WO2016018090A1 - 혈관신생촉진용 펩타이드 및 이의 용도 - Google Patents

혈관신생촉진용 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2016018090A1
WO2016018090A1 PCT/KR2015/007968 KR2015007968W WO2016018090A1 WO 2016018090 A1 WO2016018090 A1 WO 2016018090A1 KR 2015007968 W KR2015007968 W KR 2015007968W WO 2016018090 A1 WO2016018090 A1 WO 2016018090A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
angiogenesis
composition
treatment
present
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2015/007968
Other languages
English (en)
French (fr)
Inventor
오억수
이유미
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of KNU
Original Assignee
Industry Academic Cooperation Foundation of KNU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of KNU filed Critical Industry Academic Cooperation Foundation of KNU
Publication of WO2016018090A1 publication Critical patent/WO2016018090A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10—Peptides having 12 to 20 amino acids

Definitions

  • the present invention provides a composition for promoting angiogenesis comprising a novel isolated peptide, a pharmaceutical composition for preventing or treating angiogenic dependent diseases comprising the peptide, a method for promoting angiogenesis comprising administering the peptide And it relates to a method of treating angiogenic dependent disease, comprising administering the pharmaceutical composition.
  • Angiogenesis refers to the process by which new blood vessels are formed, which rarely occurs in normal living conditions, but is an essential process in embryogenesis, corpus luteum formation or wound healing.
  • the angiogenesis process is generally caused by stimulation of angiogenesis factors, resulting in the formation of lumen due to the degradation of the basal membrane, proliferation, proliferation, and differentiation of vascular endothelial cells due to proteases. Consists of being generated.
  • Angiogenesis processes are known to be tightly controlled by several types of promoters and inhibitors, including growth factors, cytokines, lipid metabolites and latent fragments of hemostatic proteins.
  • angiogenesis treatment The treatment of angiogenesis using angiogenesis is called angiogenesis treatment.
  • Angiogenesis promoters such as vascular endothelial growth factor (VEGF) are used as treatments for severe ischemia, but the isolation and purification of these factors is difficult and expensive. Therefore, there is a difficulty in clinical application, and the development of new and more effective factors for the treatment of diseases in which symptoms may be improved by vascular tissue repair is continuously required.
  • VEGF vascular endothelial growth factor
  • the present inventors have made intensive efforts to develop an effective therapeutic agent for a disease requiring the generation of neovascularization, and as a result, 16 amino acid sequences separated by MMP-7 from the extracellular domain of syndecan-2 were produced.
  • the peptides increase the proliferation, mobility and angiogenic ability of vascular endothelial cells, and exhibit an angiogenic promoting effect, it was confirmed that it can be used for the treatment of diseases caused by the lack of neovascularization, and completed the present invention.
  • An object of the present invention is to provide an angiogenesis composition
  • an isolated peptide consisting of the amino acid sequence represented by SEQ ID NO: 1.
  • Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of angiogenic dependent diseases comprising the peptide.
  • Another object of the present invention is to provide a method for promoting angiogenesis, comprising administering the peptide to a subject in need of angiogenesis.
  • Still another object of the present invention is to provide a method for treating angiogenic dependent disease, comprising administering the pharmaceutical composition to a subject suspected of being an angiogenic dependent disease.
  • the angiogenic composition comprising the isolated peptide of the present invention increases the ability of neovascularization by increasing the proliferation, mobility, and the like of vascular endothelial cells to treat diseases caused by a lack of neovascularization such as wound healing, ischemic diseases, infertility, and the like. It can be usefully used.
  • FIG. 1 shows a sequence of a Cindecan-2 peptide consisting of 16 amino acid sequences constructed from some amino acid sequences of a portion cleaved by MMP-7 in the extracellular domain of Cindecan-2.
  • FIG. 2 is a graph showing the increase in the growth of vascular endothelial cells in a concentration-dependent manner when treated with Sindecane-2 peptide.
  • Figure 3 shows that the movement of the vascular endothelial cells when treated with the syndecan-2 peptide by taking a picture of the degree of movement of the cells under a microscope using a transwell analysis.
  • Syndecane-2 peptide is indicated as SDC2 in the figures.
  • 4 is a graph showing the number of cells treated and treated with the dedecane-2 peptide.
  • Figure 5 is a photograph showing the degree of angiogenesis after treatment with the synthecan-2 peptide under a microscope. VEGF was used as a positive control.
  • FIG. 6 is a graph showing the treatment of the syndecan-2 peptide and measuring the length of the blood vessel formed. VEGF was used as a positive control.
  • Figure 7 shows by observing through the microscope the appearance of microvascularization when treated with syndecane-2 in vivo .
  • Figure 8 is a graph showing the measurement of the number of micro-vascular generated when treated with indecane-2 in vivo .
  • FIG. 9 is an image of Western blot results of analyzing expression of vascular endothelial protein.
  • Figure 9a shows the increase in tyrosine phosphorylation of the proteins when treated with the dedecane-2 peptide, Western blot
  • Figure 9b shows VEGFR, PI3K, Akt and JNK when treated with the dedecane-2 peptide Phosphorylation was increased by Western blot
  • Figure 9c shows that the expression level of ⁇ v ⁇ 4 integrin was increased by comparing the expression level of integrin after the treatment of syndecan-2 peptide.
  • FIG. 10 is an image of a western blot result of analyzing protein expression of cancer cells.
  • Figure 10a shows that the expression of HIF-1 and the phosphorylation of Akt308 increased as the treatment concentration increased when the HCT116 cell line treated with the dedecane-2
  • Figure 10b shows the HCT116 cell line
  • the increase in HIF-1 expression and phosphorylation of Akt308 when treated with 5 nM of the Sindecane-2 peptide was shown by Western blot.
  • FIG. 10C shows that HIF- was treated when 5 nM of the dec29-2 peptide line was treated with Sindecane-2 peptide.
  • 1 Expression of protein, increased phosphorylation of Akt308 and Akt473 is shown by Western blot.
  • FIG. 11 is an image of RT-PCR results confirming the increase in VEGF gene expression by synthecan-2 peptide treatment.
  • FIG. Figure 11a shows the amount of VEGF mRNA after 24 hours treatment with 5nM of the decane-2 peptide in the HCT116 cell line through RT-PCR
  • Figure 11b is 5nM of the dec29- in the HT29 cell line After 24 hours of treatment with 2 peptides, the amount of VEGF mRNA was confirmed by RT-PCR.
  • 12 is an image of the result of confirming the state of HIF-1 protein by synthecan-2 peptide treatment in a hypoxic state (5% O 2 ).
  • 12 a shows the amount of HIF-1 protein expression in the HT29 cell line through Western blot
  • FIG. 12 b shows the immunoprecipitation of ubiquitination of the HIF-1 protein in the HT29 cell line. ) Is shown through the assay.
  • angiogenesis composition comprising an isolated peptide, consisting of an amino acid sequence represented by SEQ ID NO: 1 as an aspect.
  • Amino acid sequences used in the present invention are abbreviated as follows according to the IUPAC-IUB nomenclature.
  • Protein or isolated peptide of the present invention refers to a peptide having angiogenic activity.
  • the peptide is a peptide comprising an amino acid sequence represented by SEQ ID NO: 1 may be specifically composed of 16 amino acids, but is not limited thereto.
  • the peptide comprising the amino acid of SEQ ID NO: 1 is added or removed at the terminal portion of the sequence, as long as it exhibits angiogenic activity, or even if some amino acids of the sequence is mutated in the scope of the present invention Inclusion is self-evident.
  • the peptide comprising the amino acid sequence of SEQ ID NO: 1 is an amino acid sequence 90% or more, specifically 96%, more specifically 98% or more, even more specifically 99% or more identical to the sequence, and promote angiogenesis Peptides with activity are also included within the scope of the present invention.
  • the peptide of the present invention may be protected from protein cleavage enzymes in vivo, and its N-terminus and / or C-terminus may be chemically modified or protected with an organic terminus, or amino acids may be added to the peptide terminus. It may be in a modified form.
  • acetylation of the N-terminus and / or amidation of the C-terminus are performed to remove such charges. It may be, but is not particularly limited thereto.
  • the peptides of the present invention can be synthesized by methods well known in the art, for example by automated peptide synthesizers, depending on their length, and can also be produced by genetic engineering techniques. For example, through genetic engineering, a fusion gene encoding a fusion protein, comprising a fusion partner and a peptide of the present invention, is prepared and transformed into a host cell, and then expressed in the form of a fusion protein, a protease or compound The peptide of the present invention may be cleaved and separated from the fusion protein to produce a desired peptide.
