of DSS treatment are depicted.
  • FIGs.21A-21C show IFN- ⁇ acts on IECs and delays tissue repair upon irradiation.
  • FIG.21A show WT mice received 11 Gy ionizing radiation, with lead shielding of the upper body, relative mRNA levels of Ifnl2 and Ifnl3 were measured in total colon homogenates.
  • FIG.21A-21C show WT or Ifnlr1 -/- mice received 11 Gy ionizing radiation with lead shielding of the upper body and were treated with either 50 ⁇ g kg -1 day -1 of rIFN- ⁇ (rIFN- ⁇ ), or saline vehicle (Veh). Tissue repair in the small intestine was evaluated by histology 48 hours and 96 hours after irradiation.
  • FIG.21B shows the number of intact crypts per histological section (Crypts/section).
  • FIG.21C shoes the representative histology images.
  • FIG.21A is a scatter plot.
  • FIG.21B shoes the mean with SEM.
  • FIGs.21A and 21D used a one-way ANOVA with Dunnett correction for multiple comparisons.
  • FIG.21B used a two-way ANOVA with ⁇ idak correction for multiple comparisons.
  • FIGs.22A-22E show IFN- ⁇ controls the expression of Z-DNA Binding Protein 1 (ZBP1) and the activation of Gasdermin C (GSDMC) upon irradiation damage or during colitis.
  • FIG.22A is the immunoblot analysis of the indicated organs from two WT mice for GSDMC expression was performed.
  • FIG.22B shows Gsmdc1-4 mRNA expression was analyzed by qPCR in organs isolated from WT mice.
  • FIG.22C shows the immunoblot analysis of GSDMC expression in colonic cell populations (intestinal epithelial cell (IEC) and lamina intestinal (LP) cells) isolated from WT mice at homeostasis. Each lane represents one mouse.
  • FIG.22D shows HEK293T cells were transfected with the pRetroX TetOne3G-eGFP plasmid harboring Flag-tagged N- terminal fragment of human GSDMC (hGSDMC NT) and treated or not with the indicated concentrations of doxycycline (DOX). Immunoblot analysis of Flag tag expression was performed and cell viability as well as LDH release were determined 24 hours post DOX treatment.
  • FIG.22E shows WT mice were treated with DSS for 7 days at the indicated concentrations. DSS was withdrawn on day 7. Colonocytes were isolated 8 days after start of DSS treatment. Immunoblot analysis of the indicated proteins was performed (upper panel). GSDMC-2/-3 FL p50: full length 50 kDa; GSDMC-2/-3 CL p30: p30 cleaved GSDMC-2/-3. Densitometry quantification of the band intensity from the image. Each lane represents one mouse.
  • FIG.22B shows the mean and SD from one of two independent experiments are depicted.
  • FIG.22D is the mean and SD of two independent experiments performed in triplicate are depicted.
  • FIG.22E show scatter plots are depicted. Each dot represents one mouse.
  • Statistics: FIG.22D and 22E used One-way ANOVA with Dunnett correction for multiple comparisons. ns not significant (p > 0.05); *p ⁇ 0.05; **p ⁇ 0.01; ***p ⁇ 0.001; ****p ⁇ 0.0001.
  • FIGs.23A-23I show the ZBP-1/Casp-8/GSDMC pathway is active in IBD patients.
  • FIG.23 shows the expression (defined by normalized transcript counts; Reads Per Kilobase Million [RPKM]) of GSDMC (FIG.23A), ZBP1 (FIG.23B), and CASP8 (FIG.23C) from published RNAseq data for the PROTECT (pediatric UC) cohort.
  • FIGs.23D-23F show expression (defined by Transcripts Per Kilobase Million [TPM]) of GSDMC (FIG.23D), ZBP1 (FIG.23E), and CASP8 (FIG.23F) from published RNAseq data RISK (pediatric ileal CD) cohort.
  • FIG.23 shows the expression (defined by normalized transcript counts; Reads Per Kilobase Million [RPKM]) of GSDMC (FIG.23A), ZBP1 (FIG.23B), and CASP8 (FIG.23C) from published RNAseq data for the PROTECT (pediatric UC) cohort.
  • FIGs.23D-23F show expression (
  • FIGs.23G-23I show RNA sequencing on colon biopsies from control patients, IBD patients with inactive disease, and IBD patients with active disease (see Materials and Methods). Square symbols represent controls, round symbols represent ulcerative colitis (UC) patients, and triangles represent Crohn’s disease patients (CD). Expression of GSDMC (FIG.23G), ZBP1 (FIG.23H), CASP8 (FIG.23I) expressed as normalized log2 count is depicted.
  • FIGs.23A-23F are violin plots
  • FIGs.23G-23I are box plots with median, range, and interquartile range are depicted. In FIGs.23A-23I each symbol represents one patient.
  • FIG.24A-24D show IFN- ⁇ drives pyroptosis of IECs.
  • FIG.24A-24B show mouse small intestinal organoids were seeded from freshly isolated crypts and allowed to grow for 48h. Organoids were then treated with 20ng/ml or 200ng/ml of rIFN- ⁇ .
  • FIG.24A depicts an immunoblot analysis of the indicated proteins was performed.
  • FIG.24B Organoids were cultured in the presence of 1 ⁇ g/ml propidium iodide (PI) and imaged every 12 hours over 72 hours. Percentage of live organoids was calculated as the percentage of PI- organoids over the total number of live organoids in each well.
  • FIG.24C shows mouse organoids seeded in transwells and grown to confluence as in FIG. 18B. The apical side was then exposed to air up to 14 days and treated with 200ng/ml of rIFN- ⁇ for 3 days. Organoids were pulsed with Zombie dye for 30 minutes, and stained with Ki67, CL- Casp-8 and DAPI.
  • PI propidium iodide
  • FIG.24I shows mouse organoids seeded in transwells and grown to confluence were treated during re-submersion with 200ng/ml of rIFN- ⁇ or rIFN ⁇ for 3 days. Organoids were pulsed with Zombie dye for 30 minutes, and stained with Ki67, CL-Casp-8 and DAPI. Representative image of 3 independent experiments and quantification of the different stainings are depicted.
  • FIGs.24C-24D are scatter plots with bars. Each dot or square represents an independent experiment. Mean and SEM are depicted. Statistics: FIGs.24C-24D used two- way ANOVA with ⁇ idak correction for multiple comparisons.
  • FIGs.25A-25H show the ZBP-1/Casp-8/GSDMC axis mediates IEC pyroptosis in response to damage and IFN- ⁇ encounter.
  • FIG.25A shows Cas9 expressing organoids transduced with non- targeting gRNA (NT) or a gRNA targeting Zbp1 (Zbp1 KD ) were grown for 6 days and then treated with 200ng/ml of rIFN- ⁇ for 48 hours. Immunoblot analysis of the indicated proteins was performed.
  • FIGs.25B-25C shows small intestine organoids were seeded in transwells and grown to confluence. Organoids were treated concomitantly to re-exposure to air either with 200ng/ml of rIFN- ⁇ alone (rIFN- ⁇ ) or with rIFN- ⁇ together with Z-IETD. Organoids were pulsed with Zombie dye for 30 minutes, and stained with Ki67, CL-Casp-8 and DAPI. Representative images of 3 independent experiments (FIG.25B) and quantification of the different stainings are depicted (FIG.25C).
  • FIGs.25D-25G show small intestine organoids were seeded from freshly isolated crypts from WT (FIGs.25D, 25E, 25G) or WT and Mlkl -/- (FIG.25F) mice and allowed to grow for 48 hours. Organoids were then treated with 200ng/ml of rIFN- ⁇ .
  • FIGs.25D, 25E, and 25G show treatment with rIFN- ⁇ was performed together with the pan-caspase inhibitor Z-VAD-FMK (Z-VAD; 40uM) (FIG.25D), the caspase-8 specific inhibitor Z-IETD-FMK (Z-IETD; 40uM) (FIG.25E), or the inhibitor of gasdermin D pore formation Disulfiram (10 ⁇ M or 50 ⁇ M) (FIG.25G).
  • FIGs.25D-25G show organoids were grown in the presence of 1 ⁇ g/ml propidium iodide (PI) and imaged every 12 hours over 72 hours. Percentage of live organoids was calculated as percentage of PI- organoids over the total number of organoids in each well.
  • PI propidium iodide
  • FIG.25H shows the immunoblot analysis of the indicated proteins was performed on extracts from Cas9 expressing organoids transduced with non- targeting gRNA (NT) or 2 gRNAs targeting both Gsdmc2,3 (Gsdmc2,3 KD ), or non-transduced (-) organoids.
  • FIGs.25D-25F used two-way ANOVA with Tukey correction for multiple comparisons.
  • FIGs.25C, 25D, 25E, and 25G used Two-way ANOVA with ⁇ dak correction for multiple comparisons.
  • ns not significant (p > 0.05); * p ⁇ 0.05; ** or $$ p ⁇ 0.01; *** p ⁇ 0.001; **** p ⁇ 0.0001.
  • the scale bars in FIG.25B are 20 ⁇ m.
  • interferon signaling specifically that of interferon lambda (IFNL, IFN- ⁇ ), also referred to as type III interferon, not only mediates inflammation in intestinal epithelia during inflammatory diseases, but also impairs tissue repair by upregulating a variety of key factors that promote cell death by pyroptosis and necroptosis.
  • IFNL interferon lambda
  • IFN- ⁇ interferon lambda
  • IBDs inflammatory bowel diseases
  • CD Crohn’s disease
  • UC ulcerative colitis
  • IFNL Interferon Lambda
  • IFNL-1 interleukin 29 (IL-29)
  • IFNL-2 interleukin 28A (IL-28A)
  • IFNL-3 interleukin 28B (IL-28B); interleukin 28C (IL-28C)
  • IFNAN Interferon Lambda
  • an IFNL protein contemplated herein is IFNL-1 (NCBI Reference Sequence: NP_742152.1; Gene ID: 282618).
  • an IFNL protein contemplated herein is IFNL-2 (NCBI Reference Sequence: NP_742150.1; Gene ID: 282616).
  • an IFNL protein contemplated herein is IFNL-3 (NCBI Reference Sequence: NP_742151.2; NCBI Reference Sequence: NP_001333866.1; Gene ID: 282617).
  • an IFNL protein contemplated herein is IFNL-4 (NCBI Reference Sequence: NP_001263183.2; Gene ID: 101180976).
  • an IFNL protein contemplated herein is an IFNL protein (e.g., IFNL-1, IFNL-2, IFNL-3, or IFNL-4) that is endogenously expressed by a subject, e.g., a subject having an inflammatory disease, such as an IBD (e.g., CD, UC).
  • an IFNL protein contemplated herein is an IFNL protein (e.g., IFNL-1, IFNL-2, IFNL-3, or IFNL-4) that is endogenously expressed by a human subject.
  • an IFNL protein contemplated herein is an IFNL protein endogenously expressed by a non-human subject, such as a non-human mammal, which is homologous to human IFNL (e.g., IFNL-1, IFNL-2, IFNL-3, IFNL-4).
  • IFNL interferon lambda receptor 1
  • CRF2/12 interferon lambda receptor
  • IFNLR interleukin 28 receptor 1
  • IL28RA interleukin 28 receptor A
  • an IFNLR protein contemplated herein is IFNLR1 (NCBI Reference Sequence: NP_734464.1; NCBI Reference Sequence: NP_775087.1; NCBI Reference Sequence: NP_775088.1; Gene ID: 163702).
  • an IFNLR protein contemplated herein is an IFNLR protein (e.g., IFNLR1) that is endogenously expressed by a subject, e.g., a subject having an inflammatory disease, such as an IBD (e.g., CD, UC).
  • an IFNLR protein contemplated herein is an IFNLR protein (e.g., IFNLR1) that is endogenously expressed by a human subject.
  • an IFNLR protein contemplated herein is an IFNLR protein endogenously expressed by a non-human subject, such as a non-human mammal, which is homologous to human IFNLR (e.g., IFNLR1).
  • IFNLR human IFNLR
  • recent studies have proposed various and at times conflicting activities for IFNL signaling in regard to intestinal epithelial damage. Initially, IFNL was demonstrated to limit inflammation during colitis by reducing the tissue damaging activity of neutrophils (see, e.g., Broggi A, et al., “IFN- ⁇ suppresses intestinal inflammation by non-translational regulation of neutrophil function.” Nat Immunol.2017; 18(10):1084-1093).
  • IFNL receptor IFNLR
  • type I interferons such as interferon alpha (IFNA, IFN- ⁇ ) which act systemically and drive inflammatory activities.
  • IFNL has been proposed to facilitate the proliferation of intestinal epithelial cells via signal transducer and activator of transcription 1 (STAT1) signaling (see, e.g., Chiriac MT, et al.
