WO2016044330A1 - Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm - Google Patents
Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm Download PDFInfo
- Publication number
- WO2016044330A1 WO2016044330A1 PCT/US2015/050274 US2015050274W WO2016044330A1 WO 2016044330 A1 WO2016044330 A1 WO 2016044330A1 US 2015050274 W US2015050274 W US 2015050274W WO 2016044330 A1 WO2016044330 A1 WO 2016044330A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- expression level
- biomarkers
- nen
- gep
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/533—Production of labelled immunochemicals with fluorescent label
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57557—Immunoassay; Biospecific binding assay; Materials therefor for cancer of other specific parts of the body, e.g. brain
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- Gastroenteropancreatic (GEP) neuroendocrine neoplasm GEP-NEN
- GEP-NEN Gastroenteropancreatic Neuroendocrine Tumor and Neuroendocrine Tumor
- GI gastrointestinal
- Incidence and prevalence have increased between 100 and 600 percent in the U.S. over the last thirty years, with no significant increase in survival.
- GEP-NENs have made diagnosis, treatment, and classification difficult. These neoplasms lack several mutations commonly associated with other cancers and microsatellite instability is largely absent. See Tannapfel A, Vomsch S, Karhoff D, et al., "BRAF gene mutations are rare events in gastroenteropancreatic neuroendocrine tumors," Am J Clin Pathol 2005; 123(2):256-60; Banck M, Kanwar R, Kulkarni AA, et al, "The genomic landscape of small intestine neuroendocrine tumors," J Clin Invest 2013; 123(6):2502- 8; Zikusoka MN, Kidd M, Eick G, et al, Molecular genetics of gastroenteropancreatic neuroendocrine tumors.
- tissue resources e.g., biopsy
- associate with distinct clinical behavior yet there is no definitive, generally accepted pathologic classification or prediction scheme, hindering treatment assessment and follow-up.
- GEP-NENs Existing diagnostic and prognostic approaches for GEP-NENs include imaging ⁇ e.g., CT or MRI), histology, measurements of circulating hormones and proteins associated with NENs e.g., chromogranin A and detection of some gene products. Available methods are limited, for example, by low sensitivity and/or specificity, inability to detect early-stage disease, or exposure to radiation risk. GEP-NENs often go undiagnosed until they are metastatic and often untreatable. In addition, follow-up is difficult, particularly in patients with residual disease burden.
- GEP- NEN GEP- NEN
- stable and progressive GEP-NEN for example, for use in diagnosis, prognosis, prediction, staging, classification, treatment, monitoring, and risk assessment, and for
- the present application overcomes the above-noted problems by providing novel compositions, methods, and kits for accurately diagnosing, detecting, and monitoring the presence of GEP-NENs and/or the types or stage of GEP-NEN in circulating peripheral blood samples.
- the described embodiments furthermore may be used to identify a level of risk for a patient to develop a progressive GEP-NEN, and/or to determine the risk of residual or
- GEP-NEN peptide receptor radiotherapy
- the present invention relates to gastroenteropancreatic
- GEP-NEN neuroendocrine neoplasm
- biomarkers measured in circulating blood, the detection of which may be used in diagnostic, prognostic and predictive methods.
- GEP-NEN biomarkers feature subsets and panels of the biomarkers, agents for binding and detecting the biomarkers, kits and systems containing such agents, and methods and compositions for detecting the biomarkers, for example, in biological samples e.g., blood, as well as prognostic, predictive, diagnostic, and therapeutic uses thereof.
- agents Provided are agents, sets of agents, and systems containing the agents for GEP-
- the systems include a plurality of agents (e.g., set of agents), where the plurality specifically binds to and/or detects a plurality of GEP-NEN biomarkers in a panel of GEP-NEN biomarkers.
- the agents may be isolated polypeptides or polynucleotides which specifically bind to one or more GEP-NEN biomarkers.
- sets of isolated polynucleotides and polypeptides that bind to a panel of GEP-NEN biornarkers, and methods and uses of the same.
- prognostic, diagnostic, and predictive methods and uses of the agents, compositions, systems, and kits for GEP-NEN and associated conditions, syndromes and symptoms are provided.
- methods and uses for detection, diagnosis, classification, prediction, therapeutic monitoring, prognosis, or other evaluation of GEP-NEN or an outcome, stage or level of aggressiveness or risk thereof, or associated condition are performed by determining the presence, absence, expression levels, or expression profile of a GEP-NEN biomarker, more typically a plurality of GEP-NEN biornarkers, such as a feature subset chosen from a panel of biornarkers, and/or comparing such informati on with normal or reference expression levels or profiles or standards.
- the methods are carried out by obtaining a biological test sample and detecting the presence, absence, expression level score, or expression profile of a GEP-NEN biomarker as described herein.
- the methods can be performed with any of the systems of agents, e.g., polynucleotides or polypeptides, provided herein.
- the methods generally are carried out using one or more of the provided systems.
- GEP-NEN types and stages include stable disease (SD) and progressive (highly active) disease (PD).
- SD stable disease
- PD progressive (highly active) disease
- the provided methods and compositions may be used to specifically and sensitively detect different stages of GEP-NENs, such as GEP-NENs in a stable disease (SD) or progressive disease (PD) states; in some aspects, the methods and compositions may be used to predict disease progression, treatment response, and metastasis.
- SD stable disease
- PD progressive disease
- Methods and compositions provided herein are useful for diagnosis, prognosis, prediction, staging, classification, treatment, monitoring, assessing risk, and investigating molecular factors associated with GEP-NEN disease.
- [0014] Provided are methods and compositions that are useful for defining gene expression-based classification of GEP-NENs, and thus are useful for allowing the prediction of malignancy and metastasis, such as in early stage disease or using histologically negative samples, providing accurate staging, facilitating rational therapy, and in developing large validated clinical datasets for GEP-NEN- specific therapeutics.
- the GEP-NEN biomarkers may include a subset of biomarkers, the expression of which is different in or is associated with the presence or absence of GEP-NEN, or is different in or is associated with a particular classification, stage, aggressiveness, severity, degree, metastasis, symptom, risk, treatment responsiveness or efficacy, or associated syndrome.
- the subset of GEP-NEN biomarkers typically includes at least 22 GEP-NEN biomarkers.
- the subset of biomarkers includes at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or 51 GEP-NEN biomarkers, or includes at or about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, or 51 GEP-NEN biomarkers.
- the subset of biomarkers includes at least 22, or at least 38, or at least 51 biomarkers.
- the subset contains at least 22 biomarkers, or about 22 biomarkers, or 22 biomarkers, chosen from a panel of 38 biomarkers.
- the subset of biomarkers includes at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 biomarkers chosen from a panel of 38 biomarkers.
- the systems, methods, and kits contain a plurality of agents that specifically bind to or hybridize to the biomarkers in the panel, the number of biomarkers general ly relates to the number of agents in a particular system.
- the provided methods is a method that contains at least 22 binding agents, which specifically hybridizes to or binds to a subset of at least 22 GEP-NEN biomarkers, respectively.
- the subset of biomarkers includes at least 22, 23, 24, 25, 26, 27,
- polynucleotides e.g. 38 transcripts
- polypeptides include polynucleotides (e.g. 38 transcripts) and polypeptides: PNMA2, NAP1L1, FZD7, SLCI8A2/VMAT2, NOL3, SSTR5, TPHl, RAFl, RSFL SSTR3, SSTRl, CD59, ARAF, APLP2, RAS, MORF4L2, TRMT112, M I67/ J67, SSTR4, CTGF, SPATA7, ZFHX3, PHF21A, SLC 18 A 1/VMAT 1 , ZZZ3, TECPR2, ATP6V1H, OAZ2, PANK2, PLD3, PQBP1, RNF41, SMARCD3, BNIP3L, WDFY3, COMMD9, BRAF, and/or GLT8D1 gene products.
- the subset of 22 biomarkers includes PN MA2, NAPI LI,
- agents, and systems are those that are able to classify or detect a GEP-NEN in a human blood sample.
- the provided systems and methods can identify or classify a GEP-NEN in a human blood sample.
- the systems can provide such information with a specificity, sensitivity, and/or accuracy of at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, e.g., at least 80%.
- the system can predict treatment responsiveness to, or determine whether a patient has become clinically stable following, or is responsive or non- responsive to, a GEP-NEN treatment, such as a surgical intervention or drug therapy (for example, somatostatin analog therapy).
- a GEP-NEN treatment such as a surgical intervention or drug therapy (for example, somatostatin analog therapy).
- the methods and systems do so with a specificity, sensitivity, and/or accuracy of at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, e.g., with at least 90% accuracy.
- GEP-NEN can differentiate between treated and untreated GEP-NEN with a specificity, sensitivity, and/or accuracy of at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, e.g., with a sensitivity and specificity of at least 85%.
- the system can determine diagnostic or prognostic information regarding a subject previously diagnosed with GEP-NEN, for example, whether the subject has a stable disease (SD) or progressive disease (PD) state of GEP-NEN, or is in complete remission, for example, would be clinically categorized as having stable disease, progressive disease, or being in complete remission,
- SD stable disease
- PD progressive disease
- the agents for detecting the biomarkers are capable of distinguishing between the presence and absence of GEP-NEN in a biological sample, between GEP-N EN and mucosal samples and GEP-NEN samples, and/or between specific classes or subtypes of GEP-NEN s, for example, between aggressive (high activity) and benign (low activity) GEP-NEN samples,
- the system is able to classify or detect a GEP-NEN in a human blood sample or human saliva sample.
- the human sample is whole blood or nucleic acid or protein prepared from whole blood, without first sorting or enriching for any particular population of cells.
- the system includes agents that bind to biomarkers in a subset of at least 22 GEP-NEN biomarkers.
- the provided systems in addition to the agents that bind the GEP-NEN biomarkers, contain one or more agents that bind to gene products for use in normalization or as controls, for example, housekeeping gene products include ALG9 gene products;
- the methods include selecting a subset of at least 22 biomarkers chosen from a panel of 38 biomarkers useful in generating a classifier for GEP-NEN and different stages of GEP-NEN.
- the methods further include contacting a test sample from the human patient with a plurality of agents specific to the biomarkers in the subset.
- the biological test sample used with the methods can be any biological sample, such as tissue, biological fluid, or other sample, including blood samples, such as plasma, serum, whole blood, buffy coat, or other blood sample, tissue, saliva, serum, urine, or semen sample.
- the sample is obtained from blood.
- the test sample is taken from a GEP- NEN patient.
- T he agents can be any agents for detection of biomarkers, and typically are isolated polynucleotides or isolated polypeptides or proteins, such as antibodies, for example, those that specifically hybridize to or bind to a subset or panel of GEP-NEN biomarkers including at least 22 GEP-NEN biomarkers.
- the methods are performed by contacting the test sample wi th one of the provided agents, more typi cally wi th a plurality of the provided agents, for example, one of the provided systems, such as a set of polynucleotides that specifically bind to the subset of G EP-NEN biomarkers.
- the set of polynucleotides includes DNA, RNA, cDNA, PNA, genomic DNA, or synthetic oligonucleotides.
- the methods include the step of isolating RNA from the test sample prior to detection, such as by RT-PCR, e.g., QPCR.
- detection of the GEP-NEN biomarkers, such as expression levels thereof includes detecting the presence, absence, or amount of RNA.
- the RNA is detected by PCR or by hybridization.
- the polynucleotides include sense and antisense primers, such as a pair of primers that is speci fic to each of the GEP-NEN biomarkers in the subset of biomarkers.
- the detection of the GEP-NEN biomarkers is carried out by PCR, typically quantitative or real-time PCR.
- detection is carried out by producing cDNA from the test sample by reverse transcription; then amplifying the cDNA using the pairs of sense and antisense primers that specifically hybridize to the panel of GEP- NEN biomarkers, and detecting products of the amplification.
- the GEP- NEN biomarkers include niRNA, cDNA, or protein,
- the methods further include determining a mathematically- derived expression level score of biomarkers selected in the subset in the test sample.
- This is the MAARC-NET score (Multi-Analyte Risk Classification for NETs). It has two scales 0-8 and the percentage-derivatives scaled to 100% i.e., 0-100%.
- the mathematically-derived MAARC-NET score is the product of a classifier built from predictive classification algorithms, e.g. support vector machines (SVM), linear discriminant analysis (LDA), -nearest neighbor (KNN) and/or naive Bayes (NB).
- SVM support vector machines
- LDA linear discriminant analysis
- KNN -nearest neighbor
- NB naive Bayes
- the classifier is generated from a combination of SVM, LDA, KNN, and NB classification algorithms and a 10-fold cross-validation design.
- the methods further include a step of determining a mathematically-derived expression level score of biomarkers in the subset in a normal or reference sample, typically carried out prior to the normalization and comparing steps.
- the normal or reference sample may be from a health)' patient or a patient who has GEP-NEN.
- the test sample is from a patient with GEP-NEN
- the normal or reference sample or level may be from the same or a different patient.
- the normal or reference sample may be from the GEP-NEN patient from a tissue, fluid or cell not expected to contain GEP-NEN or GEP-NEN cells.
- the normal or control sample is from the GEP-NEN patient before or after therapeutic intervention, such as after surgery or chemical intervention.
- the reference or normal sample is from a tissue or fluid that corresponds to the GEP-NEN or metastasis of the test sample, from a healthy individual, such as normal enterochromaffin cell (EC) preparation or small intestinal (SI) sample, or normal liver, lung, bone, blood, saliva, or other bodily fluid, tissue, or biological sample.
- EC enterochromaffin cell
- SI small intestinal
- the test sample is from a metastasis, plasma, or whole blood or other fluid of a GEP-NEN patient and the reference sample is from primary tumor or fluorescent activated cell (FAC)-sorted tumor cells.
- FAC fluorescent activated cell
- the test sample is from blood and the test biological sample is from the GEP-NEN patient after treatment and the reference sample is from the same GEP-NEN patient as the test biological sample, prior to treatment; the reference sample is from a tissue or fluid not containing GEP-NEN cells; the reference sample is from a healthy individual; the reference sample is from a cancer other than GEP-NEN; the reference sample is from an EC cell or SI tissue; the test biological sample is from a metastatic GEP-NEN and the reference sample is from a non-metastatic GEP-NEN; or the reference sample is from a GEP-NEN of a different classification compared to the GEP-NEN patient from which the test biological sample is obtained.
- the test biological sample is from a GEP-NEN patient prior to treatment and the normal or reference sample is from the GEP-NEN patient after treatment.
- the normal or reference sample is from a non-metastatic tissue of the GEP-NEN patient.
- a normalization step is performed to normalize the level of expression score of the biomarkers in the subset in the test sample to the level of expression score of the biomarkers in the subset in the reference sample.
- a comparison step is performed to determine whether there is a difference, such as a significant difference, between the normalized expression level score and a predetermined cut-off value or score threshold.
- Certain predetermined cut-off values or score thresholds are indicative of different stages of GEP-NEN, while others are indicative of different levels of risk, i.e. low, intermediate, or high, for developing a progressive GEP-NEN.
- the methods include comparing the normalized expression level score with a predetennined cutoff value chosen to exclude a control or reference sample, wherein a normalized expression level above the predetermined cutoff value is indicative of a GEP-NEN, wherein the cutoff value is about 2 (on a scale of 0-8, or 13.4% on a scale of 0-100%).
- the methods include comparing the normalized expression level score with a predetermined cutoff value chosen to exclude a non-progressive GEP-NEN, wherein a normalized expression level above the predetermined cutoff value of 5 (on a scale of 0-8, or 43.4%) on a scale of 0-100%s) is indicative of progressive GEP-NEN.
- the methods further include identifying the level of risk for a human patient to develop progressive GEP-NEN, wherein a normalized expression level score below about 5 (or 43.4%>) is indicative of a low level of risk for developing a progressive GEP- NEN, a normalized expression level score between about 5 and 7 (43.4% 0 -63.4% 0 ) is indicative of an intermediate level of risk for developing progressive GEP-NEN, and a normalized expression level score between about 7 and 8 (>63.4%) is indicative of a high level of risk for developing progressive GEP-NEN.
- a normalized expression level score below about 5 is indicative of a low level of risk for developing a progressive GEP- NEN
- a normalized expression level score between about 5 and 7 43.4% 0 -63.4% 0
- a normalized expression level score between about 7 and 8 is indicative of a high level of risk for developing progressive GEP-NEN.
- identifying the intermediate level of risk for developing progressive GEP-NEN further includes determining a first state of intermediate risk, wherein the normalized expression level score between a nonprogressive reference sample and the test sample is about 5 (43.4%), the normalized expression level of SMARCD3 is below a first threshold value, and the expression level of TPH1 is below a second threshold value.
- identifying the intermediate level of risk for developing progressive GEP-NEN further includes determining a second state of intermediate risk, wherein the normalized expression level score between a non-progressive reference sample and the test sample is about 6 (52.7%), the normalized expression level of VMAT1 is equal to or above 0, and the expression level of PHF21 A is equal to or above a first threshold value.
- identifying the intermediate level of risk for developing progressive GEP-NEN further includes determining a third state of intermediate risk, wherein the normalized expression level score between a non-progressive reference sample and the test sample is about 7 (63.4%), the expression level of VMAT1 is equal to or above 0, and the expression level of PHF21A is equal to or below a first threshold value.
- NEN further includes determining the normalized expression level score of ZZZ3, wherein the expression level score of ZZZ3 is equal to or less than 14.
- the level of risk for residual or reoccurring progressive GEP-NEN in the post-surgical test sample is identified, wherein a normalized expression level score below about 5 (43.4%) is indicative of a low level of risk, a normalized expression level score between about 5 and 7 (43.4-63.4%) is indicative of an intermediate level of risk, and a normalized expression level score between about 7 and
- GEP-NEN further includes determining an elevated expression level score of gene products in at least one gene cluster as determined between a pre-surgical test sample from the patient and the post-surgical test sample.
- the at least one gene cluster includes the proliferome, signalome, secretome I and II, plurome, epigenome, plurome, SSTRome, and combinations thereof.
- the at least one gene cluster includes the PD cluster, the
- the PD cluster includes the proliferome, signalome, secretome II, plurome, and epigenome.
- the ND cluster includes the ARAF1, BRAF, KRAS, RAF1, Ki67, NAP1L1, NOL3, GLT8D1, PLD3, PNMA2, VMAT2, TPH1, FZD7, MORF4L2, and ZFHX3.
- the TD cluster includes the Secretome (I), the Plurome, and the
- the ID cluster includes the Proliferome, secretome (II), plurome, and epigenome.
- determining the elevated expression of gene products in at least one gene cluster includes evaluating a plurality of gene cluster algorithms including the PDA, NDA, TDA, and IDA algorithms.
- the methods further include treating the patient based on the indication of intermediate or high level of risk for residual or recurring progressive GEP- NEN by one of surgery or therapy.
- the level of risk for somatostatin treatment failure is identified, wherein a normalized expression level score below about 5 (43.4%) is indicative of a low level of risk, a normalized expression level score between about 5 and 7 (43.4-63.4%) is indicative of an intermediate level of risk, and a normalized expression level score between about 7 and 8 (>63.4%>) is indicative of a high level of risk.