  • a protease such as Factor Xa or enterokinase
  • a compound such as CNBr or hydroxylamine
  • the peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 is prepared based on the sequence of syndecane-2.
  • Syndecan-2 protein is a cell binding receptor present on the cell surface and is a transmembrane heparan-sulfate proteoglycan.
  • syndecane-2 it has been reported that it can be used for diagnosing bowel cancer by quantitatively analyzing the methylation of the syndecane-2 gene (Korean Patent No. 1,145,406), but a specific site thereof, in particular SEQ ID NO: 1 Peptide sites comprising the amino acid sequence of have not yet been associated with angiogenesis.
  • the syndecan-2 gene and protein information may be obtained from a known database such as the National Center for Biotechnology Information (NCBI), for example, NM_002998 and NP_002989 registered with the NCBI, but one mutated sequence having the activity thereof may be used. It can include without limitation.
  • NCBI National Center for Biotechnology Information
  • angiogenesis refers to any phenomenon in which blood vessels are newly formed as new blood vessels are formed.
  • cells constituting existing blood vessels proliferate and migrate to form new blood vessels. It may refer to a phenomenon, and may include a phenomenon in which blood vessels are newly generated by progenitor cells that make blood vessels.
  • angiogenesis promotion means to promote angiogenesis such that the production of blood vessels such as capillaries can be made in a faster time and / or more blood vessels.
  • blood vessels such as capillaries
  • the formation and growth of the fetus, the formation of organs, and the healing of wounds are essential for the formation of blood vessels and the circulation of blood. Can be.
  • the isolated syndecane-2 peptide for angiogenesis promotion of the present invention may be characterized by increasing the proliferative capacity of vascular endothelial cells, the ability of vascular endothelial cells to move, angiogenesis and angiogenesis.
  • vascular endothelial cells increased depending on the concentration when treated with the isolated Shindecan-2 peptide (Fig. 2), also through the transwell movement analysis of vascular endothelial cells It was confirmed that the increase (Fig. 3 and 4). From this, it can be seen that the level similar to the proliferation and migration of vascular endothelial cells induced by VEGF treated with a positive control. In addition, as shown in FIG. 5 and FIG. 6, it was confirmed that angiogenesis of vascular endothelial cells was increased by the syndecan-2 peptide.
  • the composition of the present invention comprising the syndecane-2 peptide may be a composition for promoting angiogenesis, and in particular, may be a composition for preparing blood vessels for skin plate regeneration, wound and burn treatment, artificial skin transplantation and transplantation, but is not limited thereto. It is not.
  • skin plate regeneration, wound and burn treatment, artificial skin transplantation and implantation of blood vessels to induce the formation of tissues the smooth supply of blood is essential, promoting the angiogenesis using the peptide of the present invention to increase the effect Can be.
  • compositions for the prevention or treatment of angiogenic dependent diseases comprising the isolated peptide.
  • the angiogenesis-dependent disease refers to a disease that occurs or worsens due to inability to supply blood or oxygen due to abnormal blood vessels caused by various causes, and specifically refers to a disease requiring angiogenesis, but is not limited thereto.
  • one or more days selected from the group consisting of ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, pressure sores, alopecia, acute posterior limb ischemia and cerebrovascular dementia May be, but is not limited thereto.
  • Ischemia, ischemic stroke, atherosclerosis, myocardial infarction, and angina are caused by blockage or narrowing of blood vessels, which can lead to disorders of body tissues and organs if oxygen and nutrients are not properly supplied through blood vessels.
  • this vascular dysfunction occurs in the heart muscle, the heart stops and myocardial infarction, angina pectoris, etc. occurs in the hands or the tip of the foot, ischemic retardation disease, and when it occurs in the brain, ischemic stroke, cerebrovascular dementia, etc. Can be.
  • Ischemic heart failure and acute posterior limb ischemia can also be caused by lack of oxygen due to inadequate blood supply due to blockage or narrowing of the ducts.
  • Diabetic foot ulcers are the most common complications of diabetes and are caused by high blood sugar levels in the blood vessels of diabetic patients.
  • the cure of such a disease depends on the formation of new connective tissue and epithelial tissue by cell proliferation, and it is effective to promote or stimulate the proliferation and differentiation of cells.
  • pressure sores are also called pressure ulcers, and vascular ulcers are caused by dying tissues due to constant or repeated pressure applied to any part of the body. Can be.
  • infertility may be caused by poor blood circulation in the uterus and blood circulation in the capillaries, resulting in poor conception of fertilized eggs. It can be cured.
  • hair loss refers to an abnormally high number of hair dropouts, and may occur when blood supply is insufficient.
  • One of the methods of treating hair loss is a method of promoting blood circulation through the expansion of capillaries, and by promoting the angiogenesis using the peptide of the present invention can prevent or treat hair loss or promote hair growth.
  • the diseases may be alleviated or ameliorated by a method such as transplanting blood vessels or angiogenesis by bypassing blood vessels, and the disease may be caused by angiogenesis or transplantation of blood vessels through a pharmaceutical composition comprising the peptide of the present invention. Improve or heal them.
  • the pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier.
  • the term "pharmaceutically acceptable carrier” may refer to a carrier or diluent that does not interfere with the biological activity and properties of the compound to be injected without stimulating the organism.
  • the kind of the carrier usable in the present invention is not particularly limited, and any carrier can be used as long as it is a conventionally used and pharmaceutically acceptable carrier in the art.
  • Non-limiting examples of the carrier include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol and the like. These may be used alone or in combination of two or more thereof.
  • the carrier may include a non-naturally occuring carrier.
  • composition comprising a pharmaceutically acceptable carrier may be in various oral or parenteral formulations. When formulated, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used.
  • Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, which form at least one excipient such as starch, calcium carbonate, sucrose or lactose (at least one compound). lactose), gelatin and the like can be mixed.
  • lubricants such as magnesium stearate, talc and the like can also be used.
  • Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, and syrups, and various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • the non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable esterol such as ethyl oleate, and the like can be used.
  • the pharmaceutical composition is any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquid solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories. It can have one formulation.
  • composition of the present invention may be administered in a pharmaceutically effective amount.
  • the term "pharmaceutically effective amount” refers to an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level refers to an individual's type and severity, age, sex, activity of the drug. , Drug sensitivity, time of administration, route of administration and rate of release, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical arts.
  • Preventive agent for angiogenic dependent diseases such as ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, pressure sores, alopecia, acute posterior limb ischemia or cerebrovascular dementia or
  • the therapeutic agent may be administered daily or intermittently, and the number of administrations per day may be administered once or divided into two or three times.
  • the compositions of the present invention can be used alone or in combination with other drug treatments for the prevention or treatment of angiogenic dependent diseases. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.
  • a method for promoting angiogenesis comprising administering the angiogenic composition to a site in need of angiogenesis.
  • the term "individual” means all animals including humans in need of angiogenesis, and the angiogenesis composition may be administered to an individual to promote angiogenesis.
  • the subject means an entire mammal including a dog, cow, horse, rabbit, mouse, rat, chicken or human, but the mammal of the present invention is not limited to the above examples. Specifically, the subject may be an individual except a human.
  • the isolated syndecane-2 peptide of the present invention exhibited an effect of promoting angiogenesis even in vivo (FIGS. 7 and 8), and promoting angiogenesis including the peptide.
  • the composition can be administered to promote angiogenesis.
  • Another aspect of the present invention provides a method for treating angiogenic dependent disease, comprising administering the pharmaceutical composition for preventing or treating angiogenic dependent disease to a subject suspected of being angiogenic dependent disease.
  • the term “individual” means all animals including humans in need of preventing or treating angiogenic dependent diseases, and the disease can be effectively prevented and treated by administering the pharmaceutical composition.
  • the subject means an entire mammal including a dog, cow, horse, rabbit, mouse, rat, chicken or human, but the mammal of the present invention is not limited to the above examples. Specifically, the subject may be an individual except a human.
  • the route of administration of the pharmaceutical composition may be administered via any general route as long as it can reach the target tissue.
  • the composition of the present invention may be administered parenterally, intraperitoneally, intravenously, subcutaneously, subcutaneously, or orally, as desired.
  • the composition may also be administered by any device in which the active agent may migrate to the target cell. Frequency of administration is as described above.
  • the angiogenic dependent disease is a group consisting of ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, pressure sores, hair loss, acute posterior limb ischemia and cerebrovascular dementia It may be at least one selected from.