  • Paneth cells a group of cells that can facilitate epithelial cell regeneration by acquiring stem-like features (Schmitt M, et al., “Paneth Cells Respond to Inflammation and Contribute to Tissue Regeneration by Acquiring Stem-like Features through SCF/c-Kit Signaling.” Cell Rep.2018; 24(9):2312-2328), and by regulating the balance of epithelial growth factors in the stem cell niche (Sato T, et al. “Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts.” Nature.2011; 469(7330):415-8).
  • IFNL has a similar role in intestinal epithelial cells during inflammatory disease states, especially in the context of non-viral inflammatory diseases.
  • IFNL acts through a previously undiscovered signaling axis, wherein activation of IFNLR by IFNL on the surface of inflamed epithelial cells culminates in activation of Z-DNA binding protein 1 (ZBP1) and factors involved in activity of the PANoptosome, a multi-subunit complex that promotes apoptosis, pyroptosis, and/or necroptosis pathways (“PANoptosis”) in intestinal epithelial cells.
  • ZBP1 Z-DNA binding protein 1
  • IFNLR activation of IFNLR was specifically demonstrated to stimulate caspase-8-dependent cleavage of gasdermin C (GSDMC), thereby inducing pyroptosis of intestinal epithelial cells and delaying restitution of intestinal epithelia following tissue damage.
  • Interferon stimulated genes include Z-DNA-binding protein 1 (ZBP1), Viperin (RSAD2), and gasdermin C family (e.g., Gsdmc2 and Gsdmc3).
  • ZBP1 comprises a z-nucleic acid binding site.
  • IFNL intestinal inflammatory diseases
  • IBD intestinal inflammatory diseases
  • various agents are contemplated herein which are of use for reducing the activity of the IFNL signaling axis in intestinal epithelial cells. Said agents may interfere with IFNL signaling by inhibiting the function of IFNL and/or IFNLR directly or may interfere with IFNL signaling by inhibiting downstream components of IFNL signaling, such as, but not limited to, factors involved with the activation of PANoptosis.
  • Methods of administering these agents to subjects having intestinal inflammatory diseases may be utilized to treat intestinal inflammatory diseases by reducing inflammation and cell death caused by IFNL signaling, while promoting the repair of damaged tissues.
  • Administration of Agents for Inhibiting IFNL Signaling The present disclosure provides methods for the administration of an agent that is sufficient to inhibit interferon lambda (IFNL) signaling in intestinal epithelial cells, or a composition thereof (e.g., a pharmaceutical composition), to a subject.
  • IFNL interferon lambda
  • a method for treating or preventing a disease in a subject by administering an agent that is sufficient to inhibit interferon lambda (IFNL) signaling in intestinal epithelial cells, or a composition thereof (e.g., a pharmaceutical composition), to a subject.
  • IFNL interferon lambda
  • a therapeutically effective amount of the agent is administered to the subject such that the method results in the treatment or prevention of a disease in the subject.
  • the disease is an inflammatory disease present in intestinal epithelia of the subject, such as, but not limited to, an inflammatory bowel disease (IBD), such as Crohn’s disease (CD) or ulcerative colitis (UC).
  • IBD inflammatory bowel disease
  • CD Crohn’s disease
  • UC ulcerative colitis
  • the disease is another inflammatory disease affecting the intestinal epithelia that is generally known in the art, such as an autoimmune disease or another disease that has been associated with pathogenic inflammation, such as irritable bowel syndrome (IBS).
  • IBS irritable bowel syndrome
  • the terms “administer,” “administering,” or “administration” refer to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing an agent described herein, or a composition thereof (e.g., a pharmaceutical composition), in or on a subject.
  • treatment refers to the application or administration of an agent described herein, or a composition thereof (e.g., a pharmaceutical composition), to a subject in need thereof for the purpose of reducing the severity of a disease (e.g., IBD) in the subject.
  • a composition thereof e.g., a pharmaceutical composition
  • a “subject in need thereof” refers to an individual that has a disease, a symptom of the disease, or a predisposition toward the disease.
  • a method for treating a disease may encompass administering to a subject an agent described herein, or a composition thereof (e.g., a pharmaceutical composition) with the intention to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, a symptom of the disease, or predisposition toward the disease in the subject.
  • a method for treating a disease may encompass prophylaxis, wherein an agent is administered to the subject for the purpose of preventing development of the disease, for example, in a subject that is not known to have the disease, but may develop or be at risk of developing the disease in the future.
  • a “therapeutically effective amount” or “effective amount” refers to the amount of an agent (e.g., an agent described herein) that is sufficient to elicit the desired biological response in the subject, for example, alleviating one or more symptoms of the disease (e.g., IBD).
  • a therapeutically effective amount may be an amount that is either administered to the subject alone or in combination with one or more other agents.
  • Effective amounts vary, as recognized by those skilled in the art, depending on such factors as the desired biological endpoint, the pharmacokinetics of the administered agent, the particular condition or disease being treated, the severity of the condition or disease, the individual parameters of the subject, including age, physical condition, size, gender and weight, the duration of the treatment, the nature of any other concurrent therapy, the specific route of administration, and like factors that are within the knowledge and expertise of the health practitioner to determine. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual agents described herein (e.g., an agent described herein) or any combinations thereof to be used is at most the highest dose that can be safely administered to the subject according to sound medical judgment.
  • an effective dose is lower than the highest dose that can be safely administered to the subject. It will be understood by those of ordinary skill in the art, however, that a subject or health practitioner may select a lower dose (e.g., the minimum effective dose) in order to mitigate any potential risks of treatment, such as side effects of the treatment.
  • doses ranging from about 0.01 to 1000 mg/kg of an agent (e.g., an agent described herein) may be administered. In some embodiments, the dose is between 1 to 200 mg.
  • Treating a disease may include delaying the development or progression of the disease or reducing disease severity. Treating the disease does not necessarily require curative results.
  • "delaying" the development of a disease means to defer, hinder, slow, retard, stabilize, and/or postpone progression of the disease in a subject.
  • Delaying the progression of a disease may include delaying or preventing the spread of a disease occurring in a subject, such as, for example, delaying or preventing the spread of an IBD occurring in a subject to intestinal epithelial tissues not yet affected by the IBD. This delay can be of varying lengths of time, depending on the history of the disease and/or individuals being treated.
  • a method that delays the development of a disease, or delays the onset of the disease is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and/or reduces extent of the symptoms in a given time frame, as compared to the absence of such a method. Comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.
  • development refers to initial manifestations and/or ensuing progression of the disease in a subject. Development of a disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression may refer to the development or progression of symptoms of a disease.
  • development includes the occurrence, recurrence, and onset of a disease. As used herein “onset” or “occurrence” of a disease includes the initial onset of a disease, as well as recurrence of the disease (i.e., in a subject who has had the disease previously).
  • the agent with which a subject is treated comprises an antibody, a small molecule, a nucleic acid, or a gene editing agent.
  • the agent is an antibody (e.g., a monoclonal antibody) that binds to IFNL or IFNLR.
  • the antibody preferentially binds to IFNL or IFNLR (i.e., the antibody may also bind to other species, such as another interferon or interferon receptor, but with lower affinity as compared to IFNL or IFNLR).
  • the antibody specifically binds to IFNL or IFNLR.
  • the antibody binds to IFNL or IFNLR on the cell surface of intestinal epithelial cells of the subject. In some embodiments, binding of the antibody to IFNL or IFNLR (e.g., on the surface of intestinal epithelial cells of the subject) results in inhibition of IFNL or IFNLR (e.g., in intestinal epithelial cells of the subject).
  • binding between the antibody and IFNL or IFNLR results in inhibition of the activity of IFNL or IFNLR (e.g., IFNL signaling activity) in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the agent is a small molecule (e.g., a small molecule inhibitor) that binds to interferon lambda receptor (IFNLR).
  • the small molecule preferentially binds to IFNLR (i.e., the small molecule may also bind to other species, such as another interferon receptor, but with lower affinity as compared to IFNLR). In some embodiments, the small molecule specifically binds to IFNLR. In some embodiments, the small molecule binds to IFNLR on the cell surface of intestinal epithelial cells of the subject.
  • binding between the small molecule and IFNLR results in inhibition of the activity of IFNLR (e.g., IFNL signaling activity) in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the agent is a small molecule that binds to a Janus kinase (JAK) protein that is bound to interferon lambda receptor (IFNLR) on the cell surface of intestinal epithelial cells of the subject.
  • JK Janus kinase
  • IFNLR interferon lambda receptor
  • JAK proteins such as Janus kinase 2 (JAK2) propagate IFNL signaling that results from binding between IFNL and IFNLR on the cell surface, resulting in inflammation and cell death.
  • the JAK protein is JAK2.
  • the JAK protein does not bind to other interferon receptors.
  • the small molecule does not bind to a JAK protein that is bound to interferon alpha receptor (IFNAR) on the cell surface of intestinal epithelial cells of the subject.
  • IFNAR interferon alpha receptor
  • the small molecule inhibits the activity of the JAK protein (e.g., JAK2) in intestinal epithelial cells of the subject.
  • binding between the small molecule and the JAK protein (e.g., JAK2) bound to IFNLR on the cell surface of intestinal epithelia of the subject results in inhibition of the activity of the JAK protein (e.g., IFNL signaling activity) in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the agent is a small molecule inhibits caspase activity in the subject.
  • the caspase inhibitor is a pan-caspase inhibitor.
  • the pan-caspase inhibitor is Z-VAD-FMK.
  • the caspase inhibitor is a caspase 8 (Casp-8) inhibitor.
  • the Casp-8 inhibitor is Z- IETD-FMK.
  • administering the caspase inhibitor to the subject results in inhibition of caspase activity (e.g., IFNL-dependent caspase-8 activation that drives cell death) in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the small molecule binds to a factor (e.g., a protein) of PANoptosis signaling in intestinal epithelial cells of the subject.
  • a factor e.g., a protein
  • activation of IFNL signaling in the context of an inflammatory intestinal epithelial disease can result in subsequent activation of factors comprising the PANoptosome, a multi- subunit complex that promotes apoptosis, pyroptosis, and/or necroptosis pathways in intestinal epithelial cells.
  • a factor of PANoptosis signaling may be any factor that is known to be involved in signaling for apoptosis, pyroptosis, and/or necroptosis.
  • a factor of PANoptosis signaling may be involved in a specific cell death signaling pathway.
  • a factor of PANoptosis signaling specifically involved in necroptosis may be mixed lineage kinase domain-like pseudokinase (MLKL), dynamin-related protein 1 (Drp1), or PGAM family member 5 (PGAM-5), while a factor of PANoptosis signaling specifically involved pyroptosis may be caspase-1 or Gasdermin D.
  • MLKL lineage kinase domain-like pseudokinase
  • Drp1 dynamin-related protein 1
  • PGAM-5 PGAM family member 5
  • the factor of PANoptosis signaling is Z-DNA-binding protein 1 (ZBP1), receptor-interacting serine/threonine-protein kinase 1 (RIPK1), receptor-interacting serine/threonine-protein kinase 3 (RIPK3), Fas associated via death domain (FADD), mixed lineage kinase domain-like pseudokinase (MLKL), dynamin- related protein 1 (Drp1), PGAM family member 5 (PGAM-5), a caspase protein, or a gasdermin protein.
  • the caspase protein is caspase-8, caspase-3, caspase-7, or caspase-1.
  • the gasdermin protein is Gasdermin C or Gasdermin D.
  • a small molecule inhibiting a factor of PANoptosis signaling is generally known in the relevant art.
  • the factor of PANoptosis signaling is RIPK1 and the small molecule is necrostatin.
  • binding between the small molecule and the factor of PANoptosis signaling results in inhibition of the activity of the factor of PANoptosis signaling (e.g., IFNL signaling activity) in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the nucleic acid is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).
  • the nucleic acid inhibits the expression (e.g., protein expression) of IFNLR, a JAK protein, or a factor of PANoptosis signaling in intestinal epithelial cells of the subject.
  • the JAK protein is JAK2.
  • the factor of PANoptosis signaling is Z-DNA-binding protein 1 (ZBP1), receptor- interacting serine/threonine-protein kinase 1 (RIPK1), receptor-interacting serine/threonine- protein kinase 3 (RIPK3), Fas associated via death domain (FADD), mixed lineage kinase domain-like pseudokinase (MLKL), dynamin-related protein 1 (Drp1), PGAM family member 5 (PGAM-5), a caspase protein, or a gasdermin protein.
  • the caspase protein is caspase-8, caspase-3, caspase-7, or caspase 1.
  • the gasdermin protein is Gasdermin C or Gasdermin D.
  • the nucleic acid inhibits the expression of IFNLR, the JAK protein, or the factor of PANoptosis signaling in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the gene editing agent comprises a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeat (CRISPR)–Cas-associated nuclease (CRISPR/CAS), or another gene editing agent that is generally known in the relevant art.