- the methods may further include determining the difference in expression level score in at least one of the SSTRome and Proliferome gene clusters between a pre-therapy test sample from the human patient and the post-therapy test sample, wherein an increased level of expression score is indicative of increased risk for residual or reoccurring progressive GEP-NEN.
- a somatostatin analog is administered to the human patient-based on the indication of intermediate or high level of risk for residual or recurring progressive GEP- NEN and an increased level of expression in at least one of the SSTRome and Proliferome gene clusters.
- FIGURES 1A - IE are graphs showing differential exon expression in a marker gene panel inferred from an Affymetrix Human Exon 1.0 ST array in neuroendocrine tumor (NET) tissue relative to normal intestinal mucosa controls.
- RMA-normalized exon expressions of (A) Tphl, (B) VMAT2, (C) SCG5, (D) CgA, and (E) PTPRN2 were visualized in normal (green) and tumor (samples).
- FIGURES 2A - 2E are graphs showing the validation of alternative splicing in marker genes by Reverse transcriptase polymerase chain reaction (RT-PCR).
- Marker genes A) Tphl, (B) VMAT2, (C) SCG5, (D) CgA, and (E) PTPRN2 were differentially expressed in NET samples relative to normal mucosa controls.
- FIGURE 3 is a line graph showing the prediction accuracy of four classification algorithms (SVM, LDA, KNN, and Bayes) using sequential addition of up to 22 significantly up- regulated genes (p ⁇ 0.05) in GEP-NET samples obtained using the results of 10-fold cross validation.
- FIGURES 4A - 4C are graphs showing mathematically-derived MAARC-NET scores in the test set. A) Frequency distribution for the 0-4 score in the controls, SD and PD; B) Frequency distribution using a 0-8 score in the same sample set; C) Correlation assessment for each of the two scores in A) and B).
- FIGURES 5A - 5B are graphs showing MAARC-NET scores in the test set and a Receiver Operating Characteristics (ROC) analysis.
- ROC Receiver Operating Characteristics
- FIGURE 5A NETs had a significantly elevated score compared to controls, where values for PD were higher than SD.
- FIGURE 5B a ROC curve of controls versus GEP-NETS is shown, wherein the AUC was > 0.98, p ⁇ 0.0001.
- FIGURE 6A - 6B are A) a graph of MAARC-NET scores in the independent set, wherein Progressive Disease (PD) NETs had a significantly higher elevated score compared to Stable Disease (SD); and B) a frequency distribution graph for the 0-8 score in SD and PD.
- PD Progressive Disease
- SD Stable Disease
- FIGURES 7A - 7B are A) a graph of ROC of SD versus PD NETs with an AUC of > 0.93, p ⁇ 0.0001 and B) a graph of the percentage of SD and PD NETs correctly called using a cut-off score of > 7.
- FIGURE 8 is a nomogram for NETest 1 demonstrating how the score is achieved and categorizing patients into different disease classes.
- FIGURE 9 is a graph of the utility of the nomogram of FIG. 8. The percentages of correctly predicted SD and PD NETs, including the level of disease activity, using the nomogram of FIG. 8 are shown.
- FIGURES 10A - 10B are graphs each showing the frequency distribution for the 0-8 score in SD and PD NET tumors in A) the test set and B) the independent set.
- FIGURES 11A - 11B are graphs of A) the frequency distribution for the 0-8 score in SD and PD in the combined sets and B) the risk probability for a score being either SD or PD vs. NETest Score.
- FIGURE 12 is a nomogram of NETest 2a with the inclusion of score and risk categorizations. Top figure includes MAARC-NET as 0-8 scores; bottom figure is the 0-100% scaled version.
- FIGURE 13 is a nomogram of NETest 2 with the inclusion of risk category delineation.
- FIGURES 14A - 14B are illustrations representing the Hallmarks of Neoplasia refocused on NETs.
- FIGURE 14A shows a delineation of tumor (adenocarcinoma) derived hallmarks from Hanahan D, Weinberg RA: Hallmarks of cancer: the next generation. Cell 2011, 144(5): 646-674.
- FIGURE 14B shows NET hallmark based on the Hanahan and Weinberg classification.
- FIGURES 15A - 15B are graphs showing normalized gene expression of gene clusters in A) normal mucosa and B) NETs.
- FIGURES 16 is a graph of normalized gene expression as evaluated by the PDA and NDA algorithms in normal mucosa (NM) and NET.
- FIGURES 17A - 17C are graphs of normalized gene expression in A) normal mucosa, B) a SD related gene cluster, and C) a PD related gene cluster.
- FIGURE 18 is a graph of normalized gene expression in an independent test set, where the genes in PD and SD tumors were evaluated.
- FIGURES 19A - 19B are graphs showing normalized gene expression of PDA and NDA gene cluster algorithms in A) the test set and B) the independent set.
- FIGURES 20A - 20B are graphs showing A) normalized gene expression of PDA and NDA gene cluster algorithms in the combined set, and B) a ROC analysis curve of PDA and NDA for differentiating SD from PD, where *p ⁇ 0.05 vs. SD.
- FIGURES 21A - 21B are graphs showing normalized gene expression as evaluated by TDA and IDA gene cluster algorithms in A) the test set, and B) the independent set.
- FIGURES 22A - 22B are graphs showing a ROC analysis of A) TDA and IDA for differentiating SD from PD, and B) for each of the individual gene clusters.
- FIGURES 23A - 23B are graphs showing the alternation in A) NETest Score in Pre- and Post- Surgery conditions and B) circulating Chromogranin A (CgA) levels in Pre- and Post- Surgery conditions.
- FIGURES 24A - 24B are illustrations showing differences in the NETest nomogram in A) pre-surgical therapy conditions and B) post- surgical therapy conditions.
- FIGURES 25A - 25B are graphs showing the percentage change in A)
- FIGURES 26A - 26D are graphs showing the difference in NETest score for gene- derived algorithms, A) PDA, B) NDA, C) TDA, and D) IDA, in pre- and post- surgery conditions.
- FIGURES 27A - 271 are graphs showing the differences in NETest score for gene- derived clusters, A) SSTRome, B) Proliferome, C) Signalome, D) Metabolome, E) Secretome, F) Secretome, G) Plurome, H) EpiGenome, and I) ApopTome, in pre- and post- surgery conditions.
- FIGURE 28 is a nomogram of NETest 3 with the inclusion of surgically-relevant algorithms and gene clusters.
- FIGURES 29A - 29B are graphs showing the differences in A) NETest score and B) circulating CgA levels, each in in stable disease (SD) conditions and somatostatin analog (SSA) treatment failure (equivalent of PD conditions).
- SD stable disease
- SSA somatostatin analog
- FIGURES 30A - 30D are graphs showing the differences in gene-derived algorithms, A) PDA, B) NDA, C) TDA, and D) IDA, in stably treated patients (SD) and treatment failure (PD).
- FIGURES 31A - 311 are graphs showing the differences in gene-derived clusters, specifically A) SSTrome, B) Proliferome, C) Signalome, D) Metabolome, E) Secretome, F) Secretome, G) Plurome, H) EpiGenome, and I) ApopTome, in stably treated patients (SD) and SSA treatment failure (equivalent of PD conditions).
- FIGURES 32A - B are graphs showing a ROC analysis according to A) gene-derived cluster algorithms and B) gene clusters for differentiating treatment failure (equivalent of PD conditions) from controls.
- FIGURES 33 A - B are graphs showing the percentage of correct calls for each of A) the gene-derived cluster algorithms and clusters for defining treatment failure in patients categorized as SD and B) a Best-of-3 outperformed by a combination of SSTRome and
- FIGURE 34 is a nomogram for somatostatin analog treated patients including the mathematically-derived score as well as the SSTRome, Proliferome, and their combination.
- FIGURES 35A - 35B are graphs that demonstrate therapeutic efficacy of SSAs and the proportion of patients with low/high NETest scores that developed disease recurrence.
- FIGURES 36A - 36B are graphs that demonstrate the time point when either the NETest was elevated (>80%) or CgA was abnormal prior to the development of image positive disease recurrence as well as the times that these events occurred prior to image-positive disease recurrence.
- FIGURES 37A - 37D are graphs that demonstrate the NETest scores prior to long- term follow up (A), and the times to relapse in patients with elevated scores (B,D) or disease-free time (D).
- FIGURES 38A - 38F are graphs including predicted Ki67 index versus Ki67 index in A-B) SSTRome, C-E) All genes, and D-F) high relevant genes (KRAS, SSTR4, and VPS13C).
- FIGURES 39A - 39F are graphs showing the correlations (linear regression) between gene clusters or algorithms, A) SSTRome and Ki67, B) TDA and Ki67, C) Proliferome and Ki67, D) PDA and Ki67, E) IDA and Ki67, and F) PDA and Ki67, each versus the Ki-67 index.
- FIGURES 40 A - 40D are graphs modeling predicted SUVmax (tumor uptake - a measure of receptor density / target availability) for SSTRome (Group I: (A) and (C)) and all genes (Group II: (B) and (D)).
- FIGURES 41A - 41F are graphs modeling MTV (molecular tumor volume - a measure of the tumor burden) in individual genes (A-B), SSTRome (C-E), and all genes (D-F).
- FIGURES 42 A - 42C are graphs showing ZFHX3 expression in patients identified with (A) new lesions by imaging, with (B) progressive disease by RECIST, and (C) following surgery.
- FIGURES 43A - 43B are graphs showing ZFHX3 expression in (A) patients who remain in a stable disease state of GEP-NEN versus (B) those who develop a progressive disease state of GEP-NEN.
- FIGURES 44A - 44C are graphs representing A) the effectiveness of peptide receptor radionucleotide therapy (PRRT), B) (B) changes in NETest Score versus clinical status at 6M Follow-up (FuP) in responders (R) and non-responders (NR); and (C) change in CgA level versus clinical status at 6M FuP.
- PRRT peptide receptor radionucleotide therapy
- B changes in NETest Score versus clinical status at 6M Follow-up (FuP) in responders (R) and non-responders (NR); and
- C change in CgA level versus clinical status at 6M FuP.
- FIGURES 45 are graphs showing concordance between the NETest in responders and non-responders prior to and after therapy and in addition the comparison to CgA.
- FIGURES 46A - 46B shows the accuracy of the NETest Score versus CgA for treatment responses.
- FIGURE 47A - 47D shows expression of two subsets of NETest genes, the signalome and metabolome in blood samples prior to therapy and the differences between responders (R) and non-responders (NR), the predictive utility of each as well as when combined into a biological index (47B), the utility for predicting treatment response alone (Quotient) or as a combination with grade (Combination) (47C) and the metrics of the combination for predicting the outcome of PRRT therapy (47D).
- R responders
- NR non-responders
- the present invention provides a method for detecting a gastroenteropancreatic neuroendocrine neoplasm (GEP-NEN) in a subject in need thereof, including determining the expression level of at least 22 biomarkers from a test sample from the subject by contacting the test sample with a plurality of agents specific to detect the expression of the at least 22 biomarkers, wherein the 22 biomarkers are selected from the group consisting of APLP2, ARAF, ATP6V1H, BNIP3L, BRAF, CD59, COMMD9, CTGF, FZD7, GLT8D1, KRAS, MKI67/KI67, MORF4L2, NAP1L1, NOL3, OAZ2, PANK2, PHF21A, PLD3, PNMA2, PQBP1, RAF1, RNF41, RSFl, SLC18A1/VMAT1, SLC 18 A2/VMAT2, SMARCD3, SPATA7, SSTRl, SSTR3, SSTR4, SSTR5, TECPR2, TPH1, TR
- the score is based on a "majority vote” strategy and was developed from a binary classification system whereby a sample will be called “normal” and given a score of 0 or “tumor” and will be scored “1".
- the score can range from 0 (four calls all "normal") to 4 (four calls all "tumor”).
- Each "call” is the binary result (either "0" for normal or "1" for tumor) of one of four different learning algorithms: Support Vector Machine (SVM), Linear Discrimination Analysis (LDA), K-Nearest Neighbor (KNN), and Naive Bayes (Bayes).
- SVM Support Vector Machine
- LDA Linear Discrimination Analysis
- KNN K-Nearest Neighbor
- Naive Bayes Naive Bayes
- the at least 22 biomarkers can include APLP2, ARAF, CD59, CTGF, FZD7, KRAS, MKI67/KI67, MORF4L2, NAPILI, NOL3, PNMA2, RAFl, RSFl, SLC18A2/VMAT2, SMARCD3, SPATA7, SSTR1, SSTR3, SSTR4, SSTR5, TPH1, TRMT112, and ZFHX3.
- the methods can further include determining the presence of a progressive GEP- NEN in the subject when the normalized expression level is equal to or higher than the predetermined cutoff value, wherein the predetermined cutoff value is 5 on a scale of 0-8, or less than 55% on a scale of 0-100%.
- the methods can further include identifying a level of risk for the subject to develop a progressive GEP-NEN the method further including identifying a low level of risk for developing a progressive GEP-NEN when the normalized expression level is less than a predetermined cutoff value of 5 on a scale of 0-8, or less than 55%> on a scale of 0-100%>;
- the biomarker can be RNA, cDNA, or protein.
- the biomarker is RNA
- the RNA can be reverse transcribed to produce cDNA (such as by RT-PCR, and the produced cDNA expression level is detected.
- the expression level of the biomarker can be detected by forming a complex between the biomarker and a labeled probe or primer.
- the biomarker is RNA or cDNA
- the RNA or cDNA detected by forming a complex between the RNA or cDNA and a labeled nucleic acid probe or primer.
- the complex between the RNA or cDNA and the labeled nucleic acid probe or primer can be a hybridization complex.
- the biomarker is protein
- the protein can be detected by forming a complex between the protein and a labeled antibody.
- the label can be any label for example a fluorescent label, chemiluminescence label, radioactive label, etc.
- the test sample can be any biological fluid obtained from the subject.
- the test sample is blood, serum, plasma or neoplastic tissue.
- the reference sample can be any biological fluid obtained from a subject not having, showing symptoms of or diagnosed with a neoplastic disease.
- the reference sample is blood, serum, plasma or non-neoplastic tissue.
- the subject in need thereof can be a subject diagnosed with a GEP-NEN, a subject having at least one GEP-NEN symptom or a subject having a predisposition or familial history for developing a GEP-NEN.
- the subject can be any mammal.
- the subject is human.
- the terms subject and patient are used interchangeably herein.
- the methods can further include treating a subject identified as having an intermediate level or high level of risk for developing a progressive GEP-NEN with surgery or drug therapy.
- the drug therapy can be somatostatin analog treatment or peptide receptor radiotherapy therapy (PRRT).
- PRRT peptide receptor radiotherapy therapy
- the methods can further include treating a subject identified as having a low level of risk for developing a progressive GEP-NEN with regular or periodic monitoring over at least a six month period, a twelve month period, an eighteen month period or twenty four month period.
- the present invention also provides a method for differentiating stable and progressive GEP-NEN in a subject comprising determining that the normalized expression level of the at least 22 biomarkers from the test sample from the subject is equal to or greater than a predetermined cutoff value of 5 and less than a predetermined cutoff value of 6, according to the methods of the present invention; detecting an expression level of SMARCD3 and TPH1 from the test sample and from a reference sample by contacting the test sample and the reference sample with a plurality of agents specific to detect the expression of SMARCD3 and the expression of TPHl; normalizing the expression level of SMARCD3 and TPHl in the test sample to the expression level of SMARCD3 and TPHl in the reference sample; comparing the normalized expression level of SMARCD3 and TPHl in the test sample with a first and a second predetermined cutoff value, respectively; and determining the presence of stable GEP-NEN in the subject when the normalized expression level of SMARCD3 is greater than the first predetermined cutoff
- predetermined cutoff value wherein the first predetermined cutoff value is 1.3 on a scale of 0-8 and wherein the second predetermined cutoff value is 4 on a scale of 0-8.
- the first predetermined cutoff value of 1.3 corresponds to 12% on a scale of 0- 100% and wherein the second predetermined cutoff value of 4 corresponds to 41% on a scale of 0-100%.
- the present invention also provides a method for differentiating stable and progressive GEP-NEN in a subject comprising determining that the normalized expression level of the at least 22 biomarkers from the test sample from the subject is equal to or greater than a predetermined cutoff value of 6 and less than a predetermined cutoff value of 7, according to the methods of the present invention; detecting an expression level of VMAT1 and PHF21A from the test sample and from a reference sample by contacting the test sample and reference sample with a plurality of agents specific to detect the expression of VMAT1 and the expression of PHF21A, normalizing the expression level of VMAT1 and PHF21A in the test sample to the expression level of VMAT1 and PHF21A in the reference sample; comparing the normalized expression level of VMAT1 and PHF21A in the test sample with a first and a second
- predetermined cutoff value respectively; and determining the presence of stable GEP-NEN in the subject when the normalized expression level of VMAT1 is equal to or greater than the first predetermined cutoff value and the expression level of PHF21A is less than the second predetermined cutoff value, or determining the presence of progressive GEP-NEN in the subject when the normalized expression level of VMAT1 is equal to or greater than the first
- predetermined cutoff value and the expression level of PHF21A is equal to or greater than the second predetermined cutoff value wherein the first predetermined cutoff value is 0 on a scale of
- the first predetermined cutoff value of 0 corresponds to 0% on a scale of 0-100% and wherein the second predetermined cutoff value of 1.2 corresponds to 8% on a scale of 0-
- the present invention also provides a method for differentiating stable and progressive GEP-NEN in a subject comprising determining that the normalized expression level of the at least 22 biomarkers from the test sample from the subject is equal to or greater than a predetermined cutoff value of 7 and less than a predetermined cutoff value of 8, according to the methods of the present invention; detecting an expression level of VMAT1 and PHF21A from the test sample and a reference sample by contacting the test sample and the reference sample with a plurality of agents specific to detect the expression of VMAT1 and the expression of PHF21A; normalizing the expression level of VMAT1 and PHF21A in the test sample to the expression level of VMAT1 and PHF21A in the reference sample; comparing the normalized expression level of VMAT1 and PHF21A in the test sample with a first and a second
- predetermined cutoff value respectively; and determining the presence of stable GEP-NEN in the subject when the normalized expression level of VMAT1 is equal to or greater than the first predetermined cutoff value and the expression level of PHF21A is greater than the second predetermined cutoff value, or determining the presence of progressive GEP-NEN in the subject when the normalized expression level of VMAT1 is equal to or greater than the first
- predetermined cutoff value and the expression level of PHF21A is equal to or less than the second predetermined cutoff value wherein the first predetermined cutoff value is 0 on a scale of 0-8 and wherein the second predetermined cutoff value is 1 on a scale of 0-8.
- the first predetermined cutoff value of 0 corresponds to 0%> on a scale of 0-100%> and wherein the second predetermined cutoff value of 1 corresponds to 7% on a scale of 0-100%).
