WO2016052851A1 - 암 특이적 트랜스-스플라이싱 라이보자임 및 이의 용도 - Google Patents

암 특이적 트랜스-스플라이싱 라이보자임 및 이의 용도 Download PDF

Info

Publication number
WO2016052851A1
WO2016052851A1 PCT/KR2015/007694 KR2015007694W WO2016052851A1 WO 2016052851 A1 WO2016052851 A1 WO 2016052851A1 KR 2015007694 W KR2015007694 W KR 2015007694W WO 2016052851 A1 WO2016052851 A1 WO 2016052851A1
Authority
WO
WIPO (PCT)
Prior art keywords
ribozyme
gene
cancer
recombinant vector
cells
Prior art date
Application number
PCT/KR2015/007694
Other languages
English (en)
French (fr)
Inventor
이성욱
김주현
정진숙
한상영
Original Assignee
단국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020140185976A external-priority patent/KR101712247B1/ko
Application filed by 단국대학교 산학협력단 filed Critical 단국대학교 산학협력단
Priority to US15/515,266 priority Critical patent/US10280420B2/en
Priority to EP15847264.7A priority patent/EP3202909B1/en
Priority to JP2017518146A priority patent/JP6633626B2/ja
Publication of WO2016052851A1 publication Critical patent/WO2016052851A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • the present invention provides a kit comprising (i) a tissue specific promoter; And (ii) a ribozyme-target gene expression cassette comprising a trans-splicing ribozyme that targets a cancer specific gene and a gene of interest linked to the 3 ′ exon of the ribozyme, wherein the expression
  • the cassette has a splicing donor / splicing acceptor sequence (SD / SA sequence) linked to the 5 'end of the ribozyme-purpose gene expression cassette, and a woodchuck hepatitis (WPRE) at the 3' end.
  • RNA-122a a recombinant vector, characterized in that the nucleic acid sequence that recognizes the micro RNA-122a (microRNA-122a, miR-122a) is further linked to the 3 'end of the WPRE, Transformed cells into which a recombinant vector is introduced, a ribozyme expressed from the recombinant vector, a pharmaceutical composition for preventing or treating liver cancer comprising the recombinant vector or ribozyme and the It relates to a method for treating liver cancer using the composition.
  • Cancer is one of the leading causes of death in Korea, and it can occur in all parts of the human body and can be caused by various factors such as environmental factors and genetic factors. There have been numerous studies to conquer cancer, but it has not been conquered yet. Existing treatments for cancer include surgery, chemotherapy and radiation therapy, and the prognosis is improving with the development of medicine, but there are many limitations that may adversely affect normal cells as well as cancer cells. Recently, different therapies are being studied, and among them, gene therapies for effectively treating only cancer cells have been actively studied.
  • Gene therapy refers to a method of genetically treating a congenital or acquired gene abnormality that is difficult to treat by conventional methods.
  • gene therapy may be performed by expressing therapeutic proteins by administering genetic material such as DNA and RNA in the human body to treat and prevent chronic diseases such as congenital or acquired genetic defects, viral diseases, cancer or cardiovascular diseases. It is a therapeutic method to suppress the expression of a specific protein. This is a method that is expected to overcome the incurable disease as well as to replace the existing medical methods because it can fundamentally treat the cause of the disease at the genetic level.
  • cancer tissue targeted therapy has been attempted in an effort to reduce side effects caused by the expression of many of the target genes that can be used for gene therapy in general cells that divide a lot of cells (Fukuzawa et. al., Cancer Res 64: 363-369, 2004).
  • a method of using a tissue-specific promoter instead of CMV or RSV is being considered, but due to the disadvantage of poor therapeutic efficacy instead of increasing specificity, it has not been brought to practical use.
  • tissue-specific cancer treatment adenoviruses using factors other than tissue-specific promoters have been conducted.
  • a method using a trans-splicing ribozyme is developed. It is becoming.
  • trans-splicing ribozymes based on these Group I introns target specific RNAs that are specifically expressed only in the gene transcripts or disease cells associated with the disease, correcting them with normal RNA, or It is expected that reprogramming to be replaced with therapeutic gene transcripts could lead to disease specific and safe gene therapy techniques.
  • trans-splicing ribozymes can induce expression of desired therapeutic gene products while simultaneously eliminating disease specific RNA, thereby doubling the therapeutic effect.
  • trans-splicing ribozymes targeting hTERT human telomerase reverse transcriptase
  • hTERT human telomerase reverse transcriptase
  • treatments targeting hTERT show telomerase activity even in normal cells such as stem cells, hematopoietic stem cells, germ cells, and regenerating normal liver cells. There is a problem that can cause toxicity.
  • the cassette has a splicing donor / splicing acceptor sequence (SD / SA sequence) linked to the 5 'end of the ribozyme-purpose gene expression cassette, and a woodchuck hepatitis (WPRE) at the 3' end.
  • RNA-122a a nucleic acid sequence that recognizes the micro RNA-122a (microRNA-122a, miR-122a) is further linked to the 3 'end of the WPRE provides a recombinant vector It is.
  • Another object of the present invention is to provide a transformed cell into which the recombinant vector is introduced.
  • Still another object of the present invention is to provide a ribozyme expressed from the recombinant vector.
  • Another object of the present invention to provide a pharmaceutical composition for preventing or treating liver cancer comprising the recombinant vector or ribozyme as an active ingredient.
  • Still another object of the present invention is to provide a method for treating liver cancer, comprising administering to the subject in need of treatment the recombinant vector or ribozyme in a pharmaceutically effective amount.
  • the recombinant vector of the present invention and the ribozyme expressed therefrom include tissue-specific promoters, SD / SA and WPRE to enhance the expression level of ribozyme, and tissue-specific microRNA target sites, thereby increasing expression efficiency while maintaining normal tissue.
  • tissue-specific promoters SD / SA and WPRE to enhance the expression level of ribozyme, and tissue-specific microRNA target sites, thereby increasing expression efficiency while maintaining normal tissue.
  • Toxic effects on the treatment can reduce the toxicity and increase both the therapeutic effect and safety, which can be widely used in the field of gene therapy in the future.
  • FIG. 1 is a schematic diagram showing the configuration of a trans-splicing ribozyme derivative of the present invention.
  • PL PEPCK-Lacz
  • PT PEPCK-TK
  • EPRT-122aT PEPCK-SD / SA-Rib-TK-WPRE-122aT
  • EPRT-mut 122aT PEPCK-SD /
  • a schematic of SA-Rib-TK-WPRE-mut 122aT), PRT-122aT and PRT-mut 122aT recombinant vectors is shown.
  • Figure 3 shows the graph confirmed by realtime-PCR to increase the expression of the ribozyme further connected to SD / SA and WPRE.
  • FIG. 4 is a graph showing that the effect of inducing apoptosis when transduced with the ribozyme (EPRT-122aT, EPRT-mut 122aT) linked to SD / SA and WPRE in miR-122a - phosphorus Hep3B cells.
  • Figure 5a is a trans-splicing ribozyme linked to a cancer gene therapy drug to Huh7 cells miR-122a + miR-122aT mut-122aT when transfected with a recombinant vector PRT-122aT, EPRT-122aT additionally linked
  • PRT-122aT a recombinant vector linked to the cell death
  • Figure 5b is a trans-splicing ribozyme linked to a cancer gene therapy agent in Huh7.5 cells of miR-122a + miR-122aT mutated when transfected with the recombinant vectors PRT-122aT, EPRT-122aT additionally linked
  • a decrease in cell death was observed through a graph of the MTS assay.
  • FIG. 7 shows recombinant adenoviruses Ad-PT, Ad-PRT-122aT, and Ad-EPRT in each of cells expressing miR-122a by tetracycline and cells not expressing miR-122a by tetracycline (miR-122a - -) cell death as compared to the cells of the cell shown in Tet -122aT and Ad-EPRT-mut 122aT each infection was shown in Figure 7a by the MTS assay Tet + (miR-122a +) Figure 7b It is graphed to observe that is hardly induced.
  • Ad-PRT-122aT as a positive control (10 x 10 10 )
  • the adenovirus Ad of the present invention to confirm the toxicity in normal cells as the adenovirus of the present invention is continuously expressed -Hepatocellular value (AST, ALT) was measured over time (2 days, 7 days, 14 days) by treatment with various concentrations of EPRT-122aT.
  • FIG. 9 shows various concentrations (10) of PBS as a negative control, Ad-PRT-122aT (10 x 10 10 ) and adenovirus Ad-EPRT-122aT of the present invention as a negative control in an orthotopic multiple liver cancer mouse model transplanted with a tumor in the spleen.
  • x 10 10 , 2 x 10 10 , 1 x 10 10 and 0.5 x 10 10 9A is shown as the weight of tumor tissue.
  • Figure 9b shows the results of measuring the hepatocyte levels (AST, ALT) at the same time.
  • FIG. 10 shows various concentrations (10) of PBS as a negative control, Ad-PRT-122aT (10 x 10 10 ) and adenovirus Ad-EPRT-122aT of the present invention as a negative control in an orthotopic multiple liver cancer mouse model transplanted with a tumor in the spleen.
  • x 10 10 , 2 x 10 10 , 1 x 10 10 and 0.5 x 10 10 and then obtained and observed the mouse liver.
  • FIG. 11 shows various concentrations (10) of PBS as a negative control, Ad-PRT-122aT (10 x 10 10 ) and adenovirus Ad-EPRT-122aT of the present invention as a negative control in an in situ multiple liver cancer mouse model implanted with a tumor in the spleen.
  • x 10 10 , 2 x 10 10 , 1 x 10 10, and 0.5 x 10 10 x 10 10 , and then obtained the liver of the mouse and confirmed the result of H & E staining.
  • FIG. 12 shows Ad-PRT-122aT (10 ⁇ 10 10 ), Ad-EPRT-122aT (10 ⁇ 10 10 ), Ad-EPRT-122aT (2) in xenograft model (in situ multiple liver cancer model) transplanted with tumor in spleen x 10 10 ), Ad-EPRT-122aT (1 x 10 10 ), and Ad-EPRT-122aT (0.5 x 10 10 ), respectively, were treated systemically, and then the degree of introduction of the injected adenovirus vector The gDNAs of liver cancer tissues were extracted and confirmed at the molecular level.
  • One embodiment of the present invention for achieving the above object is (i) a tissue specific promoter; And (ii) a ribozyme-target gene expression cassette comprising a trans-splicing ribozyme that targets a cancer specific gene and a gene of interest linked to the 3 ′ exon of the ribozyme, wherein the expression
  • the cassette has a splicing donor / splicing acceptor sequence (SD / SA sequence) linked to the 5 'end of the ribozyme-purpose gene expression cassette, and a woodchuck hepatitis (WPRE) at the 3' end.
  • RNA-122a a nucleic acid sequence that recognizes the micro RNA-122a (microRNA-122a, miR-122a) is further linked to the 3 'end of the WPRE provides a recombinant vector do.
  • the recombinant vector may include a nucleic acid sequence represented by SEQ ID NO: 18.
  • the recombinant vector uses the SD / SA sequence and the WPRE at the same time, based on the fact that the ribozyme and the WPRE and the SD / SA sequence at both ends of the target gene as components are excellent in cancer treatment effect in vivo.
  • a nucleic acid sequence that recognizes microRNA-122a may be further included, thereby enabling specific treatment to cancer cells, particularly liver cancer cells.
  • vector refers to a gene construct, which is an expression vector capable of expressing a protein of interest in a suitable host cell, and which contains essential regulatory elements operably linked to express a gene insert.
  • operably linked refers to a functional linkage of a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function.
  • the ribozyme coding sequence is operably linked to a promoter such that expression of the ribozyme coding sequence is under the influence or control of this promoter.
  • Two nucleic acid sequences are operably linked when the ribozyme coding sequence is transcribed by inducing promoter action, and the nature of the linkage between the two sequences It does not induce frame-shift mutations and is operably linked if expression control sequences do not interfere with the ability to dominate ribozyme expression.
  • Operable linkage with recombinant vectors can be made using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation can employ enzymes commonly known in the art.
  • the vector of the present invention includes a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals, enhancers and can be prepared in various ways according to the purpose. .
  • the promoter of the vector may be constitutive or inducible.
  • the expression vector includes a selectable marker for selecting a host cell containing the vector and, in the case of a replicable expression vector, a replication origin. Vectors can self replicate or integrate into host DNA.
  • the vector may include a plasmid vector, a cosmid vector or a viral vector, and specifically, may be a viral vector.
  • Viral vectors are retroviruses such as Human immunodeficiency virus HIV (Murine leukemia virus) Avian sarcoma / leukosis (ASLV), Spleen necrosis virus (SNV), Rous sarcoma virus (RSV) and Mouse mammary (MMTV). tumor viruses, and the like, but are not limited to vectors derived from Adenovirus, Adeno-associated virus, Herpes simplex virus, and the like. More specifically, the recombinant vector of the present invention may be a recombinant adenovirus vector.
  • expression cassette of the present invention includes a promoter and a trans-splicing ribozyme-target gene, wherein the SD / SA sequence and the WPRE sequence are present at each end of the trans-splicing ribozyme-target gene.
  • Trans-splicing characterized in that the nucleic acid sequence recognizing micro RNA-122a (microRNA-122a, miR-122a) is further connected to the 5 'end and the 3' end, respectively, and to the 3 'end of the WPRE.
  • the ribozyme-purpose gene expression cassette may further include a sequence for controlling the level of a transcript, ie, a regulatory derivative, in a sequence to which the ribozyme and the target gene are linked, but are not limited thereto.
  • a splicing donor / splicing acceptor sequence SD / SA sequence
  • WPRE Woodchuck hepatitis virus Posttranscriptional Regulatory Element
  • the sequence recognizing RNA-122a is further linked to adjust the expression level and tissue-specific expression of the ribozyme-target gene.
  • the ribozyme-purpose gene expression cassette of the present invention is linked to the splicing donor / splicing sequence (SD / SA) at the 5 'end of the ribozyme, and the WPRE at the 3' end of the gene of interest.
  • the sequence that recognizes the micro RNA-122a may be linked to the 3 'end of the WPRE.
  • SD / SA increases transcription initiation and processing of RNA ploymerase II and nucleocytoplasmic export of mRNA from the nucleus, and WPRE is processed from the nucleus to the cytoplasm.
  • WPRE is processed from the nucleus to the cytoplasm.
  • Increasing the migration of can increase pre-mRNA levels, respectively.
  • the RNA level of the ribozyme is significantly increased in the cell and the amount of the transcript is increased, thereby increasing the apoptosis of the cancer cell in the cell and the living body while allowing the cancer cell to be specifically expressed. Toxicity may be reduced rather than reduced.
  • the expression of ribozyme is increased to further increase the effect of inducing cell death, and miR
  • miR-122aT targeting -122a
  • hepatic cell specificity was induced by inducing cell death only in hepatocellular carcinoma cells with reduced miR-122a expression, without inducing cell death for normal liver cells in which miR-122a expression was normally expressed. It was confirmed that the treatment is possible (Figs. 5 to 7).
  • the SD / SA sequence is a sequence corresponding to the beginning and end of the intron cut out in the splicing reaction to remove the intron of the RNA transcript, in general, the SD sequence may be a GU sequence at the intron 5 'end. , SA sequence may be an AG sequence of the 3 'end of the intron. In the present invention, the SD / SA sequence may include the nucleic acid sequence of SEQ ID NO: 3, but is not limited thereto as long as it can exist in the target gene expression cassette and promote expression of the target gene.
  • the WPRE refers to a sequence that induces a tertiary structure that promotes expression on DNA, thereby increasing the expression of the gene.
  • the WPRE may have a nucleic acid sequence of SEQ ID NO: 7, but is not limited thereto as long as it can exist in the target gene expression cassette and promote expression of the target gene.
  • microRNA-122a The nucleic acid sequence that recognizes the micro RNA-122a (microRNA-122a, miR-122a) is referred to herein as miR-122aT (microRNA-122a target site).
  • miR-122aT microRNA-122a target site.
  • Micro RNA-122a is normally expressed in normal cells, but decreases in expression in liver cancer cells. This can be used to develop a therapeutic agent that increases the sensitivity and specificity for liver cancer cells, and in particular, in the present invention, a nucleic acid sequence that recognizes microRNA-122a (microRNA-122a, miR-122a) because the target gene is linked to ribozyme. By linking the liver cancer cell-specific ribozyme expression can be made.
  • cancer specific gene of the present invention means a gene that is specifically expressed or significantly overexpressed only in cancer cells according to the present invention.
  • the cancer specific gene may add a feature in which the ribozyme according to the present invention may act cancer-specificly.
  • Representative examples of such cancer-specific genes include mRNA of Telomerase reverse transcriptase (ERTT), alphafetoprotein (AFP) mRNA, carcinoembryonic antigen (CEA) mRNA, prostate-specific antigen (PSA) mRNA, or cytoskeleton-associated protein 2 (CKAP2).
  • mRNA may be used, specifically, TERT (Telomerase reverse transcriptase) mRNA may be used, and more specifically, human telomerase reverse transcriptase (hTERT) mRNA may be used.
  • TERT Telomerase reverse transcriptase
  • TERT Telomerase reverse transcriptase
  • the term "Telomerase reverse transcriptase” (TERT) of the present invention is one of the most important enzymes that regulate the ability of cancer cells to survive and their ability to proliferation, and forms a terminal granule structure on the chromosome to protect the end of the chromosome. Means enzymes that inhibit the aging of cells through. In normal cells, every time the cell divides, the length of the terminal granules decreases little by little, resulting in the loss of genetic material and the cell death. However, in cancer cells, since the enzyme continues to prolong the terminal granules, the cells do not die and are known to be a serious obstacle to treating cancer by directly contributing to the immortality of cancer cells.
  • telomerases have telomerase activity of 80-90% in germ cells, hematopoietic cells and cancer cells that replicate indefinitely, but normal cells around cancer cells do not have that activity.
  • hTERT mRNA may be used as a cancer-specific gene, but is not limited thereto.
  • promoter of the present invention is involved in the binding of RNA polymerase to initiate transcription into a portion of DNA.
  • a protein that introduces an RNA polymerase or RNA polymerase a so-called transcription factor, binds to the enzyme or protein. It can be induced to be located at the starting site. In other words, it is located at the 5 'region of the gene to be transcribed on the sense strand and induces RNA polymerase to bind to the position directly or through a transcription factor to initiate mRNA synthesis for a target gene.
  • a universal promoter retrovirus LTR, Rous Sarcoma Virus (RSV) or cytomegalovirus (CMV) promoter, may be used. -Specific promoters can be used.
  • tissue-specific promoter refers to a non-translated nucleic acid sequence upstream of a coding region, which has transcription initiation activity specifically for the mRNA downstream of the promoter, depending on the tissue.
  • Tissue-specific nucleic acid sequences that initiate transcription of promoter subgenes may include, without limitation, various promoter sequences, for example, a hepatocellular specific promoter, a phosphoenolpyruvate carboxykinase (PEPCK) promoter, apolipoprotein E (apolipoprotein E).
  • PEPCK phosphoenolpyruvate carboxykinase
  • the PEPCK promoter may be a promoter comprising a nucleic acid sequence of SEQ ID NO: 2, may further include an enhancer that acts on the PEPCK promoter comprising the nucleic acid sequence of SEQ ID NO: 1.
  • ribozyme of the present invention is a molecule consisting of an RNA molecule that acts like an enzyme or a protein comprising the RNA molecule, also called an RNA enzyme or catalytic RNA.
  • RNA molecules with a clear tertiary structure carry out chemical reactions and have catalytic or autocatalytic properties, and some ribozymes have been shown to inhibit activity by cleaving magnetic or other RNA molecules, while other ribozymes It has been identified that catalyzes the aminotransferase activity of ribosomes.
  • Such ribozymes may include hammerhead ribozymes, VS ribozymes, and hairpin ribozymes.
  • the ribozyme may inhibit the activity of cancer-specific genes through a trans-splicing reaction, resulting in selective anticancer effects, as well as being expressed in a conjugated form with cancer treatment genes and thus cancer treatment genes. Can be activated. Therefore, any type of compound can be used as long as it exhibits an activity capable of inactivating cancer specific genes and activating cancer therapeutic genes.
  • the ribozyme may be to include the nucleic acid sequence of SEQ ID NO: 5.
  • the ribozyme of the present invention is a ribozyme that targets the hTERT mRNA described above, and specifically cleaves and inhibits hTERT mRNA by targeting hTERT overexpressed cancer cells, particularly liver cancer cells.
  • HSVtk Herpes simplex virus-thymidine kinase
  • the ribozyme of the present invention plays an important role in targeting and treating cancer cells without toxicity to normal cells by reaching the liver with a recombinant vector capable of expressing ribozyme into a liver such as adenovirus.
  • trans-splicing means linking RNAs from different genes. Specifically, it may be to use the hTERT target trans-splicing group I ribozyme, which has been demonstrated to be capable of recognizing and trans-splicing mRNA of human telomerase reverse transcriptase (hTERT) specific to cancer.
  • hTERT human telomerase reverse transcriptase
  • the inventors have devised a recombinant adenovirus capable of expressing a gene of interest together with the ribozyme. That is, the recombinant adenovirus may function to insert a target gene included in the target gene expression cassette linked to the ribozyme into the cancer specific gene transcript through a trans-splicing ribozyme specific to the cancer specific gene. Can be.
  • target gene refers to a gene linked to the mRNA of a cancer-specific gene by the ribozyme to induce expression, and may be a therapeutic gene or a reporter gene in the present invention, but is not limited thereto.
  • the term “anti-cancer therapeutic gene” refers to a polynucleotide sequence that encodes a polypeptide that exhibits a therapeutic effect upon expression in cancer cells.
  • the cancer treatment gene may be expressed in a conjugated form with the ribozyme or independently, and may exhibit anticancer activity.
  • cancer therapy genes include drug-sensitive genes, apoptosis genes, cytostatic genes, cytotoxic genes, tumor suppressor genes, antigenic genes, cytokine genes, anti-angiogenic genes, and the like.
  • the present invention may be used alone or in combination of two or more cancer treatment genes.
  • the drug-sensitizing gene is also called a suicide gene because a cell into which a gene is introduced is killed as a gene for an enzyme that converts a non-toxic precursor into a toxic substance.
  • a non-toxic precursor is administered systemically to a normal cell, the precursor is converted into a toxic metabolite only to cancer cells, thereby destroying cancer cells by changing sensitivity to drugs.
  • HSVtk Herpes simplex virus-thymidine kinase
  • ganciclovir E. coli cytosine deaminase (CD) gene and 5-fluorocytosine (5-FC) It is possible, but not limited to the above.
  • the proapoptotic gene refers to a nucleotide sequence that is expressed and induces programmed cell death.
  • Apoptosis genes known to those skilled in the art, encoding p53, adenovirus E3-11.6K (from Ad2 and Ad5) or adenovirus E3-10.5K (from Ad), adenovirus E4 gene, p53 pathway gene and caspase Genes may be included.
  • the cytostatic gene refers to a nucleotide sequence that is expressed in a cell and stops the cell cycle during the cell cycle. Examples include p21, retinoblastoma gene, E2F-Rb fusion protein gene, genes encoding cyclin-dependent kinase inhibitors (eg, p16, p15, p18 and p19), growth arrest specific homeobox , GAX) gene, and the like, but is not limited thereto.
  • the cytotoxic gene refers to a nucleotide sequence that is expressed in a cell and exhibits a toxic effect. Examples include, but are not limited to, nucleotide sequences encoding Pseudomonas exotoxin, lysine toxin, diphtheria toxin, and the like.