  • the gene editing agent comprises CRISPR/CAS
  • the gene editing agent further comprises a short guide RNA (sgRNA) that is complementary to a gene encoding interferon lambda receptor (IFNLR), a Janus kinase (JAK) protein, or a factor of PANoptosis signaling in intestinal epithelial cells of the subject.
  • the gene editing agent binds to and modifies (e.g., via endonuclease activity) a gene encoding interferon lambda receptor (IFNLR), a Janus kinase (JAK) protein, or a factor of PANoptosis signaling in intestinal epithelial cells of the subject.
  • IFNLR interferon lambda receptor
  • JAK Janus kinase
  • the JAK protein is JAK2.
  • the factor of PANoptosis signaling is Z-DNA-binding protein 1 (ZBP1), receptor-interacting serine/threonine-protein kinase 1 (RIPK1), receptor-interacting serine/threonine-protein kinase 3 (RIPK3), Fas associated via death domain (FADD), mixed lineage kinase domain-like pseudokinase (MLKL), dynamin- related protein 1 (Drp1), PGAM family member 5 (PGAM-5), a caspase protein, or a gasdermin protein.
  • the caspase protein is caspase-8, caspase-3, caspase-7, or caspase 1.
  • the gasdermin protein is Gasdermin C or Gasdermin D.
  • the gene editing agent reduces the expression of IFNLR, the JAK protein, or the factor of PANoptosis signaling in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • the agent e.g., an antibody, a small molecule, a nucleic acid, or a gene editing agent
  • administered to a subject for the purpose of treating an inflammatory disease affecting intestinal epithelia of the subject e.g., IBD
  • a delivery agent e.g., an antibody, a small molecule, a nucleic acid, or a gene editing agent
  • a “delivery agent” refers to any moiety that enhances the delivery of an agent (e.g., an antibody, a small molecule, a nucleic acid, or a gene editing agent) to a desired organ or tissue (e.g., intestinal epithelia), as compared delivery of the agent when administered alone.
  • the delivery agent is a peptide, an antibody, a liposome, or a viral particle, or another delivery agent known in the art that is generally suitable for intestinal delivery.
  • the delivery agent binds specifically to the cell surface of intestinal epithelial cells of the subject.
  • the agent and the delivery agent are covalently linked.
  • the agent and the delivery agent are linked by a cleavable linker, such as a protease-sensitive linker, a pH-sensitive linker, or a glutathione- sensitive linker, examples of which are well known in the relevant art. Additional examples of cleavable linkers are provided in Donaghy, mAbs.2016; 8(4):659-71, which is incorporated herein by reference.
  • the agent and the delivery agent are linked by a non- cleavable linker.
  • the delivery agent enhances delivery of the agent to intestinal epithelial cells of the subject, as compared to delivery of the agent to intestinal epithelial cells of the subject in the absence of the delivery agent.
  • the delivery agent enhances internalization (absorption) of the agent by intestinal epithelial cells of the subject, as compared to internalization (absorption) of the agent by intestinal epithelial cells of the subject in the absence of the delivery agent.
  • a method described herein for treating a subject having an inflammatory disease present in intestinal epithelia results in a reduction of inflammation in intestinal epithelial cells of the subject.
  • a method described herein results in a reduction of inflammation in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%.
  • a person of ordinary skill in the art is sufficiently capable of assessing inflammation in intestinal epithelial cells and may, for example, assess changes in the levels of inflammatory cytokines and/or chemokines present in intestinal epithelia of the subject.
  • a method described herein for treating a subject having an inflammatory disease present in intestinal epithelia results in a reduction of cell death in intestinal epithelial cells of the subject.
  • the cell death is cell death as a result of apoptosis, pyroptosis, and/or necroptosis.
  • a method described herein results in a reduction of cell death in intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%.
  • a person of ordinary skill in the art is sufficiently capable of assessing cell death occurring in intestinal epithelial cells and may, for example, assess changes in the cellular levels of factors associated with apoptosis, pyroptosis, and/or necroptosis signaling pathways.
  • a method described herein for treating a subject having an inflammatory disease present in intestinal epithelia results in increased proliferation of intestinal epithelial cells of the subject.
  • a method described herein results in an increase in proliferation of intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7- fold, at least 8-fold, at least 9-fold, or at least 10-fold or more.
  • a person of ordinary skill in the art is sufficiently capable of assessing the level of proliferation occurring in intestinal epithelial cells and may, for example, assess changes in the cellular levels of factors associated with proliferation signaling pathways (e.g., mitosis), or by assessing changes in the overall level of DNA synthesis.
  • a method described herein for treating a subject having an inflammatory disease present in intestinal epithelia results in enhanced tissue repair in intestinal epithelial cells of the subject.
  • a method described herein results in an enhancement in tissue repair of intestinal epithelial cells of the subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold or more.
  • a person of ordinary skill in the art is sufficiently capable of assessing the level of tissue repair occurring in intestinal epithelial cells and may, for example, assess changes in the cellular levels of factors associated with tissue repair.
  • a “subject” to which administration is contemplated herein may refer to a human (i.e., male or female of any age group, e.g., pediatric subject (e.g., infant, child, or adolescent) or adult subject (e.g., young adult, middle–aged adult, or senior adult)) or a non–human animal.
  • the subject is a human patient (e.g., a human patient known to have an IBD, e.g., Crohn’s disease (CD) or ulcerative colitis (UC)).
  • IBD Crohn’s disease
  • UC ulcerative colitis
  • the non-human animal is a mammal (e.g., rodent, e.g., mouse or rat), a primate (e.g., cynomolgus monkey or rhesus monkey), a commercially relevant mammal (e.g., cattle, pig, horse, sheep, goat, cat, or dog), or a bird (e.g., commercially relevant bird, such as chicken, duck, goose, or turkey).
  • the non-human animal may be a male or female at any stage of development and may be a juvenile animal or an adult animal.
  • the non-human animal may be a transgenic animal or genetically engineered animal.
  • the subject is a companion animal (e.g., a pet or service animal).
  • a companion animal refers to pets and other domestic animals.
  • companion animals include dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters.
  • the subject is a research animal.
  • research animals include rodents (e.g., rats, mice, guinea pigs, and hamsters), rabbits, or non-human primates.
  • an agent described herein or a composition thereof e.g., a pharmaceutical composition
  • an agent or composition thereof can be administered systemically (i.e., throughout the body) or locally (i.e., to one or more specific organs, tissues, or locations in the body).
  • the agent or composition thereof e.g., a pharmaceutical composition
  • parenteral includes intravenous, intramuscular, intraarticular, and intraarterial injection or infusion techniques.
  • the agent or composition thereof e.g., a pharmaceutical composition
  • the agent or composition thereof is administered orally.
  • the agent or composition thereof e.g., a pharmaceutical composition
  • the agent or composition thereof is administered rectally.
  • the agent or composition thereof is administered via intravenous injection or infusion.
  • the agent or composition thereof e.g., a pharmaceutical composition
  • the agent or composition thereof is administered is administered to intestinal epithelial cells of the subject, such as, for example, intestinal epithelial cells that are affected by an IBD.
  • the administration occurs more than once.
  • the administration occurs once per day, once per 2 days, once per 3 days, once per 4 days, once per 5 days, once per 6 days, once per week, once per 2 weeks, once per 3 weeks, once per month, once per 2 months, once per 3 months, once per 4 months, once per 6 months, once per 7 months, once per 8 months, once per 9 months, once per 10 months, once per 11 months, or once per year.
  • Example 1 Evaluation of Agents for Inhibiting IFNL signaling in Intestinal Epithelia
  • IFNL interferon lambda
  • inhibitors of IFNL signaling such as, for example monoclonal antibodies or small molecules that inhibit the activity of IFNL or IFNL receptor (IFNLR), or small molecules that inhibit downstream signaling by IFNL, such as, for example ZBP1, caspase-8, gasdermin C, and other factors that are functionally related to PANoptosis and activated as a result of IFNLR activation.
  • IFNLR IFNL receptor
  • inhibition could be achieved by RNA interference (e.g., shRNA or siRNA) or gene editing (e.g., via CRISPR/Cas) to reduce the expression of one or more of these factors in intestinal epithelia.
  • inhibitory agents may be validated using an in vitro intestinal organoid model using previously established methods with murine intestinal epithelial organoids and an air-liquid interface (ALI) (FIG.1A). Briefly, mouse small intestine organoids may be collected from freshly isolated intestinal crypts, seeded in transwells, and allowed to grow for 48 hours. Subsequent submersion of the air-exposed organoid monolayer mimics tissue damage. Organoids may be treated with recombinant IFNL prior to or following submersion in order to stimulate IFNL signaling in the monolayer. The ALI may then be reestablished, and the organoids optionally incubated with candidate agents for inhibiting IFNL signaling.
  • ALI air-liquid interface
  • treated monolayers may then be assessed through a variety of techniques known in the art (FIGs.1B and 1C). For example, cell survival may be assessed via fixable live/dead stain (i.e., Zombie dye), cell proliferation may be assessed by Ki67 staining, and IFNL signaling inhibition may be assessed by measuring the expression level or activity of factors involved in IFNL signaling (e.g., PANoptosome components). Alternately, this assay may also be performed with human organoids from a human subject (see Usui T, et al.
  • Example 2 Type III interferons induce pyroptosis in gut epithelial cells and delay tissue restitution upon acute intestinal injury. Abstract Tissue damage and repair are hallmarks of the inflammatory process. Despite a wealth of information focused on the mechanisms that govern tissue damage, mechanistic insight on how inflammatory immune mediators affect the restitution phase is lacking.
  • interferons influence tissue restitution after damage of the intestinal mucosa driven by inflammatory or physical injury. It is possible that type III, but not type I, interferons serve a central role in the restitution process. Type III interferons induce the upregulation of ZBP1, caspase activation, and cleavage of gasdermin C, and drive epithelial cell death by pyroptosis, thus delaying tissue restitution. It is also possible that this pathway is transcriptionally regulated in IBD patients. The results highlight a new molecular signaling cascade initiated by the immune system that affects the outcome of the immune response by delaying tissue repair and that may have important implications for human inflammatory disorders. Introduction.
  • the immune system has evolved to protect the host from external or internal threats, as well as to maintain homeostasis of the organs and tissues.
  • the strong interrelationship between these two functions of the immune system is best exemplified during the restitution phase that follows mucosal damage, occurring as a consequence of an immune response.
  • the skin, the lungs, the gut, and other mucosae are constantly exposed to microbial and, or physical perturbations and harbor multiple immune and non-immune cells that sense the presence of hostile environmental or endogenous factors and mount a defensive response.
  • the causative agent of this response, the response itself, or both, may lead to tissue damage.
  • Tissue damage sensing by tissue- resident as well as newly recruited cells initiates a complex cascade of cellular and molecular processes to restore tissue functionality and homeostasis, or to adapt to persistent perturbations (Meizlish, Franklin et al.2021).
  • the gastrointestinal tract represents an ideal tissue to explore the mechanisms underlying the extraordinarily balance between tissue damage and repair orchestrated by the immune system.
  • immune cells, epithelial cells, and commensal microbes are in a dynamic equilibrium.
  • a monolayer of highly specialized epithelial cells separates the gut lumen from the underlying lamina limbal.
  • IBDs inflammatory bowel diseases
  • IBDs are characterized by the breach of the intestinal barrier and a defective repair response that compromises mucosal homeostasis. Therefore, the ability of immune mediators to influence epithelial repair has an important impact on the pathogenesis of IBDs. Indeed, the promotion of mucosal healing has been recognized as a major therapeutic challenge for the management of IBDs (Pineton de Chambrun, Peyrin-Biroulet et al.2010).
  • IFNs interferons
  • type III IFNs or IFN- ⁇ interferons
  • IFN- ⁇ interferons
  • IFN- ⁇ plays potent anti-microbial roles, but, in contrast to type I IFNs, also preserves gut functionality by limiting excessive damage (Broggi, Granucci et al.2020).
  • IFN- ⁇ receptor IFN receptor
  • type I IFNs act systemically and play potent inflammatory activities on immune and non- immune cells thanks to the broad expression of the type I IFN receptor (IFNAR).
  • IFNAR type I IFN receptor
  • the local activity of IFN- ⁇ at mucosal tissues limits the extent of activation of immune cells, preventing excessive tissue damage, while preserving the anti-microbial functions of IFN- ⁇ (Broggi, Granucci et al.2020). Although it is possible for IFN- ⁇ to limit intestinal tissue damage, the involvement of this group of IFNs during tissue restitution of the gut is more controversial.
  • IFN- ⁇ and type I IFNs may function in a balanced and compartmentalized way to favor re-epithelization by acting, respectively, on epithelial cells or immune cells resident in the lamina intestinal (McElrath, Espinosa et al.2021).
  • IFN- ⁇ has been proposed to facilitate the proliferation of intestinal epithelial cells via STAT1 signaling (Chiriac, Buchen et al.2017) and to partially enhance gut mucosal integrity during graft versus host disease (Henden, Koyama et al.2021).