- the present invention also provides a method for differentiating stable and progressive GEP-NEN in a subject comprising determining that the normalized expression level of the at least 22 biomarkers from the test sample from the subject is equal to a predetermined cutoff value of 8, according to the methods of the present invention; detecting an expression level of ZZZ3 from the test sample and a reference sample by contacting the test sample and the reference sample with at least one agent specific to detect the expression of ZZZ3; normalizing the expression level of ZZZ3 in the test sample to the expression level of ZZZ3 in the reference sample; comparing the normalized expression level of ZZZ3 in the test sample with a
- predetermined cutoff value determining the presence of progressive GEP-NEN in the subject when the normalized expression level of ZZZ3 is equal to or less than the predetermined cutoff value, wherein the predetermined cutoff value is 1 on a scale of 0-8.
- the predetermined cutoff value of 1 corresponds to 18% on a scale of 0-100%.
- the methods of the present invention further include determining the expression level of each of 16 biomarkers from a test sample from the subject and a reference sample by contacting the test sample and the reference sample with a plurality of agents specific to detect the expression of each of the 16 biomarkers, wherein the 16 biomarkers comprise Ki67, NAPILI, NOL3, TECPR2, ARAF1, BRAF, KRAS, RAF1, PQBP1, TPH1, COMMD9, MORF4L2, RNF41, RSF1, SMARCD3, and ZFHX3; summing the expression level of each of the 16 biomarkers of the test sample to generate a progressive diagnostic I total test value and summing the expression level of each of the 16 biomarkers of the reference sample to generate a
- progressive diagnostic I total reference value wherein an increased value of the progressive diagnostic I total test value compared to the progressive diagnostic I total reference value indicates the presence of progressive GEP-NEN in the subject.
- the methods of the present invention further include determining the expression level of each of 15 biomarkers from a test sample from the subject and a reference sample by contacting the test sample and the reference sample with a plurality of agents specific to detect the amount of each of the 15 biomarkers, wherein the 15 biomarkers comprise ARAFl, BRAF, KRAS, RAF1, Ki67, NAPILI, NOL3, GLT8D1, PLD3, PNMA2, VMAT2, TPH1, FZD7, MORF4L2 and ZFHX3; averaging the expression level of each of the 15 biomarkers of the test sample to generate a progressive diagnostic II test value and averaging the expression level of each of the 15 biomarkers of the reference sample to generate a progressive diagnostic II reference value, wherein an increased value of the progressive diagnostic II test value compared to the progressive diagnostic II reference value indicates the presence of progressive GEP-NEN in the subject.
- the methods of the present invention further include determining the expression level of each of 7 biomarkers from a test sample from the subject and a reference sample by contacting the test sample and the reference sample with a plurality of agents specific to detect the amount of each of the 7 biomarkers, wherein the 7 biomarkers comprise PNMA2, VMAT2, COMMD9, SSTRl, SSTR3, SSTR4, and SSTR5; summing the expression level of each of the 7 biomarkers of the test sample to generate a progressive diagnostic III total test value and summing the expression level of each of the 7 biomarkers of the reference sample to generate a progressive diagnostic III total reference value, wherein an increased value of the progressive diagnostic III total test value compared to the progressive diagnostic III total reference value indicates the presence of progressive GEP-NEN in the subject.
- the methods of the present invention further include determining the expression level of each of 11 biomarkers from a test sample from the subject and a reference sample by contacting the test sample and the reference sample with a plurality of agents specific to detect the amount of each of the 11 biomarkers, wherein the 11 biomarkers comprise Ki67, NAP1L1, NOL3, TECPR2, PQBP1, TPH1, MORF4L2, RNF41, RSFl, SMARCD3, and ZFHX3;
- the present invention also provides a method for determining the risk of relapsing or reoccurring progressive GEP-NEN in a post- surgery subject, including determining the expression level of at least 22 biomarkers from a test sample from the subject by contacting the test sample with a plurality of agents specific to detect the expression of the at least 22 biomarkers, wherein the 22 biomarkers are selected from the group consisting of APLP2, ARAF, ATP6V1H, BNIP3L, BRAF, CD59, COMMD9, CTGF, FZD7, GLT8D1, KRAS, MKI67/KI67, MORF4L2, NAP1L1, NOL3, OAZ2, PANK2, PHF21A, PLD3, PNMA2, PQBP1, RAF1, RNF41, RSFl, SLC18A1/VMAT1, SLC 18 A2/VMAT2, SMARCD3, SPATA7, SSTRl, SSTR3, SSTR4, SSTR5, TECPR2, TPH1, TRMT112,
- the present invention also provides a method for determining the risk of relapsing or reoccurring progressive GEP-NEN in a subject treated with somatostatin, including
- the present invention also provides a method for determining a response of a peptide receptor radionucleotide therapy (PRRT) of a GEP-NEN in a subject in need thereof, including determining the expression level of each of 8 biomarkers from a test sample from the subject and a reference sample by contacting the test sample and the reference sample with a plurality of agents specific to detect the expression of each of the 8 biomarkers, wherein the 8 biomarkers comprise ARAF1, BRAF, KRAS, RAF1, ATP6V1H, OAZ2, PANK2, PLD3;
- PRRT peptide receptor radionucleotide therapy
- the present invention also provides a method for determining a response of a peptide receptor radionucleotide therapy (PRRT) of a GEP-NEN in a subject in need thereof, including (a) following a first cycle of PRRT therapy: determining the expression level of at least 22 biomarkers from a first cycle test sample from the subject by contacting the first cycle test sample with a plurality of agents specific to detect the expression of the at least 22 biomarkers, wherein the 22 biomarkers are selected from the group consisting of APLP2, ARAF, ATP6V1H, BNIP3L, BRAF, CD59, COMMD9, CTGF, FZD7, GLT8D1, KRAS, MKI67/KI67, MORF4L2, NAP1L1, NOL3, OAZ2, PANK2, PHF21A, PLD3, PNMA2, PQBP1, RAF1, RNF41, RSF1, SLC18A1/VMAT1, SLC18A2/VMAT2, SMARCD3, SPATA
- the present invention also provides a method for determining a progression of a GEP-NEN in a subject in need thereof, including determining the expression level of ZFHX3 from a test sample from the subject by contacting the test sample with an agent specific to detect the expression of ZFHX3; determining the expression level of ZFHX3 from a reference sample by contacting the reference sample with an agent specific to detect the expression of ZFHX3; normalizing the expression level of ZFHX3 in the test sample to the expression level of ZFHX3 in the reference sample; comparing the normalized expression level of ZFHX3 in the test sample with a predetermined cutoff value; determining the progression of a GEP-NEN in the subject when the normalized expression level is equal to or greater than the predetermined cutoff value, wherein the predetermined cutoff value is 0.5 on a scale of 0-8.
- the present invention also provides a method for predicting tumor proliferation of a GEP-NEN in a subject in need thereof, including (a) determining the expression level of at least 22 biomarkers from a test sample from the subject by contacting the test sample with a plurality of agents specific to detect the expression of the at least 22 biomarkers, wherein the 22 biomarkers are selected from the group consisting of APLP2, ARAF, ATP6V1H, BNIP3L, BRAF, CD59, COMMD9, CTGF, FZD7, GLT8D1, KRAS, MKI67/KI67, MORF4L2, NAPILI, NOL3, OAZ2, PANK2, PHF21A, PLD3, PNMA2, PQBP1, RAF1, RNF41, RSF1,
- (b) further includes determining the expression level of each of 3 biomarkers from a test sample from the subject and a reference sample by contacting the test sample and the reference sample with a plurality of agents specific to detect the expression of each of the 3 biomarkers, wherein the 3 biomarkers comprise SSTR1, SSTR2 and SSTR5;
- GEP-NEN biomarker and "NET biomarker” refer synonymously to a biological molecule, such as a gene product, the expression or presence of which (e.g., the expression level or expression profile) on its own or as compared to one or more other biomarkers (e.g., relative expression) differs (i.e., is increased or decreased) depending on the presence, absence, type, class, severity, metastasis, location, stage, prognosis, associated symptom, outcome, risk, likelihood or treatment responsiveness, or prognosis of GEP-NEN disease, or is associated positively or negatively with such factors of the prediction thereof.
- biomarkers e.g., relative expression
- nucleic acid molecule means a polymeric form of nucleotides of at least 10 bases or base pairs in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to include single and double stranded forms of DNA.
- a nucleic acid molecule or nucleic acid sequence that serves as a probe in a microarray analysis preferably comprises a chain of nucleotides, more preferably DNA and/or RNA.
- nucleic acid molecule or nucleic acid sequence comprises other kinds of nucleic acid structures such a for instance a DNA/RNA helix, peptide nucleic acid (PNA), locked nucleic acid (LNA) and/or a ribozyme.
- PNA peptide nucleic acid
- LNA locked nucleic acid
- nucleic acid molecule also encompasses a chain comprising non-natural nucleotides, modified nucleotides and/or non-nucleotide building blocks which exhibit the same function as natural nucleotides.
- hybridize As used herein, the terms “hybridize,” “hybridizing”, “hybridizes,” and the like, used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6XSSC/0.1% SDS/100 ⁇ g/ml ssDNA, in which temperatures for hybridization are above 37 degrees and temperatures for washing in 0.1 XSSC/0.1% SDS are above 55 degrees C, and most preferably to stringent hybridization conditions.
- blood biopsy refers to a diagnostic study of the blood to determine whether a patient presenting with symptoms has a condition that may be classified as either benign (low activity) or malignant (high activity/metastatic).
- classifying refers to the act of compiling and analyzing expression data for using statistical techniques to provide a classification to aid in diagnosis of a stage or type of GEP-NEN.
- classifier refers to an algorithm that discriminates between disease states with a predetermined level of statistical significance.
- a two-class classifier is an algorithm that uses data points from measurements from a sample and classifies the data into one of two groups.
- a multi-class classifier is an algorithm that uses data points from measurements from a sample and classifies the data into one of multiple groups. The "classifier” maximizes the probability of distinguishing a randomly selected cancer sample from a randomly selected benign sample, i.e., the area under a curve (AUC) of receiver operating characteristic (ROC) curve.
- AUC area under a curve
- ROC receiver operating characteristic
- normalization refers to the expression of a differential value in terms of a standard value to adjust for effects which arise from technical variation due to sample handling, sample preparation and mass spectrometry measurement rather than biological variation of protein concentration in a sample.
- the absolute value for the expression of the protein can be expressed in terms of an absolute value for the expression of a standard protein that is substantially constant in expression.
- condition refers generally to a disease, event, or change in health status.
- diagnosis also encompass the terms “prognosis” and “prognostics”, respectively, as well as the applications of such procedures over two or more time points to monitor the diagnosis and/or prognosis over time, and statistical modeling based thereupon.
- diagnosis includes: a. prediction (determining if a patient will likely develop aggressive disease (hyperproliferative/invasive)), b. prognosis (predicting whether a patient will likely have a better or worse outcome at a pre-selected time in the future), c.
- providing refers to directly or indirectly obtaining the biological sample from a subject.
- providing may refer to the act of directly obtaining the biological sample from a subject (e.g., by a blood draw, tissue biopsy, lavage and the like).
- providing may refer to the act of indirectly obtaining the biological sample.
- providing may refer to the act of a laboratory receiving the sample from the party that directly obtained the sample, or to the act of obtaining the sample from an archive.
- TP true positives
- TN true negatives
- FP false negatives
- FN false negatives
- biological sample refers to any sample of biological origin potentially containing one or more biomarker proteins.
- biological samples include tissue, organs, or bodily fluids such as whole blood, plasma, serum, tissue, lavage or any other specimen used for detection of disease.
- subject refers to a mammal, preferably a human.
- Treating” or “treatment” as used herein with regard to a condition may refer to preventing the condition, slowing the onset or rate of development of the condition, reducing the risk of developing the condition, preventing or delaying the development of symptoms associated with the condition, reducing or ending symptoms associated with the condition, generating a complete or partial regression of the condition, or some combination thereof.
- Biomarker levels may change due to treatment of the disease.
- the changes in biomarker levels may be measured by the present invention. Changes in biomarker levels may be used to monitor the progression of disease or therapy.
- a change may be an increase or decrease by 1%, 5%, 10%, 20%,30%, 40%, 50%>, 60%, 70%, 80%, 90%, 95%, 99%, 100%, or more, or any value in between 0% and 100%.
- the change may be 1-fold, 1.5- fold 2-fold, 3-fold, 4-fold, 5-fold or more, or any values in between 1-fold and five-fold.
- the change may be statistically significant with a p value of 0.1, 0.05, 0.001, or 0.0001.
- disease prevalence refers to the number of all new and old cases of a disease or occurrences of an event during a particular period. Prevalence is expressed as a ratio in which the number of events is the numerator and the population at risk is the denominator.
- disease incidence refers to a measure of the risk of developing some new condition within a specified period of time; the number of new cases during some time period, it is better expressed as a proportion or a rate with a denominator.
- stable disease refers to a diagnosis for the presence of GEP-NEN, however GEP-NEN has been treated and remains in a stable condition, i.e. one that that is not progressive, as determined by imaging data and/or best clinical judgment.
- progressive disease refers to a diagnosis for the presence of a highly active state of GEP-NEN, i.e. one has not been treated and is not stable or has been treated and has not responded to therapy, or has been treated and active disease remains, as determined by imaging data and/or best clinical judgment.
- expression level score or "NETest score” refers to the output of a mathematically-derived classifier algorithm generated from the combination of classification algorithms, i.e. SVM, LDA, KNN, and Bayes. This score ranges between 0 and 100%.
- the expression level score from a test sample once compared to the expression level score for a reference or control sample, may be used to diagnose the presence of GEP-NEN, the different stages of GEP-NEN, predict the risk of contracting a stage of GEP-NEN, or determines the risk of recurrence of GEP-NEN in post-therapy human patients. Distinctions between GEP-NEN disease states are based on pre-determined expression level score thresholds and/or ranges as further defined in the present application.
- GEP-NEN has been difficult, in part due to the prosaic symptoms and syndromes of the disease, such as carcinoid syndrome, diarrhea, flushing, sweating, bronchoconstriction, gastrointestinal bleeding, cardiac disease, intermittent abdominal pain, which often remain silent for years.
- Available diagnostic methods include anatomical localization, such as by imaging, e.g., X-ray, gastrointestinal endoscopy, abdominal computed tomography (CT), combined stereotactic radiosurgery (S S)/CT, and RJ, and detection of some gene products e.g., chromogranin A.
- CT computed tomography
- S S combined stereotactic radiosurgery
- RJ radiosurgery
- chromogranin A chromogranin A
- the present application relates to the detection and identification of GEP-NEN biomarkers and panels of such biomarkers, for example, in biological samples.
- compositions ⁇ e.g., agents, such as polynucleotides), for detecting, determining expression levels of, and recognizing or binding to the biomarkers, in biological samples, typically blood samples.
- models and biomathematical algorithms e.g., supervised learning algorithms, and methods using the same, for prediction, classification, and evaluation of GEP-NEN and associated outcomes, for example, predicting degree of risk, responsiveness to treatment, metastasis or aggressiveness, and for determining GEP-NEN subtype.
- Detection of the biomarkers using the provided embodiments is useful for improving GEP-NEN diagnostics and prognostics, and to inform treatment protocols.
- detection of the biomarkers and/or expression levels by the provided embodiments confirms or indicates the presence, absence, stage, class, location, sub-type, aggressiveness, malignancy, metastasis, prognosis, or other outcome of GEP-NEN, or a GEP-NEN ceil, such as a circulating GEP-NEN cell (CNC).
- CNC circulating GEP-NEN cell
- the provided methods and compositions may be used for tumor localization, and for predicting or detecting metastases, micrometastases, and small lesions, and/or for determining degree of risk, likelihood of recurrence, treatment responsiveness or remission, and informing appropriate courses of treatment.
- detecting the biomarkers e.g., in circulation may be used to detect early-stage and primary GEP-NENs (e.g., to identify GEP-NEN disease or metastases in a patient previously deemed "negative" by another approach, such as anatomic localization).
- the provided methods and compositions may be used for designing, implementing, and monitoring treatment strategies, including patient-specific treatment strategies.
- detected expression levels of the GEP-NEN biornarkers serve as surrogate markers for treatment efficacy, e.g., to monitor the effects of surgical therapy, e.g., removal of tumors, targeted medical therapy, e.g., inhibition of tumor secretion/ proliferation, and other therapeutic approaches, by detecting remi ssion or recurrence of tumors, even in the form of small micrometastases.
- the methods also may be used in evaluating clinical symptoms and outcomes, and for histological grading and molecular characterization of GEP-NENs.
- the provided biornarkers including GEP-NEN biornarkers, and subsets and panels of the same.
- GEP-NEN biornarkers are gene products, such as DNA, RNA, e.g., transcripts, and protem, which are differentially expressed in GEP-NEN disease, and/or in different stages or sub-types of GEP-NEN, or in different GEP-NEN tumors, such as gene products differentially expressed in metastatic versus non-metastatic tumors, tumors with different degrees of aggressiveness, high versus low-risk tumors, responsive versus non- responsive tumors, tumors exhibiting different pathological classifications and/or likelihood of response to particular courses of treatment, as well as those associated wi th features of GEP- NEN disease, stage, or type, or with neuroendocrine cells or related cell-types.
- the biornarkers include gene products whose expression is associated with or implicated in tumorogenieity, metastasis, or hormone production, or a phenotype of primary or metastatic GEP-NEN, such as adhesion, migration, proliferation, apoptosis, metastasis, and hormone secretion, and those associated with neoplasia or malignancy in general .
- GEP-NEN cell secretion products including hormones and amines, e.g., gastrin, ghrelin, pancreatic polypeptide, substance P, histamine, and serotonin, and growth factors such as tumor growth factor-beta (TGF- ⁇ ) and connective tissue growth factor (CTGF), which are detectable in the circulation.
- TGF- ⁇ tumor growth factor-beta
- CGF connective tissue growth factor
- the biornarkers are gene products associated with regulatory genotypes (i.e., adhesion, migration, proliferation, apoptosis, metastasis, and/or hormone secretion) that underlay various GEP-NEN subtypes, stages, degrees of aggressiveness, or treatment responsiveness .