  • the tumor suppressor gene refers to a nucleotide sequence that can be expressed in a target cell to suppress a tumor phenotype or induce apoptosis.
  • Tumor necrosis factor- ⁇ (TNF- ⁇ ), p53 gene, APC gene, DPC-4 / Smad4 gene, BRCA-1 gene, BRCA-2 gene, WT-1 gene, retinoblastoma gene, MMAC -1 gene, adenomatous polyposis coil protein, missing colon tumor (DCC) gene, MMSC-2 gene, NF-1 gene, esophageal tumor suppressor gene located on chromosome 3p21.3, MTS1 Gene, CDK4 gene, NF-1 gene, NF-2 gene, VHL gene or sPD-1 (programmed death-1).
  • the antigenic gene refers to a nucleotide sequence that is expressed in target cells to produce cell surface antigenic proteins that can be recognized by the immune system.
  • antigenic genes known to those of skill in the art may include carcinoembryonic antigens (CEAs) and p53.
  • the cytokine gene refers to a nucleotide sequence that is expressed in a cell to produce a cytokine.
  • the anti-angiogenic gene refers to a nucleotide sequence that is expressed to release anti-angiogenic factors out of the cell. Examples include angiostatin, inhibitors of vascular endothelial growth factor (VEGF), endostatin, and the like.
  • VEGF vascular endothelial growth factor
  • HSVtk a type of cancer therapeutic gene
  • the recombinant vector was prepared to specifically express the liver cancer cells by additionally including the miR-122aT sequence, and when the recombinant vector including both SD / SA and WPRE was introduced, the expression level was increased ( 4).
  • the induction of cell death was increased compared to cells in which miR-122a was normally expressed (FIGS. 5 to 7), and miR-122a was normally expressed with normal cells. It was confirmed that liver cancer cells can be selectively treated by distinguishing liver cancer cells having reduced expression of 122a.
  • adenovirus (Ad-EPRT-122aT) of the present invention showed no cytotoxicity to normal cells (Fig. 8), the existing adenovirus ( Ad-PRT-122aT), even when treated with an amount of 1/10 of the anti-cancer effect was confirmed to be superior to the existing adenovirus (Fig. 9a, 9b, 10 and 11), the animal liver was transplanted with normal liver Adenovirus introduction into liver cancer tissue was confirmed at the molecular level (FIG. 12).
  • trans-splicing ribozyme linked to a cancer gene therapy drug to which SD / SA, WPRE and miR-122aT of the present invention are additionally linked not only increases cell death induction efficiency of liver cancer cells but also inhibits normal cell death. By minimizing side effects, cancer-specific therapeutic effects can be enhanced.
  • HSVtk Herpes simplex virus-thymidine kinase
  • the enzyme is a representative example of a drug-sensitive gene that causes non-toxic precursors to be converted into toxic substances, causing the cells to which the gene is introduced to die.
  • the HSVtk gene may be used as a cancer treatment gene that is expressed in a conjugated form to the ribozyme according to the present invention and exhibits anticancer activity.
  • Such HSVtk gene may specifically include a nucleic acid sequence represented by SEQ ID NO: 6, Genbank accession numbers AAP13943, P03176, AAA45811, P04407, Q9QNF7, KIBET3, P17402, P06478, P06479, AAB30917, P08333, BAB84107, AAP13885, AAL73990, AAG40842, BAB11942, NP_044624, NP_044492, CAB06747 and the like.
  • reporter gene is a gene used to monitor whether the recombinant vector of the present invention is introduced or the efficiency of ribozyme expression, and a gene which can be monitored without damaging an infected cell or tissue may be used without limitation.
  • luciferase green fluorescent protein (GFP), modified green fluorescent protein (mGFP), enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP) , Modified red fluorescent protein (mRFP), enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow Fluorescent protein (EYFP), indigo blue fluorescent protein (CFP) or enhanced indigo blue fluorescent protein (ECFP).
  • the expression level of cancer cell-specific ribozyme can be observed.
  • the ribozyme of the present invention includes a tissue-specific promoter and a microRNA target site, and thus is not expressed in normal cells. It is apparent to those skilled in the art that cancer cells can be specifically expressed without the use thereof and thus can be applied to diagnose whether cancer has occurred in a specific tissue.
  • Another embodiment of the present invention provides a transformed cell into which the recombinant vector is introduced.
  • introduction refers to the introduction of foreign DNA into cells by transfection or transduction.
  • Transfections include sugars such as calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroshock, microinjection, liposome fusion, lipofectamine and protoplast fusion. It can be carried out by various methods known in the art. Transduction can also deliver genes into cells using viral or viral vector particles by means of infection.
  • transformed cell refers to a cell into which a polynucleotide of interest is introduced into a host cell. Transformation can be accomplished by the "introduction" method described above and can be carried out by selecting appropriate standard techniques depending on the host cell as is known in the art.
  • a recombinant vector was introduced into a cell using PEI, or a cell was injected into a cell using an adenovirus as a carrier to prepare a transformed cell into which the recombinant vector was introduced. It can be prepared using a method for manufacturing a cell.
  • the transformed cells of the present invention comprise (i) a tissue specific promoter; And (ii) a trans-splicing ribozyme that targets a cancer-specific gene, a ribozyme-purpose gene expression cassette comprising a target gene linked to the 3 'exon of the ribozyme, wherein the expression
  • the cassette has a splicing donor / splicing acceptor sequence (SD / SA sequence) linked to the 5 'end of the ribozyme-purpose gene expression cassette, and a woodchuck hepatitis (WPRE) at the 3' end.
  • RNA-122a microRNA-122a, miR-122a
  • WPRE virus Posttranscriptional Regulatory Element
  • Yet another embodiment of the present invention provides a ribozyme expressed from the recombinant vector.
  • a ribozyme expressed from the recombinant vector is as described above.
  • Another embodiment of the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising the recombinant vector or the ribozyme as an active ingredient.
  • cancer of the present invention is a state in which a problem arises in the regulation of normal division, differentiation and death of cells, abnormally overgrown, invading surrounding tissues and organs to form agglomerates, and destroying or modifying existing structures.
  • the cancer may be liver cancer.
  • prevention means any action that inhibits or delays the onset of cancer by administration of a recombinant adenovirus or composition according to the present invention.
  • treatment means any action by which administration of a recombinant adenovirus or composition according to the invention improves or beneficially alters cancer.
  • composition for preventing or treating cancer of the present invention may further include a pharmaceutically acceptable carrier, excipient or diluent.
  • Examples of pharmaceutically acceptable carriers, excipients and diluents that may be used in the pharmaceutical compositions of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate , Gelatin, calcium phosphate, calcium silicate, calcium carbonate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxy benzoate, talc, magnesium stearate, mineral oil and the like.
  • the pharmaceutical composition of the present invention may be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral dosage forms, external preparations, suppositories, and sterile injectable solutions according to conventional methods.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants are usually used.
  • solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc may also be used.
  • Liquid preparations for oral administration include suspensions, solvents, emulsions, and syrups.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • Another embodiment of the present invention provides a method for treating cancer, comprising administering the recombinant vector or the ribozyme in a pharmaceutically effective amount to a subject in need thereof.
  • the cancer may be liver cancer.
  • the term “pharmaceutically effective amount” means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, wherein the effective dose level is determined by the patient's sexually transmitted disease, age, type of disease, severity, It can be determined according to the activity of the drug, sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of treatment, factors including the concurrent drug and other factors well known in the medical field.
  • the pharmaceutical compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. In addition, the pharmaceutical compositions of the present invention may be administered in a single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.
  • the term "individual" of the present invention includes animals or humans such as horses, sheep, pigs, goats, camels, antelopes, dogs etc. with cancer whose symptoms may be improved by administration of the therapeutic composition according to the present invention.
  • the treatment method according to the present invention may be a method of treating an individual except a human, but is not limited thereto. That is, in the case of humans, considering that the cancer can be improved by the administration of the therapeutic composition according to the present invention, it can be sufficiently used in the treatment of humans.
  • administration means introducing a predetermined substance into an animal by any suitable method, and the route of administration of the therapeutic composition according to the present invention is oral or via any general route as long as it can reach the target tissue. Parenteral administration.
  • the therapeutic composition according to the present invention can be administered by any device that the active ingredient can move to the target cell.
  • Preferred dosages for the therapeutic compositions according to the invention vary depending on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, and may be appropriately selected by those skilled in the art.
  • the pharmaceutical composition of the present invention is preferably administered at 1 to 10 mg / kg, preferably at 1 to 5 mg / kg. Administration may be administered once a day or may be divided several times.
  • the therapeutic composition of the present invention can increase the anticancer effect by using alone or in combination with known anticancer agents or in combination with adjuvant treatment methods such as surgical surgery.
  • Chemotherapeutic agents that can be used with the compositions of the invention include cisplatin, carboplatin carboplatin, procarbazine, mechlorethamine, cyclophosphamide ), Ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, diactinomycin, daunorubicin, doxorubicin, doxorubicin (doxorubicin), bleomycin, blecomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5-fluorouracil, vincristin, vinblastin, methotrexate, and the like.
  • radiation therapy that can be used with the compositions of the invention includes X-ray irradiation and ⁇
  • the hepatocyte specific promoter PEPCK promoter (SEQ ID NO: 2)
  • SA Splicing Donor / Splicing Acceptor, SEQ ID NO: 3
  • WPRE Wiodchuck hepatitis virus Posttranscriptional Regulatory Element, SEQ ID NO: 7
  • miR-122aT miR-122aT
  • miR-122aT refers to a nucleic acid sequence (miR-122a target site (miR-122aT), SEQ ID NO: 8) that recognizes microRNA-122a (miR-122a) that is specifically expressed in hepatocytes.
  • TK was used as an example of one of the cancer gene therapeutics that can be used to mean the anti-HSV gene preparation HSVtk (herpes simplex virus thymidine kinase, SEQ ID NO: 6).
  • HTERT targeting T / S ribozyme using the PEPCK promoter targets the +21 site of hTERT; antisense sequence for the +30 to +324 site, extended P1 helix, P10 site of 6 nucleotides Cloning was performed by inserting the SD / SA upstream of the 5 'upstream and inserting the WPRE behind the TK linked to the ribozyme.
  • the 5 'end of the ribozyme-target gene includes a slicing donor / splicing acceptor site (SD / SA) and the 3' end of the ribozyme-target gene.
  • SD / SA slicing donor / splicing acceptor site
  • the vector was cut with restriction enzyme BglII (Fermentas) to remove the intermediate region of ribozyme from the antisense portion of ribozyme.
  • BglII Framas
  • the pAVQ SD / SA CRT vector into which the existing SD / SA was inserted was cut with restriction enzyme BglII (Fermentas), and the ribozyme from SD / SA was used. The intermediate part was obtained.
  • the vector and insert obtained in the above manner were mixed at a ratio of 1: 10 and then ligation reaction was performed using T4 DNA ligase (Roche) overnight at 4 ° C.
  • the obtained ligated vector was introduced into DH5 ⁇ E.coli competent cells through heat shock transformation, and then spread evenly on an agar plate containing kanamycin (kanamycin) for 16 hours in an incubator at 37 ° C. Incubated. Colonies grown on agar plates were inoculated in LB medium containing kanamycin and extracted with DNA mini-prep to identify clones containing the inserted insert vector.
  • the vector was cut and prepared with restriction enzyme FseI (Fermentas).
  • FseI restriction enzyme site as a template using the pAVQ CRT WPRE vector
  • the vector and the insert were mixed at a ratio of 1: 10 and then ligated and transformed to obtain clones.
  • PAVQ SD / SA PEPCK Ribozyme TK WPRE vector prepared as described above was prepared by cutting with NotI (Fermentas), and three copies of miR-122aT (TGGAGTGTGACAATGGTGTTTG X3; miR-122a target sequence) were prepared using a primer containing a NotI restriction site. No.
  • the prepared vector and the insert were mixed at a ratio of 1: 10, ligated and transformed to obtain a clone.
  • the clone obtained by the above method was named EPRT-122aT.
  • PRT-mut 122aT PEPCK-Rib-TK-mut 122aT
  • PRT-mut 122aT PEPCK-Rib-TK-mut 122aT
  • pAVQ-rib-TK vector was prepared by cutting with NotI (Fermentas) and 3 copies of miR-122aT (TGGAGTGTGACAATGGTGTTTG X3; miR-122a target sequence) were prepared by forward primer and sequence of SEQ ID NO: 12 including the NotI restriction site. After amplification with a reverse primer of No. 13, cut was prepared with restriction enzyme NotI (Fermentas) to prepare an insert.
  • mut miR-122aT three copies of the mut miR-122aT were forward primers (SEQ ID NO: 14; 5'-ATAAGAATGCGGCCGCACAAACACCATTCCTCACACTGACGATACAAACACCATTCCTCACACT-3 ') and reverse primers (SEQ ID NO: 15; 5'-ATAAGAATGCGGCCGCTCTGTGTGTGTGATGATGATGATGAATGAT After inserting the restriction enzyme cut with NotI (Fermentas).
  • the prepared vector and the insert were mixed at a ratio of 1: 10, ligated and transformed to obtain a clone.
  • the clone obtained by the above method was named PRT-mut 122aT.
  • EPRT-mut 122aT (PEPCK-SD / SA-Rib-TK-WPRE-mut 122aT), was prepared.
  • the prepared pAVQ SD / SA PEPCK Ribozyme TK WPRE vector was prepared by cutting with NotI (Fermentas), and three copies of mut miR-122aT were prepared by forward primer of SEQ ID NO: 14 including NotI restriction enzyme site and SEQ ID NO: 15. After amplification with a reverse primer and cut with restriction enzyme NotI (Fermentas) was prepared an insert.
  • the prepared vector and the insert were mixed at a ratio of 1: 10, ligated and transformed to obtain a clone.
  • the clone obtained by the above method was named EPRT-mut 122aT.
  • FIG. 2 A schematic diagram of each of the prepared plasmids is shown in FIG. 2.
  • Transfer vector was prepared by linearization with restriction enzyme PmeI (NEB), purified by phenol extraction and ethanol precipitation, and electroporation of 1 ⁇ g of DNA and 100ng of pAdenoVator ⁇ E1 / E3 backbone vector onto BJ5183. Electroporation co-transformation was performed.
  • Recombinant vectors homologously recombined in BJ5183 were linearized with restriction enzyme PacI (NEB) and purified by phenol extraction and ethanol precipitation, using calcium phosphate on 293 (Human embryonic kidney) cells. Transfection was performed.
  • PacI restriction enzyme
  • Recombinant viruses amplified in 293 cells were purified by centrifugation at 38,000 rpm using an ultracentrifuge using cesium chloride gradient centrifugation.
  • Dialysis (dialysis) [dH 2 O 1600ml, dialysis buffer (100mM Tris-Cl pH7.5, 10mM MgCl 2 ) 200ml, 100% Glycerol 200ml after aliquoting (aliquot) and stored at -80 °C.
  • the titer of the recombinant virus determined plaque forming units (pfu) using the tissue culture infectious dose for 50% of the cells (TCID50) method.
  • Hep3B cells Human liver cancer cell lines Hep3B cells, Huh7, Huh7.5 and HepG2 cells (Human hepatocellular carcinoma) and human lung cancer cell line SKLU-1 (human lung adenocarcinoma) were used.
  • the cells were cultured in an incubator at 37 ° C., 5% CO 2 , using 10% FBS and 1% penicillin / streptomycin with minimal essential medium (MEM) / Dulbecco's modified eagle medium (DMEM) medium. .
  • 1x PBS Phos
  • Expression levels were measured to confirm the efficiency of ribozyme in which both SD / SA and WPRE were further linked.
  • PRT-122aT, PRT-mut 122aT, EPRT-122aT and EPRT-mut 122aT prepared in Example 1-2 were transduced into Hep3B cells (hTERT + , miR-122a ⁇ ), which are human liver cancer cells, respectively.
  • the expression level of ribozyme was compared by measuring the expression level of HSVtk through realtime-PCR.
  • a PT expressing only HSVtk herepes simplex virus thymidine kinase
  • an anti-HSV gene preparation was used without the ribozyme prepared in Examples 1-2.
  • the realtime-PCR (Corbett-Rotor gene-6000) is a 5x Phire buffer, 10x SyBr (Invitrogen), 0.14 mM dNTP (NEB), 0.14uM 5 'and 3' primer, Phire taq polymerase (0.5U, Finnzyme) Pre-heating at 98 °C for 5 minutes, denaturation at 98 °C for 30 seconds, annealing at 60 °C for 30 seconds, elongation process at 72 °C for 30 seconds at 35 °C, and incubation at 72 °C for 8 minutes Was performed.
  • cDNA was amplified using TK specific binding primers.
  • Reverse primer sequence (SEQ ID NO: 17; 5'-CCATTGTTATCTGGGCGCTTG-3 ')
  • the nucleic acid sequence (miR-122aT) targeting miR-122a is expressed in SD / SA and WPRE to increase efficiency and expressed in normal liver tissue to regulate liver tissue specific expression, but decreased in liver cancer cells.
  • Three replicates were inserted (3 copies), and the plasmid prepared in Example 1 was compared with the plasmid into which mut-122aT was inserted as a negative control group. It was evaluated whether the therapeutic effect can be induced by specifically inducing cell death.
  • Recombinant vector produced in Example 1-2 PT (PEPCK-TK), PRT-122aT (PEPCK-Rib-TK-122aT), EPRT-122aT (PEPCK-SD / SA-Rib-TK-WPRE-122aT) and mut-122aT EPRT (PEPCK-SD / SA-Rib-TK-WPRE 122aT-mut) each Hep3B (hTERT +, miR-122a -), Huh7 (hTERT +, miR-122a +), Huh7.5 (hTERT + , miR-122a + ) cells were transduced.
  • PT PEPCK-TK
  • PRT-122aT PEPCK-Rib-TK-122aT
  • EPRT-122aT PEPCK-SD / SA-Rib-TK-WPRE-122aT
  • mut-122aT EPRT PEPCK-SD / SA-Rib-TK-WPRE 122
  • PEPCK-TK 35 mm dish PT
  • PRT-122aT PEPCK-Rib-TK-122aT
  • EPRT-122aT PEPCK-SD / SA-Rib-TK-
  • WPRE-122aT EPRT-mut 122aT
  • pAVQ vectors were incubated after 2 ug transfection with PEI.
  • TPP 96 well plate
  • SD / SA and WPRE-linked lyozymes (EPRT-122aT, EPRT-mut 122aT) were transduced in miR-122a - phosphorus Hep3B cells. It was confirmed that the cell death was induced more than when Bozaim (PRT-122aT, PRT-mut 122aT) were transduced. From this, the treatment effect of SD / SA and WPRE-linked ribozyme on liver cancer cells was increased. I could confirm that again.
  • miR-122a expresses PRT-122aT and EPRT-122aT, which are recombinant vectors to which miR-122aT is additionally linked to a trans-splicing ribozyme linked to a cancer gene therapeutic agent.
  • PRT-122aT and EPRT-122aT are recombinant vectors to which miR-122aT is additionally linked to a trans-splicing ribozyme linked to a cancer gene therapeutic agent.
  • transduction it was confirmed that cell death was reduced compared to the case of introducing a recombinant vector to which mut-122aT was connected.
  • the ribozyme expressed by transducing a recombinant vector to which miR-122aT is additionally expressed has a liver cancer cell-specific effect. It was confirmed again using the assay using.
  • Ad- PT, Ad-PRT-122aT, Ad-EPRT-122aT and Ad-EPRT-mut 122aT were infected.
  • PBS was used as a control.
  • the culture medium containing GCV was changed every 2 days for 5 days from the next day.
  • EPRT-122aT and EPRT-mut 122aT which express SD / SA and WPRE as additionally linked ribozymes in HepG2 cells induced cell death, induced more cell death. And it was again confirmed that the therapeutic effect could be enhanced by WPRE.
  • the present inventors have found that a stable HepG2 cell was produced for using a cell expressing the tetracycline-dependent miR122a (hTERT - -, miR122a).
  • Tet-on system Tetracycline-inducible system
  • Tet pri-122a controlled by TetR and tetracycline was cloned.
  • a stable cell was produced.
  • Tet pri-122a by tetracycline in normal medium
  • stable cells expressing TetR were prepared first. The stable cell was characterized in that miR-122 expression was suppressed in a normal medium and miR-122a was expressed in a medium to which tetracycline was added.
  • Tet pri-122a stable cells were prepared and Northern blots were used to generate miR-122a by tetracycline on / off. Tet pri-122a stable clone # 5 was selected.
  • Ad-PT and Ad-PRT-122aT prepared in Example 2 were applied to the cells expressing miR-122a by tetracycline and the cells not expressing miR-122a by tetracycline. , Ad-EPRT-122aT and Ad-EPRT-mut 122aT, respectively.
  • Tet - (miR-122a -) a look at the cell death induction efficiency of the cells, the Ad-EPRT-122aT expressing that the SD / SA and WPRE Let Lai more connected in comparison with the case in which the infection of Ad-PRT-122aT When infected, the cell death was increased.
  • Negative control PBS
  • Ad-PRT-122aT 10 ⁇ 10 10
  • Ad-EPRT-122aT 10 ⁇ 10 10
  • Ad-EPRT-122aT using 4-5 week old C57BL mice (2 ⁇ 10 10 )
  • Ad-EPRT-122aT 1 ⁇ 10 10
  • Ad-EPRT-122aT 0.5 ⁇ 10 10
  • Hep3B cells liver cancer cells were transplanted into the spleen in 4-5 week old BALB / c mice (Orient Bio inc.) In an amount of 3 ⁇ 10 6 cells to build a tumor model (isotopic multiple liver cancer model).
  • Negative control PBS
  • Ad-PRT-122aT (10 x 10 10 )
  • Ad-EPRT-122aT (10 x 10 10 )
  • Ad-EPRT-122aT (2 x 10 10
  • Ad-EPRT-122aT (1 x 10 10
  • Ad-EPRT-122aT 0.5 ⁇ 10 10
  • a xenograft model in situ multiple liver cancer model in which Hep3B (liver cancer cells) were transplanted into the spleen GDNA of normal liver and liver cancer tissues after systemic treatment of EPRT-122aT (2 x 10 10 ), Ad-EPRT-122aT (1 x 10 10 ), and Ad-EPRT-122aT (0.5 x 10 10 ), respectively.
  • a xenograft model in situ multiple liver cancer model in which Hep3
  • a negative control group PBS
  • Ad-PRT-122aT 10 ⁇ 10 10
  • Ad-EPRT-122aT 2 x 10 10
  • Ad-EPRT-122aT 1 x 10 10
  • Ad-EPRT-122aT 0.5 x 10 10
  • Ad-EPRT-122aT shows equivalent cancer treatment efficacy through the introduction of an adenovirus corresponding to 1/10 of Ad-PRT-122aT (10 ⁇ 10 10 ).
  • H & E staining of the liver tissues was confirmed that damage to the liver tissues and the immune response did not occur.
  • Ad-EPRT-122aT was dose-dependently infected with both normal liver tissue and transplanted liver cancer tissue.
  • the above results indicate that when introducing hTERT-targeting ribozyme derivative adenovirus (Ad-EPRT-122aT) into which animal models of SD / SA, WPRE, and miR-T were introduced into a liver cancer animal model, it was 1/10 of that of conventional ribozyme adenovirus. This suggests that even small doses have equal anticancer efficacy without liver toxicity. That is, it was confirmed that the anticancer efficiency is increased by the ribozyme introduced with SD / SA and WPRE in animal models. Therefore, the above results are the results of verifying the introduction of adenovirus into animal model normal liver and transplanted liver cancer tissue at the molecular level.
  • trans-splicing ribozyme to which the cancer gene therapy drug to which SD / SA, WPRE and miR-122aT of the present invention is further linked, not only increases cell death induction efficiency of liver cancer cells but also suppresses normal cell death. By minimizing side effects, cancer-specific therapeutic effects can be further enhanced.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 (i) 조직 특이적 프로모터; 및 (ii) 암특이적 유전자를 표적으로 하는 트랜스-스플라이싱 라이보자임 및 상기 라이보자임의 3' 엑손에 연결된 목적 유전자를 포함하는, 라이보자임-목적 유전자 발현 카세트를 포함하며, 상기 발현카세트는 라이보자임-목적 유전자 발현 카세트의 5' 말단에 스플라이싱 공여/스플라이싱 수여 서열(splicing donor/splicing acceptor sequence, SD/SA sequence)이 연결되고, 3' 말단에 WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element)가 연결된 것으로, (iii) 상기 WPRE의 3' 말단에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열이 추가로 연결된 것을 특징으로 하는, 재조합 벡터, 상기 재조합 벡터가 도입된 형질전환 세포, 상기 재조합 벡터로부터 발현된 라이보자임, 상기 재조합 벡터 또는 라이보자임을 포함하는 간암 예방 또는 치료용 약학 조성물 및 상기 조성물을 이용한 간암 치료방법에 관한 것이다.