  • IFN- ⁇ and, or the IFNLR were found to be upregulated in IBD patients (Chiriac, Buchen et al.2017, Gunther, Ruder et al.2019). Further, systemic and prolonged overexpression of IFN- ⁇ in mice favored the death of Paneth cells, a group of cells that can facilitate epithelial cell regeneration by acquiring stem-like features (Schmitt, Schewe et al. 2018), and by regulating the balance of epithelial growth factors in the stem cell niche (Sato, van Es et al.2011).
  • IFN- ⁇ delays the proliferation of lung epithelial cells in murine models of persistent viral infections (Broggi, Ghosh et al.2020, Major, Crotta et al. 2020).
  • IFN- ⁇ production in the lower respiratory tract of COVID-19 patients is associated with increased apoptotic and decreased proliferative transcriptional programs, and characterizes SARS-CoV-2-infected individuals with severe-to-critical outcomes (Sposito, Broggi et al.2021).
  • IFN- ⁇ plays similar roles in the intestine, and the molecular mechanisms initiated by this group of IFNs to exert their functions during gut restitution, remain unknown.
  • conditional knock-out mice that do not respond to IFN- ⁇ only in intestinal epithelial cells or in neutrophils, ex vivo transcriptomics, and biochemical assays, as well as intestinal organoids in vitro, the role of IFN- ⁇ during tissue repair secondary to either an inflammatory insult or to radiation damage was evaluated further.
  • the data reveal a new molecular cascade initiated by IFN- ⁇ that culminates in the activation of ZBP1 and of gasdermin C (GSDMC), in the induction of pyroptosis and results in delayed gut restitution. Results.
  • IFN- ⁇ delayed tissue repair of the inflamed gut. It is possible that in the acute inflammatory phase of the dextran sulfate sodium (DSS) model of colitis, IFN- ⁇ signaling in neutrophils dampens reactive oxygen species production and neutrophil degranulation, and thus restrains intestinal damage (Broggi, Tan et al.2017).
  • DSS dextran sulfate sodium
  • rIFN- ⁇ recombinant
  • mice after DSS-induced inflammation peaked. Therefore, it is possible that rIFN- ⁇ administration upregulated interferon-stimulated genes (ISGs) in the colon of DSS- treated mice (FIG.7A).
  • mice administered rIFN- ⁇ showed persistent weight loss, reduced colon length, and prolonged tissue damage as measured by histology (FIGs.2A-2C). These data suggest that IFN- ⁇ delays tissue restitution in mice encountering colitis. Whether the endogenous IFN- ⁇ , which is produced during colitis development (Broggi, Tan et al.2017), also affects the restitution phase was tested. After the peak of the inflammatory process induced by DSS administration, mice were treated with a blocking antibody directed against IFN- ⁇ and compared to mice treated with DSS, in the presence or absence of rIFN- ⁇ .
  • intestinal epithelial cells and neutrophils are the two cell types that respond to IFN- ⁇ in the gut of mice (Broggi, Tan et al.2017), conditional knock out mice that do not express the IFNLR either in intestinal epithelial cells (Vil CRE Ifnlr1 fl/fl mice) or neutrophils (Mrp8 CRE Ifnlr1 fl/fl mice) were used. Ifnlr1 fl/fl (WT) littermates were used as controls. In contrast to WT littermates, administration of rIFN- ⁇ to Vil CRE Ifnlr1 fl/fl mice did not delay tissue restitution as measured by weight change (FIG.2H).
  • Mrp8 CRE Ifnlr1 fl/fl mice didn’t show significant differences compared to their WT littermates (FIG.8C). No differences were measured in the number of crypts/section of non-irradiated mice regardless of their capacity to respond, or not, to IFN- ⁇ (FIG.8D). Irradiated Vil CRE Ifnlr1 fl/fl mice or WT littermates, treated or not with rIFN- ⁇ , were followed over time.
  • IFN- ⁇ delays repair by acting on intestinal epithelial cells.
  • IFN- ⁇ dampened regenerative and proliferative transcriptional programs in intestinal epithelial cells.
  • intestinal crypts from the small intestine of Vil CRE Ifnlr1 fl/fl mice or WT littermates that have been irradiated were isolated and targeted transcriptomics analysis (RNAseq) was performed.
  • IFN-signaling related pathways as well as anti- viral or anti-bacterial pathways, were highly enriched in WT epithelial cells, compared to Vil CRE Ifnlr1 fl/fl (FIG.4A).
  • GO terms associated with cell migration and extracellular remodeling which are linked to higher efficiency in the closure of mucosal wounds (Quirós and Nusrat 2018), were mostly represented in epithelial cells that do not respond to IFN- ⁇ (FIG.4A).
  • GSEA Gene set enrichment analysis
  • thymidine analog 2’-deoxy-5-ethynyluridine (EdU) was administered two hours before mice were euthanized and measured cell proliferation in either WT littermates or Vil CRE Ifnlr1 fl/fl mice, administered or not rIFN- ⁇ .
  • the decreased number of proliferating epithelial cells in WT mice may reflect the lack of reparatory ISCs that proliferate.
  • CIBERSORTx was used (Newman, Steen et al.2019) and the bulk RNAseq data was deconvoluted based on single-cell RNAseq data previously published (Haber, Biton et al.2017).
  • the reduced expansion of ISC can be driven either by increased cell death of ISCs and, or TA cells, reduced proliferative programs, or both.
  • the genes that were significantly differentially regulated in epithelial cells derived from irradiated Vil CRE Ifnlr1 fl/fl mice were identified and compared to WT mice (FIG.5A).
  • FIG.5A the genes that were significantly differentially regulated in epithelial cells derived from irradiated Vil CRE Ifnlr1 fl/fl mice were identified and compared to WT mice.
  • FIG.5A the genes that were significantly differentially regulated in epithelial cells derived from irradiated Vil CRE Ifnlr1 fl/fl mice were identified and compared to WT mice (FIG.5A).
  • multiple ISGs were among the genes significantly downregulated in cells that cannot respond to IFN- ⁇ (FIG.5A).
  • Zbp1 was among these genes.
  • ZBP1 is a possible component in the multiprotein complex PANoptosome, which encompasses effectors of several forms of cell death, and is an important regulator of cell fate (Kuriakose and Kanneganti 2018). It was found that protein levels of ZBP1, as well as another ISG such as RSAD2, were upregulated in epithelial cells of the small intestine upon in vivo administration of rIFN- ⁇ in non-irradiated WT mice (FIG.10A). Upregulation of these proteins was prevented in epithelial cells derived from Vil CRE Ifnlr1 fl/fl mice and was not different in the absence of rIFN- ⁇ in the two backgrounds (FIG.10A).
  • GSDMC gasdermin C
  • non-irradiated mice administered with rIFN- ⁇ do not show upregulation of the GSDMC protein (FIG.10A), demonstrating that additional pathways associated with irradiation and, or tissue damage and repair regulate Gsdmc gene expression and, or protein synthesis.
  • the expression levels of ZBP1 and GSDMC were assessed in the biopsy derived from a cohort of IBD patients with active or inactive disease, or non-IBD controls (see Material and Methods for further details).
  • GSDMC-2/-3 were cleaved in the epithelial cells of the small intestine upon irradiation was tested and confirmed that irradiated, but not non-irradiated, mice not only showed increased levels of GSDMC-2/-3, but also that GSDMC-2/-3 were efficiently cleaved in WT, but not Vil CRE Ifnlr1 fl/fl , mice (FIG.5D). In contrast, another possible effector of pyroptosis, GSDMD, was not activated. GSDMC is primarily cleaved by Caspase-8 (Hou, Zhao et al.2020, Zhang, Zhou et al. 2021).
  • Intestinal organoids were used to directly assess the role of the signaling cascade initiated by IFN- ⁇ in driving cell death.
  • Mouse and human small intestinal organoids seeded in the presence of rIFN- ⁇ died between 48 and 72 hours from treatment (FIGs.6A and 11A).
  • Dying cells assumed typical changes associated with pyroptosis including swelling and sudden disruption of the plasma membrane and liberation of nuclear DNA (FIG.6A).
  • organoids derived from WT or Stat1 -/- mice the notion that gene transcription induced by IFN- ⁇ was necessary to induce cell death was confirmed (FIG.6B). No differences were observed between the two genotypes in the absence of rIFN- ⁇ (FIG.6B).
  • Organoids were differentiated in the presence or absence of IFN- ⁇ and their survival and, or growth was followed for 72h. Survival and growth of organoids, derived either from the small or large intestine, differentiated from WT, but not Zbp1 -/- , and mice were significantly reduced upon the administration of rIFN- ⁇ (FIGs.6D and 11D). In agreement with the capacity of IFN- ⁇ to activate a ZBP1/Caspase-8/GSDMC axis, organoids grown for 6 days and then administered with rIFN- ⁇ showed ZBP1 upregulation and cleavage of GSDMC-2/-3 and Caspase-8 and Caspase-3 (FIG.6E).
  • organoids were grown in a two-dimensional (2D) epithelial monolayer system and exposed on their apical side to air, to obtain a self-organizing monolayer that mimics cells in homeostasis.
  • This monolayer could then be re-submerged in medium (to elicit damage response mimicking in vivo epithelial injuries) and re-exposed to air (which induces epithelial regeneration responses) (FIG.6H).
  • IFN- ⁇ the epithelial monolayer after re-exposure to air, the proliferative repair response was curbed, as demonstrated by the failure to incorporate EdU (FIG.6I).
  • IFN- ⁇ signaling induces a ZBP-1-GSDMC axis that controls epithelial cell survival, and dampens the capacity of ISCs to proliferate and orchestrate tissue restitution. Discussion. It was determined that IFN- ⁇ restrains the restitution of the intestinal mucosae secondary to either inflammatory damage or ionizing radiations toxicity. It was also determined that the capacity of IFN- ⁇ to initiate a previously overlooked molecular cascade in intestinal epithelial cells that allows the induction of ZBP1, the activation of caspases, and the induction and cleavage of GSDMCs. Further, similar pathways are transcriptionally upregulated in IBD patients with active disease.
  • IFN- ⁇ but not type I IFNs
  • the immune system is endowed with the capacity to not only protect against pathogen invasion, but also to maintain tissue homeostasis. Fundamental to exert these activities, is the fine balance between anti-microbial functions of the immune system that can drive tissue damage, and the regenerative capacity of organs and tissues.
  • IFNs IFNs
  • type III IFNs or IFN- ⁇ IFN- ⁇ activities at mucosal surfaces are essential to limit pathogen spread while reducing inflammation and immune cell infiltration.
  • IFN- ⁇ and type I IFNs regulated very similar transcriptional programs, but the limited expression of the IFNLR restricted the activity of IFN- ⁇ to epithelial cells, hepatocytes, neutrophils and few other cell types and, thus, reduced the extent of the inflammation (Broggi, Granucci et al.2020).
  • the limited number of cells that responded to IFN- ⁇ signaling, and the reduced capacity of IFN- ⁇ , compared to type I IFNs, to activate IRF1 allow for the preservation of the functionality of mucosal tissues during an immune response.
  • the protective functions of IFN- ⁇ in the gut, and in general at mucosal surfaces are well known (Broggi, Granucci et al.2020), much less is known about the functions of this group of IFNs during the healing phase that follows intestinal tissue damage.
  • IFN- ⁇ affects the survival of the cells, decreases the number of ISCs, and dampens the proliferation of the cells in the crypts, both in vivo in mice and in vitro in both human and mouse organoids.
  • Tissue restitution in the gut is regulated by a complex crosstalk between epithelial cells, immune cells, microbial stimuli, and mesenchymal cells and culminates in the proliferation of ISCs.
  • ISCs Treatment with ionizing radiation induces widespread epithelial damage and targets in particular proliferating ISCs in the intestinal crypt, making it an ideal model to understand the dynamics of ISCs proliferation and intestinal healing.
  • Lrg5 + ISCs support normal cell turnover as well as injury-induced restitution (Metcalfe, Kljavin et al.2014).
  • TA cells retro-differentiate and acquire new stem-like properties in the small, as well as in the large, intestine (Wang, Chiang et al.2019, Ohara, Colonna et al.2022). These cells then proliferate to allow the re-epithelization of the damaged tissue.
  • ZBP1 is a Z-DNA binding protein, and is part of the PANoptosome, a multiprotein complex that governs the cell fate (Place, Lee et al.2021).
  • PANoptosis is a form of cell death that encompasses pyroptosis, apoptosis, and necroptosis.
  • ZBP1 can interact directly or indirectly with proteins that regulate cell death and drive the activation of apoptotic caspases 8, 3 and 7, the necroptosis effector MLKL, or pyroptosis effectors Casp-1, 11 and GSDMD. So far, GSDMC has not been associated with ZBP1 and, or PANoptosis. The data highlight the existence of a ZBP1- GSDMC axis that appeared to be the preferential pathway of cell death that is active during cycles of intestinal epithelial damage and restitution. Upregulation of ZBP1 alone is not sufficient to trigger the full activation of the PANoptosome, which is consistent with the inability to detect toxic effects of IFN- ⁇ in the absence of inflammation or tissue damage.