- regulatory genotypes i.e., adhesion, migration, proliferation, apoptosis, metastasis, and/or hormone secretion
- CTGF NM_001901.2 AAACTCACACAACAACTCTTCCCCGCTGAGAGGAGACAGC 11
- FAM131A NM_001171093.1 ACCGGCCCGGTTCCCTCTCCGGGGAGCGGCGGCGGACGCG 13
- HDAC9 NM_001204144.1 GCAGCGCGCACCGAGCCGGCCGCGCCGCGCCCGCCGCTCT 17
- HSF2 NM_004506.3 ACTTGTCCGTCACGTGCGGCCGCCCGGCCTCTCGGCCTTG 18
- AAAC C CCGCGCGCCTGGCGGGGTTGGGGGGGCGGGGACCAAGATC TGCTGCGCCTGCGTTGTGGGCGTTCTCGGGGAGCTGCTGC CGTAGCTGCCGCCGCCGCTACCACCGCGTTCGGGTGTAGA ATTTGGAATCCCTGCGCCGCGTTAACAATGAAGCAGAGTT CGAACGTGCCGGCTTTCCTCAGCAAGCTGTGGACGCTTGT GG AGG AAAC C C AC AC T AAC GAG TTCATCACC T GG AGC C AG AATGGCCAAAGTTTTCTGGTCTTGGATGAGCAACGATTTG CAAAAGAAATTCTTCCCAAATATTTCAAGCACAATAATAT GGCAAGCTTTGTGAGGCAACTGAATATGTATGGTTTCCGT AAAG TAGTACATATC G AC T C T GG AAT T G T AAAGC AAG AAA G AG AT GG T C C T G T AG AAT T T C AGC AT C C T T AC T T C AAAC A AGGACAGGATGACT
- AAAAGC AAG AT GAT GAT AAAGC A AAT AAAAAGC AT AAG AAG TATGTGATCAGCGAT G AAG AGG AAG AAG AT GAT GAT T G AAG TAT GAAAT AT G AAAAC AT T T T AT AT T T TAT T G T AC AG T TAT AAAT AT G T AAAC AT GAG TATTTTGATTGAAATGAATCGATTTGCTTTTGTGTAATTT T AAT T G T AAT AAAAC AAT T T T AAAAGC AAAAAAAAAAAAAA AA
- OAZ2 NM_002537.3 ATGCAGATGAGGCACTCGGGGGCGGGGCGGCGGCGGCGGC 26
- TPH1 NM_004179.2 T T T T AG AG AAT T AC T C C AAAT T C AT C AT G AT T G AAG AC AA 44
- TRMT112 NM_016404.2 GGCCACCCGCAGAACAGAGCTTCCGGGACCCACGCCTCGT 45
- VPS 13C NM_001018088.2 CCGGAGGGGCTGTCATTTGCAGCGCTGGTCGCAGCCCTCA 48
- the 51 GEP-NEN biomarkers include: AKAP8L (A kinase (PRKA) anchor protein 8- like), APLP2 (amyloid beta (A4) precursor- like protein 2), ARAF1 (v-raf murine sarcoma 361 1 viral oncogene homolog), ATP6V1H (ATPase, H+ transporting, lysosomal 50/57kDa, VI sub unit H), BNIP3L (BCL2/adenovirus E1B 19kDa interacting protein 3-like), BRAF (v-raf murine sarcoma viral oncogene homolog Bl), C2 0RF7 (chromosome 21 open reading frame 7), CD59 (CD59 molecule, complement regulatory protein), COMMD9 (COMM domain containing 9), CTGF (connective tissue growth factor), ENPP4 (ectonucleotide pyrophosphatase/phosphodiesterase 4), FAM131A (family with sequence similarity
- MORF4L2 memory factor 4 like 2, transcript variant 1
- NAP 1 LI nucleosome assembly protein 1-like 1
- NOL3 nucleolar protein 3 (apoptosis repressor with CARD domain), transcript variant 3
- NUDT3 nucleoside diphosphate linked moiety X)-type motif 3
- OAZ2 ornithine decarboxylase antizyme 2
- PANK2 pantothenate kinase 2
- PHF21A PFD finger protein 21 A, transcript variant 1)
- PKDl polycystic kidney disease 1 (autosomal dominant), transcript variant 2)
- PLD3 phospho lipase D family, member 3, transcript variant 1)
- PNMA2 paraneoplastic antigen MA2
- PQBP1 poiygiutamine binding protein 1, transcript variant 2)
- RAF1 v-raf-1 murine leukemia viral oncogene homo log 1
- RNF41 ring finger protein 41
- VMAT1 (solute carrier family 18 (vesicular monoamine), member 1)
- VMAT 2 (solute carrier family 18 (vesicular monoamine), member 2)
- VPS13C vacuum protein sorting 13 homolog C (S, cerevisiae), transcript variant 2B
- WDFY3 WD repeat and FYVE domain containing 3
- ZFHX3 (zinc finger homeobox 3, transcript variant B), ZXDC (zinc finger C, transcript variant 2), and ZZZ3 (zinc finger, ZZ-type containing 3)
- gene products typically human gene products including transcripts, mRNA, cDNA, coding sequences, proteins and polypeptides, as well as polynucleotides (nucleic acids) encoding the proteins and polypeptides, including naturally occurring variants, e.g., allelic variants, splice variants, transcript variants, and single nucleotide polymorphism (SNP) variants.
- the biomarkers include polynucleotides (
- the housekeeping gene used to normalize expression of the 51 marker genes is the human ALG9 (asparagine-linked glycosylation 9, alpha- 1 ,2-mannosyltransferase homolog).
- biomarker genes are useful for the generation of mathematically-derived expression level scores for diagnosing, monitoring, and/or prognosticating the presence of GEP-NEN and/or different states of GEP- NENs.
- These 38 GEP-NEN biomarkers include: PNMA2, NAP1L1, FZD7, SLC 18A2/VMAT2, NOL3, SSTR5, TPHl , RAF1, RSF1, SSTR3, SSTR1, CD59, ARAF, APLP2, KRAS, MORF4L2, TRMT112, MKI67/KI67, SSTR4, CTGF, SPATA7, ZFHX3, PHF21A,
- SI.C 18 A 1 / VM AT 1 , ZZZ3, TECPR2, ATP6V1H, OAZ2, PANK2, PLD3, PQBPl, RNF41,
- biomarker genes useful for the generation of a mathematically-derived expression level score for diagnosing, monitoring, and/or prognosticating the presence of GEP- NENs at least 22 biomarker genes may be needed to generate an adequate classifier.
- biomarker genes include PNMA2, NAPILI, FZD7, SLC18A2, NQL3, SSTR5, TPH1, RAF1 , RSF1, SSTR3, SSTR1, CD59, ARAF, APLP2, ICR AS, MORF4L2, TRMT112, MKI67, SSTR4, CTGF, SPATA7, and ZFHX3.
- the ALG9 biomarkers/housekeeping genes include human ALG9 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the ALG9 biomarker/housekeeping gene is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: I (referenced at NM 024740.2), or contaimng a protein- coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the AKAP8L biomarkers include human AKAP8L gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the A AP8L biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 2 (referenced at NM_014371.3), or contaimng a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the APLP2 biomarkers include human APLP2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the APLP2 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 3
- the ARAF I biomarkers include human ARAF1 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof, in one example, the ARAF1 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 4 (referenced at NM_001654.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the ATP6V 1 H biomarkers include human ATP6V 1 H gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof, in one example, the ATP6V1H biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 5 (referenced at NM_015941.3), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the BNIP3L biomarkers include human BNIP3L gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof, in one example, the BN l P3L biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 6
- the BRAF biomarkers include BRAF gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the BRAF biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 7 (referenced at NM_004333.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the C210RF7 biomarkers include C210RF7 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the C210RF7 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 8
- the CD59 biomarkers include CDS gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the CD59 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 9 (referenced at NM_203331.2), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the COMMD9 biomarkers include COMMD9 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the COMMD9 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 10
- the CTGF biomarkers include CTGF gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the CTGF biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 11 (referenced at NM_001901.2), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the ENPP4 biomarkers include ENPP4 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the ENPP4 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 12 (referenced at NM_014936.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the F AM 131 A biomarkers include F AM 131 A gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the FAM131A biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 13 (referenced at NM 001171093.1), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the FLJ1035 biomarkers include FLJ1035 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the FLJ 1035 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 14 (referenced at NM_018071.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the FZD7 biomarkers include FZD7 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the FZD7 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 15 (referenced at NM_003507.1), or containing a protein-coding portion thereof!, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the GLT8D1 biomarkers include GLT8D1 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the GLT8D1 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 16 (referenced at NM_001010983.2), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the HDAC9 biomarkers include HDAC9 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the HDAC9 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 17 (referenced at NM_001204144.1), or containing a protein-coding portion thereof, a natural variant thereof!, or a protein encoded by such a polynucleotide.
- the H8F2 biomarkers include HSF2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the HSF2 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 18 (referenced at NM_004506.3), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the Ki-67 biomarkers include Ki-67 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the Ki-67 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 19 (referenced at NM 001145966.1), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the KRAS biomarkers include KRAS gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the KRAS biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 20 (referenced at NM_004985.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the LEO I biomarkers include LEOl gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the LEOl biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 21 (referenced at NM_138792.3), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the MORF4L2 biomarkers include MORF4L2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the MORF4L2 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 22 (referenced at NM_001142418.1), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the NAPILI biomarkers include NAP 1 LI gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the NAPILI biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 23 (referenced at NM_139207.2), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the NOL3 biomarkers include NOL3 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the NOL3 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 24 (referenced at NM_001185057.2), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the NUDT3 biomarkers include NUDT3 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the NUDT3 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 25
- the OAZ2 biomarkers include OAZ2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the OAZ2 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 26 (referenced at NM_002537.3), or containing a protein-coding portion thereof!, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the PANK2 biomarkers include PANK2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the PA 2 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 27 (referenced at NM_024960.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the PHF21 A biomarkers include PHF21 A gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the PHF21A biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 28 (referenced at NM 001101802.1), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the P D1 biomarkers include PKD1 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the PKD1 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 29 (referenced at NM_000296.3), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the PLD3 biomarkers include PLD3 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the PLD3 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 30 (referenced at NM 001031696.3), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the PNMA2 biomarkers include PNMA2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the PNMA2 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 31 (referenced at NM_007257.5), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the PQB 1 biomarkers include PQBP 1 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the PQBP1 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 32 (referenced at NM_001032381.1), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the RAF I biomarkers include RAF1 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the RA F1 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 33 (referenced at NM_002880.3), or containing a protein-coding portion thereof!, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the RNF4I biomarkers include RNF41 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the RNF41 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 34 (referenced at NM_001242826.1), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the RSF1 biomarkers include R.SF1 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the RSF1 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 35 (referenced at NM_016578.3), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the RTN2 biomarkers include RTN2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the RTN2 bioniarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 36 (referenced at NM_005619.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the SMARCD3 biomarkers include SMARCD3 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- SMARCD3 gene products including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- SMARCD3 bioniarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 37 (referenced at NM_001003801.1), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleot de.
- the SPATA7 biomarkers include SPATA7 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the SPATA7 bioniarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 38 (referenced at NM_001040428.3), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the SSTRl biomarkers include SSTRI gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the SSTRl bioniarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 39 (referenced at NM_001049.2), or containing a protein-coding portion thereof!, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the SSTR3 biomarkers include SSTR3 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the SSTR3 bioniarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 40 (referenced at NM_001051.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the SST4 biomarkers include SST4 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the SST4 bioniarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 41 (referenced at ⁇ _001052.2), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the SST5 biomarkers include SST5 gene products, including natural variants, e.g., allelic variants, and homo logs and analogs thereof.
- the SST5 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 42 (referenced at
- NM 001053.3 or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the TECPR2 biomarkers include TECPR2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the TECPR2 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 43
- the TPH1 biomarkers include TPHl gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the TPHl biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 44 (referenced at NM_004179.2), or containing a protein-coding portion thereof!, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the TRMTI 12 biomarkers include TRMT112 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the TRMTI 12 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 45
- the VMAT1 biomarkers include VMAT1 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the VMAT1 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 46
- the VMA.T2 biomarkers include VMAT2 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the VMAT2 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 47 (referenced at NM_003054.4), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the VPS13C biomarkers include VPS13C gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the VPS13C biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 48 (referenced at NM_001018088.2), or containing a protein-coding portion thereof, a natural variant thereof!, or a protein encoded by such a polynucleotide.
- the WDFY3 biomarkers include WDFY3 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the WDFY3 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 49
- the ZFHX3 biomarkers include ZFHX3 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the ZFHX3 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 50 (referenced at NM_001164766.1), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the ZXDC biomarkers include ZXDC gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the ZXDC biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 51 (referenced at NM 001040653.3), or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the ZZZ3 biomarkers include ZZZ3 gene products, including natural variants, e.g., allelic variants, and homologs and analogs thereof.
- the ZZZ3 biomarker is a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 52 (referenced at
- NM_015534.4 or containing a protein-coding portion thereof, a natural variant thereof, or a protein encoded by such a polynucleotide.
- the panel of polynucleotides further includes one or more polynucleotide able to specifically hybridize to "housekeeping," or reference genes, for example, genes for which differences in expression is known or not expected to correlate with differences in the variables analyzed, for example, with the presence or absence of GEP-NEN or other neoplastic disease, differentiation of various GEP-NEN sub-types, metastasis, mucosal or other tissue types, prognostic indications, and/or other phenotype, prediction, or outcome.
- expression levels of such housekeeping genes are detected and used as an overall expression level standards, such as to normalize expression data obtained for GEP-NEN biomarkers across various samples.
- Housekeeping genes are well known in the art. Typically, the housekeeping genes include one or more genes characterized as particularly appropriate for analyzing GEP-NEN samples, such as ALG9,. See idd M, et a!., "GeneChip, geNorm and Gastrointestinal tumors: novel reference genes for real-time PCR.” Physiol Genomics 2007;30:363-70. In the current application, ALG9 is the housekeeping gene of choice.
- the present invention provides methods, compositions, and systems, for the detection of the GEP- NEN biomarkers and for identifying, isolating, and enriching tumors and ceils that express the GEP-NEN biomarkers.
- agents, sets of agents, and systems for detecting the GEP-NEN biomarkers and methods for use of the same including for diagnostic and prognostic uses.
- the agents are proteins, polynucleotides or other molecules which specifically bind to or specifically hybridize to the GEP-NEN biomarkers.
- the agents include polynucleotides, such as probes and primers, e.g. sense and antisense PCR primers, having identity or complementarity to the polynucleotide biomarkers, such as mRNA, or proteins, such as antibodies, which specifically bind to such biomarkers.
- the systems e.g., microarrays, sets of polynucleotides, and kits, provided herein include those with nucleic acid molecules, typically DNA oligonucleotides, such as primers and probes, the length of which typically varies between 15 bases and several kilo bases, such as between 20 bases and 1 kilobase, between 40 and 100 bases, and between 50 and 80 nucleotides or between 20 and 80 nucleotides.
- most (i.e. at least 60% of) nucleic acid molecules of a nucleotide microarray, kit, or other system are capable of hybridizing to GEP-NEN biomarkers.
- systems containing polynucleotides that specifically hybridize to the biomarkers are provided to detect and measure changes in expression levels and determine expression profiles of the biomarkers according to the provided methods.
- microarrays are those comprising polynucleotides able to hybridize to at least as at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 80, 85, 90, 95, or 100 or more biomarkers, such as to at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or 51, and/or all of the following sets of biomarkers:
- At least 60%, or at least 70%, at least 80%, or more, of the nucleic acid molecules of the system, e.g., microarray, are able to hybridize to biomarkers in the panel of biomarkers.
- probes immobilized on such nucleotide microarrays comprise at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 80, 85, 90, 95, or 100 or more biomarkers, such as to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or 51, or more nucleic acid molecules able to hybridize to at least 2, 3, 4, 5, 6, 7, 8,
- the remaining nucleic acid molecules, such as 40% or at most 40%) of the nucleic acid molecules on the microarray or in the set of polynucleotides are able to hybridize to a set of reference genes or a set of normalization genes (such as housekeeping genes), for example, for normalization in order to reduce systemic bias.
- Systemic bias results in variation by inter-array differences in overall performance, which can be due to for example inconsistencies in array fabrication, staining and scanning, and variation between labeled NA samples, which can be due for example to variations in purity.
- Systemic bias can be introduced during the handling of the sample in a microarray experiment.
- the determined RNA levels are preferably corrected for background non-specific hybridization and normalized.
- a set of polynucleotides or system e.g., microarray
- at least 90% of the nucleic acid sequences are abl e to hybridize to the GEP-NEN biomarkers
- further embodiments include such systems and sets in which at least 95% or even 100% of the polynucleotides hybridize to the biomarkers.
- exemplary suitable polynucleotides such as PGR primers.
- Other nucleic acid probes and primers able to hybridize to different regions of the biomarkers are of course also suitable for use in connection with the provided systems, kits and methods.
- the present invention provides methods for detecting and quantifying the biomarkers, including detecting the presence, absence, amount or relative amount, such as expression levels or expression profile of the biomarkers.
- the methods are nucleic acid based methods, for example, measuring the presence, amount or expression levels of biomarker mRNA expression.
- Such methods typically are carried out by contacting polynucleotide agents to biological samples, such as test samples and normal and reference samples, for example, to quantify expression levels of nucleic acid biomarkers (e.g., mRNA) in the samples.
- Biomarkers are RNA biomarkers
- RNA detection and quantification methods are used.
- Exemplary methods for quantifying or detecting nucleic acid expression levels are well known, and include northern blotting and in situ hybridization (Parker and Barnes, Methods in Molecular Biology 106:247-283, 1999); RNAse protection assays (Hod, Biotechniques 13:852-854, 1992); and quantitative or semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., Trends in Genetics 8:263-264, 1992), representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).
- SAGE Serial Analysis of Gene Expression
- MPSS massively parallel signature sequencing
- expression of the biomarker or biomarker panel includes RNA expression; the methods include determining levels of RNA of the biomarkers, such as RN A obtained from and/or present in a sample of a patient, and performing analysis, diagnosis, or predictive determinations based upon the RN A expression levels determined for the biomarkers or panel of biomarkers.
- RNA samples can be processed in numerous ways, as is known to those in the art.
- Several methods are well known for isolation of RNA from samples, including guanidinium thiocyanate -phenol-chloroform extraction, which may be carried out using the TRIZOL® reagent, a proprietary formulation (see Chomczynski P, Sacchi N (2006). "The single-step method of RNA isolation by acid guanidinium miocyanate-phenol-chloroform extraction:
- TRIZOL® is used to extract RN A and DNA; chloroform and centrifugation are used to separate RNA from other nucleic acids, followed by a series of washes with ethanol for cleanup of the RNA sample.
- RNA samples can be freshly prepared from samples e.g., cells or tissues at the moment of harvesting; alternatively, they can be prepared from samples that stored at -70°C until processed for sample preparation.
- tissues or cell samples can be stored under and/or subjected to other condi tions known in the art to preserve the quali ty of the RN A, including fixation for example with formalin or similar agent; and incubation with RNase inhibitors such as RNAsin® (Pharmingen) or RNasecure® (Ambion); aqueous solutions such as RNAlater® (Assuragen), Hepes-Ghitamic acid buffer mediated Organic solvent Protection Effect (HOPE), and R.CL2 (Alphelys); and non-aqueous solutions such as Universal Molecular Fixative (Sakura Finefek USA Inc.).
- a chaotropic nucleic acid isolation lysis buffer (Boom method. Boom et al. J Clin Microbiol. 1990; 28:495
- RNA is isolated from buffy coat by incubating samples with TRIZOL®, followed by RNA clean-up. RNA is dissolved in diethyl pyrocarbonate water and measured spectrophotometrically, and an aliquot analyzed on a Bioanalyzer (Agilent
- RNA is isolated from plasma using the QIAamp RNA Blood Mini Kit; in some cases, this method allows better detection by real-time PGR of significantly more housekeeping genes from plasma compared to the TRiZOL® approach.
- RNA is isolated directly from whole blood, for example, using the QIAamp RNA Blood Mini Kit in a similar manner.