  • Residues 79-94 (named hS2LQ: LTSAAPKVETTTLNIQ; SEQ ID NO: 1) of syndecan-2, a peptide consisting of 16 amino acid sequences in the syndecan-2 extracellular domain, were constructed.
  • scrambled peptides for hS2LQ (Scr: IPNTSVKTLTAQLAET; SEQ ID NO: 2) as a control were synthesized using an improved version of the solid-phase method using Fmoc chemistry (Anygen Inc., Gwangju, Korea) (FIG. 1). .
  • Human umbilical vein endothelial cells isolated from human umbilical cord (HUVEC) in 1% gelatin coated dish 20% FBS, 1% penicillin / streptomycin, 5 unit / Incubated in a 37 ° C. thermostat with 5% carbon dioxide using M199 (Hyclone, Logan) medium containing ml Heparin and 2 ng / ml basic-fibroblast growth factor (bFGF).
  • M199 Hyclone, Logan
  • bFGF basic-fibroblast growth factor
  • Colon cancer cell lines HCT116 and HT29 cells were cultured in a 37 ° C thermostat with 5% carbon dioxide using McCoy 5A medium (Welgene, Seoul, Korea) containing 10% FBS, 1% penicillin / streptomycin.
  • vascular endothelial cells were dispensed in a 96-well plate coated with 1% gelatin, 20% FBS, 1 After culturing for about 24 hours in M199 medium containing% penicillin / streptomycin, 5 unit / ml heparin, and 2 ng / ml bFGF, it was changed to low serum medium (M199 medium containing 0.5% FBS) and incubated for 16 hours. The effect of growth factors was removed.
  • VEGF vascular endothelial growth factor
  • the proliferative capacity of vascular endothelial cells was increased when treated with the dedecane-2 peptide, and the proliferative capacity was increased to 5 nM or more.
  • the effect of syndecan-2 peptide on the motility of vascular endothelial cells was observed using a transwell migration assay.
  • a 24-well transwell (Costar, 8 ⁇ m pore size) was coated with type I collagen (0.5 mg / ml) and used after drying for 1 hour at room temperature.
  • a 10 nM synthecan-2 peptide-treated medium was placed and the chamber was incubated for 24 hours with the same number of vascular endothelial cells along with a medium without FBS, and the number of cells passing through the membrane was counted.
  • 20 ng / ml VEGF was treated as a positive control.
  • the separated cells were fixed with methanol for 1 minute, stained with hematoxylin for 10 minutes, and eosin for 4 minutes, and the cells on the unmoved membrane were removed with a cotton swab and balsam on slide glass.
  • the membranes were fixed by staining and the stained cells were checked under a microscope. And counting the number of cells moved to the graph.
  • the effect of the syndecan-2 peptide on the vascular endothelial ability of vascular endothelial cells was observed using a tube formation assay. Specifically, 60 ⁇ l of Matrigel (Matrigel, BD) was laid on a 96-well plate, and then gelled at 37 ° C. for 30 minutes. After culturing the vascular endothelial cells in a medium treated with 10 nM syndecane-2 peptide 8 hours later, tube formation was confirmed under a microscope. Medium treated with 20 ng / ml VEGF was used as a positive control. In addition, the length of the formed tube was measured and graphed.
  • Matrigel Matrigel
  • CAM deposit chorioallantoic membrane
  • the purchased fertilized egg was raised for 3 days while maintaining a saturation humidity of 90% in an incubator at 37 °C, after removing about 3 ml of albumin using a syringe, the egg shell was broken and a window of a certain size was identified, and confirmed as a fertilized egg Only one was sealed with glass tape.
  • 10 nM of syndecan-2 peptide was applied to the Thermanox cover slip, dried, placed on the CAM site, sealed with tape, and incubated for 3 days.
  • PMA phorobol 12-myristate 13-acetate
  • the protein changes in vascular endothelial cells were analyzed by Western blot after treatment with synthecan-2 peptide. Specifically, after treatment with 10 nM syndecan-2 peptide to vascular endothelial cells, cells were recovered after 24 hours, lysed cells using RIPA buffer, and protein phosphorylation and expression changes were confirmed by Western blot. The negative control was observed by treating the scrambled peptide (Scr).
  • VEGF receptors VAGFR
  • PI3K phosphoinositide 3-kinase
  • AKT phosphoinositide 3-kinase
  • JNK c-JUN N-terminal kinase
  • Primary antibodies include anti-phosphorylated VEGF receptor (hosphor-VEGFR) antibodies, anti-phosphorylated phosphoinositide 3-kinase (hosphor-PI3K) antibodies, anti-phosphorylated hosphor-AKT (AKT) antibodies, anti-phosphorylated Erk (hosphor-Erk) , Anti-phosphorylated p38 (hosphor-p38) and anti-phosphorylated c-JUN N-terminal kinase (hosphor-JNK) antibodies were reacted for 16 hours.
  • the primary antibodies were purchased from Cell Signaling (Cell Signaling, Danvers, MA, USA) and reacted at a concentration of 0.2 ⁇ g / ml.
  • integrin one of the adhesion receptors known to increase expression when angiogenesis was increased through Western blot.
  • the primary antibody was reacted for 16 hours with anti- ⁇ v antibody, anti- ⁇ 5 antibody, anti- ⁇ 6 antibody, anti- ⁇ 1 antibody, anti- ⁇ 3 antibody and anti- ⁇ 4 antibody.
  • the primary antibodies were purchased from Cell Signaling (Cell Signaling, Danvers, MA, USA) and reacted at a concentration of 0.2 ⁇ g / ml. Then, the solution was washed with TBST solution and reacted for 16 hours using HRP-coupled goat anti-rabbit IgG antibody (AbClon, Seoul, Korea / 0.1 ⁇ g / ml) as a secondary antibody.
  • neovascularization increases the expression of various genes by increasing the transcription factor of HIF (hypoxia inducible factor) due to the hypoxic state in the tissue by cancer cells and binding to the HRE (hypoxia response element), the promoter region of the VEGF gene. Stabilized. The resulting VEGF promotes cell growth and migration specific to vascular endothelial cells and increases vascular permeability.
  • HIF hypooxia inducible factor
  • HCT116 cells were treated at various concentrations and time periods in HCT116 cells, which are colorectal cancer cell lines, and HIF-1 expression levels were compared.
  • HT29 cells which are other colorectal cancer cell lines, were treated with 5 nM of Sindecan-2 peptide for 24 hours, and then Western blot was used to analyze protein expression changes.
  • anti-HIF-1 antibodies (BD science, San Jose, California, USA / 0.2 ⁇ g / ml), anti-phosphorylated Akt 308 antibody and anti-phosphorylated Akt 473 antibody (Cell Signaling (Danvers, MA, USA) / 0.2 ⁇ g / ml) after 16 hours, washed with TBST solution, 16 hours using goat anti-mouse IgG antibody (AbClon, Seoul, Korea / 0.1 ⁇ g / ml) bound to HRP as a secondary antibody Reacted for a while.
  • Anti-HIF-1 antibodies BD science, San Jose, California, USA / 0.2 ⁇ g / ml
  • anti-phosphorylated Akt 308 antibody and anti-phosphorylated Akt 473 antibody Cell Signaling (Danvers, MA, USA) / 0.2 ⁇ g / ml) after 16 hours, washed with TBST solution, 16 hours using goat anti-mouse IgG antibody (AbClon, Seoul, Korea
  • HIF-1 expression and phosphorylation of Akt 308 at 6, 15 and 24 hours after treatment with 5 nM of the Sindecan-2 peptide were compared to the case of treatment with scrambled peptide, a negative control. Expression of -1 protein was significantly increased, and it was confirmed that phosphorylation of Akt 308 was significantly increased (FIG. 10B).
  • RT-PCR confirmed the amount of VEGF mRNA in cancer cells.
  • a PCR composition comprising a reaction buffer (ELPiS, Korea), 1 mM dNTP (ELPiS, Korea), 1 Unit Taq polymerase (ELPiS, Korea), 0.5 pmole primer (Cosmogenetech, Korea) and 1.5 ⁇ g cDNA
  • reaction buffer ELPiS, Korea
  • 1 mM dNTP ELPiS, Korea
  • Unit Taq polymerase ELPiS, Korea
  • 0.5 pmole primer Cosmogenetech, Korea
  • 1.5 ⁇ g cDNA After the reaction for 5 minutes at 94 °C (initial denaturation), 30 seconds of denaturation at 94 °C, annealing at 54 °C 30 seconds, extension 30 seconds at 72 °C was 25 cycles.