  • ZBP1 can be activated both by binding microbial- derived nucleic acids (Kuriakose, Zheng et al.2018, Muendlein, Connolly et al.2021) or by binding host-derived Z-DNA following oxidative damage of the mitochondria (Szczesny, Marcatti et al.2018). It is, thus, possible that in vivo, under tissue-damaging conditions, either microbiota- or host-derived DNA becomes available to induce the assembly and activation of the PANoptosome downstream of ZBP1. In contrast to the in vivo data, administration of IFN- ⁇ to murine or human intestinal organoids induces the ZBP1-GSDMC axis and drives cell death.
  • IFN- ⁇ signaling in neutrophils potentiates tissue damage (Broggi, Tan et al.2017), making it hard to compare the tissue restitution phase with WT mice that start from a different level of damage. Indeed, IFNs were always administered or blocked in the colitis model after the peak of the inflammatory phase. Alternatively, mice deficient for the IFNLR were used in epithelial cells only. Total knock-out mice were solely used in the radiation model in which damage and, or inflammation are not driven by neutrophils but by the ionizing radiations. The compartmentalized activity of IFN- ⁇ in different cell types appears to be, thus, a possible feature of this group of IFNs.
  • mice were housed under specific pathogen-free conditions at Boston Children’s Hospital, and all the procedures were approved under the Institutional Animal Care and Use Committee (IACUC) and operated under the supervision of the department of Animal Resources at Children’s Hospital (ARCH). Reagents and antibodies.
  • mice IFN ⁇ -2 were used and attached to polyethylene glycol (provided by Bristol- Myers Squibb), mouse recombinant IFN- ⁇ (12401-1; PBL interferonsource), anti-IFN- ⁇ 2-3 (MAB17892; R&D systems) and anti-IFNAR1 (BE00241; BioXCell), the pan caspase inhibitor Z- VAD-FMK (HY-16658B; MedChem Express), EdU (NE08701; Carbosynth).
  • rIFN- ⁇ mouse IFN ⁇ -2
  • polyethylene glycol provided by Bristol- Myers Squibb
  • anti-IFN- ⁇ 2-3 MAB17892; R&D systems
  • anti-IFNAR1 BE00241; BioXCell
  • pan caspase inhibitor Z- VAD-FMK HY-16658B; MedChem Express
  • EdU EdU
  • ⁇ -Actin Mae monoclonal; A5441; AC-15 clone; Lot# 127M4866V; Sigma-Aldrich
  • Rsad2 Mae monoclonal custom made; BioLegend
  • Zbp1 Mae monoclonal; AG-20B-0010-c100; Lot# A28231605; AdipoGen
  • gasderminC-2/-3 gasdermin C-2/-3
  • gasdermin D Rabbit polyclonal; 20770-1-AP; Proteintech
  • Caspase 8 D35G2; 4790; Lot#2; CST
  • Caspase 3 9662; Lot# 19; CST
  • cleaved caspase 8 Rabbit monoclonal; Asp387; D5B2; 8592; Lot#4; CST
  • cleaved caspase 3 Rabbit monoclonal; D1
  • mice were given 2.5% (w/v) dextran sulfate sodium (DSS, Affymetrix) in drinking water for 7 days and were then administered water for 7 days.
  • DSS dextran sulfate sodium
  • mice were received daily intraperitoneal injections of 50 mg kg - 1 day -1 rIFN- ⁇ or rIFN- ⁇ , and, to deplete endogenous IFN- ⁇ or to block type I IFN signaling, mice received daily intraperitoneal injections of 12.5 mg kg -1 day -1 of anti-IFN- ⁇ 2-3 or anti-IFNAR1 antibody respectively.
  • Body weight, stool consistency and the presence of blood in the stool were monitored daily. Weight change was calculated as percentage of initial weight.
  • mice Partial body irradiation. Mice were sedated with a mix of ketamine (100 mg/ml) and xylazine (20 mg/ml) intraperitoneally. Mice then received gamma irradiation in a Best Theratronics Gammacell 40 Cesium 137-based irradiator with lead shielding of the head, thorax, and upper extremities to prevent bone marrow failure. In one sitting mice received either 11 Grey of gamma irradiation to assess tissue restitution in small intestinal crypts or 14 Grey of gamma irradiation for survival experiments. To assess proliferation, mice were intraperitoneally administered a 100 mg/kg dose of EdU in saline, final volume 500 ⁇ l.
  • Histological scoring was performed in a blinded fashion by assignment of a score of 1–5 to segments of the colon roll (1, presence of leukocyte infiltrate, loss of goblet cells; 2, bottom third of the crypt compromised; 3, two thirds of the crypt compromised; 4, complete crypt architecture loss; 5, complete crypt loss and lesion of the epithelial layer).
  • Each segment was then measured with ImageJ software, and the final histological score of each sample was obtained by ‘weighting’ the score of each segment against the length of the segment and divided by the total length of the colon roll. EdU incorporation staining.
  • Deparaffinized slides or organoids fixed on transwell were stained for 30 minutes with 2mM Sulfo-Cyanine5-azide (Lumiprobe) in the presence of 1mM CuSO4 and 2mg/ml Sodium ascorbate, in PBS. After EdU staining, slides were stained with DAPI (Sigma) to detect nuclei, and mounted with ProLongGold antifade reagent (Thermo Fisher Scientific). Crypt extraction. Small intestines were longitudinally cut and rinsed in PBS. Mucus was washed away by incubation with 1mM DTT at 4°C for 5 minutes.
  • the tissue was moved to 10mM EDTA, 1% FBS, 1% sucrose at 37°C for 5 minutes. Samples were vortexed and small intestine fragments were moved to a new tube with 10mM EDTA, 1% FBS, 1% sucrose at 37°C for 10 minutes. Samples were vortexed. The supernatant was filtered through a 70uM strainer and kept on ice. Small intestine fragments were moved to a new tube with 10mM EDTA, 1% FBS, 1% sucrose at 37°C for 10 minutes. Samples were vortexed and the supernatant was combined with the previous fraction.
  • the isolated crypts were resuspended in Trizol for RNA extraction and in RIPA Buffer with protease and phosphatase inhibitors for Western Blot analysis. Measured cytokine gene expression in the colon, small intestine crypts and organoids. Samples were collected in Trizol (Thermo Scientific) and RNA was isolated using phenol-chloroform extraction.
  • RNA sequencing was analyzed for gene expression by qPCR on a CFX384 real-time cycler (Bio-rad) using Power SYBRTM Green RNA-to-CTTM 1-Step Kit (Thermo Scientific, 4389986) and pre-designed KiCqStart SYBR Green Primers (MilliporeSigma) specific for Rsad2 (RM1_Rsad2 and FM1_Rsad2), Lgr5 (RM1_Lgr5 and FM1_Lgr5) and IDT PrimeTime Predesigned qPCR Assays specific for Gapdh (Mm.PT.39a.1;). RNA sequencing.
  • RNA (15ng) isolated from small intestinal crypts was retro-transcribed to cDNA using SuperScript VILO cDNA Synthesis Kit (11754-05; Invitrogen). Barcoded libraries were prepared using the Ion AmpliSeq Transcriptome Mouse Gene Expression Panel, Chef-Ready Kit (A36412; Thermo Scientific) as per the manufacturer’s protocol. Sequencing, read alignment, de-multiplexing, quality control and normalization was performed using an Ion S5 system (A27212; Ion Torrent). The generated count matrixes were analyzed using custom scripts in R (v 4.1.1). Differential Expression of Gene analysis was performed using the R package DEseq2 (v 1.34) with shrinkage of log2 fold changes.
  • Volcano plots were created using the R package EnhancedVolcano (v 1.12).
  • the differentially expressed genes with an adjusted p-value lesser that 0.1 and a log2 fold change greater than 1.5 were selected for downstream analysis.
  • Functional enrichment analysis in Gene Ontology was performed using the R package ClusterProfiler (v 4.2) with the Biological Process terms and Benjamin-Hochberg multi-test correction with 5% of FDR threshold.
  • Geneset Enrichment Analysis (GSEA) of hallmarks was performed using the R package fgsea (v 1.20) using the hallmark genesets (v 7.4) from the Broad Institute MSigDB or custom genesets. Leading edges of the different selected genesets were selected to build heatmaps of their expression in the different conditions and samples.
  • GSEA Geneset Enrichment Analysis
  • the R package ComplexHeatmap (v 2.10) was used to plot the heatmaps.
  • CIBERSORTx was used (Newman, Steen et al.2019) to estimate the abundances of epithelial cell types using bulk gene expression data as an input and scRNAseq signature matrices from single-cell RNA sequencing data to provide the reference gene expression profiles of pure cell populations.
  • the scRNAseq signature matrix used to deconvolute RNAseq dataset from small intestine crypts was taken from (Haber, Biton et al.2017).
  • Western blot Western blot was performed with standard molecular biology techniques.
  • RNAseq on IBD patient s biopsies.
  • the IBD biobank was generated starting with biopsy samples collected from patients suffering from CD or UC and diagnosed as clinically quiescent or in an active phase of the disease with various degrees. Controls were taken from non- inflammatory healthy portions of the colon. The investigation was registered under ClinicalTrials.gov Identifier: NCT02304666. A detailed description of the biobank as well as the RNAseq studies are described elsewhere (V. Millet et al., submitted).
  • RISK samples with “undetermined” histopathology data were excluded from the analysis, and IBD samples labeled as macroscopically or microscopically inflammation were categorized as “Active” with the rest as “Inactive”.
  • organoids were treated according to the figure legend in the presence of 1ug/ml Propidium Iodide (PI) (Sigma), and incubated in the video microscope “Observer Z.1 Zeiss with Hamamatsu ORCA Flash 4.0 LT”, equipped with a temperature-controlled and CO 2 chamber. Wells were scanned every 12 hours and mosaic brightfield and fluorescence images were taken. Organoids were identified by ImageJ and were followed over time for PI incorporation as hallmark of cell death. Percent of live organoids was expressed as Percent of organoids that never incorporated PI. Where indicated in the figure legends, organoids viability was measured with CellTiter-Blue (Promega) according to the manufacturer’s instruction.
  • PI Propidium Iodide
  • Percentage of live organoids is expressed based on relative CellTiter-Blue signal compared to untreated organoids.
  • ALI Air-Liquid Interface
  • CORNING cultured mouse small intestinal organoids were dissociated in single cells and seeded on polycarbonate transwells, with 0.4 ⁇ M pores (CORNING). Initially, cells were seeded in the presence of 50% L-WRN media with 10 ⁇ M Rock inhibitor Y-27632 in both the lower and the upper chamber. After 7 days, the media was removed from the upper chamber to create an ALI. Cells were maintained in these conditions for 14 days to establish a homeostatic monolayer.
  • the ALI culture was then resubmerged with 200 ⁇ L 50% L- WRN medium, for 7 days and re-exposed to air for 3 days in the presence or absence of rIFN- ⁇ , as indicated in the figure legends.
  • cells were pulsed with 10 ⁇ M EdU for 2 hours, fixed in 10% formalin and stained for EdU incorporation. Samples were examined using a Zeiss LSM 880 confocal microscope (Carl Zeiss) and data were collected with fourfold averaging at a resolution of 2100 ⁇ 2100 pixels. The percentage of EdU-positive-cells was calculated as the ratio of the number EdU-positive foci and DAPI-positive foci.
  • GSDMC knockdown (Gsdmc2, 3 KD ) stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG (SEQ ID NO: 1), HC108542B– AGTTGTGTTGTCCAGTTTCCTGTCCATGC (SEQ ID NO: 2) and scrambled negative control non-effective shRNA (Origene Item no: TR30023).
  • Lentivirus was packaged by co- transfecting shRNA and psPAX2 and pVSVG packaging plasmids into HEK293T cells. Transfection efficiency was monitored by GFP fluorescence, media was changed 24 hours post transfection and lentivirus particles were harvested in cell culture media 72 hours after transfection. Lentivirus particles were concentrated with Lenti-X TM Concentrator (Takara 631232) with the manufacturers protocol. Concentrated particles were resuspended in 100% WRN conditioned media and titers were checked using Lenti-X TM GoStix TM Plus (Takara 631280). Only high titer lenti-particles were used to transduce duodenoids.
  • duodenoids were removed from Matrigel with Cell Recovery Solution and dissociated into single cells in Trypsin-EDTA for 10 minutes. Debris was removed by filtering over a 70uM Cell strainer (Stem Cell Technologies #27260) and single cells isolated at 300RCF for 10 minutes. Single cells were resuspended in 1ml of Organoid Growth Media + 500ul of concentrated lentivirus particles in a 15ml conical tube supplemented with 4ug/mL polybrene. Cells were spin-transduced in a pre-warmed 32C centrifuge in a swinging bucket rotor at 500 x g for 1 hour.