- RNA isolation, purification, primer extension and amplification for example: T. E. Godfrey et al, Molec. Diagnostics 2: 84-91 [2000]; K. Specht et al., Am. J. Pathol. 158: 419-29 [2001]).
- RNA is extracted from a sample such as a blood sample using the QIAamp RNA Blood Mini Kit RNA.
- RNA is extracted from tissue, followed by removal of protein and DNA and analysis of RNA concentration.
- An RNA repair and/or amplification step may be included, such as a step for reverse transcription of RNA
- RNA biomarkers may be determined or quantified by any method known in the art, for example, by quantifying RNA expression relative to housekeeping gene or with relation to RNA levels of other genes measured at the same time. Methods to detemiine RNA levels of genes are known to a skilled person and include, but are not limited to, Northern blotting, (quantitative) PCR, and microarray analysis.
- RNA biomarkers can be reverse transcribed to produce cDNA and the methods of the present invention can include detecting and quantifying that produced cDNA.
- the cDNA is detected by forming a complex with a labeled probe.
- the RN A biomarkers are directed detected by forming a complex with a labeled probe or primer.
- Northern blotting may be performed for quantification of RNA of a specific biomarker gene or gene product, by hybridizing a labeled probe that specifically interacts with the RNA, following separation of RNA by gel electrophoresis. Probes are for example labeled with radioactive isotopes or chemiluminescent substrates. Quantification of the labeled probe that has interacted with said nucleic acid expression product serves as a measure for determining the level of expression.
- the determined level of expression can be normalized for differences in the total amounts of nucleic acid expression products between two separate samples with for instance an internal or external calibrator by comparing the level of expression of a gene that is known not to differ in expression level between samples or by adding a known quantity of RNA before determining the expression levels.
- RNA is reverse transcribed into cDNA.
- Reverse transcriptase polymerase chain reaction (RT-PCR) is, for example, performed using specific primers that hybridize to an RNA sequence of interest and a reverse transcriptase enzyme.
- RT-PCR can be performed with random primers, such as for instance random hexamers or decamers which hybridize randomly along the RNA, or oligo d(T) which hybridizes to the poiy(A) tail of mRNA, and reverse transcriptase enzyme.
- random primers such as for instance random hexamers or decamers which hybridize randomly along the RNA, or oligo d(T) which hybridizes to the poiy(A) tail of mRNA, and reverse transcriptase enzyme.
- RNA expression levels of the biomarkers in a sample are determined using quantitative methods such as by real-time rt-PCR (qPCR) or microarray analysis, in some embodiments, quantitative Polymerase Chain Reaction (QPCR) is used to quantify the level of expression of nucleic acids.
- qPCR real-time rt-PCR
- QPCR quantitative Polymerase Chain Reaction
- detection and determining expression levels of the biomarkers is carried out using RT-PCR, GeneChip analysis, quantitative real-time PGR (Q RT-PCR), or carcinoid tissue microarray (TMA)
- immunostainmg/quantitation for example, to compare biomarker RNA, e.g., mRNA., or other expression product, levels in different sample populations, characterize patterns of gene expression, to discriminate between closely related mRNAs, and to analyze RNA structure.
- biomarker RNA e.g., mRNA., or other expression product
- QPCR is performed using real-time PCR (RTPCR), where the amount of product is monitored during the amplification reaction, or by end-point measurements, in which the amount of a final product is determined.
- RTPCR real-time PCR
- rtPCR is for instance performed by the use of a nucleic acid intercalator, such as for example ethidium bromide or SYBR® Green I dye, which interacts which all generated double stranded products resulting in an increase in fluorescence during amplification, or for instance by the use of labeled probes that react specifically with the generated double stranded product of the gene of interest.
- a nucleic acid intercalator such as for example ethidium bromide or SYBR® Green I dye
- Alternative detection methods that can be used are provided by amongst other things dendrimer signal amplification, hybridization signal amplification, and molecular beacons.
- reverse transcription on total RN A is carried out using the High Capacity cDNA Archive Kit (Applied Biosystems (ABI), Foster City, CA) following the manufacturer's suggested protocol (briefly, using 2 micrograms of total RNA in 50 microliters water, mixing with 50 uL of 2XRT mix containing Reverse Transcription Buffer, deoxynueleotide triphosphate solution, random primers, and Multiscribe Reverse Transcriptase). RT reaction conditions are well known.
- the RT reaction is performed using the following thermal cycler conditions: 10 mins, 25°C; 120 min,, 37°C ⁇ see Kidd M, et a!., "The role of genetic markers— NAP 1 LI, MAGE-D2, and MTA1— in defining small-intestinal carcinoid neoplasia," Ann Surg Oncol 2006;! 3(2):253-62).
- Assays-on- DemandTM products are used with the ABI 7900 Sequence Detection System according to the manufacturer's suggestions ⁇ see Kidd M, Eick G, Shapiro MD, et al. Microsatellite instability and gene mutations in transforming growth factor-beta type II receptor are absent in small bowel carcinoid tumors. Cancer 2005;103(2):229-36).
- cycling is performed under standard conditions, using the TaqMan® Universal PCR Master Mix Protocol, by mixing cDNA in 7.2 uL water, 0.8 uL 20 ⁇ Assays-on-Demand primer and probe mix and 8 uL of 2X TaqMan Universal Master mix, in a 384-well optical reaction plate, under the following conditions: 50°C, 2 min.; 95°C; 10 min.; 50 cycles at 95°C for 15 min., 60° for 1 min ⁇ see Kidd M, et al, "The role of genetic markers— NAP 1 LI, MAGE-D2, and MTA1— in defining small-intestinal carcinoid neoplasia," Ann Surg Oncol 2006;13(2);253-62).
- results from real-time PCR are normalized, using internal standards and/or by comparison to expression levels for housekeeping genes.
- Microarray analysis involves the use of selected nucleic acid molecules that are immobilized on a surface. These nucleic acid molecules, termed probes, are able to hybridize to nucleic acid expression products. In a preferred embodiment the probes are exposed to labeled sample nucleic acid, hybridized, washed and the (relative) amount of nucleic acid expression products in the sample that are com lementary to a probe is determined. Microarray analysis allows simultaneous determination of nucleic acid expression levels of a large number of genes. In a method according to the invention it is preferred that at least 5 genes according to the invention are measured simultaneously.
- Background correction can be performed for instance according to the "offset" method that avoids negative intensity values after background subtraction.
- normalization can be performed in order to make the two channels on each single array comparable for instance using global loess normalization, and scale normalization which ensures that the log-ratios are scaled to have the same median-absolute-deviation (MAD) across arrays.
- MAD median-absolute-deviation
- Protein levels may, for example, be measured using antibody-based binding assays. Enzyme labeled, radioactive ly labeled or fluorescently labeled antibodies may be used for detection of protein. Exemplary assays include enzyme-linked immunosorbent assays (ELISA), radio-immuno assays (RIA), Western Blot assays and immunohistochemical staining assays. Alternative!)', in order to determine the expression level of multiple proteins
- protein arrays such as antibody-arrays are used.
- the biomarkers and housekeeping markers are detected in a biological sample, such as a tissue or fluid sample, such as a blood, such as whole blood, plasma, serum, stool, urine, saliva, tears, serum or semen sample, or a sample prepared from such a tissue or fluid, such as a cell preparation, including of cells from blood, saliva, or tissue, such as intestinal mucosa, tumor tissue, and tissues containing and/or suspected of containing GEP-NEN metastases or shed tumor cells, such as liver, bone, and blood.
- a specific cell preparation is obtained by fluorescence-activated ceil sorting (FACS) of cell suspensions or fluid from tissue or fluid, such as mucosa, e.g., intestinal mucosa, blood or buffy coat samples.
- FACS fluorescence-activated ceil sorting
- the sample is taken from a GEP-NEN patient, a patient suspected of having GEP-NEN, a patient having and/or suspected of having cancer generally, a patient exhibiting one or more GEP-NEN symptoms or syndromes or determined to be at-risk for GEP-NEN, or a GEP-NEN patient undergoing treatment or having completed treatment, including patients whose disease is and/or is thought to be in remission.
- the sample is taken from a human without GEP-NEN disease, such as a healthy individual or an individual with a different type of cancer, such as an adenocarcinoma, for example, a gastrointestinal adenocarcinoma or one of the breast, prostate, or pancreas, or a gastric or hepatic cancer, such as esophageal, pancreatic, gallbladder, colon, or rectal cancer.
- the sample is taken from the GEP-NEN tumor or metastasis.
- the sample is taken from the GEP-NEN patient, but from a tissue or fluid not expected to contain GEP-NEN or GEP-NEN cells; such samples may be used as reference or normal samples.
- the normal or reference sample may be a tissue or fluid or other biological sample from a patient without GEP-NEN disease, such as a
- tissue, fluid or other sample such as a normal blood sample, a normal small intestinal (SI) mucosa sample, a normal enterochromaffin (EC) cell preparation.
- SI small intestinal
- EC enterochromaffin
- the sample is a whole blood sample.
- neuroendocrine tumors metastasize they typically shed cells into the blood. Accordingly, detection of the panels of G EP-NEN biomarkers provided herein in plasma and blood samples may be used for identification of GEP-NENs at an early time point and for predicting the presence of tumor metastases, e.g., even if anatomic localization studies are negative. Accordingly, the provided agents and methods are useful for early diagnosis.
- the methods can identify a GEP-NEN molecular signature or expression profile in 1 mL or about 1 mL of whole blood.
- the molecular signature or expression profile is stable for up to four hours (for example, when samples are refrigerated 4-8 °C following phlebotomy) prior to freezing.
- the approach able to diagnose, prognosticate or predict a given GEP-NEN-associated outcome using a sample obtained from tumor tissue is also able to make the same diagnosis, prognosis, or prediction using a blood sample.
- a number of existing detection and diagnostic methodologies require 7 to 10 days to produce a possible positive result, and can be costly.
- the provided methods and compositions are useful in improving simplicity and reducing costs associated with GEP- NEN diagnosis, and make early-stage diagnosis feasible.
- the biomarkers are detected in circulation, for example by detection in a blood sample, such as a serum, plasma, cells, e.g., peripheral blood mononuclear cells (PBMCs), obtained from buffy coat, or whole blood sample.
- a blood sample such as a serum, plasma, cells, e.g., peripheral blood mononuclear cells (PBMCs), obtained from buffy coat, or whole blood sample.
- PBMCs peripheral blood mononuclear cells
- Tumor- specific transcripts have been detected in whole blood in some cancers. See Sieuwerts AM, et ai., "Molecular characterization of circulating tumor cells in large quantities of contaminating leukocytes by a multiplex real-time PGR ,” Breast Cancer Res Treat 2009;] 1 8(3):455-68 and Mimori K, et al, "A large-scale study of MT! -MMP as a marker for isolated tumor cells in peripheral blood and bone marrow in gastric cancer cases," Ann Surg Oncol 2008;15(10):2934-42.
- the CeilSearchTM CTC Test (Veridex LLC) (described by Kahan L practice "Medical devices; immunology and microbiology devices; classification of the immunomagnetic circulating cancer cell selection and enumeration system. Final rule," Fed Regist 20G4;69:26036- 8) uses magnetic beads coated with EpCAM-specific antibodies that detects epithelial cells (CK- 8/18/19) and leukocytes (CD45), as described by Sieuwerts AM, Kraan J, Bolt-de Vries J, et al., "Molecular characterization of circulating tumor ceils in large quantities of contaminating leukocytes by a multiplex real-time PCR," Breast Cancer Res Treat 2009; 118(3):455 ⁇ 68.
- This method has been used to detect circulating tumor cells (CTCs), and monitoring disease progression and therapy efficacy in metastatic prostate (Danila DC, Heller G, Gignac GA, et al. Circulating tumor ceil number and prognosis in progressive castration-resistant prostate cancer. Clin Cancer Res 2007;13(23):7053-8), colorectal (Cohen Si, Alpaugh R , Gross S, et al.
- PBMCs peripheral blood mononuclear cells
- Neuroendocrine ceils are FACS-sorted to heterogeneity, using known methods, following acridine orange (AO) staining and uptake, as described Kidd M, et al., "Isolation, Purification and Functional Characterization of the Mastomys EC cell," Am J Physiol 2006;291 :G778-91 ; Modlin EVI, et al., "The functional characterization of normal and neoplastic human enterochromaffin cells,” Clin Endocrinol Metab 2006;91(6):2340-8.
- AO acridine orange
- the provided detection methods are used to detect, isolate, or enrich for the GEP-NEN ceils and/or biomarkers in two to three mL of blood or less.
- the methods are performed using standard laboratory apparatuses and thus are easily performed in the clinical laboratory setting. In one example, a readout is obtained within 12 hours, at an average cost of approximately 20-30 per sample.
- the present invention provides diagnostic, prognostic, and predictive uses for the agents and detection methods provided herein, such as for the diagnosis, prognosis, and prediction of GEP- NEN, associated outcomes, and treatment responsiveness.
- available GEP-NEN classification methods are limited, in part due to incorrect classifications and that individual lesions or tumors can evolve into different GEP-NEN sub-types or patterns, and/or contain more than one GEP-NEN sub-type.
- Known classification frameworks are limited, for example, in the ability to predict response to treatment or discriminate accurately between tumors with similar histopathologic features that may vary substantially in clinical course and treatment response, and to predict treatment responsiveness.
- diagnostic, prognostic, and predictive methods are those which employ statistical analysis and biomathematical algorithms and predictive models to analyze the detected information about expression of GEP-NEN biomarkers and other markers such as housekeeping genes, in some embodiments, expression levels, detected binding or other information is normalized and assessed against reference value(s), such as expression levels in normal samples or standards.
- Provided embodiments include methods and systems for
- GEP-NEN classification and prediction of GEP-NENs using the detected and measured information about the expression of the GEP-NEN biomarkers for example, in classification, staging, prognosis, treatment design, evaluation of treatment options, and prediction of GEP-NEN disease outcomes, e.g., predicting development of metastases.
- the methods are used to establish GEP-NEN diagnosis, such as diagnosis or detection of early-stage disease or metastasis, define or predict the extent of disease, identify early spread or metastasis, predict outcome or prognosis, predict progression, classify disease activity, monitor treatment responsiveness, detect or monitor for recurrence, and to facilitate early therapeutic intervention.
- GEP-NEN diagnosis such as diagnosis or detection of early-stage disease or metastasis
- define or predict the extent of disease identify early spread or metastasis, predict outcome or prognosis, predict progression, classify disease activity, monitor treatment responsiveness, detect or monitor for recurrence, and to facilitate early therapeutic intervention.
- the provided methods and algorithms are those for use in classification, staging, prognosis, treatment design, evaluation of treatment options, and prediction of GEP-NEN disease outcomes, e.g., predicting development of metastases.
- the methods, algorithms and models are useful for diagnostic surveillance, such as routine surveillance and patient follow-up.
- the methods, algorithms and models provide for early diagnosis; in one aspect, the methods are capable of detection of low- volume tumors, and detection of circulating tumor cells, including at early stages of disease, such as detection of as few as at or about 3 circulating GEP-NEN cells per milliliter of blood.
- early evidence of disease allows early therapeutic intervention, at a time when therapies are more effective, which can improve survival rates and disease outcomes.
- the methods useful for early detection of the recurrence and/or metastasis of GEP-NEN such as after treatment for example following surgical or chemical intervention.
- the methods are performed weekly or monthly following therapeutic intervention, for example, on human blood samples.
- the methods are capable of detecting micrometastases that are too small to be detected by
- the methods are capable of detecting metastases less than one centimeter (cm), such as at or about 1 cm, 0.9 cm, 0.8 cm, 0.7 cm, 0.6 cm, 0.5 cm, 0.4 cm, 0.3 cm, 0.2 cm, or 0.1 cm metastases, such as in the liver.
- centimeter such as at or about 1 cm, 0.9 cm, 0.8 cm, 0.7 cm, 0.6 cm, 0.5 cm, 0.4 cm, 0.3 cm, 0.2 cm, or 0.1 cm metastases, such as in the liver.
- a GEP-NEN determines the presence or absence (or both) of a GEP-NEN in a subject or sample with a correct call rate of between 56 and 92 %, such as at least or at least about a 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%», 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% correct call rate.
- the methods are useful for diagnosis with a specificity or sensitivity of at least or at least about 70%, 7%5, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100 %,
- the methods are capable of detecting the recurrence, metastasis, or spread of GEP-NEN following treatment or during initial disease progression at an earlier stage as compared with other diagnostic methods, such as imaging and detection of available biomarkers.
- the detected expression levels and/or expression signature of the biomarkers correlate significantly with the progression of disease, disease severity or
- GEP-NEN-associated events risk, prognosis, type or class of GEP-NEN or disease stage.
- Among the provided embodiments are methods that use the provided biomarkers and detection thereof in treatment development, strategy, and monitoring, including evaluation of response to treatment and patient- specific or individualized treatment strategies that take into consideration the likely natural history of the tumor and general health of the patient.
- GEP-NEN management strategies include surgery for cure (rarely achieved) or cytoreduction-— radiological intervention— for example, by ehemoembolization or
- radiofrequency ablatio— chemotherapy, cryoablation, and treatment with somatostatin and somatostatin analogues such as Sandostatin EAR ⁇ (Octreotide acetate injection)
- somatostatin and somatostatin analogues such as Sandostatin EAR ⁇ (Octreotide acetate injection)
- Biological agents, including interferon, and hormone therapy, and somatostatin-tagged radionucleotides are under investigation.
- Cryoablation liberates GEP-NEN tissue for entry into the blood, which in turn induces symptoms, as described by Mazzaglia P.), et ah, " ⁇ Laparoscopic
- Chemo therapeutic agents e.g., systemic cytotoxic chemo therapeutic agents, include etoposide, eisplatin, 5-fluorouraeil, streptozotocin, doxorubicin; vascular endothelial growth factor inhibitors, receptor tyrosine kinase inhibitors (e.g., Sunitinib, Sorafenib, and Vatalanib), and mammalian target of rapamycin (raTOR) inhibitors (e.g., Temsirolimus and Everolimus), and combinations thereof, for example to treat disseminated and/or poorly differentiated/aggressive disease. Other treatment approaches are well known.
- raTOR mammalian target of rapamycin
- the detection and diagnostic methods are used in conjunction with treatment, for example, by performing the methods weekly or monthly before and/or after treatment.
- the expression levels and profiles correlate with the progression of disease, ineffectiveness or effectiveness of treatment, and/or the recurrence or lack thereof of disease.
- the expression information indicates that a different treatment strategy is preferable.
- therapeutic methods in which the GEP-NEN biomarker detection methods are performed prior to treatment, and then used to monitor therapeutic effects.
- the therapeutic strategy is changed fol lowing performing of the detection methods, such as by adding a different therapeutic intervention, either in addition to or in place of the current approach, by increasing or decreasing the aggressiveness or frequency of the current approach, or stopping or reinstituting the treatment regimen.
- the detected expression levels or expression profile of the biomarkers identifies the GEP-NEN disease for the first time or provides the first definitive diagnosis or classification of GEP-NEN disease.