  • primer sequences used are summarized in Table 1 below.
  • VEGF mRNA As described above, the amount of VEGF mRNA was confirmed after 24 hours treatment of 5 nM syndecan-2 peptide to HCT116 and HT29 colorectal cancer cell lines, indicating that the amount of VEGF mRNA was increased in both cell lines (FIG. 11). b) of a and 11;
  • the colon cancer cell line HT-29 was incubated in a serum-free medium for 12 hours, and then treated with 5% O 2 to establish a hypoxic condition.
  • the HIF-1 stabilizing effect of the syndecan-2 peptide was confirmed by Western blot, and the effect of the syndecane-2 peptide on the HIF-1 ubiquitination was confirmed by an immunoprecipitation assay.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 신규한 분리된 펩타이드를 포함하는 혈관신생촉진용 조성물, 상기 펩타이드를 포함하는 혈관신생 의존성 질환의 예방 또는 치료용 약학적 조성물, 상기 펩타이드를 투여하는 단계를 포함하는 혈관신생을 촉진하는 방법 및 상기 약학적 조성물을 투여하는 단계를 포함하는, 혈관신생 의존성 질환의 치료방법에 관한 것이다.

Description

혈관신생촉진용 펩타이드 및 이의 용도
본 발명은 신규한 분리된 펩타이드를 포함하는 혈관신생촉진용 조성물, 상기 펩타이드를 포함하는 혈관신생 의존성 질환의 예방 또는 치료용 약학적 조성물, 상기 펩타이드를 투여하는 단계를 포함하는 혈관신생을 촉진하는 방법 및 상기 약학적 조성물을 투여하는 단계를 포함하는, 혈관신생 의존성 질환의 치료방법에 관한 것이다.
혈관신생(angiogenesis)이란 새로운 혈관이 생성되는 과정을 말하며, 정상적인 생체 조건에서는 드물게 일어나지만, 배발생, 황체 형성 또는 상처치료 과정에서는 반드시 수반되는 과정이다. 혈관신생이 일어나는 과정은 일반적으로 혈관신생 촉진인자의 자극에 의하여 프로테아제로 인한 혈관 기저막의 분해, 혈관 내피세포의 이동, 증식 및 혈관 내피세포 분화에 의한 관강의 형성으로 혈관이 재구성되어 새로운 모세혈관이 생성되는 것으로 이루어진다. 혈관생성 과정은 생장인자, 사이토카인, 지질대사물질 및 지혈 단백질의 잠재성 단편 등 여러 종류의 촉진인자와 억제인자에 의해 엄격하게 통제되는 것으로 알려져 있다.
발생 및 상처 치유, 기관 형성에 중요한 과정인 혈관 생성이 제대로 일어나지 않을 경우 심각한 질환이 발생하게 된다. 예를 들어, 발생단계에서 혈관 형성이 되지 않을 경우 태반의 미발달을 초래하여 유산의 원인이 될 수 있으며, 조직의 궤양 및 허혈의 발생이 기관의 기능 이상을 유발시키고 더 나아가 사망에 이르게 한다. 최근 식생활의 변화, 영양 상태의 개선과 노년 인구의 증가에 따라 동맥경화, 심근경색 및 협심증, 뇌경색, 급성사지허혈과 같은 다양한 심혈관계 질환이 성인 사망률의 수위를 차지하는 심각한 질환으로 대두되고 있으나 뚜렷한 치료법이 정립되지 않은 상태이며, 이러한 허혈성 질환을 치료하기 위해 신생혈관형성을 유도하는 방법 또는 촉진하는 새로운 치료법 및 인자의 개발이 주목을 받고 있다(김덕경 et al, 대한내분비학회, 16(3), 328-338, 2001).
혈관신생을 이용한 생체 질환의 치료를 혈관신생 치료라 하며, 혈관내피 성장인자(VEGF)와 같은 혈관신생 촉진인자가 중증의 국소 빈혈을 위한 치료제로 사용되고 있으나, 상기 인자들의 분리·정제가 어려우며, 고가이므로 임상 적용에 어려움이 있으며, 혈관성 조직 복구에 의해 증상이 개선될 수 있는 질환의 치료를 위해 보다 효과적이고 새로운 인자들의 발굴이 지속적으로 요구되고 있는 실정이다.
본 발명자들은 신생혈관의 생성을 필요로 하는 질환에 대한 효과적인 치료제의 개발을 위하여 예의 노력한 결과, 신데칸-2의 세포외 도메인 중 MMP-7에 의해 절단되어 제작된 16개의 아미노산 서열로 이루어진 분리된 펩타이드가 혈관내피세포의 증식, 이동성 및 혈관형성능을 증가시키고, 혈관신생 촉진효과를 나타내는 것을 확인함으로써 이를 신생혈관의 부족으로 인한 질환 치료를 위해 사용할 수 있음을 확인하고, 본 발명을 완성하게 되었다.
본 발명의 목적은 서열번호 1로 표시되는 아미노산 서열로 이루어진, 분리된 펩타이드를 포함하는 혈관신생촉진용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 펩타이드를 포함하는 혈관신생 의존성 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 혈관신생이 필요한 개체에 상기 펩타이드를 투여하는 단계를 포함하는, 혈관신생을 촉진하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 약학적 조성물을 혈관신생 의존성 질환인 것으로 의심되는 개체에 투여하는 단계를 포함하는, 혈관신생 의존성 질환의 치료방법을 제공하는 것이다.
본 발명의 분리된 펩타이드를 포함하는 혈관신생촉진용 조성물은 혈관내피세포의 증식, 이동성 등을 증가시킴으로써 신생혈관의 형성능을 증가시킴으로써 상처치유, 허혈성 질환, 불임 등과 같은 신생혈관의 부족으로 인한 질환 치료에 유용하게 사용될 수 있다.
도 1은 신데칸-2 의 세포외 도메인 중 MMP-7에 의해 절단된 부분의 일부 아미노산 서열로 제작된 16개의 아미노산 서열로 이루어진 신데칸-2 펩타이드의 서열을 나타낸 것이다.
도 2는 신데칸-2 펩타이드를 처리하였을 때, 농도의존적으로 혈관내피세포의 증식이 증가하는 것을 그래프로 나타낸 것이다.
도 3은 신데칸-2 펩타이드를 처리하였을 때 혈관내피세포의 이동이 증가한 것을 트랜스웰이동분석을 이용하여 현미경으로 세포의 이동 정도를 촬영하여 나타낸 것이다. 신데칸-2 펩타이드는 도면 내에 SDC2로 표기하였다.
도 4는 신데칸-2 펩타이드를 처리하고, 이동한 세포의 수를 세어 그래프로 나타낸 것이다.
도 5는 신데칸-2 펩타이드를 처리한 후 혈관형성 정도를 현미경으로 관찰하여 나타낸 사진이다. VEGF는 양성 대조군으로 사용하였다.
도 6은 신데칸-2 펩타이드를 처리하고, 형성된 혈관의 길이를 측정하여 그래프로 나타낸 것이다. VEGF는 양성 대조군으로 사용하였다.
도 7은 in vivo에서 신데칸-2를 처리하였을 때 미세혈관의 신생이 나타나는 것을 현미경을 통해 관찰하여 나타낸 것이다.
도 8은 in vivo에서 신데칸-2를 처리하였을 때 생성된 미세혈관의 수를 측정하여 그래프로 나타낸 것이다.
도 9는 혈관내피세포 내부 단백질의 발현을 분석한 웨스턴블롯(Western blot) 결과의 이미지이다. 도 9의 a는 신데칸-2 펩타이드를 처리하였을 때 단백질들의 타이로신 인산화가 증가하는 것을 웨스턴블롯을 통해 나타낸 것이고, 도 9의 b는 신데칸-2 펩타이드를 처리하였을 때 VEGFR, PI3K, Akt 및 JNK의 인산화가 증가한 것을 웨스턴블롯을 통해 나타낸 것이고, 도 9의 c는 신데칸-2 펩타이드 처리후 인테그린의 발현 정도를 비교하여, αvβ4 인테그린의 발현이 증가된 것을 확인한 것이다.