  • Organoid pellet was resuspended in matrigel, plated onto a Corning 24 Well plate, and incubated in a 37C +5%CO2 incubator for 2 hours. After two hours 500ul of organoid growth media was added. Media was changed every other day. Transduction efficiency was assessed by GFP fluorescence, and positively transduced wells were expanded. Vehicle (Veh) treated, scramble shRNA, and Gsdmc2, 3 KD duodenoids were treated with 200ng/ml of rIFN- ⁇ in Organoid Growth Media.
  • duodenoids were removed from Matrigel in Cell Recovery Solution for 1 hour at 4oC, washed with PBS and resuspended in Organoid FACS Buffer (1X PBS+ 1%BSA + 2mM EDTA + 10uM Y27632). Duodenoids were stained with Zombie AquaTM (Biolegend) and Calcein RedTM AM (Thermofisher) in Organoid FACS buffer, diluted according to manufacturer’s protocol. Cells were washed twice with PBS and mechanically disrupted by pipetting with a P200 pipet tip, then incubated with prewarmed Trypsin-EDTA for 10 minutes at 37C.
  • Small intestine organoids were isolated from wild-type (WT), Ripk1 D138N mutant (kinase dead), Ripk3 -/- (knockout or “KO”), Ripk3 -/- /Caspase 8 /- (double knockout or “dKO”). Briefly, the organoids were exposed to 2D Air-Liquid-Interface culture (ALI culture). While in ALI culture, organoids were seeded and submersed for 7 days, followed by 7 days of ALI differentiation. See Wang et al. Cell 2019. To induce hypoxic damage, organoids were re- submerged for 3 days. On day 3 of the re-submersion organoids were treated with IFN- ⁇ (200 ng/ml) for 72 hours total.
  • ALI culture 2D Air-Liquid-Interface culture
  • Controls were not treated with IFN- ⁇ (NT). Organoids were exposed to ALI for 2 days after re-submersion for repair phase in which IFN- ⁇ was still present (FIG. 12A). Immunofluorescent staining and quantification of dead cells (using Zombie Red) and cleaved Caspase 8 (cCasp8) was performed. Under no treatment (NT) conditions, organoids had little to no cells with the presence of cCasp8. When exposed to IFN- ⁇ (200 ng/ml) wild-type (WT) mice exhibited about 30% of cells positive for cCasp8.
  • organoids derived from WT mice treated with IFN- ⁇ organoids derived from Ripk1 D138N mutant (kinase dead), and Ripk3 -/- (knockout or “KO”), and Ripk3 -/- /Caspase 8 /- (double knockout or “dKO”) mice treated with IFN- ⁇ exhibited a decrease in the percentage of dead cells (FIGs.12B-12C).
  • organoids While in ALI culture, organoids were seeded and submersed for 7 days, followed by 7 days of ALI differentiation. See Wang et al. Cell 2019. To induce hypoxic damage, organoids were re-submerged for 3 days. On day 3 of the re- submersion organoids were treated with IFN- ⁇ (200 ng/ml) for 72 hours total. Controls were not treated with IFN- ⁇ (NT). Organoids were exposed to ALI for 2 days after re-submersion for repair phase in which IFN- ⁇ was still present (FIG.13A). Immunofluorescent staining and quantification of dead cells (using Zombie Red) and cleaved Caspase 8 (cCasp8) was performed.
  • organoids Under no treatment (NT) conditions, organoids had little to no cells with the presence of cCasp8. When exposed to IFN- ⁇ (200 ng/ml) wild-type (WT) mice exhibited about 40% of cells positive for cCasp8. Relative to WT mice treated with IFN- ⁇ , Zbp1 ⁇ Z ⁇ 2/ ⁇ Z ⁇ 2 treated with IFN- ⁇ exhibited a decrease in the percentage of cells positive for cCasp8. Under no treatment (NT) conditions, organoids had little to no cells with the presence of Zombie. When exposed to IFN- ⁇ (200 ng/ml) wild-type (WT) mice exhibited about 50% of cells positive for Zombie.
  • Tissue damage sensing by tissue-resident as well as newly recruited cells initiates a complex cascade of cellular and molecular processes to restore tissue functionality and homeostasis or adapt to persistent perturbations (1).
  • the gastrointestinal tract represents an ideal tissue for exploring the mechanisms underlying the extraordinar balance between tissue damage and repair orchestrated by the immune system.
  • immune cells, epithelial cells, and commensal microbes are in a dynamic equilibrium.
  • a monolayer of highly specialized intestinal epithelial cells (IECs) separates the gut lumen from the underlying lamina intestinal.
  • IECs intestinal epithelial cells
  • IBDs inflammatory bowel diseases
  • IFN- ⁇ receptor IFN receptor
  • IFN- ⁇ and type I IFNs have been shown to function in a balanced and compartmentalized manner to favor re-epithelization by inducing the secretion of epithelial growth factors and acting, respectively, on IECs or immune cells resident in the lamina propria (12).
  • IFN- ⁇ has also been proposed to facilitate the proliferation of IECs via Signal Transducer and Activator of Transcription 1 (STAT1) signaling (13) and to partially enhance gut mucosal integrity during graft-versus-host disease (14).
  • STAT1 Signal Transducer and Activator of Transcription 1
  • IFN- ⁇ artificial overexpression of IFN- ⁇ in mice favored the death of Paneth cells (15), a group of cells that can facilitate IEC regeneration (16, 17).
  • IFN- ⁇ delays the proliferation of lung epithelial cells in murine models of persistent viral infections (18, 19), as well as in the lower respiratory tract of COVID-19 patients with severe-to-critical outcomes (20).
  • IFN- ⁇ and/or the IFNLR were found to be upregulated in IBD patients (13, 15), but it is still debated whether this group of IFNs plays protective or detrimental activities during intestinal inflammation.
  • IFN- ⁇ initiates a signaling pathway that delays epithelial cell regeneration, secondary to either colitis or radiation damage in mice, and that is also activated in IBD patients.
  • RESULTS IFN- ⁇ delays tissue repair during colitis.
  • colitis was induced by the administration of dextran sulfate sodium (DSS). In this murine model of colitis, DSS is administered for 7 days in the drinking water and later removed to allow tissue repair.
  • DSS dextran sulfate sodium
  • IFN- ⁇ signaling in neutrophils but not in IECs, restrains intestinal damage (9).
  • type III IFN gene induction in DSS-treated mice revealed that the levels of IFN- ⁇ , as well as Ifit1, an interferon-stimulated gene (ISG), remain elevated after DSS removal (FIGs.20A, 20B).
  • ISG interferon-stimulated gene
  • mice in which only IECs (Vil CRE Ifnlr1 fl/fl mice) or neutrophils (MRP8 CRE Ifnlr1 fl/fl mice) did not respond to IFN- ⁇ as well as Ifnlr1 fl/fl littermate controls were evaluated. It was determined that Ifnlr1 fl/fl mice showed a significant decrease in their weight and colon length compared to Vil CRE Ifnlr1 fl/fl , but not MRP8 CRE Ifnlr1 fl/fl , mice (FIGs.14A, 20C). These data suggested that IFN- ⁇ signaling in IECs delays the repair phase of DSS-induced colitis.
  • ISG levels in IECs were significantly decreased in mice treated with the anti-IFN- ⁇ antibody (FIG.7A), further supporting a major role for IFN- ⁇ , rather than type I IFNs, in IECs during tissue repair. Accordingly, ISG levels in colonocytes were not altered in mice that received either the anti-IFNAR antibody or rIFN- ⁇ , compared to control mice (FIG. 7B), confirming previous studies showing that IECs are hyporesponsive to type I IFNs (12, 21).
  • IFN- ⁇ acts on IECs to delay repair.
  • a well-characterized model of epithelial damage resulting from exposure to ionizing radiation was employed (22).
  • the repair of the gut epithelial monolayer is a complex process, and the regenerative capacity of intestinal stem cells (ISCs) plays a role (23).
  • ISC death in the small intestine is followed by the repair of the damaged epithelial crypts and the return to homeostasis.
  • ISG induction in epithelial cells was dependent on IFN- ⁇ , rather than type I IFNs (FIG.8A).
  • IFN- ⁇ type I IFNs
  • FIG.8A the number of crypts was significantly decreased in WT mice compared to Vil CRE Ifnlr1 fl/fl mice, either in the presence or absence of rIFN- ⁇ (FIG.3C).
  • a role for IFN- ⁇ signaling in neutrophils during the repair process that followed irradiation was excluded using MRP8 CRE Ifnlr1 fl/fl mice and no significant differences in crypt numbers compared to their WT littermates was observed (FIG.8C).
  • rIFN- ⁇ rIFN- ⁇
  • intestinal crypts were isolated from the small intestine of Vil CRE Ifnlr1 fl/fl mice or WT littermates that have been irradiated and performed targeted RNA sequencing (RNAseq).
  • RNAseq targeted RNA sequencing
  • Gene ontology (GO) enrichment analyses were performed on differentially expressed genes (DEG) overexpressed in WT, compared to Vil CRE Ifnlr1 fl/fl epithelial cells (FIG.4A), or vice versa (FIG. 4A).
  • IFN-signaling related pathways and anti-viral or anti-bacterial pathways were highly enriched in WT epithelial cells, compared to Vil CRE Ifnlr1 fl/fl (FIG.4A).
  • a volcano plot analysis of DEG showed enrichment of ISGs in WT, compared to knock- out, cells (FIG.5A).
  • GSEA Gene set enrichment analysis
  • ISCs The reduced expansion of ISCs can be driven by increased cell death of bona fide ISCs and/or retro-differentiating cells that give rise to emergency stem cells.
  • IFN- ⁇ the genes differentially regulated in epithelial cells derived from irradiated WT were identified and compared to Vil CRE Ifnlr1 fl/fl mice (FIG.5A).
  • Zbp1 an important regulator of cell fate that has been shown to govern pyroptosis, apoptosis, as well as necroptosis (34), was among the ISGs significantly upregulated by IFN- ⁇ in WT, but not Vil CRE Ifnlr1 fl/fl , IECs (FIG.5A). It was also determined that protein levels of ZBP1, as well as another ISG, RSAD2 (also known as Viperin), were upregulated in epithelial cells of the small intestine upon in vivo administration of rIFN- ⁇ in non-irradiated WT mice (FIG.10A).
  • GSDMs exert their pyroptotic function upon cleavage by caspases, when the N-terminal cleavage product oligomerizes to form lytic pores in the cell membrane, leading to the loss of ionic homeostasis and cell death (35, 36).
  • N-terminal domain of GSDMC induces cell death when ectopically expressed.
  • ZBP-1/GSDMC-2/-3 axis was also activated in DSS-treated mice.
  • ZBP-1 and GSMDC- 2/-3 were upregulated in WT littermates, but not in Vil CRE Ifnlr1 fl/fl mice, and the canonical ISG Viperin followed a similar trend (FIGs.16E, 16F).
  • GSDMC-2/-3 was cleaved in response to IFN- ⁇ signaling (FIGs.16E, 16F), and GSDMC-2/-3 cleavage was proportional to the extent of the inflammatory response (FIG.22E).
  • GSDMC-2/-3 cleavage, and ZBP1 upregulation peaked between day 8 and 10 after DSS administration (FIG. 16G).
  • GSDMC family proteins are primarily cleaved by Caspase-8 (Casp-8) (37, 38). Indeed, the pattern of bands of cleaved GSDMC-2/-3 in irradiated mice or mice with colitis is compatible with the activity of Casp-8 (41).
  • IFN- ⁇ initiates a signaling cascade that allows the upregulation of ZBP1, the activation of Casp-8, and the induction and cleavage of GSDMC, an executor of pyroptosis.
  • the ZBP-1/Casp-8/GSDMC pathway is active in IBD patients.
  • IBD patients present increased levels of IFN- ⁇ and/or IFNLR1 (13, 15).
  • RNAseq datasets derived from samples of three different cohorts of patients were assessed, and in particular, from: i) rectal mucosal biopsies from ulcerative colitis (UC) pediatric patients (PROTECT cohort) (42) (FIGs.23A-C); ii) from ileal biopsies from Crohn’s disease (CD) pediatric patients (RISK cohort) (43) (FIG.23D); and iii) from biopsies derived from a cohort of adult IBD patients with active or inactive disease, or non-IBD controls (44) (FIG.23G).
  • UC ulcerative colitis
  • CD Crohn’s disease
  • RISK cohort RISK cohort
  • This culture system leads to the differentiation of a self- organizing monolayer that mimics homeostasis. This monolayer can then be re-submerged in medium, to induce hypoxic stress and cause damage responses, and re-exposed to air to induce epithelial regeneration responses (30). When the homeostatic epithelial monolayer was treated with IFN- ⁇ , it was determined that IFN- ⁇ alone was not able to induce cell death, activate caspases, or inhibit proliferation (FIG.24C).