- a treatment approach is designed based upon the expression levels or expression profiles, and/or the determined classification. The methods include iterative approaches, whereby the biomarker detection methods are followed by initiation or shift in therapeutic intervention, followed by continued periodic monitoring, reevaluation, and change, cessation, or addition of a new therapeutic approach, optionally with continued monitoring.
- the methods and systems determine whether or not the assayed subject is responsive to treatment, such as a subject who is clinically categorized as in complete remission or exhibiting stable disease. In some aspects, the methods and systems determine whether or not the subject is untreated (or treatment-I, i.e., has not received treatment) or is non- responsive (i.e., clinically categorized as "progressive.” For example, methods are provided for d stingu shing treatment-responsive and non-responsive patients, and for distinguishing patients with stable disease or those in complete remission, and those with progressive disease.
- the methods and systems make such calls with at least at or about 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%», 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% correct call rate (i.e., accuracy), specificity, or sensitivity.
- the sensitivity or correct call rate for the diagnostic or predictive or prognostic outcome is greater than, e.g., significantly greater than, that obtained using a known diagnosis or prognostic method, such as detection and measurement of circulating CgA or other single protein,
- the diagnostic, prognostic, and predictive methods often in an initial step, select a subset of biomarkers based on their ability to build a classifier that may accurately predict and classify GEP-NEN and/or different stages of GEP-NEN .
- an accurate classifier may be based on topographic, pattern-recognition based protocols e.g., support vector machines (SVM) (Noble WS. What is a support vector machine? Nat Biotechnol. 2006;24(12): 1565-7).
- SVM support vector machines
- Machine-learning based techniques are typically desirable for developing sophisticated, automatic, and/or objective algorithms for analyzing high-dimensional and multimodal biomedical data.
- SVM a variant of the supervised learning algorithm— is used in connection with the provided methods and systems.
- SVMs have been used to predict the grading of astrocytomas with a > 90 accuracy, and prostatic carcinomas with an accuracy of 74- 80% (Glotsos D, Tohka J, Ravazoula P, Cavouras D, Nikiforidis G. Automated diagnosis of brain tumours astrocytomas using probabilistic neural network clustering and support vector machines, Int J Neural Syst 2005;! 5(1-2): 1 -1 1 ; Glotsos D, Tohka J, Ravazoula P, Cavouras D, Nikiforidis G. Automated diagnosis of brain tumours astrocytomas using probabilistic neural network clustering and support vector machines. Int J Neural Syst 2005; 15(1 -2): 1-1 1).
- LDA linear discriminant analysis
- NB naive Bayes
- KNN K-nearest neighbor
- Such approaches are useful for identifying individual or multi-variable alterations in neoplastic conditions (Drozdov I, Tsoka S, Ouzounis CA, Shah AM. Genome-wide expression patterns in physiological cardiac hypertrophy. BMC Genomics. 201Q;11 : 55; Freeman TC, Goldovsky L, Brosch M, et al. Construction, visualization, and clustering of transcription networks from microarray expression data.
- an accurate classifier for GEP-NEN and/or different stages of GEP-NEN is based on a combination of the SVM, LDA, NB, and KNN protocols. This is termed the Multi-Analyte- Algorithm Risk Classifier for NETs (MAARC-NET).
- MAARC-NET Multi-Analyte- Algorithm Risk Classifier for NETs
- Methods using the predictive algorithms and models use statistical analysis and data compression methods, such as those well known in the art.
- expression data may be transformed, e.g., In-transformed, and imported into a statistical analysis program, such as Partek® Genomic Suite ("Partek,” Partek® Genomics SuiteTM, ed. Revision 6.3 St. Louis: Partek Inc, 2008) or similar program, for example.
- Partek® Genomic Suite (“Partek,” Partek® Genomics SuiteTM, ed. Revision 6.3 St. Louis: Partek Inc, 2008) or similar program, for example.
- Partek® Genomic Suite Partek
- Partek® Genomics SuiteTM ed. Revision 6.3 St. Louis: Partek Inc, 2008
- Whether differences in expression level score or values are deemed significant may be determined by well-known statistical approaches, and typically is done by designating a threshold for a particular statistical parameter, such as a threshold p-vaiue (e.g. , p ⁇ 0,05), threshold S-value (e.g. , +0.4, with S ⁇ -0.4 or S > 0.4), or other value, at which differences are deemed significant, for example, where expression of a biomarker is considered significantly down- or up-regulated, respectively, among two different samples, for example, representing two different GEP-NEN sub-types, tumors, stages, localizations, aggressiveness, or other aspect of GEP-NEN or normal or reference sample.
- a threshold p-vaiue e.g. , p ⁇ 0,05
- threshold S-value e.g. , +0.4, with S ⁇ -0.4 or S > 0.4
- the algorithms, predictive models, and methods are based on biomarkers expressed from genes associated with regulatory gene clusters (i.e., SSTRome, Proliferome. Signalome. Metabolome, Secretome, Secretome, Plurome, EpiGenome, and Apoptome) underlying various GEP-NEN subtypes.
- SSTRome regulatory gene clusters
- Proliferome. Signalome. Metabolome, Secretome, Secretome, Plurome, EpiGenome, and Apoptome underlying various GEP-NEN subtypes.
- the methods apply the mathematical formulations, algorithms or models identify specific cutoff points, for example, pre-determined expression level scores, which distinguish between normal and GEP-NEN samples, between GEP-NEN and other cancers, and between various sub-types, stages, and other aspects of disease or disease outcome.
- the methods are used for prediction, classification, prognosis, and treatment monitoring and design.
- the predictive embodiments are useful for identifying molecular parameters predictive of biologic behavior, and prediction of various GEP-NEN- associated outcomes using the parameters.
- machine learning approaches are used, e.g., to develop sophisticated, automatic and objective algorithms for the analysis of high-dimensional and multimodal biomedical data.
- a "ROC curve” as used herein refers to a plot of the true positive rate (sensitivity) against the false positive rate (specificity) for a binary classifier system as its discrimination threshold is varied.
- AUC represents the area under the ROC curve.
- the AUC is an overall indication of the diagnostic accuracy of 1) a subset or panel of GEP-NEN biomarkers and 2) a ROC curve.
- AUC is determined by the "trapezoidal rule." For a given curve, the data points are connected by straight line segments, perpendiculars are erected from the abscissa to each data point, and the sum of the areas of the triangles and trapezoids so constructed is computed.
- a subset or panel of GEP-NEN has an AUC in the range of about 0.75 to 1.0. In certain of these embodiments, the AUC is in the range of about 0.50 to 0.85, 0.85 to 0.9, 0.9 to 0.95, or 0.95 to 1.0.
- PCA Principal Component Analysis
- expression level data are acquired, e.g., by real-time PCR, and reduced or compressed, for example, to principal components.
- PCA is used to reduce dimensionality of the data (e.g., measured expression values) into uncorrel ated principal components (PCs) that expl ain or represent a majority' of the variance in the data, such as about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99 % of the variance.
- PCs principal components
- the PCA is 3 -component PCA, in which three PCs are used that collectively represent most of the variance, for example, about 75%, 80%, 85%, 90%, or more variance in the data (Jolliffe IT, "Principle Component Analysis,” Springer, 1986).
- PCA mapping e.g., 3-cornponent PCA mapping is used to map data to a three dimensional space for visualization, such as by assigning first (1 S! ), second (2 na ) and third (3 rd ) PCs to the X-, Y ⁇ , and Z-axes, respectively.
- PCA may be used to determine expression profiles for the biomarkers in various samples. For example, reduced expression data for individual sample types (e.g., each tumor type, sub-type or grade, or normal sample type) are localized in a PCA coordinate system and localized data used to determine individual transcript expression profiles or signatures.
- individual sample types e.g., each tumor type, sub-type or grade, or normal sample type
- localized data used to determine individual transcript expression profiles or signatures.
- the expression profile is determined for each sample by plotting or defining a centroid (center of mass; average expression), corresponding to or representing the sample's individual transcript expression profile (regulatory signature), as given by the principal component vector, as determined by PCA for the panel of biomarkers.
- centroids or points of localization separated by a relatively large distance in this coordinate system represent two relatively distinct transcript expression profiles.
- relatively close centroids represent relatively similar profiles.
- Proximity of centroids indicates similarity between samples. For example, the relative distance between centroids for different GEP-NEN tumor samples represents the relative similarity of their regulatory signatures or transcript expression profiles.
- Pearson's Correlation (PC) coefficients may be used to assess linear relationships (correlations) between pairs of values, such as between expression levels of a biornarker for different biological samples (e.g., tumor sub-types) and between pairs of biomarkers. This analysis may be used to linearly separate distribution in expression patterns, by calculating PC coefficients for individual pairs of the biomarkers (plotted on x ⁇ and y- axes of individual Similarity Matrices). Thresholds may be set for varying degrees of linear correlation, such as a threshold for highly linear con-elation of (R > 0.50, or 0.40). Linear classifiers can be applied to the datasets. In one example, the correlation coefficient is 1.0.
- regulatory clusters are determined by constructing networks of correlations using statistical analyses, for example, to identify regulatory clusters composed of subsets of the panel of biomarkers.
- PC correlation coefficients are determined and used to constmct such networks of correlations.
- the networks are identified by drawing edges between transcript pairs having R above the pre-defined threshold. Degree of correlation can provide information on reproducibility and robustness.
- objective algorithms predictive models, and topographic analytical methods, and methods using the same, to analyze high-dimensional and multimodal biomedical data, such as the data obtained using the provided methods for detecting expression of the GEP-NEN biomarker panels.
- the objective algorithms, models, and analytical methods include mathematical analyses based on topographic, pattern-recognition based protocols e.g., support vector machines (SVM) (Noble WS. What is a support vector machine? Nat Biotechnol.
- SVM support vector machines
- LDA linear discriminant analysis
- NB naive Bayes
- N ⁇ nearest neighbor protocols
- other supervised learning algorithms and models such as Decision Tree, Perception, and regularized discriminant analysis (RDA), and similar models and algorithms well-known in the art (Gallant Si, "Perceptron-based learning algorithms,” Perceptron-based learning algorithms 1990; 1(2): 179-91).
- Feature Selection is applied to remove the most redundant features from a dataset, such as a GEP-NEN biomarker expression dataset, and generate a relevant subset of GEP-NEN biornarkers.
- FS enhances the generalization capability, accelerates the learning process, and improves model interpretability.
- FS is employed using a "greedy forward" selection approach, selecting the most relevant subset of features for the robust learning models. (Peng H, Long F, Ding C, "Feature selection based on mutual information: criteria of max-dependency, max- relevance, and min-redundancy," IEEE Transactions on Pattern Analysis and Machine Intelligence, 2005;27(8): 1226-38),
- Support Vector Machines algorithms are used for classification of data by increasing the margin between the n data sets (Cristianini N, Shawe- Taylor J. An Introduction to Support Vector Machines and other kernel -based learning methods. Cambridge: Cambridge University Press, 2000).
- the predictive models include Decision Tree, which maps observations about an item to a conclusion about its target value (Zhang H, Singer B. "Recursive Partitioning in the Health Sciences,” (Statistics for Biology and Health): Springer, 1999.).
- the leaves of the tree represent classifications and branches represent conjunctions of features that devolve into the individual classifications.
- the predictive models and algorithms further include Percept on, a linear classifier that forms a feed forward neural network and maps an input variable to a binary classifier (Gallant SI. "Perceptron-based learning algorithms,” Perceptron-based learning algorithms 1990; 1(2): 179-91). It has been used to predict malignancy of breast cancer (Markey MK et al. "Perceptron error surface analysis: a case study in breast cancer diagnosis,” Comput Biol Med 2002;32(2) ;99- 109). In this model, the learning rate is a constant that regulates the speed of learning. A lower learning rate improves the classification model, while increasing the time to process the variable (Markey MK et al.
- Perceptron error surface analysis a case study in breast cancer diagnosis," Comput Biol Med 2002;32(2):99-109).
- a learning rate of 0.05 is used.
- a Perceptron algorithm is used to distinguish between localized or primary tumors and corresponding metastatic tumors.
- three data scans are used to generate decision boundaries that explicitly separate data into classes.
- the predictive models and algorithms further include Regularized Discriminant Analysis (RDA), which can be used as a flexible alternative to other data mining techniques, including Linear and Quadratic Discriminant Analysis (LDA, QDA) (Lilien RH, Farid H, Donald BR. "Probabilistic disease classification of expression-dependent proteomic data from mass spectrometry of human serum.," J Comput Biol 2003;10(6):925 ⁇ 46.; Cappeln D, Luong- Nguyen NH, Bongiovanni S, et al. "Transcriptional program of mouse osteoclast differentiation governed by the macrophage colony- stimulating factor and the ligand for the receptor activator of NFkappa B.
- RDA Regularized Discriminant Analysis
- RDA's regularization parameters, ⁇ and ⁇ are used to design an intermediate classifier between LDA and QDA.
- QDA is performed when ⁇ :::: 0 and ⁇ ⁇ 0 while LDA. is performed when ⁇ :::: 0 and ⁇ ::: 1 (Picon A, Gold LI, Wang J, Cohen A, Friedman E.
- a subset of metastatic human colon cancers expresses elevated levels of
- reguiarization parameters are defined as ⁇ ::: 0.002 and ⁇ :::: 0.
- S-values are assigned to ail transcripts which are then arranged by a decreasing 8-value.
- RDA. is performed, e.g., 21 times, such that the N 1 " iteration consists of top N scoring transcripts.
- Error estimation can be carried out by a 10-fold cross-validation of the RDA classifier. This can be done by partitioning the tissue data set into complementary subsets, performing the analysis on one subset (called the training set), and validating the analysis on the other subset (called the validation set or testing set).
- misclassification error is averaged to reduce variability in the overall predictive assessment, which can provide a more accurate approach to error estimation compared to other approaches, including bootstrapping and leave-one-out cross-validation (Kohavi R. "A study of cross-validation and bootstrap for accuracy estimation and model selection.," Proceedings of the Fourteenth International Joint Conference on Artificial
- selection for tissue classification is performed, for example, by computing the rank score (S) for each, gene and for each class pair as:
- ⁇ and ⁇ 2 represent means of first and second class respectively and ⁇ and Gc2 are inter-class standard deviations.
- a large S value is indicative of a substantial differential expression ("Fold Change”) and a low standard deviation ("transcript stability”) within each class.
- Genes may be sorted by a decreasing S ⁇ value and used as inputs for the regularized discriminant analysis algorithm (RDA).
- RDA regularized discriminant analysis algorithm
- the algorithms and models may be evaluated, validated and cross-validated, for example, to validate the predictive and classification abilities of the models, and to evaluate specificity and sensitivity.
- radial basis function is used as a kernel
- a 10- fold cross-validation used to measure the sensitivity of classification (Cristiamni N, Shawe- Taylor J. "An Introduction to Support V ector Machines and other kernel-based learning methods.," Cambridge: Cambridge University Press, 2000.).
- Various classification models and algorithms may be compared by the provided methods, for example, using training and cross- validation, as provided herein, to compare performance of the predictive models for predicting particular outcomes.
- Embodiments of the provided methods, systems, and predictive models are reproducible, with high dynamic range, can detect small changes in data, and are performed using simple methods, at low cost, e.g., for implementation in a clinical laboratory.
- kits and other articles of manufacture are provided for use in the diagnostic, prognostic, predictive, and therapeutic applications described herein.
- the kits include a carrier, package, or packaging, compartmentalized to receive one or more containers such as vials, tubes, plates, and wells, in which each of the containers includes one of the separate elements for use in the methods provided herein, and in some aspects further include a label or insert with instructions for use, such as the uses described herein.
- the individual containers include individual agents for detection of the GEP-NEN biomarkers as provided herein; in some examples, individual containers include agents for detection of housekeeping genes and/or normalization.
- the container(s) can comprise an agent, such as a probe or primer, which is or can be detectably labeled.
- the kit can also have containers containing iiucleotide(s) for amplification of the target nucleic acid sequence.
- Kits can comprise a container comprising a reporter, such as a biotin- binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, fluorescent, or radioisotope label; such a reporter can be used with, e.g., a nucleic acid or antibody.
- kits will typically comprise the containers) described above and one or more other containers associated therewith that comprise materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes; carrier, package, container, vial and/or tube labels listing contents and/or instructions for use, and package inserts with instructions for use.
- a label can be present on or with the container to indicate that the composition is used for a specific therapeutic or non-therapeutic application, such as a prognostic, prophylactic, diagnostic or laboratory application, and can also indicate directions for either in vivo or in vitro use, such as those described herein. Directions and or other information can also be included on an insert(s) or label(s) which is included with or on the kit.
- the label can be on or associated with the container.
- a label a can be on a container when letters, numbers or other characters forming the label are molded or etched into the container itself; a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
- the label can indicate that the composition is used for diagnosing, treating, prophylaxing or prognosing a condition, such as GEP-NEN.
- an article(s) of manufacture containing compositions such as amino acid sequence(s), small molecule(s), nucleic acid sequence! s), and/or antibody(s), e.g., materials useful for the diagnosis, prognosis, or therapy of GEP-NEN.
- the article of manufacture typically comprises at least one container and at least one label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass, metal or plastic. The container can hold amino acid sequence(s), small molecule(s), nucleic acid sequence(s), cell population(s) and/or antibody(s).
- the container holds a polynucleotide for use in examining the mRNA expression profile of a ceil, together with reagents used for this purpose.
- a container comprises an antibody, binding fragment thereof or specific binding protein for use in evaluating protein expression of GEP-N EN biomarkers in biological samples, e.g., blood or cells and tissues, or for relevant laboratory, prognostic, diagnostic, prophylactic and therapeutic purposes; indications and/or directions for such uses can be included on or with such container, as can reagents and other compositions or tools used for these purposes.
- the article of manufacture can further comprise a second container comprising a pharmaceuticaily-acceptable buffer, such as phosphate -buffered saline. Ringer's solution and/or dextrose solution. It can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, stirrers, needles, syringes, and/or package inserts with indications and/or instructions for use.
- a pharmaceuticaily-acceptable buffer such as phosphate -buffered saline. Ringer's solution and/or dextrose solution. It can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, stirrers, needles, syringes, and/or package inserts with indications and/or instructions for use.
- FIGURE 1 The RMA-normalized exon expression of the NET marker genes in this subset is shown in FIGURE 1 in normal (green) and tumor (red) samples.
- Tphl was the only gene where all exons were differentially expressed in tumor (FC>1.5, p ⁇ 0.05), while CgA was the only gene where all exon expressions remained constant between tumor and normal samples.
- candidate biomarkers e.g., VMAT2
- pantothen Chr.20
- FIGURE 3 shows the prediction accuracy of each classifier algorithm using sequential addition of up to 27 significantly up-regulated genes (p ⁇ 0.05) in the GEP-NET samples obtained using results of the 10-fold cross validation.
- the average accuracy of the SVM, LDA, KNN, and Bayes algorithms to distinguish GEP-NET from control blood samples using the sequentially added 27 genes was comparable - 0.89 (0.85-1.0), 0.89 (0.86- 0.93), 0.88 (0.85-0.93), and 0.86 (0.85-0.93) respectively.