도 10은 암세포의 단백질 발현을 분석한 웨스턴블롯(western blot) 결과의 이미지이다. 도 10의 a는 HCT116 세포주에 신데칸-2를 처리하였을 때 처리 농도가 증가함에 따라 HIF-1의 발현 및 Akt308 의 인산화가 증가한 것을 웨스턴블롯을 통해 나타낸 것이고, 도 10의 b는 HCT116 세포주에, 5nM의 신데칸-2 펩타이드를 처리하였을 때 HIF-1 발현 및 Akt308의 인산화가 증가한 것을 웨스턴블롯을 통해 나타낸 것이고, 도 10의 c는 HT29 세포주에 신데칸-2 펩타이드 5nM을 처리하였을 때, HIF-1 단백질의 발현, Akt308 및 Akt473의 인산화가 증가한 것을 웨스턴블롯을 통해 나타낸 것이다.
도 11은 신데칸-2 펩타이드 처리에 의한 VEGF 유전자 발현 증가를 확인한 RT-PCR 결과의 이미지이다. 도 11의 a는 HCT116 세포주에 5nM의 신데칸-2 펩타이드를 24시간 동안 처리한 후 VEGF mRNA의 양을 RT-PCR을 통해 확인하여 나타낸 것이고, 도 11의 b는 HT29 세포주에 5nM의 신데칸-2 펩타이드를 24시간 동안 처리한 후 VEGF mRNA의 양을 RT-PCR을 통해 확인하여 나타낸 것이다.
도 12는 저산소 상태(5% O2)에서 신데칸-2 펩타이드 처리에 의한 HIF-1 단백질의 상태를 확인한 결과의 이미지이다. 도 12의 a는 HT29 세포주에서의 HIF-1 단백질 발현양을 웨스턴블롯을 통해 확인하여 나타낸 것이고, 도 12의 b는 HT29 세포주에의 HIF-1 단백질의 유비퀴틴화(ubiquitination)를 면역침강반응(immunoprecipitation) 어세이를 통해 확인하여 나타낸 것이다.
상기 목적을 달성하기 위하여 본 발명은 하나의 양태로서, 서열번호 1로 표시되는 아미노산 서열로 이루어진, 분리된 펩타이드를 포함하는 혈관신생촉진용 조성물을 제공한다.
본 발명에서 사용된 아미노산 서열은 IUPAC-IUB 명명법에 따라 다음과 같이 약어로 기재하였다.
알라닌 A 아르기닌 R
아스파라긴 N 아스파르트산 D
시스테인 C 글루탐산 E
글루타민 Q 글리신 G
히스티딘 H 이소루신 I
루신 L 라이신 K
메티오닌 M 페닐알라닌 F
프롤린 P 세린 S
트레오닌 T 트립토판 W
티로신 Y 발린 V
본 발명의 “펩타이드 또는 분리된 펩타이드”는 혈관신생촉진 활성을 가지는 펩타이드를 말한다.
본 발명에서 상기 펩타이드는 서열번호 1로 표시되는 아미노산 서열을 포함하는 펩타이드로서 구체적으로는 16개의 아미노산으로 구성된 것일 수 있으나 이에 제한되지 않는다.
또한, 상기 서열번호 1의 아미노산을 포함하는 펩타이드는 혈관신생 촉진 활성을 나타내는 한 상기 서열의 말단 부위에서 하나 이상의 아미노산이 첨가 또는 제거되거나, 상기 서열의 일부 아미노산이 변이된 경우도 본 발명의 범위에 포함됨은 자명하다. 특히, 서열번호 1의 아미노산 서열을 포함하는 펩타이드는 상기 서열과 90% 이상, 구체적으로는 96%, 더욱 구체적으로는 98% 이상, 보다 더 구체적으로는 99% 이상 동일한 아미노산 서열로서, 혈관신생촉진 활성을 가지는 펩타이드 역시 본 발명의 범주에 포함된다.
본 발명의 펩타이드는, 생체 내의 단백질 절단 효소들로부터 보호하고 안정성을 증가시키기 위하여 이의 N-말단 또는/및 C-말단 등이 화학적으로 수식되거나 유기단으로 보호되거나, 또는 펩타이드 말단 등에 아미노산이 추가되어 변형된 형태일 수 있다. 특히, 화학적으로 합성한 펩타이드의 경우, N- 및 C-말단이 전하를 띠고 있기 때문에, 이러한 전하를 제거하기 위하여 N-말단을 아세틸화(acetylation) 또는/및 C-말단을 아미드화(amidation)할 수 있으나, 특별히 이에 제한되지는 않는다.
본 발명의 펩타이드는 그 길이에 따라 이 분야에서 잘 알려진 방법, 예를 들어 자동 펩타이드 합성기에 의해 합성할 수 있으며, 유전자 조작 기술에 의하여 생산할 수도 있다. 예를 들어 유전자 조작을 통하여, 융합파트너 및 본 발명의 펩타이드를 포함하는, 융합 단백질을 코딩하는 융합 유전자를 제조하고 이를 숙주 세포에 형질전환시킨 후, 융합 단백질 형태로 발현하고, 단백질 분해효소 또는 화합물을 이용하여 융합 단백질로부터 본 발명의 펩타이드를 절단, 분리하여 원하는 펩타이드를 생산할 수 있다. 이를 위하여 예를 들어 Factor Xa나 엔테로키나제와 같은 단백질 분해효소, CNBr 또는 하이드록실아민과 같은 화합물에 의해 절단될 수 있는 아미노산 잔기를 코딩하는 DNA 서열을 융합파트너와 본 발명의 펩타이드를 코딩하는 폴리뉴클레오티드 사이에 삽입할 수 있다.
본 발명의 일 양태에 따르면, 상기 서열번호 1로 표시되는 아미노산 서열로 구성되는 펩타이드는 신데칸-2의 서열에 기초하여 제작된 것이다.
본 발명에서 용어, “신데칸-2(Syndecan-2)” 단백질은 세포 표면에 존재하는 세포결합 수용체로, 막횡단 헤파란-설페이트 프로테오글리칸이다. 신데칸-2 의 용도와 관련하여, 신데칸-2 유전자의 메틸화를 정량 분석하여 장암 진단 용도로 사용될 수 있음이 보고된 바 있으나(한국등록특허 제1,145,406호), 이의 특정 부위, 특히 서열번호 1의 아미노산 서열을 포함하는 펩타이드 부위가 혈관신생과 관련되어 있음은 아직 밝혀진바 없다.
상기 신데칸-2 유전자 및 단백질 정보는 NCBI(National Center for Biotechnology Information)와 같은 공지의 데이터베이스에서 얻을 수 있으며, 그 예로 NCBI에 등록된 NM_002998, NP_002989일 수 있으나, 이의 활성을 갖는 한 변이된 서열 등을 제한없이 포함할 수 있다.
본 발명에서 용어, “혈관신생(angiogenesis)”은 새로 혈관이 생기는 현상으로서 혈관이 새로 생성되는 모든 현상을 지칭할 수 있으며, 그 예로 기존의 혈관을 구성하는 세포가 증식 및 이주하여 새로 혈관을 만드는 현상을 지칭할 수 있고, 혈관을 만드는 전구세포에 의하여 혈관이 새로 생성되는 현상까지 포함할 수 있다.
본 발명에서, “혈관신생촉진”은 상기와 같은 혈관신생을 촉진하여 모세혈관 등의 혈관의 생성이 보다 빠른 시간 내에 및/또는 보다 많은 혈관의 생성이 이루어질 수 있도록 하는 것을 의미한다. 태아의 발생 및 성장, 장기의 형성, 상처의 치유 등에는 혈관의 형성과 혈액의 순환이 필수적인바, 혈관신생이 촉진됨으로써 태아의 발생 및 성장, 장기의 형성, 상처의 치유 등이 보다 효율적으로 이루어질 수 있다.
구체적으로 본 발명의 상기 혈관신생촉진용 분리된 신데칸-2 펩타이드는 혈관내피세포의 증식능, 혈관내피세포의 이동능, 혈관 형성능 및 혈관신생촉진을 증가시키는 것을 특징으로 할 수 있다.
본 발명의 일 실시예에서는 분리된 신데칸-2 펩타이드를 처리하였을 때 농도의존적으로 혈관내피세포의 증식이 증가하는 것을 확인하였으며(도 2), 트랜스웰이동분석을 통하여 혈관내피세포의 이동능 역시 증가한 것을 확인하였다(도 3 및 도 4). 이로부터 양성 대조군으로 처리한 VEGF에 의해 유도된 혈관내피세포의 증식 및 이동과 거의 유사한 수준임을 알 수 있었다. 또한, 도 5 및 도 6에 나타난 바와 같이 신데칸-2 펩타이드에 의해 혈관내피세포의 혈관 형성이 증가한 것을 확인할 수 있었다.