  • IFN- ⁇ type I IFNs
  • IFN- ⁇ reduces the expression of proliferative transcriptional programs and reduces the number of proliferating epithelial cells.
  • in vitro assays were performed to determine whether IFN- ⁇ exerted similar effects when IECs were treated concomitantly with re-exposure to air, which mimics the onset of a reparative response. It was discovered that IFN- ⁇ blunted proliferation by decreasing the proportion of Ki67 + proliferating cells, and, at the same time, causing caspase activation and cell death in reparatory monolayers (FIG.18E, 18F). Overall, this demonstrates that IFN- ⁇ acts directly on IECs to induce cell death and to inhibit repair after epithelial cell damage.
  • the ZBP-1/Casp-8/GSDMC axis mediates IEC pyroptosis in response to damage and IFN- ⁇ encounter.
  • the ZBP-1/Casp-8/GSDMC axis was assessed to determine if it is required to induce cell death in response to IFN- ⁇ . Initially, the capacity of IFN- ⁇ to induce cell death following damage induced by re-submersion of the homeostatic monolayer was tested. It was determined that organoids in which Zbp1 was knocked out using CRISPR-Cas9 (Zbp1 KD , FIG. 25A), cell death and Casp-8 cleavage were significantly decreased (FIGs.19A, 19B).
  • Gsdmc-2 and Gsdmc-3 were knocked out with CRISPR/Cas9 in small intestine organoids (Gsdmc2,3 KD , FIG. 25H). It was discovered that upon exposure to rIFN- ⁇ , survival of organoids that do not express Gsdmc2, 3 was significantly increased compared to controls in condition of re-submersion induced damage (FIGs.19H, 19I), while Casp-8 activity was preserved (FIGs.19H, 19I). Similarly, Gsdmc2,3 KD spheroids were protected from cell death upon exposure to IFN- ⁇ (FIG. 19J).
  • IFN- ⁇ initiates a ZBP-1/Casp-8/GSDMC axis that drives pyroptosis in IECs.
  • DISCUSSION In this work, it was revealed that IFN- ⁇ restrains the regeneration of the epithelial barrier either during colitis or secondary to ionizing radiation toxicity. It was determined that the capacity of IFN- ⁇ to initiate a previously overlooked molecular cascade in IECs that allows the induction of ZBP1, the activation of Casp-8, and the induction and cleavage of GSDMCs. Components of these pathways were also activated in IBD patients.
  • IFN- ⁇ but not type I IFNs, were the major drivers of the delayed repair in vivo in mouse models of intestinal mucosal damage that follows colitis or irradiation, opening new ways of therapeutic intervention for individuals that encounter tissue damage such as IBD patients or subjects exposed to radiation therapies.
  • IFN- ⁇ instructs epithelial cells of different organs to initiate distinct cell death pathways (i.e.: apoptosis in the lungs and pyroptosis in the gut) remains an open question that will require further investigation. Another interesting observation was that exogenous administration of IFN- ⁇ does not induce caspase or GSDMC activation in vivo in the absence of tissue damage, although it induces ZBP1 upregulation at the transcriptional as well as the protein level. ZBP1 is a Z- nucleic acid binding protein and is a key node in the formation of a multiprotein complex that governs the cell fate (45).
  • ZBP1 can interact directly or indirectly with proteins that regulate cell death and drive the activation of apoptotic caspases, the necroptosis effector MLKL, or pyroptosis effectors Casp-1, 11 and GSDMD (36, 46, 47). So far, GSDMC was not associated with ZBP1.
  • the data highlight the existence of a ZBP1-GSDMC axis that appears to be the preferential pathway of cell death active during intestinal epithelial damage and restitution cycles. Upregulation of ZBP1 alone is not sufficient to trigger cell death, which is consistent with the inability to detect toxic effects of IFN- ⁇ in the absence of inflammation or tissue damage, or in vitro in organoids grown at ALI that model a homeostatic monolayer.
  • ZBP1 can be activated both by binding microbial-derived nucleic acids (47, 48) or by binding host-derived Z-DNA following oxidative damage of the mitochondria (49), as well as dsRNA, derived from ISG transcripts or endogenous retroelements that can fold in the form of Z-RNA (50). It is, thus, possible that in vivo, under tissue-damaging conditions, either microbiota-, or host-derived nucleic acids become available to induce the activation of ZBP1.
  • mice were solely used in the radiation model in which damage and/or inflammation are not driven by neutrophils but by ionizing radiation.
  • the compartmentalized activity of IFN- ⁇ in different cell types appears to be, thus, a key feature of this group of IFNs.
  • the data unveiled a new axis between IFN- ⁇ , ZBP1, and GSDMC that governs mucosal repair in the gut and opens new perspectives to future therapeutic interventions.
  • MATERIALS AND METHODS Mouse strains.
  • C57BL/6J (Jax 00664) (wild-type), Ifnar1 -/- (Jax 028288), MRP8 CRE recombinase (Jax 021614), recombinase (Jax 004586) mice were purchased from Jackson Labs.
  • C57BL/6 IL-28R ⁇ / ⁇ (Ifnlr1 ⁇ / ⁇ ) mice were provided by Bristol-Myers Squibb.
  • Cells from the intestine of B6.129S(Cg)-Stat1tm1Dlv (Stat1 ⁇ / ⁇ , JAX 012606) were kindly provided by Dr. S.B. Snapper.
  • the mutant mouse line Ifnlr1 tm1a(EUCOMM)Wtsi was provided by the Wellcome Trust Sanger Institute Mouse Genetics Project (Sanger MGP) and its funders (funding and associated primary phenotypic Information, sanger.ac.uk/mouseportal).
  • Mice constitutively expressing Cas9 Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP) Fezh/J ; JAX stock no.024858) were kindly donated by Dr. B. Malissen.
  • mice were housed under specific pathogen-free conditions at Boston Children’s Hospital, and all the procedures were approved under the Institutional Animal Care and Use Committee (IACUC) and operated under the supervision of the department of Animal Resources at Children’s Hospital (ARCH). Reagents and antibodies.
  • mice IFN ⁇ -2 attached to polyethylene glycol (provided by Bristol-Myers Squibb), mouse recombinant IFN- ⁇ (12401-1; PBL interferonsource), anti-IFN- ⁇ 2-3 (MAB17892; R&D systems) and anti-IFNAR1 (BE00241; BioXCell), the pan-caspase inhibitor Z-VAD-FMK (HY-16658B; MedChem Express), EdU (NE08701; Carbosynth) were used.
  • recombinant human IFN ⁇ -2 300-02K; Peprotech
  • ⁇ - Actin Mae monoclonal; A5441; Lot# 127M4866V; or A3854; Lot # 0000141518; AC-15 clone; Sigma-Aldrich
  • Rsad2 Mae monoclonal custom made; BioLegend
  • Zbp1 Mae monoclonal; AG-20B-0010-c100; Lot# A28231605; AdipoGen
  • gasdermin C gasdermin C
  • gasdermin D Rabbit monoclonal; 229896; Lot# GR3317481-6; abcam or Rabbit monoclonal; 225635; Lot # GR3317480-2 abcam or Rabbit polyclonal; #MBS8242472; Lot # CP1D10A; MyBiosource
  • gasdermin D Rabbit polyclonal; 20770-1-AP; Proteintech
  • Anti-Flag-HRP Mae monoclonal; clone M2; A85
  • Ki67 (Rat monoclonal; SolA15 clone; 14-5698-82; Lot# 2496198; Invitrogen), Zombie Red Tm Fixable Viability Kit (423109; Lot# B337268; Biolegend), Zombie NIR Tm Fixable Viability Kit (423105; Lot# B350797; Biolegend), DAPI (MBD0015; Lot #0000128033; Sigma).
  • the plasmids for sgRNA cloning and lentiviral particles production were kindly provided by S. Roulland: pMCB320 (Addgene #89359); psPAX2 (Addgene #12260) and pMD2.G (Addgene # 12259). DSS-colitis induction.
  • mice were given 2.5% (w/v) dextran sulfate sodium (DSS, Affymetrix) in drinking water for 7 days and were then administered water for 7 days.
  • DSS dextran sulfate sodium
  • mice received daily intraperitoneal injections of 50 ⁇ g kg- 1 day -1 rIFN- ⁇ or rIFN- ⁇ , and, to deplete endogenous IFN- ⁇ or to block type I IFN signaling, mice received daily intraperitoneal injections of 12.5 ⁇ g kg -1 day -1 of anti-IFN- ⁇ 2-3 or anti- IFNAR1 antibody respectively.
  • Body weight, stool consistency and the presence of blood in the stool were monitored daily. Weight change was calculated as percentage of initial weight. Partial body irradiation.
  • mice were sedated with a mix of ketamine (100 mg/ml) and xylazine (20 mg/ml) intraperitoneally. Mice then received gamma irradiation in a Best Theratronics Gammacell 40 Cesium 137-based irradiator with lead shielding of the head, thorax, and upper extremities to prevent bone marrow failure. In one sitting mice received either 11 Grey of gamma irradiation to assess tissue restitution in small intestinal crypts or 14 Grey of gamma irradiation for survival experiments. To assess proliferation, mice were intraperitoneally administered a 100 mg/kg dose of EdU in saline, final volume 500 ⁇ l. Histological Analysis.
  • Histological scoring was performed in a blinded fashion by assignment of a score of 1–5 to segments of the colon roll (1, presence of leukocyte infiltrate, loss of goblet cells; 2, bottom third of the crypt compromised; 3, two thirds of the crypt compromised; 4, complete crypt architecture loss; 5, complete crypt loss and lesion of the epithelial layer).
  • Each segment was then measured with ImageJ software, and the final histological score of each sample was obtained by ‘weighting’ the score of each segment against the length of the segment and divided by the total length of the colon roll.
  • Immunofluorescence For ex-vivo experiments, paraffin sections were deparaffinized with sequential washes in xylene and ethanol.
  • Organoids were permeabilized using 0.5% Triton X-100 in PBS, saturated with 3% BSA in PBS then stained with Ki67 and CL-Casp-8 antibodies and DAPI. Organoids were mounted with Fluoromount G (Invitrogen). Images were acquired using LSM 888 confocal microscope (Zeiss). Intestinal epithelial and lamina intestinal cell isolation. Small intestines were longitudinally cut and rinsed in PBS. Mucus was washed away by incubation with 1mM dithiothreitol (DTT) at 4°C for 5 minutes. The tissue was moved to 10mM EDTA, 1% fetal bovine serum (FBS), 1% sucrose at 37°C for 5 minutes.
  • DTT dithiothreitol
  • Samples were vortexed and small intestine fragments were moved to a new tube with 10mM EDTA, 1% FBS, 1% sucrose at 37°C for 10 minutes. Samples were vortexed. The supernatant was filtered through a 70 ⁇ m strainer and kept on ice. Small intestine fragments were moved to a new tube with 10mM EDTA, 1% FBS, 1% sucrose at 37°C for 10 minutes. Samples were vortexed and the supernatant was combined with the previous fraction. The isolated crypts were resuspended in Trizol for RNA extraction and in RIPA Buffer with protease and phosphatase inhibitors for Western Blot analysis.
  • Colons were opened longitudinally and washed with PBS to remove fecal contents.
  • IEC were extracted by incubating them in dissociation buffer (Hanks’ Balanced Salt Solution (HBSS) supplemented with 2.5 mM EDTA, 1 mM DTT, and 5% FCS) at 37°C, 250 rpm for 30 minutes).
  • IEC were collected by centrifugation of dissociated cells that passed through 40 ⁇ m cell strainers, while LP cells were further obtained from the retained colon pieces.
  • dissociation buffer Hanks’ Balanced Salt Solution (HBSS) supplemented with 2.5 mM EDTA, 1 mM DTT, and 5% FCS
  • Remaining intestine pieces were then washed with PBS, cut into small pieces, and incubated in digestion buffer (RPMI 1,640 medium supplemented with 10% FCS, 0.5 mg/ml collagenase I, 0.5 mg/ml collagenase IV, and 40 ⁇ g/ml DNase I) at 37°C, 250 rpm for 30 minutes.
  • digestion buffer RPMI 1,640 medium supplemented with 10% FCS, 0.5 mg/ml collagenase I, 0.5 mg/ml collagenase IV, and 40 ⁇ g/ml DNase I
  • Digested tissues were homogenized in 40 ⁇ m cell strainers, washed with PBS and centrifuged at 900 x g for 5 minutes. Measure of gene expression in organs, small intestine crypts and organoids.
  • Mouse GSDMC qPCR primers were designed to detect all four murine GSDMC paralogs (Forward: GGAAGAGATCTGAGGCCTG (SEQ ID NO: 3), Reverse: CACTTCAGGCTCTGGAACAG (SEQ ID NO: 4)).