- the "majority voting" combination of the four classifiers achieved an accuracy of 0.88.
- the at least 22 genes sufficient to build an accurate classifier were used to develop the MAARC-NET scoring system, and are featured in TABLE 3.
- Each "call” is the binary result (either "0" for normal or "1" for tumor) of one of four different learning algorithms: Support Vector Machine (SVM), Linear Discrimination Analysis (LDA), K-Nearest Neighbor (KNN), and Na ' ive Bayes (Bayes).
- SVM Support Vector Machine
- LDA Linear Discrimination Analysis
- KNN K-Nearest Neighbor
- Na ' ive Bayes Na ' ive Bayes
- GEP-NEN GEP-NEN
- a number of rules were implemented to generate an amended majority vote strategy.
- a call of "normal” was assigned a value of 0; a call of tumor “treated” was assigned a value of 1; a call of tumor “untreated” was assigned a value of 2.
- a value of 0 was assigned for each call, thereby totaling a score of 0.
- a value of 1 was assigned for call, thereby totaling a score of 4.
- a sample results in four calls of tumor "untreated” a "2" is assigned for each, thereby totaling a score of 8.
- Scores in the amended majority vote strategy can therefore range between 0 and 8.
- a receiver operating characteristic (ROC) curve was generated of controls versus GEP-NETs (SD and PD combined).
- a ROC curve is a generalization of the set of potential combinations of sensitivity and specificity possible for predictors.
- a ROC curve is a plot of the true positive rate (sensitivity) against the false positive rate (1 -specificity) for the different possible cut-points of a diagnostic test.
- FIGURE 5B is a graphical representation of the functional relationship between the distribution of the sensitivity and specificity values in the test set and in a cohort of control samples.
- the area under the curve (AUC) is an overall indication of the diagnostic accuracy of (1) the amended mathematically- derived scores and (2) a receiver operating characteristic (ROC) curve.
- AUC may be determined by the "trapezoidal rule.” For a given ROC curve, the data points are connected by straight line segments, perpendiculars are erected from the abscissa to each data point, and the sum of the areas of the triangles and trapezoids so constructed is computed.
- the ROC curve in FIGURE 5B identifies that the amended mathematically- derived score may be utilized to differentiate between controls and GEP-NETs - exhibiting an AUC of > 0.98, and ap ⁇ 0.0001; *p ⁇ 0.05 vs. controls; #p ⁇ 0.05 vs. SD (2-tailed Mann- Whitney U-test).
- FIGURE 6B a frequency distribution plot of amended mathematical ly-derived scores in SD and PD patients confirmed that PD samples exhibited higher scores, with #p ⁇ 0.0001 vs. SD (2- tailed Mann- Whitney U-test).
- a second ROC curve was generated to determine whether the amended mathematically-derived score could be utilized to differentiate SD from PD.
- the ROC analysis identified that the score could be used to differentiate PD from SD tumors with an AUC of 0.93.
- a score cutoff of > 6.5 i.e. a score of ⁇ 7 had a sensitivity of 85% and 83% specificity for detecting PDs (Likelihood ratio: 4.97).
- a cut-off of >3 has a sensitivity of 95% and 94% specificity.
- the sensitivity can be improved to 98% using a cut-off of >2.
- a cut-off of >7 can be used (sensitivity of 85% and 83% specificity).
- the sensitivity can be improved to 96%> using a cut-off of >5.
- the mathematically-derived MAARC-NET scores therefore range from 0-2 (control); 2-5 (SD); and 5-8 (PD). These scores can be converted to a percentage as displayed in
- the score percentages from TABLE 4 can be displayed within a nomogram representing "NETest 1."
- the NETest 1 nomogram demonstrates how the amended mathematically-derived score is achieved and how it categorizes patients into different classes of GEP-NEN (no disease, stable disease, or progressive disease).
- the utility of the NETest 1 nomogram was assessed. Values for the correct predictions of SD and PD using the NETest 1 nomogram of FIGURE 8 are shown. Overall, the NETest 1 nomogram identified 80% of SD patients as exhibiting low or moderate disease activity and 84% of PD patients as exhibiting high disease activity.
- the NETest 1 nomogram from FIGURE 8 can be updated to include risk values.
- the NETest 2a nomogram of FIGURE 12 includes the NETest with the inclusion of score and risk categorizations.
- a NETest score of 5 has a > 90% chance of identifying an SD sample (as shown in FIGURES 11-12). Comparisons of the individual 51 gene expression profiles between patients scored as 5 (SD versus PD) identified expression of SMARCD3 and TPH1 as candidate differentiation markers. Using the rule:
- a NETest score of 6 has a -50% chance of differentiating SD from PD samples.
- Gene expression profile analysis identified VMAT1 and PHF21A as candidates.
- a ROC analysis defined the AUCs for each to differentiate PD from SD to be:
- a NETest score of 7 has a -50% chance of differentiating SD from PD samples.
- gene expression profile analysis identified both VMAT1 and
- a ROC analysis defined the AUCs for each to differentiate PD from SD to be:
- a NETest score of 8 has a >90% chance of identifying a sample as PD.
- FIGURE 14A the Hallmarks of Neoplasia are illustrated, including the delineation of tumor (adenocarcinoma)-derived hallmarks.
- FIGURE 14B the NET hallmarks based on the Hanahan and Weinberg classifications are illustrated.
- the "PDA” algorithm which included a summation of the proliferome, signalome, secretome II, plurome and epigenome (the PDA algorithm is also referred to as Progressive Diagnostic I);
- the "NDA” algorithm which included expression of 15 genes associated with disease: these included ARAFl, BRAF, KRAS, RAFl, Ki67, NAPILI, NOL3, GLT8D1, PLD3, PNMA2, VMAT2, TPHl, FZD7, MORF4L2 and ZFHX3 (the NDA algorithm is also referred to as Progressive Diagnostic II). Genes were summated and an averaged value was derived.
- FIGURES 15B and 15 A Prior to assessing the value of the nine gene clusters and two algorithms in blood samples, their expression in NET tumor tissue was assessed to confirm that these were NET- relevant.
- expression of the signalome, metabolome, secretome (I) and (II), epigenome, apoptome and SSTRome were elevated in NETs (p ⁇ 0.05).
- Genes in the apoptome were decreased in NETs, while the proliferome was not different between NETs and normal mucosa.
- FIGURE 16 shows that each of the PDA and NDA were significantly increased (p ⁇ 0.05) in NET tumor tissue compared to normal mucosa.
- the independent set the proliferome, secretome (II), plurome and epigenome were significantly increased.
- the PDA and NDA were evaluated in each of the two datasets (independent and test sets). With reference to FIGURE 19 A, no significant differences were identified between SD and PD for either of the two algorithms in the test set. With reference to FIGURE 19B, each of the PDA and NDA were elevated in the independent set.
- TDA test
- IDA independent
- TDA Secretome
- Plurome the TDA algorithm is also referred to as Progressive Diagnostic III
- SSTRome the TDA algorithm is also referred to as Progressive Diagnostic III
- IDA Proliferome, secretome (II), plurome and epigenome (the IDA algorithm is also referred to as Progressive Diagnostic IV).
- FIGURE 22A Algorithm-generated ROC curves of TDA and IDA for differentiating between SD and PD are shown in FIGURE 22A.
- FIGURE 22B Algorithm-generated ROC curves for each of the clusters for differentiating between SD and PD are shown in FIGURE 22B.
- the ROC curves in FIGURES 22A and 22B demonstrate that AUCs range from 0.51 (GF signalome) to 0.72 (plurome) for the differentiation of SD and PD.
- Chromogranin A (CgA), a gene used in a prior known single biomarker assay for NETs, was not significantly decreased (58.5 ⁇ 137.9ng/ml vs. 55.25 ⁇ 154.8), as shown in FIGURE 23B.
- the clinical utility of the test therefore is defined by the examination of scores, algorithms and clusters and evaluation in comparison to pre-surgical bloods.
- Evidence of elevated expression of e.g., PDA or proliferome in post-surgical samples is indicative of residual progressive (highly active disease).
- a NETest 3 nomogram is illustrated with the inclusion of surgically-relevant algorithms and gene clusters.
- a combination score, as well as alterations in gene clusters e.g., a significant increase in the proliferome, will be indicative of disease regrowth following surgery.
- FIGURE 32 analysis of the data identified that algorithms (FIGURE 32A) and selected clusters (FIGURE 32B) differentiated controls from PD treated with SSAs. Data for the individual clusters are included in TABLE 11.
- Scores were also determined in blood samples collected prior to as well as monthly during SSA treatment to evaluate whether early alterations were predictive of outcome, i.e., response to therapy.
- the results identify that elevated NETest scores (80-100% activity) measured at any time point during therapy were predictive of therapeutic responsiveness.
- the mean time for CgA was 70 days (range: 0-196 days).
- Dataset 1 included patients who were collected for therapeutic intervention, namely peptide receptor radionucleotide therapy (PRRT).
- Dataset 2 included patients who exhibited stable disease and were undergoing routine follow-up.
- PRRT peptide receptor radionucleotide therapy
- a Surrogate for the Ki-67 Index did not identify any significant correlation between individual gene expression and the Ki-67 index (a marker of tumor proliferation) in either of the two groups.
- Ki-67 index a marker of tumor proliferation
- Proliferome + SSTRome algorithm is also referred to as Progressive Diagnostic V; the highly relevant genes (KRAS, SSTR4, and VPS13C) algorithm is also referred to as
- Progressive Diagnostic VI the highly relevant genes + SSTRome algorithm is also referred to as Progressive Diagnostic VII.
- ZFHX3 as a Marker for Disease Assessment: The identification of ZFHX3 as the best marker for MTV, as shown in FIGURE 41 A, suggests that expression of this gene may have clinical utility as a measure of tumor burden and changes thereof.
- ZFHX3 is a zinc finger protein involved in the regulation of neuronal differentiation through the control of cell cycle arrest. Loss of ZFHX3 expression with a subsequent loss of cell cycle arrest therefore is related to tumor proliferation and the development of new lesions and/or progression of disease.
- Pre -treatment NETest scores as well as grading were available and used to identify whether a combination of gene expression and clinical parameters were predictive of outcome, i.e., response to therapy.
- NETest gene expression levels were significantly different between responders and non-responders prior to therapy. These included genes linked to growth factor signaling (GF signalome: IR. // ⁇ ' /. BRAF, KRAS and RAF I) as well as genes linked to metabolism (including ATP6V1H, OAZ2, PANK2, PLD3). Specifically,
- An integration of the two "clusters" (GF signalome + metabolome) into a "Biological Index" through summation of gene expression enabled prediction of future PRRT-responders from non-responders.
- a cut-off of 5.9 normalized gene expression
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Oncology (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (17)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2015317893A AU2015317893B2 (en) | 2014-09-15 | 2015-09-15 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
| KR1020257003150A KR20250021631A (ko) | 2014-09-15 | 2015-09-15 | 위장관췌장 신경내분비 신생물의 진단을 위한 조성물, 방법 및 키트 |
| EP21169154.8A EP3929303B1 (en) | 2014-09-15 | 2015-09-15 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
| BR112017005279-2A BR112017005279B1 (pt) | 2014-09-15 | 2015-09-15 | Métodos para detectar um neoplasma neuroendócrino gastroenteropancreático (gep-nen), para diferenciar gep-nen estável de um gep-nen progressivo e para determinar uma resposta a uma terapia com radionucleotídeo para receptor de peptídeo de um gep-nen |
| DK15771837.0T DK3194618T3 (da) | 2014-09-15 | 2015-09-15 | Sammensætninger, fremgangsmåder og kits til diagnosticering af et gastroenteropankreatisk neuroendokrin neoplasma |
| CN201580061761.0A CN107208132A (zh) | 2014-09-15 | 2015-09-15 | 用于诊断胃肠胰神经内分泌瘤的组合物、方法和试剂盒 |
| KR1020177010086A KR102762958B1 (ko) | 2014-09-15 | 2015-09-15 | 위장관췌장 신경내분비 신생물의 진단을 위한 조성물, 방법 및 키트 |
| EP15771837.0A EP3194618B1 (en) | 2014-09-15 | 2015-09-15 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
| ES15771837T ES2881474T3 (es) | 2014-09-15 | 2015-09-15 | Composiciones, métodos y kits para el diagnóstico de una neoplasia neuroendocrina gastroenteropancreática |
| JP2017533744A JP6782700B2 (ja) | 2014-09-15 | 2015-09-15 | 膵・消化管神経内分泌新生物の診断のための組成物、方法およびキット |
| MX2017003370A MX386919B (es) | 2014-09-15 | 2015-09-15 | Composiciones, métodos y kits para el diagnóstico de una neoplasia neuroendocrina gastroenteropancreática. |
| PL15771837T PL3194618T3 (pl) | 2014-09-15 | 2015-09-15 | Kompozycje, sposoby i zestawy do diagnozy nowotworu neuroendokrynnego żołądkowo- jelitowo-trzustkowego |
| CA2959670A CA2959670C (en) | 2014-09-15 | 2015-09-15 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
| IL250867A IL250867B (en) | 2014-09-15 | 2017-03-01 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
| IL281355A IL281355B (en) | 2014-09-15 | 2021-03-09 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
| AU2021212151A AU2021212151B2 (en) | 2014-09-15 | 2021-08-06 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
| AU2023258444A AU2023258444A1 (en) | 2014-09-15 | 2023-11-03 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462050465P | 2014-09-15 | 2014-09-15 | |
| US62/050,465 | 2014-09-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016044330A1 true WO2016044330A1 (en) | 2016-03-24 |
Family
ID=54207775
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/050274 Ceased WO2016044330A1 (en) | 2014-09-15 | 2015-09-15 | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
Country Status (13)
| Country | Link |
|---|---|
| US (4) | US10407730B2 (https=) |
| EP (2) | EP3194618B1 (https=) |
| JP (2) | JP6782700B2 (https=) |
| KR (2) | KR102762958B1 (https=) |
| CN (1) | CN107208132A (https=) |
| AU (3) | AU2015317893B2 (https=) |
| CA (1) | CA2959670C (https=) |
| DK (2) | DK3929303T3 (https=) |
| ES (2) | ES2881474T3 (https=) |
| IL (2) | IL250867B (https=) |
| MX (2) | MX386919B (https=) |
| PL (2) | PL3929303T3 (https=) |
| WO (1) | WO2016044330A1 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111315897A (zh) * | 2017-05-25 | 2020-06-19 | 液体活检研究有限责任公司 | 用于黑素瘤检测的方法 |
| WO2021072035A1 (en) | 2019-10-10 | 2021-04-15 | Liquid Biopsy Research LLC | Compositions, methods and kits for biological sample and rna stabilization |
| US11744907B2 (en) | 2017-11-30 | 2023-09-05 | Liquid Biopsy Research LLC | Predicting peptide receptor radiotherapy using a gene expression assay |
| WO2024073652A1 (en) * | 2022-09-30 | 2024-04-04 | Liquid Biopsy Research LLC | Methods for neuroendocrine cancer detection in saliva |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3194618B1 (en) | 2014-09-15 | 2021-04-21 | Clifton Life Sciences LLC | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
| CN108048564B (zh) * | 2018-02-09 | 2021-03-05 | 中国科学院昆明动物研究所 | 人glt8d1基因的新用途 |
| WO2020027732A1 (en) * | 2018-07-30 | 2020-02-06 | Agency For Science, Technology And Research | Method and system for assessing fibrosis in a tissue sample |
| FR3110764B1 (fr) * | 2020-05-20 | 2024-05-10 | Quantum Surgical | Méthode de prédiction de la récidive d’une lésion par analyse d’images |
| CN113215255B (zh) * | 2021-04-26 | 2022-04-05 | 山东天川精准医疗科技有限公司 | 用于肝癌早期诊断或预后的生物标记物及其用途 |
| US20260021141A1 (en) * | 2022-07-15 | 2026-01-22 | Emendobio Inc. | Strategies For Knock-Ins At APLP2 Safe Harbor Sites |
| CN117292755B (zh) * | 2023-08-09 | 2026-02-06 | 郑州大学 | 多模态临界边生物标志物识别方法 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005020795A2 (en) * | 2003-08-25 | 2005-03-10 | The Johns Hopkins University | Method of diagnosis and treatment of pancreatic endocrine neoplasms based on differntial gene expression analysis |
| WO2012119013A1 (en) * | 2011-03-01 | 2012-09-07 | Yale University | PREDICTING GASTROENTEROPANCREATIC NEUROENDOCRINE NEOPLASMS (GEP-NENs) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2727082C (en) * | 2008-06-12 | 2019-02-26 | Syntaxin Limited | Fusion proteins for use in suppression of acromegaly |
| EP3194618B1 (en) | 2014-09-15 | 2021-04-21 | Clifton Life Sciences LLC | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm |
-
2015
- 2015-09-15 EP EP15771837.0A patent/EP3194618B1/en active Active
- 2015-09-15 CN CN201580061761.0A patent/CN107208132A/zh active Pending
- 2015-09-15 US US14/855,229 patent/US10407730B2/en active Active
- 2015-09-15 MX MX2017003370A patent/MX386919B/es unknown
- 2015-09-15 ES ES15771837T patent/ES2881474T3/es active Active
- 2015-09-15 EP EP21169154.8A patent/EP3929303B1/en active Active
- 2015-09-15 CA CA2959670A patent/CA2959670C/en active Active
- 2015-09-15 PL PL21169154.8T patent/PL3929303T3/pl unknown
- 2015-09-15 PL PL15771837T patent/PL3194618T3/pl unknown