본 발명의 다른 일 실시예에서는 본 발명 펩타이드의 혈관신생 촉진능력을 알아보기 위하여 in vivo CAM(chick chorioallantoic membrane) assay를 수행하였으며, 신데칸-2 펩타이드를 처리한 CAM에서 새롭게 형성된 혈관이 증가한 것을 확인할 수 있었다(도 7). 또한, 생성된 미세혈관(microvessel)의 수를 측정하여 그래프로 나타낸 결과, 양성대조군인 PMA를 처리한 경우와 같이 미세혈관의 수가 음성 대조군에 비해 유의적인 증가를 나타내는 것을 확인함으로써, 본 발명의 신데칸-2 펩타이드가 in vivo 상에서 혈관신생을 촉진하는 효과가 있음을 알 수 있었다(도 8).
본 발명의 또 다른 일 실시예에서는 본 발명의 펩타이드를 처리함으로써 혈관형성능 증가 요인인 혈관내피세포 내부 단백질의 발현(도 9), 암세포의 HIF 단백질 발현 및 Akt 단백질의 인산화(도 10), 및 VEGF 유전자 발현(도 11) 수준이 모두 증가함을 확인하였고, 나아가 저산소 상태에서도 혈관 신생에 관여하는 전사인자인 HIF 단백질 발현이 증가함을 확인하였다(도 12).
상기 신데칸-2 펩타이드를 포함하는 본 발명의 조성물은 혈관신생촉진용 조성물일 수 있으며, 구체적으로 피부판 재생, 상처 및 화상치료, 인공피부이식 및 이식용 혈관 제조용 조성물일 수 있으나, 이에 제한되는 것은 아니다. 상기 피부판 재생, 상처 및 화상치료, 인공피부이식 및 이식용 혈관 제조의 경우 조직의 형성을 유도하는 것으로서 혈액의 원활한 공급이 필수적인바, 본 발명의 펩타이드를 이용하여 혈관신생을 촉진하여 효과를 높일 수 있다.
본 발명의 또 하나의 양태로서, 상기 분리된 펩타이드를 포함하는 혈관신생 의존성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 혈관신생 의존성 질환은 다양한 원인에 의한 혈관 이상으로 인해 혈액이나 산소가 제대로 공급되지 못하여 발생하거나 악화되는 질병을 말하는 것으로, 구체적으로는 혈관신생이 필요한 질환을 말하나, 이에 제한되지 않는다. 그 예로, 허혈, 불임, 당뇨성 족부궤양, 허혈성 뇌졸중, 궤양, 동맥경화증, 심근경색, 협심증, 허혈성 심부전, 욕창, 탈모, 급성 후방지 국소빈혈 및 뇌혈관성 치매로 구성된 군에서 선택되는 1종 이상일 수 있으나, 이에 제한되는 것은 아니다.
허혈, 허혈성 뇌졸중, 동맥경화증, 심근경색, 협심증 등은 혈관이 막히거나 좁아지는 것이 원인이 되어 혈관 내 혈액을 통해 산소와 영양이 적절히 공급되지 못하면 신체 조직 및 장기 기능 장애가 발생하게 됨으로써 발병하게 된다. 이러한 혈관 기능 장애가 심장 근육에서 발생하면 심장이 멈추어 심근경색, 협심증 등이 발생하게 되고, 손이나 발 끝 부분에서 발생하면 허혈성 지체질환이 되며, 뇌에서 발생하게 되면 허혈성 뇌졸중, 뇌혈관성 치매 등이 발생할 수 있다.
허혈성 심부전 및 급성 후방지 국소빈혈 역시 관이 막히거나 좁아지는 것이 원인으로 혈액을 충분히 공급받지 못하여 산소가 부족하여 발생할 수 있다.
당뇨성 족부궤양은 당뇨병의 가장 흔한 합병증으로 당뇨병 환자의 혈관에 존재하는 고농도의 혈당에 의해 세포 내 일부 기능이 손상되면서 다리 부위의 미세혈관과 신경세포가 죽게되어 발생하게 된다.
소화관 궤양, 피부 궤양 등의 궤양, 화상, 상처 등은 조직 손상에 의한 것으로서 통상적인 치료방법은 처치 후 손상부위가 자연회복력에 의해 치유되는 것을 기다리는 것이나, 시간이 오래 걸리는 단점이 있다. 상기와 같은 질환의 치유는 세포 증식에 의한 새로운 결합 조직 및 상피 조직의 형성에 의해 좌우되는바, 세포의 증식, 분화를 촉진하거나 자극하는 것이 효과적이다.
또한, 욕창은 압박궤양으로도 불리며, 몸의 어느 부위든 지속적인 또는 반복적인 압박이 가해지면서 혈액순환이 잘 되지 않아 조직이 죽어 발생한 궤양으로서 혈관의 신생을 촉진함으로써 혈액순환이 잘 이루어지도록 유도하여 치료할 수 있다.
또한, 불임의 경우 자궁 내의 혈액순환과 모세혈관의 혈류순환이 저하되어 수정란의 착상이 잘 이루어지지 않음으로써 발생할 수 있으며, 혈관의 신생을 촉진하여 자궁 내 혈액 순환이 잘 이루어지도록 하여 불임을 예방 또는 치료할 수 있다.
또한, 탈모는 비정상적으로 모발이 탈락되는 수가 많아지는 것을 말하며, 혈액에 의한 영양공급이 충분하지 못할 경우 발생할 수 있다. 탈모의 치료방법 중 하나로 모세혈관의 확장을 통해 혈액순환을 촉진하는 방법이 있으며, 본 발명의 펩타이드를 이용하여 혈관신생을 촉진함으로써 탈모를 예방 또는 치료하거나 육모를 촉진할 수 있다.
상기 질병들은 혈관을 이식하거나 우회혈관을 신생시키는 등의 방법으로 증상을 완화 또는 개선시킬 수 있으며, 본 발명의 펩타이드를 포함하는 약학적 조성물을 통하여 혈관을 신생시키거나 이식용 혈관을 생성하여 이러한 질병들을 개선하거나 치료할 수 있다.
본 발명의 구체적인 하나의 양태로서, 본 발명의 약학적 조성물은 약학적으로 허용 가능한 담체를 추가로 포함할 수 있다.
본 발명에서 사용되는 용어, "약학적으로 허용 가능한 담체"란 생물체를 자극하지 않으면서, 주입되는 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 의미할 수 있다. 본 발명에 사용 가능한 상기 담체의 종류는 특별히 제한되지 아니하며 당해 기술 분야에서 통상적으로 사용되고 약학적으로 허용되는 담체라면 어느 것이든 사용할 수 있다. 상기 담체의 비제한적인 예로는, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사 용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 등을 들 수 있다. 이들은 단독으로 사용되거나 2 종 이상을 혼합하여 사용될 수 있다. 상기 담체는 비자연적 담체 (non-naturally occuring carrier)를 포함할 수 있다.
약학적으로 허용 가능한 담체를 포함하는 상기 조성물은 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용될 수 있다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테롤 등이 사용될 수 있다.
상기 약학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제으로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있다.
상기 본 발명의 조성물은 약학적으로 유효한 양으로 투여될 수 있다.
본 발명에서 용어 "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명의 허혈, 불임, 당뇨성 족부궤양, 허혈성 뇌졸중, 궤양, 동맥경화증, 심근경색, 협심증, 허혈성 심부전, 욕창, 탈모, 급성 후방지 국소빈혈 또는 뇌혈관성 치매 등의 혈관신생 의존성 질환의 예방제 또는 치료제는, 매일 투여 또는 간헐적으로 투여할 수 있고, 1일당 투여 횟수는 1회 또는 2~3회로 나누어 투여하는 것도 가능하다. 또한, 본 발명의 조성물은 혈관신생 의존성 질환의 예방 또는 치료를 위하여 단독으로, 또는 다른 약물 치료와 병용하여 사용할 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 또 하나의 양태로서, 개체의 혈관형성이 필요한 부위에 상기 혈관신생촉진용 조성물을 투여하는 단계를 포함하는, 혈관신생을 촉진하는 방법을 제공한다.
본 발명에서 용어, "개체"란 혈관형성이 필요한 인간을 포함한 모든 동물을 의미하고 혈관신생촉진용 조성물을 개체에게 투여함으로써, 혈관의 신생을 촉진할 수 있다. 상기 개체는 개, 소, 말, 토끼, 마우스, 랫트, 닭 또는 인간을 포함하는 포유류 전체를 의미하나, 상기 예에 의해 본 발명의 포유류가 한정되는 것은 아니다. 구체적으로 상기 개체는 인간을 제외한 개체일 수도 있다.