  • RNA was analyzed for gene expression by qPCR on a CFX384 real-time cycler (Bio-rad) using Power SYBRTM Green RNA-to-C T TM 1-Step Kit (Thermo Scientific, 4389986) and pre-designed KiCqStart SYBR Green Primers (MilliporeSigma) or IDT PrimeTime Predesigned qPCR Assays.
  • RNA sequencing Thermo Scientific, 4389986
  • RNA (15ng) isolated from small intestinal crypts was retro-transcribed to cDNA using SuperScript VILO cDNA Synthesis Kit (11754-05; Invitrogen). Barcoded libraries were prepared using the Ion AmpliSeq Transcriptome Mouse Gene Expression Panel, Chef-Ready Kit (A36412; Thermo Scientific) as per the manufacturer’s protocol. Sequencing, read alignment, de-multiplexing, quality control and normalization was performed using an Ion S5 system (A27212; Ion Torrent, Torrent Suite software v5.12.1). The generated count matrices were analyzed using custom scripts in R (v 4.1.1).
  • RNAseq on IBD patient s biopsies.
  • the IBD biobank was generated starting with biopsy samples collected from patients suffering from CD or UC and diagnosed as clinically quiescent or in an active phase of the disease with various degrees. Controls were taken from non- inflammatory healthy portions of the colon. This investigation was registered under ClinicalTrials.gov Identifier: NCT02304666. A detailed description of the biobank as well as the RNAseq studies, are described elsewhere (44).
  • IBD samples with “undetermined” histopathology data were excluded from the analysis, and IBD samples labeled as macroscopically or microscopically inflammation were categorized as “Active” with the rest as “Inactive”.
  • samples lacking histology scores were excluded from the analysis and all other IBD samples were categorized as “Active” if they had a Histology Severity Score (for chronic and active acute neutrophil inflammation) > 1 and “Inactive” if they had a Histology Severity Score of 0-1 (54).
  • Group comparisons between healthy controls, inactive and active IBD were performed using non-parametric t-testing (Wilcoxon test) and p values reported. Human biopsies.
  • Colonic tissue from pediatric (age > 6, ⁇ 21 years) subjects were collected after providing written informed consent. Samples were collected peri-procedure (colectomy/colonoscopy) at Boston Children’s Hospital under Institutional Review Board protocol IRB-P00000529. Biopsies were collected in 500mL RPMI 1640 medium (ThermoFisher), 50mL FBS plus 5mL of: Pen/Strep (ThermoFisher), NEAA, Sodium pyruvate, Glutamax, and HEPES (Gibco). Samples were cryopreserved in freezing media (10% dimethyl sulfoxide (DMSO) (Sigma) and 90% FBS (Gibco). Samples were transferred to liquid nitrogen for long-term storage.
  • DMSO dimethyl sulfoxide
  • cDNA coding for the full-length human GSDMC (hGSDMC FL) was amplified from HaCaT cells and cloned into a cFlag pcDNA 3 vector under control of CMV promoter (Addgene #20011).
  • the pCDH-CuO-MCS-EF1a- GFP+Puro plasmid containing the N-terminus of human GSDMC (hGSDMC NT) was kindly provided by QuenchBio.
  • Mouse GSDMD N-term-pRetroX TetONE-eGFP plasmid was kindly provided by Dr. Petr Broz (55).
  • HEK293T cells were seeded into 96-well plate (50,000 cells per well) at the day of transfection and subsequently transfected with 100 or 200 ng of plasmid DNA in GeneJuice transfection reagent (Millipore Sigma) following the manufacturer’s guidelines.
  • Duodenal biopsy samples were obtained from routine diagnostic endoscopy under Boston Children’s Hospital IRB protocol P00027983 and cultured with methods modified from (57). Briefly, crypts were dissociated from duodenal biopsy samples obtained from age-matched ( ⁇ 3 years) healthy control individuals. Isolated crypts were suspended in Matrigel and plated in 50 ⁇ L domes with 50% L-WRN supplemented media. For maintenance, organoids were liberated from the extracellular matrix by incubating in cell recovery solution (Corning) at 4°C for 60 minutes, then a single cell preparation was obtained by incubating in TrypLE express (Thermo Fisher Scientific) at 37°C for 10 minutes.
  • Organoids were identified by ImageJ and were followed over time for PI incorporation as hallmark of cell death. Percent of live organoids was expressed as percent of organoids that never incorporated PI. Where indicated in the figure legends, organoids viability was measured with CellTiter-Blue (Promega) according to the manufacturer’s instruction. Percent of live organoids is expressed based on relative CellTiter- Blue signal compared to untreated organoids. For experiments with 2D organoids in Air-Liquid Interface (ALI), a previously described protocol was followed (30). Briefly, cultured mouse small intestinal organoids were dissociated in single cells and seeded on polycarbonate transwells, with 0.4 ⁇ m pores (CORNING).
  • ALI Air-Liquid Interface
  • GSDMC Gsdmc2, 3 KD
  • ZBP1 Zbp1 KD knockdown stable cell lines
  • gRNAs targeting the mouse GSDMC isoforms Gsdmc2, Gsdmc3 and Gsdmc4 were designed using the IDT guide design tool (Gsdmc-3- TCAGTTTCCCAACCTGATCG and Gsdmc-4-CCTGGAGTATGTGAAATAGG).
  • gRNA targeting mouse ZBP1 TGAGCTATGACGGACAGACG was derived from the published mouse CRISPR Knockout Pooled Library (Brie) (58).
  • Non-targeting gRNA (GACGGAGGCTAAGCGTCGCAA) was used as a negative control.
  • the gRNAs were cloned into the plasmid pMCB320 (Addgene #89359).
  • Lentivirus was packaged by co-transfecting sgRNA-containing pMCB320, with the packaging plasmids psPAX2 and pVSVG, into HEK293FT cells with Trans-IT 293T (Mirus cat. MIR2705).
  • Lentivirus particles were harvested in cell culture media 48 and 72 hours after transfection, filtered through a 45 ⁇ m filter and concentrated with Lenti-X TM Concentrator (Takara 631232) according to the manufacturer's protocol.
  • Organoids were transduced as previously described (59). Briefly duodenoids were removed from Matrigel by incubating at 4°C in Cell Recovery Solution (Corning) and dissociated into single cells by incubation in TrypLE for 10 minutes at 37°C. After centrifugation at 600 x g for 5 minutes, single cells were seeded in 48 Well plate in 150 ⁇ l of Organoid Growth Media + 100 ⁇ l of concentrated lentivirus particles supplemented with 4 ⁇ g/mL polybrene. Cells were spin-transduced in a pre-warmed centrifuge at 600 x g for 1 hour at 32°C, then incubated for 4 hours at 37°C.
  • Example 5 References: 1. M. L. Meizlish, R. A. Franklin, X. Zhou, R. Medzhitov, Tissue Homeostasis and Inflammation. Annu Rev Immunol 39, 557-581 (2021). 2. S. Danese, C. Fiocchi, Ulcerative colitis. The New England journal of medicine 365, 1713-1725 (2011). 3. G. Roda et al., Crohn's disease. Nat Rev Dis Primers 6, 22 (2020). 4. G. Pineton de Chambrun, L. Peyrin-Biroulet, M. Lemann, J. F. Colombel, Clinical implications of mucosal healing for the management of IBD.
  • the disclosure of a group that includes “or” between two or more group members provides embodiments in which exactly one member of the group is present, embodiments in which more than one members of the group are present, and embodiments in which all of the group members are present. For purposes of brevity those embodiments have not been individually spelled out herein, but it will be understood that each of these embodiments is provided herein and may be specifically claimed or disclaimed. It is to be understood that the disclosure encompasses all variations, combinations, and permutations in which one or more limitation, element, clause, or descriptive term, from one or more of the claims or from one or more relevant portion of the description, is introduced into another claim.
  • a claim that is dependent on another claim can be modified to include one or more of the limitations found in any other claim that is dependent on the same base claim.
  • methods of making or using the composition according to any of the methods of making or using disclosed herein or according to methods known in the art, if any, are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
  • elements are presented as lists, e.g., in Markush group format, it is to be understood that every possible subgroup of the elements is also disclosed, and that any element or subgroup of elements can be removed from the group.
  • values expressed as ranges can assume any subrange within the given range, wherein the endpoints of the subrange are expressed to the same degree of accuracy as the tenth of the unit of the lower limit of the range.
  • URL addresses are provided as non-browser-executable codes, with periods of the respective web address in parentheses. The actual web addresses do not contain the parentheses.
  • any particular embodiment of the present disclosure may be explicitly excluded from any one or more of the claims. Where ranges are given, any value within the range may explicitly be excluded from any one or more of the claims.

Landscapes

  • Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des méthodes de traitement de maladies inflammatoires, telles qu'une maladie intestinale inflammatoire (IBD), par administration à un sujet d'un agent pour inhiber la signalisation d'interféron lambda (IFNL) dans des cellules épithéliales intestinales. De telles méthodes peuvent être utilisées pour réduire l'inflammation, réduire la mort cellulaire, augmenter la prolifération cellulaire épithéliale, et/ou augmenter la réparation tissulaire dans l'épithélium intestinal de patients ayant une maladie intestinale inflammatoire.
PCT/US2023/074874 2022-09-23 2023-09-22 Inhibition de l'interféron lambda (ifnl) dans des cellules épithéliales intestinales pour le traitement d'une inflammation WO2024064879A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263409676P 2022-09-23 2022-09-23
US63/409,676 2022-09-23

Publications (1)

Publication Number Publication Date
WO2024064879A2 true WO2024064879A2 (fr) 2024-03-28

Family

ID=90455306

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/074874 WO2024064879A2 (fr) 2022-09-23 2023-09-22 Inhibition de l'interféron lambda (ifnl) dans des cellules épithéliales intestinales pour le traitement d'une inflammation

Country Status (1)

Country Link
WO (1) WO2024064879A2 (fr)

Similar Documents

Publication Publication Date Title
Kodama et al. Increases in p53 expression induce CTGF synthesis by mouse and human hepatocytes and result in liver fibrosis in mice
Leemans et al. Renal-associated TLR2 mediates ischemia/reperfusion injury in the kidney
Fanton d'Andon et al. Leptospira Interrogans induces fibrosis in the mouse kidney through Inos-dependent, TLR-and NLR-independent signaling pathways
JP7160683B2 (ja) 術後癒着の予防及び治療のための方法及び組成物
EP3307329A2 (fr) Traitement et diagnostic du cancer
Hirsova et al. TRAIL deletion prevents liver inflammation but not adipose tissue inflammation during murine diet‐induced obesity
WO2011031600A1 (fr) Utilisation d'antagonistes de l'il-33 à des fins de traitement des maladies fibrotiques
US20160354427A1 (en) Methods for inducing epithelial cancer cell senescence
US20110244059A1 (en) Inhibiting obesity progression by inhibiting adipocyte differentiation with a pre-adipocyte autophagy inhibitor
Hu et al. Interleukin-35 pretreatment attenuates lipopolysaccharide-induced heart injury by inhibition of inflammation, apoptosis and fibrotic reactions
Bai et al. Myeloid cells protect intestinal epithelial barrier integrity through the angiogenin/plexin‐B2 axis
Yu et al. Reducing inflammatory cytokine production from renal collecting duct cells by inhibiting GATA2 ameliorates acute kidney injury
Chen et al. LincRNA‐EPS alleviates severe acute pancreatitis by suppressing HMGB1‐triggered inflammation in pancreatic macrophages
JP2018503685A (ja) 線維化を処置および予防するためのならびに創傷治癒を促進するための抗ｎｅｔ化合物
Chao et al. Early systemic granulocyte-colony stimulating factor treatment attenuates neuropathic pain after peripheral nerve injury
Yang et al. Liver kinase B1/AMP-activated protein kinase pathway activation attenuated the progression of endotoxemia in the diabetic mice
US20160136237A1 (en) Ngal and urinary tract infection
Mar et al. LY6E is a pan-coronavirus restriction factor in the respiratory tract
Lau et al. Genetic disruption of the inflammasome adaptor ASC has minimal impact on the pathogenesis of Duchenne muscular dystrophy in mdx mice
US20100260718A1 (en) Irf-4 as a tumor suppressor and uses thereof
EP3242680B1 (fr) Un agoniste pour le traitement d'une infection urinaire
WO2024064879A2 (fr) Inhibition de l'interféron lambda (ifnl) dans des cellules épithéliales intestinales pour le traitement d'une inflammation
Sposito et al. Type III interferons induce pyroptosis in gut epithelial cells and delay tissue restitution upon acute intestinal injury
Zhang et al. d-Mannose promotes recovery from experimental colitis by inducing AMPK phosphorylation to stimulate epithelial repair
WO2018200473A1 (fr) Détection et ciblage d'une référence croisée de neutrophiles favorisant une tumeur à des applications associées

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23869221

Country of ref document: EP

Kind code of ref document: A2