- 2015-09-15 KR KR1020177010086A patent/KR102762958B1/ko active Active
- 2015-09-15 JP JP2017533744A patent/JP6782700B2/ja active Active
- 2015-09-15 AU AU2015317893A patent/AU2015317893B2/en active Active
- 2015-09-15 ES ES21169154T patent/ES3013599T3/es active Active
- 2015-09-15 DK DK21169154.8T patent/DK3929303T3/da active
- 2015-09-15 WO PCT/US2015/050274 patent/WO2016044330A1/en not_active Ceased
- 2015-09-15 KR KR1020257003150A patent/KR20250021631A/ko active Pending
- 2015-09-15 DK DK15771837.0T patent/DK3194618T3/da active
-
2017
- 2017-03-01 IL IL250867A patent/IL250867B/en active IP Right Grant
- 2017-03-14 MX MX2021012347A patent/MX2021012347A/es unknown
-
2019
- 2019-08-01 US US16/528,864 patent/US11168372B2/en active Active
-
2020
- 2020-10-20 JP JP2020175701A patent/JP7157788B2/ja active Active
-
2021
- 2021-03-09 IL IL281355A patent/IL281355B/en unknown
- 2021-08-06 AU AU2021212151A patent/AU2021212151B2/en active Active
- 2021-11-08 US US17/521,205 patent/US12258633B2/en active Active
-
2023
- 2023-11-03 AU AU2023258444A patent/AU2023258444A1/en active Pending
-
2025
- 2025-03-05 US US19/071,035 patent/US20260043085A1/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005020795A2 (en) * | 2003-08-25 | 2005-03-10 | The Johns Hopkins University | Method of diagnosis and treatment of pancreatic endocrine neoplasms based on differntial gene expression analysis |
| WO2012119013A1 (en) * | 2011-03-01 | 2012-09-07 | Yale University | PREDICTING GASTROENTEROPANCREATIC NEUROENDOCRINE NEOPLASMS (GEP-NENs) |
Non-Patent Citations (70)
| Title |
|---|
| "Isolation and characterization of circulating tumor cells in patients with metastatic colorectal cancer", CLIN COLORECTAL CANCER, vol. 6, no. 2, 2006, pages 125 - 32 |
| BANCK M; KANWAR R; KULKARNI AA ET AL.: "The genomic landscape of small intestine neuroendocrine tumors", J CLIN INVEST, vol. 123, no. 6, 2013, pages 2502 - 8 |
| BOOM ET AL., J CLIN MICROBIOL., vol. 28, 1990, pages 495 - 503 |
| CAI YC ET AL.: "Cytokeratin 7 and 20 and thyroid transcription factor 1 can help distinguish pulmonary from gastrointestinal carcinoid and pancreatic endocrine tumors", HUM PATHOL, vol. 32, no. 10, 2001, pages 1087 - 93 |
| CAPPELLEN D; LUONG-NGUYEN NH; BONGIOVANNI S ET AL.: "Transcriptional program of mouse osteoclast differentiation governed by the macrophage colony- stimulating factor and the ligand for the receptor activator ofNFkappa B.", J BIOL CHEM, vol. 277, no. 24, 2002, pages 21971 - 82, XP002286917, DOI: doi:10.1074/jbc.M200434200 |
| CHOMCZYNSKI P; SACCHI N: "The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty- something years on", NAT PROTOC, vol. 1, no. 2, 2006, pages 581 - 5, XP009134296 |
| CRISTIANINI N; SHAWE-TAYLOR J: "An Introduction to Support Vector Machines and other kernel-based learning methods", 2000, CAMBRIDGE UNIVERSITY PRESS |
| CRISTIANINI N; SHAWE-TAYLOR J: "An Introduction to Support Vector Machines and other kernel-based learning methods.", 2000, CAMBRIDGE UNIVERSITY PRESS |
| CRISTOFANILLI M; BUDD GT; ELLIS MJ ET AL.: "Circulating tumor cells, disease progression, and survival in metastatic breast cancer", N ENGL J MED, vol. 351, no. 8, 2004, pages 781 - 91 |
| DANILA DC; HELLER G; GIGNAC GA ET AL.: "Circulating tumor cell number and prognosis in progressive castration-resistant prostate cancer", CLIN CANCER RES, vol. 13, no. 23, 2007, pages 7053 - 8 |
| DHAWAN M; SELVARAJA S; DUAN ZH: "Application of committee kNN classifiers for gene expression profile classification", INT J BIOINFORM RES APPL., vol. 6, no. 4, 2010, pages 344 - 52 |
| DROZDOV I; TSOKA S; OUZOUNIS CA; SHAH AM: "Genome-wide expression patterns in physiological cardiac hypertrophy", BMC GENOMICS, vol. 11, 2010, pages 55, XP021072854, DOI: doi:10.1186/1471-2164-11-557 |
| EVGENIOU T; PONTIL; POGGIO T: "Regularization Networks and Support Vector Machines.", ADVANCES IN COMPUTATIONAL MATH, vol. 13, no. 1, 2000, pages 1 - 50 |
| FREEMAN TC; GOLDOVSKY L; BROSCH M ET AL.: "Construction, visualization, and clustering of transcription networks from microarray expression data", PLOS COMPUT BIOL, vol. 3, no. 10, 2007, pages 2032 - 42 |
| GABRIEL KR: "The biplot graphic display of matrices with application to principal component analysis", BIOMETRIKA, vol. 58, no. 3, 1971, pages 453 |
| GALLANT SI: "Perceptron-based learning algorithms", PERCEPTRON-BASED LEARNING ALGORITHMS, vol. 1, no. 2, 1990, pages 179 - 91, XP000133517, DOI: doi:10.1109/72.80230 |
| GLOTSOS D ET AL.: "Automated diagnosis of brain tumours astrocytomas using probabilistic neural network clustering and support vector machines", INT J NEURAL SYST, vol. 15, no. 1-2, 2005, pages 1 - 11 |
| GLOTSOS D; TOHKA J; RAVAZOULA P; CAVOURAS D; NIKIFORIDIS G: "Automated diagnosis of brain tumours astrocytomas using probabilistic neural network clustering and support vector machines", INT J NEURAL SYST, vol. 15, no. 1 -2, 2005, pages 1 - 11 |
| GLOTSOS D; TOHKA J; RAVAZOULA P; CAVOURAS D; NIKIFORIDIS G: "Automated diagnosis of brain tumours astrocytomas using probabilistic neural network clustering and support vector machines", INT J NEURAL SYST, vol. 15, no. 1-2, 2005, pages 1 - 11 |
| HANAHAN D; WEINBERG RA: "Hallmarks of cancer: the next generation", CELL, vol. 144, no. 5, 2011, pages 646 - 674, XP028185429, DOI: doi:10.1016/j.cell.2011.02.013 |
| HOD, BIOTECHNIQUES, vol. 13, 1992, pages 852 - 854 |
| I S; YE J. KERNEL: "Uncorrelated and Regularized Discriminant Analysis: A Theoretical and Computational Study.", IEEE TRANSACTIONS ON KNOWLEDGE AND DATA ENGINEERING, vol. 20, no. 10, 2000, pages 1311 - 21, XP011225926, DOI: doi:10.1109/TKDE.2008.57 |
| JOLLIFTE IT: "Principle Component Analysis", 1986, SPRINGER |
| K. SPECHT ET AL., AM. J. PATHOL., vol. 158, 2001, pages 419 - 29 |
| KAHAN L.: "Medical devices; immunology and microbiology devices; classification of the immunomagnetic circulating cancer cell selection and enumeration system. Final rule", FED REGIST, vol. 69, 2004, pages 26036 - 8 |
| KAWARAZAKI S; TANIGUCHI K; SHIRAHATA M ET AL.: "Conversion of a molecular classifier obtained by gene expression profiling into a classifier based on real-time PCR: a prognosis predictor for gliomas", BMC MED GENOMICS, vol. 3, 2010, pages 52, XP021082989, DOI: doi:10.1186/1755-8794-3-52 |
| KIDD M ET AL.: "GeneChip, geNorm, and gastrointestinal tumors: novel reference genes for real-time PCR", PHYSIOL GENORNIES, vol. 30, no. 2, 2007, pages 263 - 70 |
| KIDD M ET AL.: "The role of genetic markers NAP 1 LI, MAGE-D2, and MTA1 in defining small-intestinal carcinoid neoplasia", ANN SURG ONCOL, vol. 13, no. 2, 2006, pages 253 - 62 |
| KIDD M ET AL.: "The role of genetic markers NAP 1 LI, MAGE-D2, and MTA1 in defining small-intestinal carcinoid tieoplasia", ANN SURG ONCOL, vol. 13, no. 2, 2006, pages 253 - 62 |
| KIDD M: "Genechip; geNorm and Gastrointestinal tumors: novel reference genes for real-time PCR.", PHYSIO! GENOMICS, vol. 30, 2007, pages 363 - 70, XP009097156, DOI: doi:10.1152/physiolgenomics.00251.2006 |
| KIDD M; EICK G; SHAPIRO MD ET AL.: "Microsatellite instability and gene mutations in transforming growth factor-beta type II receptor are absent in small bowel carcinoid tumors", CANCER, vol. 103, no. 2, 2005, pages 229 - 36 |
| KIDDM ET AL.: "The role of genetic markersNAP ILL MAGE-D2, and MTA1 in defining small-intestinal carcinoid neoplasia", ANN SURG ONCOL, vol. 13, no. 2, 2006, pages 253 - 62 |
| KIDDM, EICK G; SHAPIRO MD ET AL.: "Microsatellite instability and gene mutations in transforming growth factor-beta type II receptor are absent in small bowel carcinoid tumors", CANCER, vol. 103, no. 2, 2005, pages 229 - 36 |
| KIDDM: "Isolation, Purification and Functional Characterization of the Mastomys EC cell", AM J PHYSIOL, vol. 291, 2006, pages G778 - 91 |
| KINROSS JAMES M ET AL: "Metabonomic profiling: A novel approach in neuroendocrine neoplasias", SURGERY, vol. 154, no. 6, 1 December 2013 (2013-12-01), pages 1185 - 1193, XP028772106, ISSN: 0039-6060, DOI: 10.1016/J.SURG.2013.06.018 * |
| KOHAVI R.: "A study of cross-validation and bootstrap for accuracy estimation and model selection.", PROCEEDINGS OF THE FOURTEENTH INTERNATIONAL JOINT CONFERENCE ON ARTIFICIAL INTELLIGENCE, vol. 2, no. 12, 1995, pages 1137 - 43 |
| LAWLOR G; ROSENBERG L.; AHMED A ET AL.: "Increased Peripheral Blood GATA-3 Expression in Asymptomatic Patients With Active Ulcerative Colitis at Colonoscopy", GASTROENTEROLOGY, vol. 140, no. 1, 2011 |
| LILIEN RH; FARID H; DONALD BR: "Probabilistic disease classification of expression-dependent proteomic data from mass spectrometry of human serum.", J COMPUT BIOL, vol. 10, no. 6, 2003, pages 925 - 46, XP008039501, DOI: doi:10.1089/106652703322756159 |
| MARKEY MK ET AL.: "Perceptron error surface analysis: a case study in breast cancer diagnosis", COMPUT BIOL MED, vol. 32, no. 2, 2002, pages 99 - 109 |
| MATTFELDT T ET AL.: "Classification of prostatic carcinoma with artificial neural networks using comparative genomic hybridization and quantitative stereological data", PATHOL RES PRACT, vol. 199, no. 12, 2003, pages 773 - 84, XP004958803, DOI: doi:10.1078/0344-0338-00496 |
| MAZZAGLIA PJ: "Laparoscopic radiofrequency ablation of neuroendocrine liver metastases: a 10-year experience evaluating predictors of survival", SURGERY, vol. 142, no. 1, 2007, pages 10 - 9, XP022140312, DOI: doi:10.1016/j.surg.2007.01.036 |
| MICHIELS S; KOSCIEINY S; HILL C: "Interpretation of microarray data in cancer", BR J CANCER, vol. 96, no. 8, 2007, pages 1155 - 8 |
| MIMORI K ET AL.: "A large-scale study of MT1-MMP as a marker for isolated tumor cells in peripheral blood and bone marrow in gastric cancer cases", ANN SURG ONCOL, vol. 15, no. 10, 2008, pages 2934 - 42, XP019598234 |
| MODLIN EVI ET AL.: "The functional characterization of normal and neoplastic human enterochromaffin cells", CLIN ENDOCRINOL METAB, vol. 91, no. 6, 2006, pages 2340 - 8 |
| MODLIN I; DROZDOV I; KIDD M, PLOS ONE, 2013 |
| MODLIN I; DROZDOV I; KIDD M: "The Identification of gut neuroendocrine tumor disease by multiple synchronous transcript analysis in blood", PLOS ONE, 2013, pages E63364 |
| NOBLE WS: "What is a support vector machine?", NAT BIOTECHNO, vol. 24, no. 12, 2006, pages 1565 - 7 |
| NOBLE WS: "What is a support vector machine?", NAT BIOTECHNOL., vol. 24, no. 12, 2006, pages 1565 - 7 |
| PARKER; BARNES, METHODS IN MOLECULAR BIOLOGY, vol. 106, 1999, pages 247 - 283 |
| PENG H; LONG F; DING C: "Feature selection based on mutual information: criteria of max-dependency, max- relevance, and min-redundancy", IEEE TRANSACTIONS ON PATTERN ANALYSIS AND MACHINE INTELLIGENCE, vol. 27, no. 8, 2005, pages 1226 - 38, XP011135147, DOI: doi:10.1109/TPAMI.2005.159 |
| PICON A; GOLD LI; WANG J; COHEN A; FRIEDMAN E: "A subset of metastatic human colon cancers expresses elevated levels of transforming growth factor beta 1", CANCER EPIDEMIOL. BIOMARKERS PREV., vol. 7, no. 6, 1998, pages 497 - 504, XP009049280 |
| PIMA I; ALADJEM M.: "Regularized discriminant analysis for face recognition", PATTERN RECOGNITION, vol. 37, no. 9, 2003, pages 1945 - 48, XP085003470, DOI: doi:10.1016/j.patcog.2004.03.011 |
| PIMENTEL M; AMICHAI M; CHUA K; BRAHAM L: "Validating a New Genomic Test for Irritable Bowel Syndrome", GASTROENTEROLOGY, vol. 140, no. 1, 2011, pages S-798 |
| PIROOZNIA M ET AL.: "A comparative study of different machine learning methods on microarray gene expression data", BMC GENOMICS, vol. 9, no. 1, 2008, pages S13, XP021033171 |
| ROSS AA ET AL.: "Detection and viability of tumor cells in peripheral blood stem cell collections from breast cancer patients using immunocytochemica and clonogenic assay techniques", BLOOD, vol. 82, no. 9, 1993, pages 2605 - 10 |
| SCHIMMACK S ET AL: "The clinical implications and biologic relevance of neurofilament expression in gastroenteropancreatic neuroendocrine neoplasms", CANCER 20120515 JOHN WILEY AND SONS INC. USA, vol. 118, no. 10, 15 May 2012 (2012-05-15), pages 2763 - 2775, XP002751236, ISSN: 0008-543X * |
| SIEUWERTS AM ET AL.: "Molecular characterization of circulating tumor cells in large quantities of contaminating leukocytes by a multiplex real-time PCR", BREAST CANCER RES TREAT, vol. 118, no. 3, 2009, pages 455 - 68, XP019746596 |
| SIEUWERTS AM; KRAAN J; BOLT-DE VRIES J ET AL.: "Molecular characterization of circulating tumor cells in large quantities of contaminating leukocytes by a multiplex real-time PCR", BREAST CANCER RES TREAT, vol. 118, no. 3, 2009, pages 455 - 68, XP019746596 |
| T. E. GODFREY ET AL., MOLEC. DIAGNOSTICS, vol. 2, 2000, pages 84 - 91 |
| TANNAPFEL A; VOMSCHLOSS S; KARHOFF D ET AL.: "BRAF gene mutations are rare events in gastroenteropancreatic neuroendocrine tumors", AM J CLIN PATHOL, vol. 123, no. 2, 2005, pages 256 - 60 |
| URGARD E; VOODER T; VOSA U ET AL.: "Metagenes associated with survival in non-small cell lung cancer", CANCER INFORM., vol. 10, 2 June 2011 (2011-06-02), pages 175 - 83 |
| VAN EEDEN S ET AL.: "Classification of low-grade neuroendocrine tumors of midgut and unknown origin", HUM PATHOL, vol. 33, no. 11, 2002, pages 1126 - 32 |
| VANDEBRIEL RJ; VAN LOVEREN H; MEREDITH C: "Altered cytokine (receptor) mRNA expression as a tool in immunotoxicology", TOXICOLOGY, vol. 130, no. 1, 1998, pages 43 - 67 |
| VANDESOMPELE J; DE PREFER K; PATTYN F ET AL.: "Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes", GENOME BIOL, vol. 3, no. 7, 2002, XP021021149, DOI: doi:10.1186/gb-2002-3-7-research0034 |
| WEIS, TRENDS IN GENETICS, vol. 8, 1992, pages 263 - 264 |
| YU L ET AL.: "TGF-beta receptor- activated p38 MAP kinase mediates Smad-independent TGF-beta responses", EMBO J, vol. 21, no. 14, 2002, pages 3749 - 59 |
| ZAMPETAKI A; KIECHL S; DROZDOV 1 ET AL.: "Plasma microRNA profiling reveals loss ofen othelial miR-126 and other microRNAs in type 2 diabetes", CIRC RES, vol. 107, no. 6, 22 July 2010 (2010-07-22), pages 810 - 7 |
| ZHANG H ET AL.: "Recursive partitioning for tumor classification with gene expression microarray data.", PROC NATL ACAD SCI U SA, vol. 98, no. 12, 2001, pages 6730 - 5, XP002424447, DOI: doi:10.1073/pnas.111153698 |
| ZHANG H; SINGER B: "Statistics for Biology and Health", 1999, SPRINGER, article "Recursive Partitioning in the Health Sciences" |
| ZIKUSOKA MN; KIDD M; EICK G ET AL.: "Molecular genetics of gastroenteropancreatic neuroendocrine tumors", CANCER, vol. 104, 2005, pages 2292 - 309 |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111315897A (zh) * | 2017-05-25 | 2020-06-19 | 液体活检研究有限责任公司 | 用于黑素瘤检测的方法 |
| JP2020524524A (ja) * | 2017-05-25 | 2020-08-20 | リキッド バイオプシー リサーチ リミティド ライアビリティ カンパニー | 黒色腫の検出方法 |
| JP7227964B2 (ja) | 2017-05-25 | 2023-02-22 | リキッド バイオプシー リサーチ リミティド ライアビリティ カンパニー | 黒色腫の検出方法 |
| US11744907B2 (en) | 2017-11-30 | 2023-09-05 | Liquid Biopsy Research LLC | Predicting peptide receptor radiotherapy using a gene expression assay |
| WO2021072035A1 (en) | 2019-10-10 | 2021-04-15 | Liquid Biopsy Research LLC | Compositions, methods and kits for biological sample and rna stabilization |
| WO2024073652A1 (en) * | 2022-09-30 | 2024-04-04 | Liquid Biopsy Research LLC | Methods for neuroendocrine cancer detection in saliva |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12258633B2 (en) | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm | |
| US20230349000A1 (en) | Classification and prognosis of cancer | |
| AU2017204086B2 (en) | Predicting gastroenteropancreatic neuroendocrine neoplasms (GEP-NENs) | |
| HK40066027A (en) | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm | |
| HK40066027B (en) | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm | |
| HK1241416B (en) | Compositions, methods and kits for diagnosis of a gastroenteropancreatic neuroendocrine neoplasm | |
| BR112017005279B1 (pt) | Métodos para detectar um neoplasma neuroendócrino gastroenteropancreático (gep-nen), para diferenciar gep-nen estável de um gep-nen progressivo e para determinar uma resposta a uma terapia com radionucleotídeo para receptor de peptídeo de um gep-nen | |
| HK1193127A (en) | Evaluating response to therapy of gastroenteropancreatic neuroendocrine neoplasms (gep-nens) | |
| HK1193127B (en) | Evaluating response to therapy of gastroenteropancreatic neuroendocrine neoplasms (gep-nens) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15771837 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2959670 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 250867 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2017533744 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2017/003370 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2015317893 Country of ref document: AU Date of ref document: 20150915 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112017005279 Country of ref document: BR |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015771837 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2015771837 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20177010086 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112017005279 Country of ref document: BR Kind code of ref document: A2 Effective date: 20170315 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020257003150 Country of ref document: KR |