Description

암 특이적 트랜스-스플라이싱 라이보자임 및 이의 용도
본 발명은 (i) 조직 특이적 프로모터; 및 (ii) 암특이적 유전자를 표적으로 하는 트랜스-스플라이싱 라이보자임 및 상기 라이보자임의 3' 엑손에 연결된 목적 유전자를 포함하는, 라이보자임-목적 유전자 발현 카세트를 포함하며, 상기 발현카세트는 라이보자임-목적 유전자 발현 카세트의 5' 말단에 스플라이싱 공여/스플라이싱 수여 서열(splicing donor/splicing acceptor sequence, SD/SA sequence)이 연결되고, 3' 말단에 WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element)가 연결된 것으로, (iii) 상기 WPRE의 3' 말단에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열이 추가로 연결된 것을 특징으로 하는, 재조합 벡터, 상기 재조합 벡터가 도입된 형질전환 세포, 상기 재조합 벡터로부터 발현된 라이보자임, 상기 재조합 벡터 또는 라이보자임을 포함하는 간암 예방 또는 치료용 약학 조성물 및 상기 조성물을 이용한 간암 치료방법에 관한 것이다.
암은 국내 사망 원인의 1위를 차지하는 중대 질환으로, 인체의 모든 부위에서 발생할 수 있으며, 환경적 요인, 유전적 요인 등 다양한 요인들에 의해 발생할 수 있다. 암을 정복하기 위한 수많은 연구가 있어 왔지만 아직까지 정복되지 않고 있는 난치병이다. 암에 대한 기존의 치료법으로는 수술, 화학 요법 및 방사선 치료 등이 있으며 의학의 발달로 예후가 좋아지고 있지만, 암세포 뿐 아니라 정상 세포에도 악영향을 끼칠 수 있는 한계가 많다. 최근에는 이러한 치료법들과는 개념이 다른 치료법들이 연구되고 있는데 그 중에서 특히 암세포 만을 효과적으로 치료하기 위한 유전자 치료법이 활발히 연구되고 있다.
유전자 치료(gene therapy)란 통상적인 방법으로는 치료가 곤란한 선천적 또는 후천적 유전자 이상을 유전공학적 방법으로 치료하는 방법을 일컫는다. 구체적으로, 유전자 치료는 선천적 또는 후천적 유전자 결함, 바이러스성 질병, 암 또는 심혈관계 질환 등과 같은 만성 질환의 치료와 예방을 위하여, DNA 및 RNA 등의 유전 물질을 인체 내에 투여하여 치료 단백질을 발현시키거나 특정 단백질의 발현을 억제하도록 하는 치료 방법이다. 이는, 질병의 원인을 유전자 차원에서 해석하여 근본적으로 치료할 수 있기 때문에 난치병의 극복은 물론 기존 의료 방식의 대체 수단으로 기대되고 있는 방법이다.
아울러, 유전자 치료에 활용될 수 있는 표적 유전자들의 다수가 세포분열을 많이 하는 일반 세포에도 발현함으로 인해서 발생하는 부작용을 줄이기 위한 노력으로 암세포 특이적인 치료(cancer tissue targeted therapy)가 시도되고 있다(Fukuzawa et al., Cancer Res 64: 363-369, 2004). 이를 위해 CMV나 RSV 대신 조직 특이적(tissue-specific) 프로모터를 쓰는 방법이 고려되고 있으나, 특이성이 높아지는 대신 치료 효능이 떨어지는 단점으로 인해 실용화에 이르지 못하고 있는 실정이다.
또한, 최근에는 조직 특이적 프로모터 이외의 인자를 이용하여 조직 특이적인 암치료용 아데노바이러스를 개발하려는 연구가 진행되고 있는데, 대표적인 예로서, 트랜스-스플라이싱 라이보자임 등을 사용하는 방법이 개발되고 있다.
상기 트랜스-스플라이싱 라이보자임을 이용한 조직 특이적인 암치료용 아데노바이러스의 개발에 관한 연구는 테트라하이메나 써모필라(Tetrahymena thermophila)로부터의 그룹 I 인트론 라이보자임이 실험관 내에서뿐만 아니라 박테리아 나아가 인체 세포 내에서 트랜스-스플라이싱 반응을 수행함으로써 별도로 존재하는 두 개의 전사체를 서로 연결시킬 수 있음이 밝혀지면서 주목받게 되었다.
구체적으로, 이러한 그룹 I 인트론을 기초로 한 트랜스-스플라이싱 라이보자임은 질환과 관련된 유전자 전사체 또는 질병 세포에서만 특이적으로 발현되는 특정 RNA를 표적으로 하여, 이들을 정상적인 RNA로 보정하거나 또는 새로운 치료용 유전자 전사체로 치환되도록 재프로그램을 유발할 수 있어, 질환 특이적이며 안전한 유전자 치료 기술이 될 수 있을 것이라 예상되고 있다. 또한, 트랜스-스플라이싱 라이보자임은 질환 특이 RNA를 제거함과 동시에 원하는 치료용 유전자 산물의 발현을 유도할 수 있으므로 치료 효과를 배가시킬 수 있다.
특히, 최근 연구에 있어 암 조직에서 특이적으로 작용할 수 있는 hTERT(human Telomerase reverse transcriptase)를 타겟으로 하는 트랜스-스플라이싱 라이보자임이 알려지면서, 이를 이용한 암 치료제를 개발하려는 시도가 활발히 진행되고 있다. 그러나, 이들이 조직 특이적인 프로모터와의 조합에 의하여 높은 조직특이성을 보이는 반면 발현 효율이 매우 낮아, 치료 효율 측면의 단점을 아직까지 극복하지 못하고 있다. 또한, hTERT를 타겟으로 하는 치료의 경우, 줄기세포, 조혈모세포, 생식세포, 정상적으로 세포분열하는 간 세포(regenerating normal liver cell) 등의 정상 세포에서도 텔로머라제(telomerase) 활성을 나타내어, 정상 조직에 대한 독성을 유발할 수 있는 문제가 있다.
이러한 배경 하에, 본 발명자들은 조직 특이성과 치료 효능이 동시에 향상된 암 치료 유전자 치료 방안을 개발하기 위하여 예의 노력한 결과, 스플라이싱 공여/스플라이싱 수여 서열(splicing donor/splicing acceptor sequence, SD/SA sequence) 서열 및 WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element)가 연결된 암 조직 특이적 트랜스-스플라이싱 라이보자임에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열을 추가로 연결하여, 높은 조직 특이성을 유지할 뿐만 아니라 암 조직에 특이적인 우수한 치료효과를 나타내고, 뿐만 아니라 유전자 치료에 따른 부작용을 현저히 줄일 수 있음을 확인하고, 본 발명을 완성하였다.
본 발명의 목적은 (i) 조직 특이적 프로모터; 및 (ii) 암특이적 유전자를 표적으로 하는 트랜스-스플라이싱 라이보자임 및 상기 라이보자임의 3' 엑손에 연결된 목적 유전자를 포함하는, 라이보자임-목적 유전자 발현 카세트를 포함하며, 상기 발현카세트는 라이보자임-목적 유전자 발현 카세트의 5' 말단에 스플라이싱 공여/스플라이싱 수여 서열(splicing donor/splicing acceptor sequence, SD/SA sequence)이 연결되고, 3' 말단에 WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element)가 연결된 것으로, (iii) 상기 WPRE의 3' 말단에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열이 추가로 연결된 것을 특징으로 하는, 재조합 벡터를 제공하는 것이다.
본 발명의 다른 목적은 상기 재조합 벡터가 도입된 형질전환 세포를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 재조합 벡터로부터 발현된 라이보자임을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 재조합 벡터 또는 라이보자임을 유효성분으로 포함하는 간암 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명이 또 다른 목적은 상기 재조합 벡터 또는 라이보자임을 치료를 필요로 하는 개체에 약학적으로 유효한 양으로 투여하는 단계를 포함하는, 간암 치료방법을 제공하는 것이다.
본 발명의 재조합 벡터 및 이로부터 발현되는 라이보자임은 조직 특이적인 프로모터, 라이보자임의 발현량을 향상시키기 위한 SD/SA 및 WPRE와 조직 특이적인 microRNA 타겟 사이트까지 포함함으로써 발현 효율이 증가하면서도 정상 조직에 미치는 독성은 감소시켜 치료 효과 및 안전성을 모두 높이는 효과를 나타내어 향후 유전자 치료 분야에서 널리 활용될 수 있다.
도 1은 본 발명의 트랜스-스플라이싱 라이보자임 유도체의 구성을 나타내는 모식도이다.
도 2는 본 발명에서 제작한 PL(PEPCK-Lacz), PT(PEPCK-TK), EPRT- 122aT(PEPCK-SD/SA-Rib-TK-WPRE-122aT), EPRT-mut 122aT(PEPCK-SD/SA-Rib-TK-WPRE-mut 122aT), PRT-122aT 및 PRT-mut 122aT 재조합 벡터의 모식도를 나타낸 것이다.
도 3은 SD/SA 및 WPRE가 추가로 연결된 라이보자임의 발현이 증가된 것을 realtime-PCR을 통해 확인하여 그래프로 나타낸 것이다.
도 4는 miR-122a- 인 Hep3B 세포에서 SD/SA 및 WPRE가 연결된 라이보자임(EPRT-122aT, EPRT-mut 122aT)을 형질도입한 경우 세포사 유도 효과가 증가한 것을 그래프로 나타낸 것이다.
도 5a는 miR-122a+ 인 Huh7세포에 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임에 miR-122aT가 추가로 연결된 재조합 벡터인 PRT-122aT, EPRT-122aT를 형질도입한 경우 mut-122aT가 연결된 재조합 벡터를 도입한 경우에 비해 세포사가 감소된 것을 MTS assay를 통해 관찰하여 그래프로 나타낸 것이다.
도 5b는 miR-122a+ 인 Huh7.5 세포에 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임에 miR-122aT가 추가로 연결된 재조합 벡터인 PRT-122aT, EPRT-122aT를 형질도입한 경우 mut-122aT가 연결된 재조합 벡터를 도입한 경우에 비해 세포사가 감소된 것을 MTS assay를 통해 관찰하여 그래프로 나타낸 것이다.
도 6은 HepG2(hTERT+, miR122a-) 세포 및 SKLU-1(hTERT-, miR122a-)에 재조합 아데노바이러스인 Ad-PT, Ad-PRT-122aT, Ad-EPRT-122aT 및 Ad-EPRT-mut 122aT을 각각 감염시킨후 MTS assay를 통해 세포의 생존율을 관찰한 것으로, hTERT가 발현되는 HepG2 세포(도 6a)에서 hTERT가 발현되지 않은 SKLU-1 세포(도 6b)에 비해 세포사가 더 많이 유도된 것을 나타낸 그래프이다.
도 7은 테트라사이클린을 투여하여 miR-122a가 발현이 되는 세포와 테트라사이클린을 투여하지 않아 miR-122a가 발현되지 않는 세포 각각에 재조합 아데노바이러스인 Ad-PT, Ad-PRT-122aT, Ad-EPRT-122aT 및 Ad-EPRT-mut 122aT을 각각 감염시킨 후 MTS assay를 통하여 도 7a에 나타난 Tet+(miR-122a+)인 세포에서는 도 7b 에 나타난 Tet-(miR-122a-)인 세포에 비해 세포사가 거의 유도되지 않는 것을 관찰하여 그래프로 나타낸 것이다.
도 8은 본 발명의 아데노바이러스가 지속적으로 발현됨에 따른 정상 세포에서의 독성 여부를 확인하기 위하여 음성 대조군으로 PBS, 양성 대조군으로 Ad-PRT-122aT(10 x 1010) 및 본 발명의 아데노바이러스 Ad-EPRT-122aT를 다양한 농도로 처리하여 시간 경과(2일, 7일, 14일)에 따른 간세포 수치 (AST, ALT)를 측정한 결과를 나타낸 것이다.
도 9는 비장 내에 종양을 이식한 동소 다발성 간암 마우스 모델에 음성 대조군으로 PBS, 양성 대조군으로 Ad-PRT-122aT(10 x 1010) 및 본 발명의 아데노바이러스 Ad-EPRT-122aT를 다양한 농도(10 x 1010, 2 x 1010, 1 x 1010 및 0.5 x 1010)로 처리한 결과를 나타낸다. 도 9a는 종양 조직의 무게로 나타내었다. 도 9b는 동시에 간세포 수치 (AST, ALT)를 측정한 결과를 나타낸 것이다.
도 10은 비장 내에 종양을 이식한 동소 다발성 간암 마우스 모델에 음성 대조군으로 PBS, 양성 대조군으로 Ad-PRT-122aT(10 x 1010) 및 본 발명의 아데노바이러스 Ad-EPRT-122aT를 다양한 농도(10 x 1010, 2 x 1010, 1 x 1010 및 0.5 x 1010)로 처리한 후 마우스 간을 수득하여 관찰한 사진이다.
도 11은 비장 내에 종양을 이식한 동소 다발성 간암 마우스 모델에 음성 대조군으로 PBS, 양성 대조군으로 Ad-PRT-122aT(10 x 1010) 및 본 발명의 아데노바이러스 Ad-EPRT-122aT를 다양한 농도(10 x 1010, 2 x 1010, 1 x 1010 및 0.5 x 1010)로 처리한 후 마우스 간을 수득하여 H&E 염색한 결과를 확인한 사진이다.
도 12는 비장 내에 종양을 이식한 이종이식 모델(동소 다발성 간암 모델)에 Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010), Ad-EPRT-122aT(0.5 x 1010)를 각각 전신으로 처리한 후, 주입된 아데노바이러스 벡터의 도입된 정도를 정상 간 조직과 간암 조직의 gDNA를 각각 추출하여 분자 수준에서 확인한 결과를 나타낸 것이다.
상기 목적을 달성하기 위한 본 발명의 일 구현예는 (i) 조직 특이적 프로모터; 및 (ii) 암특이적 유전자를 표적으로 하는 트랜스-스플라이싱 라이보자임 및 상기 라이보자임의 3' 엑손에 연결된 목적 유전자를 포함하는, 라이보자임-목적 유전자 발현 카세트를 포함하며, 상기 발현카세트는 라이보자임-목적 유전자 발현 카세트의 5' 말단에 스플라이싱 공여/스플라이싱 수여 서열(splicing donor/splicing acceptor sequence, SD/SA sequence)이 연결되고, 3' 말단에 WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element)가 연결된 것으로, (iii) 상기 WPRE의 3' 말단에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열이 추가로 연결된 것을 특징으로 하는, 재조합 벡터를 제공한다. 구체적으로 상기 재조합 벡터는 서열번호 18로 표시되는 핵산 서열을 포함하는 것일 수 있다.
상기 재조합 벡터는 라이보자임 및 목적 유전자의 양 말단에 SD/SA 서열 및 WPRE를 구성요소로 포함시킬 때, 생체 내에서 암치료 효과가 탁월한 것을 확인한 것을 기초로, SD/SA 서열 및 WPRE 동시 사용하고, 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열을 추가로 포함하여 암 세포, 특히 간암 세포에 특이적인 치료가 가능하도록 한 것을 특징으로 한다.
본 발명에서 용어, "벡터"란 적당한 숙주세포에서 목적 단백질을 발현할 수 있는 발현 벡터로서, 유전자 삽입물이 발현되도록 작동 가능하게 연결된 필수적인 조절 요소를 포함하는 유전자 작제물을 말한다.
본 발명에서 용어, "작동 가능하게 연결된(operably linked)"은 일반적 기능을 수행하도록 핵산 발현조절 서열과 목적하는 단백질을 코딩하는 핵산 서열이 기능적으로 연결(functional linkage)되어 있는 것을 말한다. 예를 들어, 라이보자임 암호화 서열은 프로모터에 작동 가능하게 연결시킴으로써, 라이보자임 암호화 서열의 발현은 이 프로모터의 영향 또는 조절 하에 있게 된다. 2개의 핵산 서열(라이보자임 암호화 서열과 이 서열의 5' 말단의 프로모터 부위 서열)은 프로모터 작용이 유도됨으로써 라이보자임 암호화 서열이 전사되는 경우 작동 가능하게 연결된 것이며, 상기 두 서열 사이의 연결 특성이 프레임 변경 돌연변이(frame-shift mutation)를 유도하지 않으며, 발현 조절서열이 라이보자임의 발현을 지배하는 능력을 저해하지 않는 경우 작동 가능하게 연결되었다고 한다. 재조합 벡터와의 작동 가능한 연결은 당해 기술 분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 이용할 수 있다.
본 발명의 벡터는 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화 시그널, 인핸서와 같은 발현 조절 요소 외에도 막 표적화 또는 분비를 위한 신호 서열 또는 리더 서열을 포함하며 목적에 따라 다양하게 제조될 수 있다. 벡터의 프로모터는 구성적 또는 유도성일 수 있다. 또한, 발현벡터는 벡터를 함유하는 숙주 세포를 선택하기 위한 선택성 마커를 포함하고, 복제 가능한 발현벡터인 경우 복제 기원을 포함한다. 벡터는 자가 복제하거나 숙주 DNA에 통합될 수 있다. 상기 벡터는 플라스미드 벡터, 코즈미드 벡터 또는 바이러스 벡터 등을 포함할 수 있으며 구체적으로는 바이러스 벡터일 수 있다. 바이러스 벡터는 레트로바이러스(Retrovirus), 예를 들어 HIV(Human immunodeficiency virus) MLV(Murine leukemia virus) ASLV(Avian sarcoma/leukosis), SNV(Spleen necrosis virus), RSV(Rous sarcoma virus), MMTV(Mouse mammary tumor virus) 등, 아데노바이러스(Adenovirus), 아데노 관련 바이러스(Adeno-associated virus), 헤르페스 심플렉스 바이러스(Herpes simplex virus) 등에서 유래한 벡터를 포함하나, 이에 제한되지 않는다. 더욱 구체적으로, 본 발명의 재조합 벡터는 재조합 아데노바이러스 벡터일 수 있다.
본 발명의 용어 "발현 카세트"는 프로모터와 트랜스-스플라이싱 라이보자임-목적 유전자를 포함하고 있고, 트랜스-스플라이싱 라이보자임-목적 유전자의 각 말단에 SD/SA 서열 및 WPRE 서열이 각각 5' 말단과 3' 말단에 존재하며, 상기 WPRE의 3' 말단에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열이 추가로 연결된 것을 특징으로 하여 트랜스-스플라이싱 라이보자임-목적 유전자를 발현시킬 수 있는 단위 카세트를 의미한다.
본 발명에서 라이보자임-목적 유전자 발현 카세트는 상기 라이보자임과 목적 유전자가 연결된 서열에 전사체의 수준을 조절하는 서열, 즉 조절 유도체를 추가로 포함하는 것일 수 있으며 이에 제한되는 것은 아니나, 본 발명에서는 특히 스플라이싱 공여/스플라이싱 수여 서열(splicing donor/splicing acceptor sequence, SD/SA sequence) 및/또는 WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element)이 연결되고, 상기 WPRE의 3' 말단에 마이크로 RNA-122a를 인식하는 서열이 추가로 연결되어 라이보자임-목적 유전자의 발현량 및 조직 특이적으로 발현이 이루어질 수 있도록 조절하는 것을 특징으로 한다.
구체적으로, 본 발명의 라이보자임-목적 유전자 발현 카세트는 라이보자임의 5’ 말단에 스플라이싱 공여/스플라이싱 수여 서열(SD/SA)이 연결되고, 목적 유전자의 3’말단에 WPRE가 연결되고, 상기 WPRE의 3’ 말단에 마이크로 RNA-122a를 인식하는 서열이 연결된 것일 수 있다.