본 발명의 일 실시예에서는 본 발명의 분리된 신데칸-2 펩타이드가 in vivo에서도 신생혈관 생성을 촉진하는 효과를 나타내는 것을 확인하였는바(도 7 및 도 8), 상기 펩타이드를 포함하는 혈관신생촉진용 조성물을 투여하여, 혈관신생을 촉진시킬 수 있다.
본 발명의 또 하나의 양태는 상기 혈관신생 의존성 질환의 예방 또는 치료용 약학적 조성물을 혈관신생 의존성 질환인 것으로 의심되는 개체에 투여하는 단계를 포함하는, 혈관신생 의존성 질환 치료방법을 제공한다.
상기 “개체”란, 혈관신생 의존성 질환의 예방 또는 치료가 필요한 인간을 포함한 모든 동물을 의미하고, 상기 약학적 조성물을 투여함으로써 상기 질환을 효과적으로 예방 및 치료할 수 있다. 상기 개체는 개, 소, 말, 토끼, 마우스, 랫트, 닭 또는 인간을 포함하는 포유류 전체를 의미하나, 상기 예에 의해 본 발명의 포유류가 한정되는 것은 아니다. 구체적으로 상기 개체는 인간을 제외한 개체일 수도 있다.
상기 약학적 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 본 발명의 조성물은 목적하는 바에 따라 비경구 투여인 복강 내 투여, 정맥 내 투여, 피하 투여, 피 내 투여, 또는 경구 투여될 수 있으나, 이에 제한되지는 않는다. 또한 상기 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다. 투여 횟수는 상기 기재한 바와 같다.
구체적으로, 상기 혈관신생 의존성 질환은 허혈, 불임, 당뇨성 족부궤양, 허혈성 뇌졸중, 궤양, 동맥경화증, 심근경색, 협심증, 허혈성 심부전, 욕창, 탈모, 급성 후방지 국소빈혈 및 뇌혈관성 치매로 구성된 군에서 선택되는 1종 이상일 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명이 하기 실시예에 의해 한정되는 것은 아니다.
실시예 1. 신데칸-2(Syndecan-2) 펩타이드의 제작 및 세포배양
1-1. 신데칸-2 펩타이드의 제작
신데칸-2 세포외 도메인 내의 16개 아미노산 서열로 이루어진 펩타이드인 신데칸-2의 79-94번 잔기(hS2LQ로 명명: LTSAAPKVETTTLNIQ; 서열번호 1)를 제작하였다. 또한, 대조군으로서 hS2LQ에 대한 스크램블 펩타이드(Scr: IPNTSVKTLTAQLAET; 서열번호 2)를 Fmoc chemistry(Anygen Inc., 광주, 한국)를 사용하여 고체-상 방법의 개선된 버전을 사용하여 합성하였다(도 1).
1-2. 세포배양
사람의 탯줄로부터 분리한 혈관내피세포(human umbilical vein endothelial cell, HUVEC)를 1% 젤라틴으로 코팅된 디쉬(dish)에서 20%의 FBS, 1% 페니실린/스트렙토마이신(penicillin/streptomycin), 5 unit/ml 헤파린(Heparin) 및 2 ng/ml 염기성 섬유아세포 증식인자(basic-fibroblast growthfactor, bFGF)가 포함된 M199(Hyclone, Logan) 배지를 사용하여 5% 이산화탄소가 있는 37℃ 항온기에서 배양하였다. 대장암 세포주인 HCT116과 HT29 세포는 10% FBS, 1% 페니실린/스트렙토마이신이 포함된 McCoy 5A 배지(Welgene, 서울, 한국)를 사용하여 5% 이산화탄소가 있는 37℃ 항온기에서 배양하였다.
실시예 2. 신데칸-2 펩타이드의 혈관내피세포 증식효과 확인
상기 실시예 1-1에서 제작한 신데칸-2 펩타이드가 혈관내피세포의 증식능에 미치는 영향을 확인하기 위해, 혈관내피세포를 1% 젤라틴으로 코팅된 96-웰 플레이트에 분주하여 20% FBS, 1% 페니실린/스트렙토마이신, 5 unit/ml 헤파린 및 2 ng/ml bFGF가 포함된 M199 배지에서 약 24시간 배양한 후, 저혈청 배지(0.5%의 FBS를 포함하는 M199 배지)로 바꾸어 16시간 배양하여 성장 인자(growth factor)의 영향을 제거하였다. 그 후, 다양한 농도의 신데칸-2 펩타이드를 처리하여 24시간 더 배양한 후, Cell proliferation ELISA, BrdU(Roche)를 사용하여 신데칸-2 펩타이드의 농도에 따른 증식능을 확인하였다. 20 ng/ml의 혈관내피세포성장인자(vascular endothelial growth factor, VEGF)는 양성 대조군으로서 세포에 처리하여 관찰하였다. 구체적으로, BrdU를 4시간 처리한 후 배지를 제거하고 Fix Denat으로 30분 동안 고정시켰다. 항-BrdU-POD working solution을 90분간 처리한 후 PBS로 3번 세척하고 Substrate solution을 처리하여 370nm(ref. 492nm)에서 흡광도를 측정하였다.
그 결과 도 2에 나타난 바와 같이 신데칸-2 펩타이드를 처리하였을 때 농도의존적으로 혈관내피세포의 증식능이 증가하는 것을 확인할 수 있었고, 5 nM 이상에서는 증식능이 유의적인 수준으로 증가하는 것을 관찰하였다.
실시예 3. 신데칸-2 펩타이드의 혈관내피세포 이동능 촉진효과 확인
신데칸-2 펩타이드가 혈관내피세포의 이동능에 미치는 영향을 트랜스웰 이동분석(Transwell migration assay)을 이용하여 관찰하였다. 24-웰의 트랜스웰(Costar, 8㎛ pore size)을 type I 콜라겐(0.5 mg/ml)으로 코팅하여 실온에서 1시간 건조 후 사용하였다. 챔버의 아래에는 10 nM 신데칸-2 펩타이드를 처리한 배지를 넣고 챔버 위에는 FBS가 없는 배지와 함께 동일한 수의 혈관내피세포를 깔아 24시간 배양한 후 막을 통과하는 세포의 수를 세었다. 또한, 20 ng/ml VEGF를 양성 대조군으로서 처리하였다. 이동한 세포의 구분은 메탄올로 1분 고정 후 헤마톡실린(hematoxylin)으로 10분, 에오신(eosin)으로 4분간 염색하고 이동하지 않은 막 위의 세포를 면봉으로 제거한 후 슬라이드 글라스에 발삼(balsam)으로 막을 고정하여 염색된 세포를 현미경으로 확인하였다. 그리고 이동한 세포의 수를 세어 그래프로 나타내었다.
도 3에 나타난 바와 같이 신데칸-2 펩타이드에 의해 혈관내피세포의 이동이 증가한 것을 현미경을 통해 관찰하였다. 또한 도 4에 나타난 바와 같이 이동한 세포의 수를 측정하여 그래프로 나타낸 결과, 음성 대조군에 비해 신데칸-2 펩타이드를 처리하였을 때 혈관내피세포의 이동능이 유의적으로 증가된 것을 확인하였으며, 이는 혈관내피세포성장인자인 VEGF에 의해 유도된 HUVEC의 이동과 거의 유사한 수준이었다.
실시예 4. 신데칸-2 펩타이드의 혈관내피세포 혈관 형성능 촉진효과 확인
신데칸-2 펩타이드가 혈관내피세포의 혈관 형성능에 미치는 영향을 튜브 형성 분석법(Tube formation assay)를 이용하여 관찰하였다. 구체적으로 96-웰 플레이트에 웰당 60 ㎕의 마트리젤(Matrigel, BD)을 깔아준 다음 37℃에서 30분간 젤화시켜 사용하였다. 이후 10 nM 신데칸-2 펩타이드를 처리한 배지에서 혈관내피세포를 배양하여 8시간 후 튜브형성을 현미경으로 확인하였다. 20 ng/ml VEGF를 처리한 배지를 양성 대조군으로 사용하였다. 또한, 형성된 튜브의 길이를 측정하여 그래프화 하였다.
도 5 에 나타난 바와 같이 신데칸-2 펩타이드에 의해 혈관내피세포의 혈관 형성이 증가한 것을 현미경으로 관찰하였다. 또한 도 6에 나타난 바와 같이 형성된 튜브의 길이를 측정하여 그래프로 나타낸 결과, 음성 대조군에 비해 신데칸-2 펩타이드를 처리하였을 때 혈관 형성능이 유의적으로 향상된 것을 확인하였다.