본 발명에서, SD/SA는 전사 시작(transcription initiation)과 RNA ploymerase Ⅱ의 프로세싱(processing) 및 mRNA의 핵에서 세포질로의 이동(nucleocytoplasmic export)을 증가시키며, WPRE는 mRNA의 프로세싱과 핵에서 세포질로의 이동을 증가시킴으로써 각각 pre-mRNA 수준을 증가시킬 수 있다.
상기와 같은 구성을 통하여 세포 내에서 라이보자임의 RNA 수준이 현저히 증가되고, 전사체 양이 증가함으로써, 세포 및 생체 내에서 암세포의 사멸도를 높이면서도 암 세포 특이적으로 발현이 이루어지도록 함으로써 정상 세포에 미치는 독성은 오히려 감소하도록 할 수 있다.
본 발명 일 실시예에서는 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임에 있어서 SD/SA 및 WPRE가 추가로 연결된 경우, 라이보자임의 발현이 증가하여 세포사를 유도하는 효과가 더욱 증가하며, miR-122a를 표적으로 하는 miR-122aT를 연결함으로써 miR-122a의 발현이 정상적으로 이루어지는 정상 간 세포에 대해서는 세포사를 유도하지 않고 miR-122a의 발현이 감소된 간암 세포에 대해서만 세포사를 유도하여 간암 세포 특이적으로 치료가 가능함을 확인하였다(도 5 내지 도 7).
상기 SD/SA 서열은 RNA 전사체의 인트론을 제거하는 스플라이싱 반응에 있어서 잘려나가는 인트론의 시작부분과 끝나는 부분에 해당하는 서열로서, 일반적으로 SD서열은 인트론 5' 말단의 GU 서열일 수 있으며, SA서열은 인트론의 3' 말단의 AG 서열일 수 있다. 본 발명에서 SD/SA 서열은 서열번호 3의 핵산 서열을 포함할 수 있으나, 목적 유전자 발현 카세트 내에 존재하면서 목적 유전자의 발현을 촉진시킬 수 있는 한 이에 제한되지 않는다.
상기 WPRE는 DNA 상에 발현을 촉진하는 3차 구조를 유도하여, 유전자의 발현을 증가시키는 서열을 의미한다. 본 발명에서 WPRE는 서열번호 7의 핵산 서열을 가질 수 있으나, 목적 유전자 발현 카세트 내에 존재하면서 목적 유전자의 발현을 촉진시킬 수 있는 한 이에 제한되지 않는다.
상기 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열은 본 명세서 내에서 miR-122aT(microRNA-122a target site)로 명명된다. 마이크로 RNA-122a는 정상 세포에서는 정상적으로 발현되나, 간암 세포에서는 발현량이 감소하는 특징을 나타낸다. 이를 이용하여 간암 세포에 대한 민감도 및 특이도를 증가시킨 치료제를 개발할 수 있으며, 특히 본 발명에서는 목적 유전자가 연결된 라이보자임에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열을 연결함으로써 간암 세포 특이적인 라이보자임의 발현이 이루어질 수 있도록 하였다.
본 발명의 용어 "암특이적 유전자"는 본 발명에 따른 암세포에서만 특이적으로 발현되거나 또는 현저하게 과발현되는 유전자를 의미한다. 상기 암특이적 유전자는 본 발명에 따른 라이보자임이 암특이적으로 작용할 수 있는 특징을 부가할 수 있다. 이러한 암특이적 유전자의 대표적인 예로는, TERT(Telomerase reverse transcriptase)의 mRNA, AFP(alphafetoprotein) mRNA, CEA(carcinoembryonic antigen) mRNA, PSA(Prostate-specific antigen) mRNA, 또는 CKAP2(Cytoskeleton-associated protein 2) mRNA 등이 사용 가능하나, 구체적으로는 TERT(Telomerase reverse transcriptase) mRNA를 사용할 수 있고, 더욱 구체적으로는 hTERT(human telomerase reverse transcriptase) mRNA를 사용할 수 있다.
본 발명의 용어 "TERT(Telomerase reverse transcriptase)"는 암 세포의 영속성(immortality) 및 증식(proliferation) 능력을 조절하는 가장 중요한 효소 중의 하나로서, 염색체에 말단소립 구조를 형성해 염색체 끝을 보호하는 역할을 통해 세포의 노화를 억제하는 효소를 의미한다. 정상적인 세포에서는 세포가 분열할 때마다 말단소립의 길이가 조금씩 줄어들어 결국 유전물질이 손실되고, 세포가 사멸하게 되는 기작을 갖는다. 그러나, 암세포에서는 이 효소가 말단소립을 계속적으로 연장시켜 주기 때문에 세포가 사멸하지 않으며, 암세포의 불멸성에 직접 기여함으로써 암을 치료하는데 중대한 장애 요소로 알려져 있다. 이러한, 텔로머라제(telomerase)는 무한히 복제되는 생식세포, 조혈세포 및 암세포에서 80 내지 90%의 텔로머라제 활성을 갖고 있지만, 암세포 주변의 정상세포들은 그 활성을 갖지 않는 특징을 갖는다. 본 발명에서는 암특이적 유전자로서 hTERT mRNA를 사용할 수 있으나, 이에 제한되지는 않는다.
본 발명의 용어 "프로모터"는 DNA의 일부분으로 전사를 개시할 수 있도록 RNA 중합효소의 결합에 관여한다. 일반적으로 표적 유전자와 동일 가닥상에 표적 유전자에 인접하여 이의 상류에 위치하며, RNA 중합효소 또는 RNA 중합효소를 도입하는 단백질 이른바 전사인자(transcription factor)가 결합하는 자리로서 상기 효소 또는 단백질이 올바른 전사시작 부위에 위치하도록 유도할 수 있다. 즉, 센스 가닥(sense strand) 상에서 전사하고자 하는 유전자의 5' 부위에 위치하여 RNA 중합효소가 직접 또는 전사인자를 통해 해당 위치에 결합하여 표적 유전자에 대한 mRNA 합성을 개시하도록 유도하는 것으로 특정한 유전자 서열을 갖는다. 유전자의 발현을 높이기 위하여 보편적인 프로모터(universal promoter)인 레트로바이러스의 LTR, 로우스 사르코마 바이러스(Rous Sarcoma Virus; RSV) 또는 사이토메갈로바이러스(cytomegalovirus; CMV) 프로모터를 이용할 수 있으나, 본 발명에서는 조직-특이적 프로모터를 이용할 수 있다.
본 발명에서 용어 "조직-특이적 프로모터"란 조직에 따라 특이적으로 프로모터 다운스트림 (downstream) 유전자의 mRNA로의 전사 개시 활성을 가지는, 암호화 영역의 업스트림 (upstream)의 비해독되는 핵산 서열을 말한다. 조직 특이적으로 프로모터 하위 유전자의 전사를 개시하도록 하는 핵산 서열은 조직에 따라 다양한 프로모터 서열이 제한 없이 포함될 수 있으며, 그 예로 간세포 특이적 프로모터인 PEPCK (phosphoenolpyruvate carboxykinase) 프로모터, 아포리포프로테인 E(apolipoprotein E) 프로모터, 혈청 알부민 프로모터, 간암 특이적 AFP(alphafetoprotein) 프로모터, 대장암 특이적 CEA(carcinoembryonic antigen) 프로모터, 또는 전립선암 특이적 PSA(Prostate-specific antigen) 프로모터가 있다. 본 발명에서는 이에 제한되는 것은 아니나, 특히 간조직 특이적인 PEPCK 프로모터일 수 있다. 본 발명에서 상기 PEPCK 프로모터는 서열번호 2의 핵산 서열을 포함하는 프로모터일 수 있으며, 서열번호 1의 핵산 서열을 포함하는 PEPCK 프로모터에 작용하는 인핸서를 추가로 포함하는 것일 수 있다.
본 발명의 용어 "라이보자임"은 효소처럼 작용하는 RNA 분자 또는 그 RNA 분자를 포함하는 단백질로 구성되는 분자로 RNA 효소 또는 촉매적 RNA라고도 불린다. 명확한 3차 구조를 갖는 RNA 분자로 화학반응을 수행하며 촉매적 또는 자기촉매적 특성을 가지며, 몇몇 라이보자임은 자기 또는 다른 RNA 분자를 절단하여 활성을 저해하는 것으로 밝혀졌으며, 다른 라이보자임은 리보솜의 아미노전달효소(aminotransferase) 활성을 촉매하는 것이 확인되었다. 이러한 라이보자임에는 망치머리(hammerhead) 라이보자임, VS 라이보자임 및 헤어핀(hairpin) 라이보자임 등이 포함될 수 있다. 본 발명에서 라이보자임은 트랜스-스플라이싱 반응을 통해 암 특이적 유전자의 활성을 저해시켜서 결과적으로는 선택적인 항암효과를 나타낼 수 있을 뿐만 아니라 암치료 유전자와 접합된 형태로 발현되어 암치료 유전자를 활성화시킬 수 있다. 따라서, 암특이적 유전자를 불활성화시키고, 암치료 유전자를 활성화시킬 수 있는 활성을 나타낸다면 어떠한 형태의 것이라도 사용 가능하다. 구체적으로 상기 라이보자임은 서열번호 5의 핵산서열을 포함하는 것일 수 있다.
본 발명의 목적상, 본 발명의 라이보자임은 상기에서 설명한 hTERT mRNA를 표적하는 라이보자임이며, hTERT가 과다발현되는 암세포, 특히 간암 세포를 표적으로 하여 hTERT mRNA를 특이적으로 절단하여 억제시키고 치료유전자인 HSVtk(Herpes simplex virus-thymidine kinase) 유전자를 특이적으로 발현시키는 역할을 할 수 있다. 또한, 본 발명의 라이보자임은 라이보자임을 발현시킬 수 있는 재조합 벡터를 아데노바이러스 등의 전달체에 의해 간 내로 도달하여 정상 세포에 대한 독성없이 암세포를 표적하여 치료하는데 중요한 역할을 한다.
본 발명의 용어 "트랜스-스플라이싱(trans-splicing)"은 서로 다른 유전자로부터의 RNA를 연결하는 것을 의미한다. 구체적으로는 암에 특이적인 hTERT(human Telomerase reverse transcriptase)의 mRNA를 인지하여 트랜스-스플라이싱하는 능력이 검증된 hTERT 표적 트랜스-스플라이싱 그룹 I 라이보자임을 사용하는 것일 수 있다.
한편, 본 발명자들은 상기 라이보자임과 함께 목적 유전자를 발현시킬 수 있는 재조합 아데노바이러스를 고안하였다. 즉, 상기 재조합 아데노바이러스는 암특이적 유전자에 특이적인 트랜스-스플라이싱 라이보자임을 통하여 라이보자임에 연결된 목적 유전자 발현카세트에 포함된 목적 유전자를 암특이적 유전자 전사체에 삽입하는 기능을 할 수 있다.
본 발명의 용어 "목적 유전자"는 상기 라이보자임에 의하여 암특이적 유전자의 mRNA에 연결되어 발현이 유도되는 유전자를 의미하며, 본 발명에서는 치료용 유전자 또는 리포터 유전자일 수 있으나 이에 제한되지 않는다.
본 발명의 용어 "암치료 유전자(anti-cancer therapeutic gene)"는 암 세포 내에서 발현시에 치료학적 효과를 나타내는 폴리펩티드를 암호화하는 폴리뉴클레오타이드 서열을 의미한다. 본 발명에 있어서, 상기 암치료 유전자는 상기 라이보자임과 접합된 형태로 발현되거나 또는 독립적으로 발현되어, 항암활성을 나타낼 수 있다. 이러한 암치료 유전자의 예로는, 약제감수성 유전자, 세포사멸 유전자, 세포증식 억제 유전자, 세포독성 유전자, 종양 억제인자 유전자, 항원성 유전자, 사이토카인 유전자, 항신생 혈관 생성 유전자 등을 들 수 있으나, 이에 제한되지는 않을 뿐만 아니라, 본 발명에서는 상기 암치료 유전자를 단독적으로 사용하거나 또는 둘 이상 복합적으로 사용할 수도 있다.
상기 약제감수성 유전자(drug-sensitizing gene)는 독성이 없는 전구체(prodrug)를 독성물질로 전환시키는 효소에 대한 유전자로 유전자가 이입된 세포가 사멸하게 되므로 자살 유전자(suicide gene)로도 불린다. 즉, 정상 세포에는 독성이 없는 전구체를 전신적으로 투여했을 때 암세포에만 전구체가 독성 대사체(toxic metabolite)로 전환되어 약제에 대한 감수성을 변화시킴으로써 암세포를 파괴시키는 방법이다. 대표적으로 HSVtk(Herpes simplex virus-thymidine kinase) 유전자와 간사이클로비르(ganciclovir), 대장균의 사이토신 탈아미노효소(cytosine deaminase, CD) 유전자와 5-플루오로시토신(5-fluorocytosine, 5-FC)가 가능하며, 상기에 제한되는 것은 아니다.
상기 세포사멸 유전자(proapoptotic gene)는 발현되어 프로그램된 세포 사멸을 유도하는 뉴클레오타이드 서열을 말한다. 당업자에게 공지된 세포사멸 유전자로, p53, 아데노바이러스 E3-11.6K (Ad2 및 Ad5에서 유래) 또는 아데노바이러스 E3-10.5K (Ad에서 유래), 아데노바이러스 E4 유전자, p53 경로 유전자 및 카스파제를 코딩하는 유전자가 포함될 수 있다.
상기 세포증식 억제 유전자(cytostatic gene)는 세포 내에서 발현되어 세포 주기 도중에 세포 주기를 정지시키는 뉴클레오타이드 서열을 의미한다. 그 예로 p21, 망막아세포종 유전자, E2F-Rb 융합 단백질 유전자, 사이클린-종속성 카이네이즈 억제인자를 코딩하는 유전자(예를 들면, p16, p15, p18 및 p19), 성장 중지 특이성 호메오박스(growth arrest specific homeobox, GAX) 유전자 등이 있으며, 이에 제한되는 것은 아니다.
상기 세포독성 유전자(cytotoxic gene)는 세포 내에서 발현되어 독성 효과를 나타내는 뉴클레오타이드 서열을 말한다. 그 예로, 슈도모나스 외독소(exotoxin), 리신 독소, 디프테리아 독소 등을 코딩하는 뉴클레오타이드 서열 등이 있으며, 이에 제한되는 것은 아니다.
상기 종양 억제인자 유전자(tumor suppressor gene)는 표적 세포 내에서 발현되어 종양 표현형을 억제할 수 있거나 세포사멸을 유도할 수 있는 뉴클레오타이드 서열을 의미한다. 대표적으로 종양 괴사 인자(tumor necrosis factor-α, TNF-α), p53 유전자, APC 유전자, DPC-4/Smad4 유전자, BRCA-1 유전자, BRCA-2 유전자, WT-1 유전자, 망막아세포종 유전자, MMAC-1 유전자, 선종양 폴립증 코일 단백질(adenomatous polyposis coil protein), 결손된 결장 종양(DCC) 유전자, MMSC-2 유전자, NF-1 유전자, 염색체 3p21.3에 위치한 비인후 종양 억제인자 유전자, MTS1 유전자, CDK4 유전자, NF-1 유전자, NF-2 유전자, VHL 유전자 또는 sPD-1(programmed death-1)가 포함될 수 있다.
상기 항원성 유전자(antigenic gene)는 표적 세포 내에서 발현되어 면역 시스템에서 인식할 수 있는 세포 표면 항원성 단백질을 생산하는 뉴클레오타이드 서열을 말한다. 당업자에게 공지된 항원성 유전자의 예로 암태아성 항원 (carcinoembryonic antigen, CEA) 및 p53이 포함될 수 있다.
상기 사이토카인 유전자(cytokine gene)는 세포 내에서 발현되어 사이토카인을 생성하는 뉴클레오타이드 서열을 의미한다. 대표적으로 GM-CSF, 인터루킨(IL-1, IL-2, IL-4, IL-12, IL-10, IL-19, IL-20), 인터페론 α, β, γ(인터페론 α-2b) 및 인터페론 α-2α-1과 같은 융합체 등이 포함될 수 있다.
상기 항신생혈관 생성 유전자(anti-angiogenic gene)는 발현되어 항-신생혈관 생성 인자를 세포 밖으로 방출하는 뉴클레오타이드 서열을 말한다. 그 예로 안지오스타틴, 혈관 내피 성장 인자(VEGF)의 억제 인자, 엔도스타틴 등이 포함될 수 있다.
본 발명 일 실시예에서는 hTERT를 표적으로 작용하는 라이보자임에 접합된 형태로 암치료 유전자의 일종인 HSVtk를 발현시킬 수 있고, SD/SA 서열 및/또는 WPRE를 포함하여 높은 발현 효율을 나타낼 뿐 아니라 miR-122aT 서열을 추가로 포함하여 간암 세포에 특이적으로 발현할 수 있도록 한 재조합 벡터를 제작하였으며, SD/SA 및 WPRE를 모두 포함하는 재조합 벡터를 도입하였을 때 발현량이 증가하는 것을 확인하였다(도 4). 나아가 이를 miR-122a가 감소된 세포에 처리하였을 때 miR-122a가 정상적으로 발현되는 세포에 비해 세포사 유도가 증가한 것을 관찰함으로써(도 5 내지 도 7), miR-122a가 정상적으로 발현되는 정상 세포와 miR-122a의 발현이 감소된 간암 세포를 구별하여 간암 세포 선택적으로 치료할 수 있음을 확인하였다.
또한, 본 발명 일 실시예에서는 동소 다발성 간암 마우스 모델을 제조하여 본 발명의 아데노바이러스(Ad-EPRT-122aT)를 처리한 결과 정상 세포에 대해서는 세포 독성을 보이지 않고(도 8), 기존 아데노바이러스(Ad-PRT-122aT)에 비해 1/10의 양을 처리하여도 기존 아데노바이러스보다 더 항암 효과가 우수한 것을 확인하였으며(도 9a, 도 9b, 도 10 및 도 11), 동물모델의 정상 간과 이식된 간암 조직으로의 아데노바이러스 도입을 분자 수준에서 확인하였다(도 12).
따라서 본 발명의 SD/SA, WPRE 및 miR-122aT가 추가로 연결된 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임을 이용하여 간암 세포의 세포사 유도 효율이 증가할 뿐 아니라 정상 세포의 사멸을 억제하여 부작용을 최소화함으로써 암 특이적인 치료 효과를 더욱 높일 수 있다.
본 발명의 용어, "HSVtk(Herpes simplex virus-thymidine kinase)"은 단순 포진 바이러스로부터 유래되는 티미딘 인산화 효소를 의미한다. 이 효소는 독성이 없는 전구체(prodrug)를 독성물질로 전환시킴으로써, 그 유전자가 이입된 세포가 사멸하게 하는 약제감수성 유전자의 대표적인 예이다. 본 발명에 있어 HSVtk 유전자는 본 발명에 따른 라이보자임에 접합된 형태로 발현되어 항암활성을 나타내는 암치료 유전자로 사용될 수 있다. 이러한 HSVtk 유전자는 구체적으로는 서열번호 6으로 표시되는 핵산 서열을 포함할 수 있으며, 진뱅크(genbank) 등록번호 AAP13943, P03176, AAA45811, P04407, Q9QNF7, KIBET3, P17402, P06478, P06479, AAB30917, P08333, BAB84107, AAP13885, AAL73990, AAG40842, BAB11942, NP_044624, NP_044492, CAB06747 등에 기재된 것일 수 있다.
본 발명에서 용어 "리포터 유전자"는 본 발명의 재조합 벡터의 도입 여부 또는 라이보자임 발현 효율을 모니터링하기 위해 사용되는 유전자로서 감염된 세포 또는 조직의 손상이 없이 모니터링할 수 있는 유전자는 제한 없이 사용될 수 있으나, 그 예로 루시퍼라제(luciferase), 녹색 형광 단백질(GFP), 변형된 녹색 형광 단백질(modified green fluorescent protein; mGFP), 증강된 녹색 형광 단백질(enhanced green fluorescent protein; EGFP), 적색 형광 단백질(RFP), 변형된 적색 형광 단백질(modified red fluorescent protein; mRFP), 증강된 적색 형광 단백질(ERFP), 청색 형광 단백질(BFP), 증강된 청색 형광 단백질(EBFP), 황색 형광 단백질(YFP), 증강된 황색 형광 단백질(EYFP), 남색 형광 단백질(CFP) 또는 증강된 남색 형광 단백질(ECFP)일 수 있다.
목적 유전자로서 리포터 유전자를 삽입시킴으로써 암 세포 특이적인 라이보자임의 발현 정도를 관찰할 수 있으며, 특히 본 발명의 라이보자임은 조직 특이적인 프로모터 및 마이크로 RNA 표적 사이트를 포함하고 있어, 정상 세포에서는 발현되지 않고 암 세포 특이적으로 발현할 수 있음에 따라 이를 이용하여 특정 조직에서 암이 발생한 것인지 여부를 진단하는데 적용할 수 있음은 당업자에게 자명한 것이다.
본 발명의 또 다른 일 구현예는 상기 재조합 벡터가 도입된 형질전환 세포를 제공한다.
본 발명에서 용어 "도입"은 형질감염(transfection) 또는 형질도입(transduction)에 의해 외래 DNA를 세포로 유입시키는 것을 의미한다. 형질감염은 칼슘 포스페이트-DNA 공침전법, DEAE-덱스트란-매개 형질감염법, 폴리브렌-매개 형질감염법, 전기충격법, 미세주사법, 리포좀 융합법, 리포펙타민 및 원형질체 융합법 등의 당분야에 공지된 여러 방법에 의해 수행될 수 있다. 또한, 형질도입은 감염(infection)을 수단으로 하여 바이러스 또는 바이러스 벡터 입자를 사용하여 세포 내로 유전자를 전달시킬 수 있다.
본 발명에서 용어, "형질전환 세포"는 숙주세포에 목적으로 하는 폴리뉴클레오티드를 도입한 세포를 의미한다. 형질전환은 상기 "도입" 방법에 의해 이루어질 수 있고, 당 분야에서 공지된 바와 같이 숙주세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있다. 본 발명 일 실시예에서는 재조합 벡터를 PEI를 이용하여 DNA를 세포 내로 주입하거나, 아데노바이러스를 전달체로 이용하여 세포 내로 주입하여 재조합 벡터가 도입된 형질전환 세포를 제조하였으며, 나아가 일시적인 형질도입이 아닌 stable cell을 제작하는 방법을 사용하여 제조할 수 있다.
구체적으로, 본 발명의 형질전환 세포는 (i) 조직 특이적 프로모터; 및 (ii) 암특이적 유전자를 표적으로 하는 트랜스-스플라이싱 라이보자임, 상기 라이보자임의 3' 엑손에 연결된 목적 유전자를 포함하는, 라이보자임-목적 유전자 발현 카세트를 포함하며, 상기 발현카세트는 라이보자임-목적 유전자 발현 카세트의 5' 말단에 스플라이싱 공여/스플라이싱 수여 서열(splicing donor/splicing acceptor sequence, SD/SA sequence)이 연결되고, 3' 말단에 WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element)가 연결된 것으로, (iii) 상기 WPRE의 3' 말단에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열이 추가로 연결된 것을 특징으로 하는, 재조합 벡터가 도입된 것일 수 있다.
본 발명의 또 다른 일 구현예는 상기 재조합 벡터로부터 발현된 라이보자임을 제공한다. 재조합 벡터 및 라이보자임에 관한 내용은 앞서 설명한 바와 같다.
본 발명의 또 다른 일 구현예는 상기 재조합 벡터 또는 상기 라이보자임을 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 용어 "암"은 세포의 정상적인 분열, 분화 및 사멸의 조절 기능에 문제가 발생하여 비정상적으로는 과다 증식하여 주위 조직 및 장기에 침윤하여 덩어리를 형성하고 기존의 구조를 파괴하거나 변형시킨 상태를 의미하며, 구체적으로 상기 암은 간암일 수 있다.
본 발명의 용어, "예방"은 본 발명에 따른 재조합 아데노바이러스 또는 조성물의 투여로 암을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명의 용어, "치료"는 본 발명에 따른 재조합 아데노바이러스 또는 조성물의 투여로 암이 호전되거나 이롭게 변경하는 모든 행위를 의미한다.
아울러, 본 발명의 암 예방 또는 치료용 약학 조성물은 약학적으로 허용가능한 담체, 부형제 또는 희석제를 추가로 포함할 수 있다.
본 발명의 약학적 조성물에 사용될 수 있는 약학적으로 허용가능한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 칼슘 카보네이트, 셀룰로즈, 메틸 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시 벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 등을 들 수 있다.
본 발명의 약학적 조성물은 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 제형화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제의 예로는 정제, 환제, 산제, 과립제, 캡슐제 등이 있으며, 이러한 고형제제는 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘 카보네이트, 수크로즈 또는 락토스, 젤라틴 등을 혼합하여 조제될 수 있다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다.
경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함될 수 있다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
본 발명의 또 다른 일 구현예는 상기 재조합 벡터 또는 상기 라이보자임을 치료를 필요로 하는 개체에 약학적으로 유효한 양으로 투여하는 단계를 포함하는, 암 치료방법을 제공한다. 구체적으로 상기 암은 간암일 수 있다.
본 발명의 용어 "약학적으로 유효한 양"은 의학적 치료에 적용가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 성병, 연령, 질병의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와 순차적으로 또는 동시에 투여될 수 있다. 또한 본 발명의 약학적 조성물은 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 용어 "개체"는 본 발명에 따른 치료용 조성물의 투여에 의해 증상이 호전될 수 있는 암을 가진 말, 양, 돼지, 염소, 낙타, 영양, 개 등의 동물 또는 인간을 포함한다. 본 발명에 따른 치료용 조성물을 개체에게 투여함으로써, 암을 효과적으로 예방 및 치료할 수 있다. 본 발명에 따른 상기 치료방법은 인간을 제외한 개체를 치료하는 방법일 수 있으나, 이에 제한되지 않는다. 즉, 인간의 경우 본 발명에 따른 치료용 조성물의 투여에 의해 증상이 호전될 수 있는 암을 가지는 것을 고려할 때, 인간의 치료에 있어서도 충분히 사용될 수 있다.
본 발명의 용어 "투여"는 어떠한 적절한 방법으로 동물에게 소정의 물질을 도입하는 것을 의미하며, 본 발명에 따른 치료용 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 경구 또는 비경구 투여될 수 있다. 또한, 본 발명에 따른 치료용 조성물은 유효성분이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
본 발명에 따른 치료용 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명의 약학적 조성물은 1일 1 내지 10 mg/kg으로, 바람직하게는 1 내지 5 mg/kg으로 투여하는 것이 좋다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다.
본 발명의 치료용 조성물은 단독으로, 또는 공지의 항암제를 병용 투여하거나 외과적 수술요법 등의 보조 치료 방법들과 병행하여 사용하여 항암 효과를 증대시킬 수 있다. 본 발명의 조성물과 함께 이용될 수 있는 화학 요법제(chemotherapeutic agent)는 시스플라틴(cisplatin), 카르보플라틴 carboplatin), 프로카르바진(procarbazine), 메클로레타민(mechlorethamine), 시클로포스파미드(cyclophosphamide), 이포스파미드 (ifosfamide), 멜팔란(melphalan), 클로라부실(chlorambucil), 비술판(bisulfan), 니트로소우레아 (nitrosourea), 디악티노마이신(dactinomycin), 다우노루비신(daunorubicin), 독소루비신(doxorubicin), 블레오마이신(bleomycin), 플리코마이신(plicomycin), 마이토마이신(mitomycin), 에토포시드(etoposide), 탁목시펜(tamoxifen), 택솔(taxol), 트랜스플라티눔(transplatinum), 5-플루오로우라실(5-fluorouracil), 빈크리스틴(vincristin), 빈블라스틴(vinblastin) 및 메토트렉세이트(methotrexate) 등을 포함할 수 있다. 또한, 발명의 조성물과 함께 이용될 수 있는 방사 요법은 X-선 조사 및 γ-선 조사 등이 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명이 하기 실시예에 의해 한정되는 것은 아니다.
실시예 1. 재조합 벡터의 제작
1-1. pAVQ PEPCK-SD/SA-Ribozyme-TK-WPRE-122aT(3X) 플라스미드의 제작
본 발명에서 조직 특이적인, 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임(trans-splicing ribozyme) 발현을 유도하기 위하여, 간세포 특이적 프로모터인 PEPCK 프로모터(서열번호 2), 조절 유도체인 SD/SA(Splicing Donor/Splicing Acceptor, 서열번호 3), WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element, 서열번호 7) 및 miR-122aT를 이용하여 최적의 구성을 제조하였다. miR-122aT는 간세포 특이적으로 발현되는 마이크로RNA-122a(miR-122a)를 인식하는 핵산서열(miR-122a target site(miR-122aT), 서열번호 8)을 의미한다. 또한, TK는 항 HSV 유전자 제제인 HSVtk(herpes simplex virus thymidine kinase, 서열번호 6)를 의미하는 것으로 사용될 수 있는 암 유전자 치료제 중 하나의 예로서 사용하였다.
PEPCK 프로모터를 이용하는 T/S 라이보자임(hTERT targeting T/S ribozyme; hTERT의 +21 부위를 표적하며 +30부터 +324 부위에 대한 안티센스 서열(antisense sequence), extended P1 helix, 6 nucleotide의 P10 부위 함유)의 5' 업스트림(upstream)에 SD/SA를 삽입하고, 라이보자임에 연결된 TK의 뒤쪽에 WPRE를 삽입하는 클로닝(cloning)을 하기와 같이 수행하였다.
구체적으로는 pAVQ PEPCK Ribozyme TK 벡터를 기반으로 하여, 라이보자임-목적 유전자의 5' 말단 쪽에 SD/SA(Splicing donor/splicing acceptor site)를 포함하고, 라이보자임-목적 유전자의 3' 말단 쪽에 WPRE(woodchuck hepatitis virus post transciptional regulatory element) 및 miR-122aT를 포함하는 벡터를 제작하였다.
우선, SD/SA를 pAVQ PEPCK Ribozyme TK 벡터에 삽입하기 위하여, 상기 벡터를 제한효소 BglII(Fermentas)로 잘라 라이보자임의 안티센스 부분부터 라이보자임의 중간 부위를 제거하였다. 또한 삽입하기 위한 insert로, 기존의 SD/SA가 삽입되어 있던 pAVQ SD/SA CRT 벡터(출원번호 제10-2013-0099276호 참조)를 제한효소 BglII(Fermentas)로 잘라 SD/SA 부터 라이보자임의 중간부위까지 얻어냈다.
상기와 같은 방식으로 얻어낸 벡터와 insert를 1 : 10의 비율로 섞은 후 4℃에서 하룻밤 동안 T4 DNA ligase(Roche)를 이용하여 라이게이션(ligation) 반응시켰다.
이렇게 수득한 라이게이션한 벡터를 DH5αE.coli competent cell에 열충격 형질전환 방법(Heat shock transformation)을 통하여 세포 내로 도입한 후, 카나마이신(kanamycin)이 첨가된 agar plate에 골고루 깔아 37℃ 인큐베이터에서 16시간 동안 배양시켰다. agar plate에 자란 콜로니를 카나마이신이 첨가된 LB 배지에 접종하여 mini-prep으로 DNA를 뽑아 insert가 삽입된 벡터를 포함하는 클론을 확인하였다.
상기 클로닝을 통해 SD/SA가 삽입된 벡터(pAVQ PEPCK SD/SA Ribozyme TK 벡터)에 WPRE를 삽입하기 위하여, 상기 벡터를 제한효소 FseI(Fermentas)으로 잘라 준비하였다. 또한, 기존의 WPRE가 삽입되어 있던 pAVQ CRT WPRE 벡터(출원번호 제10-2013-0099276호 참조)를 주형으로 FseI 제한효소 사이트를 포함하는 프라이머(서열번호 10; 정방향 프라이머- 5'-GCGGCCGGCCAATCAACCTCTGGATTACAAA-3', 서열번호 11; 역방향 프라이머- 5'-GCGGCCGGCCGCGGGGAGGCGGCCCAAA-3')로 증폭한 후 제한효소 FseI(Fermentas)로 잘라 insert를 준비하였다.
상기 벡터와 insert를 1 : 10의 비율로 섞은 후 라이게이션하고 형질전환을 통해 클론을 얻었다.
상기와 같이 제조된 pAVQ SD/SA PEPCK Ribozyme TK WPRE 벡터를 NotI(Fermentas)으로 잘라 준비하고 3 카피의 miR-122aT(TGGAGTGTGACAATGGTGTTTG X3; miR-122a 표적 서열)를 NotI 제한효소 사이트를 포함하는 프라이머(서열번호 12; 정방향 프라이머- 5'- ATAAGAATGCGGCCGCACAAACACCATTGTCACACT CCACGATACAAACACCATTGTCACACTC -3', 서열번호 13; 역방향 프라이머- 5'- ATAAGAATGCGGCCGCTGGAGTGTGACAATGGTGTTTGTATCGTGGAGTGTGACAATGGTGTTTG -3') 로 증폭한 후 제한효소 FseI(Fermentas)으로 잘라 insert를 준비하였다.
준비된 벡터와 insert를 1 : 10의 비율로 섞은 후 라이게이션하고 형질전환을 통해 클론을 얻었다. 상기와 같은 방법으로 얻은 클론을 EPRT-122aT로 명명하였다.
1-2. PEPCK 프로모터를 포함하는 pAVQ 벡터 기반의 대조군 플라스미드의 제작
본 발명자들은 pAVQ 벡터 기반의 대조군 플라스미드 중 하나인 PRT-mut 122aT(PEPCK-Rib-TK-mut 122aT)를 제작하였다.
구체적으로, pAVQ-rib-TK 벡터를 NotI(Fermentas)으로 잘라 준비하고 3 카피의 miR-122aT(TGGAGTGTGACAATGGTGTTTG X3; miR-122a 표적 서열)를 NotI 제한효소 사이트를 포함하는 서열번호 12의 정방향 프라이머와 서열번호 13의 역방향 프라이머로 증폭한 후 제한효소 NotI(Fermentas)로 잘라 insert를 준비하였다. 또한 3 카피의 mut miR-122aT를 NotI 제한효소 사이트를 포함하는 정방향 프라이머(서열번호 14; 5'- ATAAGAATGCGGCCGCACAAACACCATTCCTCACACTGACGATACAAACACCATTCCTCACACT-3')와 역방향 프라이머 (서열번호 15; 5'-ATAAGAATGCGGCCGCTCAGTGTGAGGAATGGTGTTTGTATCGTCAGTGTGAGGAATGGTGTTTG -3')로 증폭한 후 제한효소 NotI(Fermentas)로 잘라 insert를 준비하였다.
준비된 벡터와 insert를 1 : 10의 비율로 섞은 후 라이게이션하고 형질전환을 통해 클론을 얻었다. 상기와 같은 방법으로 얻은 클론을 PRT-mut 122aT로 명명하였다.
또한, 다른 대조군 플라스미드인 EPRT-mut 122aT(PEPCK-SD/SA-Rib-TK-WPRE-mut 122aT)를 제작하였다.
구체적으로, 상기 제조된 pAVQ SD/SA PEPCK Ribozyme TK WPRE 벡터를 NotI(Fermentas)으로 잘라 준비하고 3 카피의 mut miR-122aT를 NotI 제한효소 사이트를 포함하는 서열번호 14의 정방향 프라이머와 서열번호 15의 역방향 프라이머 로 증폭한 후 제한효소 NotI(Fermentas)로 잘라 insert를 준비하였다.
준비된 벡터와 insert를 1 : 10의 비율로 섞은 후 라이게이션하고 형질전환을 통해 클론을 얻었다. 상기와 같은 방법으로 얻은 클론을 EPRT-mut 122aT 로 명명하였다.
그 외 대조군 플라스미드로 사용한 PT(PEPCK-TK), PL(PEPCK-Lacz)의 경우 International Journal of Cancer 129: 1018-1029 (2011) 「Selective and efficient retardation of cancers expressing cytoskeleton-associated protein 2 by targeted RNA replacement.」에 개시된 내용에 따라 제작하여 사용하였다.
상기와 같이 제작된 플라스미드 각각에 대한 모식도는 도 2에 나타내었다.
실시예 2. 재조합 아데노바이러스의 제작
아데노 바이러스 벡터를 제작하기 위해서 pAdenoVator transfer vector(Qbiogene)에 클로닝된 콘스트럭(construct)들을 pAdenoVator?E1/E3 backbone vector(Qbiogene)와 함께 competent cell인 BJ5183 E.coli strain에 함께 형질도입(co-transformation) 하여 상동재조합(homologous recombination)을 시켰다. 전송 벡터(Transfer vector)는 제한효소 PmeI(NEB)으로 선형화(linearization) 시킨 후 페놀 추출 및 에탄올 침전을 통해 정제하여 준비하였고, 수득한 DNA 1μg과 pAdenoVator△E1/E3 backbone vector 100ng을 BJ5183에 전기천공법(electroporation) co-transformation 하였다. BJ5183에서 상동재조합된 재조합 벡터(recombinant vector)들을 제한효소 PacI(NEB)으로 선형화 시킨 후 페놀 추출 및 에탄올 침전을 통해 정제하였고, 이를 293(Human embryonic kidney)세포에 칼슘 포스페이트(calcium phosphate)를 이용하여 트랜스펙션(transfection)하였다.
293 세포에서 증폭시킨 재조합 바이러스들을 염화세슘구배 원심분리법(cesium chloride gradient centrifugation)을 이용하여 울트라원심분리기(ultracentrifuge)를 통해 38,000rpm으로 원심분리하여 정제하였고, 이렇게 얻은 바이러스는 2시간, 2시간, 16시간으로 투석(dialysis)[dH2O 1600ml, dialysis buffer(100mM Tris-Cl pH7.5, 10mM MgCl2) 200ml, 100% Glycerol 200ml]한 후 분주(aliquot)하여 -80℃에 보관하였다. 재조합 바이러스의 타이터(titer)는TCID50(tissue culture infectious dose for 50% of the cells) 방법을 이용하여pfu(plaque forming units)를 결정하였다.
실시예 3: 세포 배양
인간 간암 세포주 Hep3B 세포, Huh7, Huh7.5 및 HepG2 세포(Human hepatocellular carcinoma) 및 인간 폐암 세포주 SKLU-1(human lung adenocarcinoma)를 이용하였다.
상기 세포는 10% FBS와 1% 페니실린/스트렙토마이신을 첨가한 MEM (minimum essential medium)/ DMEM(Dulbecco's modified eagle medium) 배지를 이용하여, 37 ℃, 5% CO2 조건이 유지되는 인큐베이터에서 배양하였다.
2~3일에 한번씩 새로운 100mm 배양접시에 계대배양하였다. 구체적으로는, 상기 세포들이 부착된 배양접시를 1x PBS(Phosphate buffered saline, 8g NaCl, 0.2g KCl, 1.14g Na2HPO4, 0.2g KH4PO4/L)로 세척한 후, 1x Trypsin/EDTA(8.2g NaCl, 0.2g KCl, 1.14g Na2HPO4, 0.2 g KH2PO4, 0.029g Na2EDTA·dH2O, 1g trypsin, pH 7.35/L) 1ml을 처리하여 CO2 인큐베이터에 1분간 두었다. 배지 4mL로 트립신을 불활성화시킨 후 1,500rpm 2분 30초간 원심 분리하여, 상층액을 제거하고 배지에 재현탁하여 계대배양을 진행하였다.
실시예 4. SD/SA 및 WPRE가 추가 연결된 라이보자임의 발현 증가 확인
SD/SA 및 WPRE가 모두 추가 연결된 라이보자임의 효율성을 확인하기 위하여, 발현 정도를 측정하였다. 구체적으로, 상기 실시예 1-2에서 제작한 PRT-122aT, PRT-mut 122aT, EPRT-122aT 및 EPRT-mut 122aT를 각각 인간 간암 세포인 Hep3B 세포(hTERT+, miR-122a-)에 형질도입한 후 realtime-PCR을 통하여 HSVtk의 발현량을 측정함으로써 라이보자임의 발현량을 비교하였다. 대조군으로 실시예 1-2에서 제조한 라이보자임 없이 항 HSV 유전자제제인 HSVtk(herpes simplex virus thymidine kinase) 만을 발현하는 PT를 사용하였다.
상기 realtime-PCR(Corbett-Rotor gene-6000)은 5x Phire buffer, 10x SyBr(Invitrogen), 0.14 mM dNTP(NEB), 0.14uM의 5' 및 3' 프라이머, Phire taq 폴리머라제(0.5U, Finnzyme)을 사용해 98℃에서 5분간 pre-heating 시킨 후 98℃에서 30초간 denaturation 한 뒤 60℃에서 30초 동안 annealing, 72℃에서 30초간 elongation 과정을 35 cycle 수행한 후 72℃, 8 분간 incubation 시키는 조건에서 수행하였다.
cDNA는 TK specific binding 프라이머를 사용하여 증폭시켰다.
정방향 프라이머 서열(서열번호 16; 5'- TGACTTACTGGCAGGTGCTG-3')
역방향 프라이머 서열(서열번호 17; 5'- CCATTGTTATCTGGGCGCTTG-3')
도 3에 나타난 바와 같이, SD/SA 및 WPRE가 연결되지 않은 라이보자임을 발현시키는 재조합 벡터인 PRT-122a 및 PRT-mut 122aT를 도입한 경우에 비해 SD/SA 및 WPRE가 연결된 라이보자임을 발현시키는 재조합 벡터인 EPRT-122aT 및 EPRT-mut 122aT를 도입하였을 때 발현량이 증가한 것을 확인하였다.
이로부터 SD/SA 및 WPRE가 추가로 연결된 경우, 암 유전자 치료제인 HSVtk 등이 연결된 라이보자임의 발현이 증가하게 되어 간암세포에 대한 치료효과가 증가될 수 있음을 알 수 있었으며, 트랜스-스플라이싱 라이보자임을 기반으로 한 암 유전자 치료제의 치료 효율을 증가시킬 수 있음을 확인하였다.
실시예 5. 간암 세포 특이적인 세포사 유도 효과 확인
효율성 증가를 위한 SD/SA, WPRE가 삽입되고, 간조직 특이적 발현 조절을 위한 정상 간 조직에서는 발현이 되지만 간암세포에서는 발현량이 감소되는 miR-122a를 표적으로 하는 핵산 서열(miR-122aT)을 3번 반복하여 삽입시킨(3 copies), 상기 실시예 1에서 제조한 플라스미드와 이에 대한 음성대조군(negative control)으로 mut-122aT를 삽입시킨 플라스미드를 비교실험하여 miR-122에 의한 조절 여부와 간암 세포에 대해 특이적으로 세포사를 유도하여 치료 효과를 나타낼 수 있는지를 평가하였다.
5-1. Transient MTS assay
상기 실시예 1-2에서 제작한 재조합 벡터, PT(PEPCK-TK), PRT-122aT (PEPCK-Rib-TK-122aT), EPRT-122aT(PEPCK-SD/SA-Rib-TK-WPRE-122aT) 및 EPRT-mut 122aT(PEPCK-SD/SA-Rib-TK-WPRE-mut 122aT)를 각각 Hep3B(hTERT+, miR-122a-), Huh7(hTERT+, miR-122a+), Huh7.5(hTERT+, miR-122a+)세포에 형질도입하였다.
구체적으로, 35mm dish에 106개의 세포를 분주한 후 1일 후에 PT(PEPCK-TK), PRT-122aT(PEPCK-Rib-TK-122aT), EPRT-122aT(PEPCK-SD/SA-Rib-TK-WPRE-122aT), EPRT-mut 122aT(PEPCK-SD/SA-Rib-TK-WPRE-mut 122aT) 및 pAVQ 벡터를 PEI를 이용하여 2ug씩 transfection 한 후 배양하였다. 그 후 1일 후에 각각의 세포를 96 well plate(TPP)에 104개씩 계대배양하였다. 이후 다음날부터 5일 동안 GCV가 함유된 배지를 2일에 한 번씩 갈아주면서 배양하고, 5일 후 CellTiter 96® AQueous ONE Solution Cell Proliferation Assay(Promega)를 각 배지에 20%로 첨가하여 96웰에 각 웰당 100㎕로 처리하여 Microplate reader model 550(BioRad)으로 490㎚ 파장으로 측정하여 세포의 생존율(cell survival)을 관찰하였다.
도 4에 나타난 바와 같이, miR-122a- 인 Hep3B 세포에서 SD/SA 및 WPRE가 연결된 라이보자임(EPRT-122aT, EPRT-mut 122aT)을 형질도입한 경우 SD/SA 및 WPRE가 연결되지 않은 라이보자임(PRT-122aT, PRT-mut 122aT)을 형질도입한 경우에 비해 세포사를 더 많이 유도한 것을 확인하였으며, 이로부터 SD/SA 및 WPRE가 연결된 라이보자임의 간암세포에 대한 치료 효과가 증가된 것을 다시 확인할 수 있었다.
나아가, 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임에 miR-122aT가 추가로 연결된 재조합 벡터인 PRT-122aT, EPRT-122aT를 형질도입한 경우 mut-122aT가 연결된 재조합 벡터를 도입한 경우에 비해 miR-122a- 간암세포에 대한 세포사 유도 효과가 더욱 우수한 것을 알 수 있었다.
또한, miR-122a+ 인 Huh7세포 및 Huh7.5 세포에 상기와 동일한 재조합 벡터들을 형질도입한 후 세포사를 관찰하였다. 도 5a 및 도 5b에 나타난 바와 같이, miR-122a가 발현되는 세포에서는 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임에 miR-122aT가 추가로 연결된 재조합 벡터인 PRT-122aT, EPRT-122aT를 형질도입한 경우 mut-122aT가 연결된 재조합 벡터를 도입한 경우에 비해 세포사가 감소된 것을 확인하였다.
상기와 같은 결과로부터 정상 간 세포 특이적으로 발현되고 간암 세포에서는 발현이 감소되는 것으로 알려져 있는 miR-122a를 표적으로 인식하는 miR-122aT를 삽입한 라이보자임의 경우, miR-122a- 인 간암 세포에서 특이적으로 세포사를 유도할 수 있으며 이를 이용하여 간암 세포 특이적으로 치료 효과를 나타낼 수 있음을 알 수 있었다.
5-2. Adenoviral vector MTS assay
암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임에 miR-122aT가 추가로 연결된 재조합 벡터를 형질도입하여 발현된 라이보자임이 간암 세포 특이적인 효과를 나타내는 것을 상기 5-1의 transient assay 외에 바이러스 감염을 이용한 assay를 이용하여 다시 확인하였다.
구체적으로, HepG2(hTERT+, miR122a-) 세포 및 SKLU-1(hTERT-, miR122a-) 세포를 96 well plate(TPP)에 104개씩 각각 분주한 후 1일 후에 상기 실시예 2에서 제작한 Ad-PT, Ad-PRT-122aT, Ad-EPRT-122aT 및 Ad-EPRT-mut 122aT을 각각 감염시켰다. 대조군으로 PBS를 사용하였다. 이후 다음 날부터 5일 동안 GCV가 함유된 배지를 2일에 한 번씩 갈아주면서 배양하였다. 5일 후 CellTiter 96® AQueous ONE Solution Cell Proliferation Assay(Promega)를 각 배지에 20%로 첨가하여 96웰에 각 웰당 100㎕로 처리하여 Microplate reader model 550(BioRad)으로 490㎚ 파장으로 측정하여 세포의 생존율(cell survival)을 관찰하였다.
상기 실험결과, 도 6a 및 도 6b에 나타난 바와 같이, hTERT가 발현되는 HepG2 세포에서 hTERT가 발현되지 않은 SKLU-1 세포에 비해 세포사가 더 많이 유도된 것을 확인하였다. 이로부터 본 발명의 라이보자임이 hTERT가 발현되는 간암 세포에 특이한 것을 다시 확인하였다.
또한, 세포사가 유도된 HepG2 세포에서도 SD/SA 및 WPRE가 추가로 연결된 라이보자임을 발현시키는 EPRT-122aT 및 EPRT-mut 122aT를 도입한 경우 세포사를 더 많이 유도함을 확인할 수 있었으며 이로부터 SD/SA 서열 및 WPRE에 의해 치료 효과가 증대될 수 있음을 다시 확인하였다.
나아가, 본 발명자들은 HepG2(hTERT-, miR122a-) 세포를 이용하여 테트라사이클린 의존적으로 miR-122a를 발현시키는 stable cell을 제작하였다.
miR-122a에 의해서 hTERTrib-TK-miR122aT 아데노 바이러스가 조절됨을 확인하기 위해 Tetracycline-inducible system (Tet-on system)을 사용하였으며, TetR와 테트라사이클린에 의해 조절되는 Tet pri-122a를 클로닝하였고, 이를 가지고 stable cell을 제작하였다. 정상(Normal) 배지에 들어있는 테트라사이클린에 의한 Tet pri-122a의 발현을 억제시키기 위해 TetR가 발현되는 stable cell을 우선 제작하였다. 상기 stable cell은 정상 배지에서는 miR-122 발현이 억제되고 부가적으로 테트라사이클린을 첨가한 배지에서 miR-122a를 발현시키는 특성을 나타내도록 하였다.
7개의 TetR 클론들 중에서 TetR 양이 가장 많이 발현되는 클론 # 4 를 선별하였고, 순차적으로 Tet pri-122a stable cell을 제작하여 노던블롯(northern blot)으로 테트라사이클린에 의해 miR-122a발현이 on / off되는 Tet pri-122a stable 클론 # 5 를 선별하였다.
테트라사이클린을 투여하여 miR-122a가 발현이 되는 세포와 테트라사이클린을 투여하지 않아 miR-122a가 발현되지 않는 세포 각각에 상기 실시예 2에서 제작한 재조합 아데노바이러스인 Ad-PT, Ad-PRT-122aT, Ad-EPRT-122aT 및 Ad-EPRT-mut 122aT을 각각 감염시켰다.
도 7a 및 도 7b에 나타난 바와 같이, miR-122aT가 추가로 연결된 Ad-PRT-122aT 및 Ad-EPRT-122aT를 감염시킨 경우 Tet+(miR-122a+)인 세포에서는 Tet-(miR-122a-)인 세포에 비해 세포사가 거의 유도되지 않음을 알 수 있었다. 이로부터 miR-122aT가 추가로 연결된 재조합 벡터를 형질도입하여 발현된 라이보자임이 miR-122의 발현이 감소된 간암 세포를 특이적으로 인식하여 세포사를 유도하는 것을 다시 확인하였다.
또한 Tet-(miR-122a-)인 세포에서의 세포사 유도 효율을 살펴보면, Ad-PRT-122aT를 감염시킨 경우에 비해 SD/SA 및 WPRE가 추가로 연결된 라이보자임을 발현시키는 Ad-EPRT-122aT를 감염시켰을 때 세포사가 증가한 것을 알 수 있었다.
5-3. 동물 실험(Animal assay)
1) 독성 검사
4 내지 5주령 C57BL 마우스(Orient Bio inc.)를 사용하여 음성 대조군(PBS), Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010), Ad-EPRT-122aT(0.5 x 1010)를 각각 주입하였다. 주입 후 2, 7일 그리고 14일 (n = 7) 후에 혈액 샘플을 얻어 ALT와 AST 수준을 측정하였다.
2) 항암 효과의 검증
4 내지 5주령 BALB/c 마우스(Orient Bio inc.)에 Hep3B 세포(간암 세포)를 3 x 106 세포 양으로 비장 내로 이식하여, 종양 모델(동소 다발성 간암 모델)을 구축하였다. 이에 음성 대조군(PBS), Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010), Ad-EPRT-122aT(0.5 x 1010)를 i.v로 주입한 후, TK 유전자의 활성을 위하여 10일 동안 매일 GCV 50 mg/kg을 주입시켰다. 10일 후 그 결과는 종양 조직의 무게 측정 및 H&E 염색을 통한 조직을 관찰하였다.
또한, Hep3B(간암 세포)를 비장 내에 이식한 이종이식(xenograft) 모델(동소 다발성 간암 모델)에 Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010), Ad-EPRT-122aT(0.5 x 1010)를 각각 전신으로 처리한 후, 정상 간 조직과 간암 조직의 gDNA를 각각 추출하여 주입된 아데노바이러스 벡터의 도입된 정도를 분자 수준에서 확인하였다.
도 8에 나타낸 바와 같이 아데노바이러스의 지속적인 발현으로 인한 정상 세포에 독성 여부를 확인하기 위하여 종양이 없는 정상 쥐에 음성 대조군(PBS), Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010), Ad-EPRT-122aT(0.5 x 1010)를 주입한 후, 10일 동안 GCV를 투입한 후 간의 모양과 간에서 나오는 효소의 수준을 측정하였다.
그 결과, 14일 동안 음성 대조군(PBS), Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010), Ad-EPRT-122aT(0.5 x 1010)를 주입한 쥐는 PBS를 주입한 쥐와 거의 비슷한 변화를 보였다. 이는 정상 간에서는 TK 유전자가 생성되지 않음을 시사한다. 또한, AST/ALT 양에도 PBS를 주입한 쥐와 비교하여 유사한 수치가 관찰되었다.
또한, 도 9a 및 도 9b에 나타낸 바와 같이, Ad-EPRT-122aT 리보자임의 간암세포 치료제로서의 가능성을 검증하기 위하여 Hep3B 세포(간암 세포)를 비장 내에 이식된 종양(동소 다발성 간암 모델)에 음성 대조군(PBS), Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010), Ad-EPRT-122aT(0.5 x 1010)를 i.v로 주입한 후 그 결과를 관찰하였다. 바이러스를 주입시킨 후 TK 유전자의 활성을 위하여 10일 동안 매일 GCV 50 mg/kg을 주입시켰다. 10일 후 그 결과는 종양 조직의 무게로 나타내었다. PBS를 주입한 음성 대조군의 경우에는 종양의 무게가 증가하였지만 Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010), Ad-EPRT-122aT(0.5 x 1010)를 주입한 경우에는 종양의 무게가 현저히 감소하였다. 또한, Ad-EPRT-122aT를 1 x 1010 농도로 처리하였을 때, 10 x 1010 농도로 처리한 것과 동일한 효과를 확인하였다. 동시에 암발생 모델에서 처리된 바이러스에 의한 간독성이 유발되지 않음을 확인하였다.
아울러, 도 10에서 확인한 바와 같이, 최종 GCV 투입 완료 후 암 발생 쥐의 간을 관찰하였다. PBS를 처리한 대조군 그룹의 간은 대부분이 종양으로 대체되어 있었으며, 그와는 반대로 Ad-PRT-122aT(10 x 1010), Ad-EPRT-122aT(10 x 1010), Ad-EPRT-122aT(2 x 1010), Ad-EPRT-122aT(1 x 1010)를 주입한 쥐의 간은 종양이 거의 관찰되지 않았고, Ad-EPRT-122aT(0.5 x 1010)를 주입한 경우에는 종양이 부분적으로 관찰되었다. 현미경으로 관찰하는 것을 통해서 매우 작은 종양을 관찰할 수 있었을 뿐이다. 이는 Ad-EPRT-122aT의 효능이 Ad-PRT-122aT(10 x 1010)의 1/10에 해당하는 adenovirus의 도입을 통해 동등한 암치료 효능을 나타냄을 시사한다. 뿐만 아니라 도 11에서는 상기 간조직에 대해서 H&E 염색을 통해 간조직의 손상 및 면역반응이 일어나지 않음을 검증하였다.
또한, 도 12에서 확인한 바와 같이, Ad-EPRT-122aT가 용량 의존적으로 정상 간 조직 및 이식된 간암 조직 모두에 감염된 것을 관찰하였다. 상기 결과는 SD/SA, WPRE, miR-T가 도입된 hTERT 타겟팅 리보자임 유도체 아데노바이러스(Ad-EPRT-122aT)를 간암 동물모델에 전신도입할 경우, 기존 리보자임 아데노바이러스에 비해 1/10의 적은 양으로도 간 독성 없이 동등한 항암 효능이 나타난다는 것을 시사한다. 즉, 동물모델에서도 SD/SA 및 WPRE이 도입된 리보자임에 의해 항암 효율성이 증가된다는 것을 확인한 것이다. 따라서, 상기 결과는 동물모델 정상 간 및 이식 간암 조직으로의 아데노바이러스 도입을 분자 수준에서 검증한 결과이다.
상기와 같은 결과로부터 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임에 있어서 SD/SA 및 WPRE가 추가로 연결된 경우, 라이보자임의 발현이 증가하여 세포사를 유도하는 효과가 더욱 증가하며, miR-122a를 표적으로 하는 miR-122aT를 연결함으로써 miR-122a의 발현이 정상적으로 이루어지는 정상 간 세포에 대해서는 세포사를 유도하지 않고 miR-122a의 발현이 감소된 간암 세포에 대해서만 세포사를 유도하여 간암 세포 특이적으로 치료가 가능함을 알 수 있었다.
따라서, 본 발명의 SD/SA, WPRE 및 miR-122aT가 추가로 연결된 암 유전자 치료제가 연결된 트랜스-스플라이싱 라이보자임을 이용하여 간암 세포의 세포사 유도 효율이 증가할 뿐 아니라 정상 세포의 사멸을 억제하여 부작용을 최소화함으로써 암 특이적인 치료 효과를 더욱 높일 수 있다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (15)

  1. (i) 조직 특이적 프로모터; 및
    (ii) 암특이적 유전자를 표적으로 하는 트랜스-스플라이싱 라이보자임, 상기 라이보자임의 3' 엑손에 연결된 목적 유전자를 포함하는, 라이보자임-목적 유전자 발현 카세트를 포함하며,
    상기 발현카세트는 라이보자임-목적 유전자 발현 카세트의 5' 말단에 스플라이싱 공여/스플라이싱 수여 서열(splicing donor/splicing acceptor sequence, SD/SA sequence)이 연결되고, 3' 말단에 WPRE(Woodchuck hepatitis virus Posttranscriptional Regulatory Element)가 연결된 것으로, (iii) 상기 WPRE의 3' 말단에 마이크로 RNA-122a(microRNA-122a, miR-122a)를 인식하는 핵산 서열이 추가로 연결된 것을 특징으로 하는, 재조합 벡터.
  2. 제1항에 있어서,
    상기 트랜스-스플라이싱 라이보자임은 서열번호 5의 핵산 서열을 포함하는것인, 재조합 벡터.
  3. 제1항에 있어서,
    상기 암특이적 유전자는 TERT(Telomerase Reverse Transcriptase) mRNA, AFP(alphafetoprotein) mRNA, CEA(carcinoembryonic antigen) mRNA, PSA(Prostate-specific antigen) mRNA, 또는 CKAP2(Cytoskeleton-associated protein 2) mRNA인 것인 재조합 벡터.
  4. 제1항에 있어서,
    상기 조직 특이적 프로모터는 간세포 특이적 프로모터인 PEPCK (phosphoenolpyruvate carboxykinase) 프로모터, 아포리포프로테인 E(apolipoprotein E) 프로모터, 혈청 알부민 프로모터, 간암 특이적 AFP(alphafetoprotein) 프로모터인 것인, 재조합 벡터.
  5. 제4항에 있어서,
    상기 조직 특이적 프로모터는 서열번호 2의 핵산 서열로 이루어진 PEPCK (phosphoenolpyruvate carboxykinase) 프로모터인, 재조합 벡터.
  6. 제1항에 있어서, 상기 목적 유전자는 치료용 유전자 또는 리포터 유전자인, 재조합 벡터.
  7. 제6항에 있어서,
    상기 치료용 유전자는 약제감수성 유전자, 세포사멸 유전자, 세포증식 억제 유전자, 세포독성 유전자, 종양 억제인자 유전자, 항원성 유전자, 사이토카인 유전자 및 항신생 혈관 생성 유전자로 이루어진 군에서 선택된 1종 이상의 유전자인, 재조합 벡터.
  8. 제7항에 있어서,
    상기 약제감수성 유전자는 HSVtk(Human Simplex Virus thymidine kinase) 유전자인 것인, 재조합 벡터.
  9. 제8항에 있어서,
    상기 HSVtk 유전자는 서열번호 6의 핵산 서열을 포함하는 것인, 재조합 벡터.
  10. 제6항에 있어서,
    상기 리포터 유전자는 루시퍼라제(luciferase), 녹색 형광 단백질(GFP), 변형된 녹색 형광 단백질(modified green fluorescent protein; mGFP), 증강된 녹색 형광 단백질(enhanced green fluorescent protein; EGFP), 적색 형광 단백질(RFP), 변형된 적색 형광 단백질(mRFP), 증강된 적색 형광 단백질(ERFP), 청색 형광 단백질(BFP), 증강된 청색 형광 단백질(EBFP), 황색 형광 단백질(YFP), 증강된 황색 형광 단백질(EYFP), 남색 형광 단백질(CFP) 및 증강된 남색 형광 단백질(ECFP)로 이루어지는 군에서 선택된 것인, 재조합 벡터.
  11. 제1항에 있어서,
    상기 마이크로 RNA-122(microRNA-122a, miR-122a)를 인식하는 핵산 서열은 서열번호 8의 핵산 서열을 포함하는 것인, 재조합 벡터.
  12. 제1항 내지 제11항 중 어느 한 항의 재조합 벡터가 도입된 형질전환 세포.
  13. 제1항 내지 제11항 중 어느 한 항의 재조합 벡터로부터 발현된 라이보자임.
  14. 제1항 내지 제11항 중 어느 한 항의 재조합 벡터 또는 제14항의 라이보자임을 유효성분으로 포함하는 간암 예방 또는 치료용 약학적 조성물.
  15. 제1항 내지 제11항 중 어느 한 항의 재조합 벡터 또는 제14항의 라이보자임을 치료를 필요로 하는 개체에 약학적으로 유효한 양으로 투여하는 단계를 포함하는, 간암 치료방법.
PCT/KR2015/007694 2014-09-29 2015-07-23 암 특이적 트랜스-스플라이싱 라이보자임 및 이의 용도 WO2016052851A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US15/515,266 US10280420B2 (en) 2014-09-29 2015-07-23 Cancer specific-splicing ribozyme and use thereof
EP15847264.7A EP3202909B1 (en) 2014-09-29 2015-07-23 Cancer specific-splicing ribozyme and use thereof
JP2017518146A JP6633626B2 (ja) 2014-09-29 2015-07-23 癌特異的トランススプライシングリボザイム及びその用途

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20140130286 2014-09-29
KR10-2014-0130286 2014-09-29
KR10-2014-0185976 2014-12-22
KR1020140185976A KR101712247B1 (ko) 2014-09-29 2014-12-22 암 특이적 트랜스-스플라이싱 라이보자임 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2016052851A1 true WO2016052851A1 (ko) 2016-04-07

Family

ID=55630846

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/007694 WO2016052851A1 (ko) 2014-09-29 2015-07-23 암 특이적 트랜스-스플라이싱 라이보자임 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2016052851A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11078487B2 (en) 2019-02-22 2021-08-03 Rznomics Inc. Cancer-specific trans-splicing ribozymes and use thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100024055A (ko) * 2008-08-25 2010-03-05 단국대학교 산학협력단 조직 특이적 프로모터와 암 특이 유전자를 타겟팅하는트랜스-스플라이싱 라이보자임을 포함하는 재조합아데노바이러스 및 이의 용도
KR20120132594A (ko) * 2011-05-26 2012-12-06 단국대학교 산학협력단 마이크로ｒｎａ를 이용한 조절을 통한 암 특이적 유전자 치료제

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100024055A (ko) * 2008-08-25 2010-03-05 단국대학교 산학협력단 조직 특이적 프로모터와 암 특이 유전자를 타겟팅하는트랜스-스플라이싱 라이보자임을 포함하는 재조합아데노바이러스 및 이의 용도
KR20120132594A (ko) * 2011-05-26 2012-12-06 단국대학교 산학협력단 마이크로ｒｎａ를 이용한 조절을 통한 암 특이적 유전자 치료제

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBan k 2 August 1993 (1993-08-02), "Herpes simplex virus type 1 thymidine kinase and 3KBL genes", Database accession no. J02224.1 *
KWON, B-S. ET AL.: "Specific Regression of Human Cancer Cells by Ribozyme-Mediated Targeted Replacement of Tumor-Specific Transcript", MOLECULAR THERAPY, vol. 12, no. 5, November 2005 (2005-11-01), pages 824 - 834, XP005126644, DOI: doi:10.1016/j.ymthe.2005.06.096 *
LIM, JI YEONG: "Studies on the Improvement of Efficacy of Trans-Splicing Ribozyme for Cancer Therapy based on Group I Intron of Tetrahymena Thermophila", MASTER'S THESIS OF GRADUATE SCHOOL OF DANKOOK UNIVERSITY, 2012 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11078487B2 (en) 2019-02-22 2021-08-03 Rznomics Inc. Cancer-specific trans-splicing ribozymes and use thereof

Similar Documents

Publication Publication Date Title
KR101712247B1 (ko) 암 특이적 트랜스-스플라이싱 라이보자임 및 이의 용도
US7048920B2 (en) Recombinant oncolytic adenovirus for human melanoma
EP0791050B1 (en) Vectors for tissue-specific replication
JP2008507279A (ja) アデノウイルスベクター中への導入遺伝子の付加
US20100008977A1 (en) Liposomally encapsulated hybrid adenovirus-semliki forest virus (sfv) vectors carrying rnai constructs and therapeutic genes for use against cancer targets and other diseases
US20120230954A1 (en) Drug Comprising As The Active Ingredient Proliferative Vector Containing Survivin Promoter
KR102252423B1 (ko) 암 특이적 트랜스-스플라이싱 리보자임 및 이의 용도
WO2013027988A2 (ko) 트랜스-스플라이싱 라이보자임 및 암치료 유전자를 포함하는 재조합 아데노바이러스 및 이의 용도
WO2019117632A1 (ko) 재조합 아데노바이러스 및 이를 포함하는 줄기세포
US11078487B2 (en) Cancer-specific trans-splicing ribozymes and use thereof
JP2007525949A (ja) 自己プロセッシング性ペプチド切断部位を含む細胞特異的複製適格ウィルス・ベクター
US7482156B2 (en) Hepatocellular carcinoma specific promoter and uses thereof
WO2016052851A1 (ko) 암 특이적 트랜스-스플라이싱 라이보자임 및 이의 용도
JP6238485B2 (ja) Ａｕｒｏｒａキナーゼプロモーターを含む増殖制御型ウイルスベクター
WO2005035744A1 (fr) Tumeur ciblant un virus a deux genes, procedes d'hybridation et utilisation
WO2022158891A1 (ko) 면역관문 억제제를 발현하는 암 특이적 트랜스-스플라이싱 리보자임 및 이의 용도
WO2023128048A1 (ko) 암 특이적 트랜스-스플라이싱 리보자임과 면역관문억제제를 포함하는 암 치료적 병용물
WO2023014206A1 (ko) 방사선 치료와 병용되는 유전자 치료제로서 암 특이적 트랜스-스플라이싱 리보자임
WO2019132594A1 (ko) 유전자 전달용 세포 시트
WO2022060155A1 (ko) 재조합 발생이 최소화된 유전자치료 벡터, 상기 벡터를 포함하는 재조합 레트로바이러스 및 상기 재조합 레트로바이러스를 포함하는 암의 예방 또는 치료용 약학 조성물
KR102471898B1 (ko) 면역관문 억제제를 발현하는 암 특이적 트랜스-스플라이싱 리보자임 및 이의 용도
WO2002053760A2 (en) Chimeric cytolytic viruses for cancer treatment
JP5574284B6 (ja) サービビン（Ｓｕｒｖｉｖｉｎ）プロモーターを含む増殖型アデノウイルスベクターを有効成分とする癌治療薬
WO2013137495A1 (ko) 슈도타입 복제가능 레트로바이러스 벡터 시스템
WO2017065497A1 (ko) 유전자 전달 및 유전자 치료를 위한 아데노바이러스 복합체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15847264

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017518146

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2015847264

Country of ref document: EP