실시예 5. 신데칸-2 펩타이드의 in vivo 에서의 혈관신생 촉진효과 확인
in vivo에서의 신데칸-2 펩타이드의 혈관신생촉진 효과를 확인하기 위하여, CAM(chick chorioallantoic membrane) assay를 수행하였다. 구체적으로, 구입한 유정란을 37℃의 부화기에서 포화습도 90%를 유지하면서 3일간 키운 뒤, 주사기를 이용해 알부민을 3 ml 정도 제거 후 난 껍질을 깨어 일정 크기의 창을 낸 후, 수정란으로 확인된 것만 유리테이프로 밀봉시켰다. 다시 6일 동안 배양한 뒤, Thermanox cover slip에 신데칸-2 펩타이드 10nM를 도포하여 말린 후 CAM 부위에 얹고 테이프로 밀봉한 후 3일 동안 배양하였다. 양성 대조군으로 PMA(phorobol 12-myristate 13-acetate) 100 ng을 사용하였다. 이후 10% 지방 에멀젼(intralipid)을 CAM 막 안쪽에 주입한 후, 현미경으로 혈관형성 정도를 관찰하고 사진을 찍었다. 새롭게 형성된 미세혈관의 존재 유무 및 그 정도에 따라 채점하였고, 검사된 전체 개수의 난 중 양성 난의 백분율을 구하였다.
그 결과, 도 7에 나타난 바와 같이 신데칸-2 펩타이드를 처리한 CAM에서 새롭게 형성된 혈관이 증가한 것을 확인할 수 있었다. 또한 도 8에 나타난 바와 생성된 미세혈관(microvessel)의 수를 측정하여 그래프로 나타낸 결과, 양성대조군인 PMA를 처리한 경우와 같이 미세혈관의 수가 음성 대조군에 비해 유의적인 증가를 나타내는 것을 확인하였다. 이를 통해, 신데칸-2 펩타이드가 in vivo 상에서 혈관신생을 촉진하는 효과가 있음을 알 수 있었다.
실시예 6. 신데칸-2 펩타이드에 의한 혈관형성능 증가요인 분석
6-1. 웨스턴블롯(Western blot)을 이용한 혈관내피세포 내부 단백질의 발현 분석
신데칸-2 펩타이드에 의한 혈관내피세포의 혈관형성능 증가 원인을 분석하기 위하여, 신데칸-2 펩타이드를 처리한 다음, 웨스턴블롯을 통해 혈관내피세포 내부의 단백질 변화를 분석하였다. 구체적으로 혈관내피세포에 10 nM 신데칸-2 펩타이드를 처리한 다음, 24시간 후 세포를 회수하여 RIPA 버퍼를 이용하여 세포를 용해시키고 웨스턴블롯을 통해 단백질 인산화 및 발현 변화를 확인하였다. 음성 대조군으로서 스크램블 펩타이드(Scr)를 처리하여 관찰하였다.
1차 항체로 항-인산화 타이로신(22hosphor-tyrosine) 항체를(Upstate Biotechnology, Inc., Lake Placid, NY/ 0.5 ㎍/ml) 16시간 동안 반응시킨 후, Tris-Buffered Saline and Tween-20(TBST) 용액으로 세척하고, 2차 항체로 HRP가 결합된 goat anti-mouse IgG 항체(AbClon, 서울, 한국/ 0.1 ㎍/ml)를 이용하여 16 시간 동안 반응시켰다. 그 결과, 도 9의 a에 나타난 바와 같이, 양성 대조군인 VEGF를 처리한 경우와 마찬가지로 신데칸-2 펩타이드를 처리하였을 때 다양한 단백질들의 타이로신 인산화가 증가한 것을 확인하였다.
또한, 혈관내피세포의 혈관 증식에 영향을 주는 것으로 알려진 단백질들인 VEGF 수용체(VEGFR), phosphoinositide 3-kinase(PI3K), AKT, Erk, p38 및 c-JUN N-terminal kinase(JNK)의 신데칸-2 펩타이드 처리에 의한 인산화 정도를 웨스턴블롯을 통해 관찰하였다.
1차 항체로 항-인산화 VEGF 수용체(hosphor-VEGFR) 항체, 항-인산화phosphoinositide 3-kinase(hosphor-PI3K) 항체, 항-인산화 AKT(hosphor-AKT) 항체, 항-인산화 Erk(hosphor-Erk), 항-인산화 p38(hosphor-p38) 및 항-인산화 c-JUN N-terminal kinase(hosphor-JNK) 항체를 16시간 동안 반응시켰다. 상기 1차 항체들은 Cell Signaling(Cell Signaling, Danvers, MA, USA)에서 구입하였으며, 0.2 ㎍/ml 농도로 반응시켰다. 이후, TBST 용액으로 세척하고, 2차 항체로 HRP가 결합된 anti-mouse(or rabbit) IgG 항체(AbClon, 서울, 한국/ 0.1 ㎍/ml)를 이용하여 16 시간 동안 반응시켰다.
그 결과, 도 9의 b에 나타난 바와 같이, 신데칸-2 펩타이드를 처리한 경우 VEGFR, phosphoinositide 3-kinase (PI3K), AKT, Erk, p38 및 c-JUN N-termianl kinase(JNK)의 인산화가 증가하는 것을 확인할 수 있었다. 베타-actin은 웨스턴블롯에 있어서 동일한 양을 로딩하였는지 확인하기 위하여 사용하였다.
또한, 혈관신생능력 증가시 발현이 증가되는 것으로 알려진 adhesion receptor 중 하나인 인테그린(integrin)의 발현을 웨스턴블롯을 통해 관찰하였다.
1차 항체로 항-αv항체, 항-α5 항체, 항-α6 항체, 항-β1 항체, 항-β3 항체 및 항-β4 항체를 16시간 동안 반응시켰다. 상기 1차 항체들은 Cell Signaling(Cell Signaling, Danvers, MA, USA)에서 구입하였으며, 0.2 ㎍/ml 농도로 반응시켰다. 이후, TBST 용액으로 세척하고, 2차 항체로 HRP가 결합된 goat anti-rabbit IgG 항체(AbClon, 서울, 한국/ 0.1 ㎍/ml)를 이용하여 16시간 동안 반응시켰다.
그 결과, 도 9의 c에 나타난 바와 같이, 신데칸-2 펩타이드를 처리한 경우 αvβ4의 발현이 증가한 것을 확인할 수 있었다. αvβ4 인테그린은 혈관형성에 있어서 혈관내피세포의 이동 및 모세혈관 형성에 중요한 역할을 하는 것으로 알려져 있는바, 신데칸-2 펩타이드를 처리함으로써 혈관 형성이 촉진될 수 있음을 확인하였다.
6-2. 웨스턴블롯(Western blot)을 이용한 암세포의 단백질 발현 분석
신생혈관형성의 증가는 암세포의 신호전달 변화의 영향을 받게 되므로, 신데칸-2 펩타이드에 의한 암세포의 단백질의 발현 및 인산화 정도의 변화를 비교 분석하였다. 신생 혈관은 암세포에 의한 조직 내 저산소 상태에 의하여 HIF(hypoxia inducible factor) 전사인자가 증가하여 VEGF 유전자의 프로모터 부위인 HRE(hypoxia response element)에 결합함으로써 다양한 유전자의 발현을 증가시키고, 특히 VEGF mRNA를 안정화시키게 된다. 생성된 VEGF는 혈관내피세포에 특이적으로 세포의 성장 및 이동을 촉진하고, 혈관투과성을 증가시킨다.
이에 따라 신데칸-2 펩타이드에 의한 암세포의 HIF 발현 변화를 웨스턴블롯을 통해 확인하였다. 우선 대장암 세포주인 HCT116 세포에 신데칸-2 펩타이드를 다양한 농도 및 시간대 별로 처리한 후 HIF-1의 발현 정도를 확인하였으며, 음성 대조군으로 스크램블 펩타이드를 처리하여 비교하였다. 또한, 다른 대장암 세포주인 HT29 세포에 5 nM의 신데칸-2 펩타이드를 24시간 동안 처리한 후 웨스턴블롯을 이용하여 단백질의 발현 변화를 분석하였다.
1차 항체로 항-HIF-1 항체(BD science, San Jose, California, USA/ 0.2㎍/ml), 항-인산화 Akt308 항체 및 항-인산화 Akt473 항체를(Cell Signaling (Danvers, MA, USA/ 0.2 ㎍/ml) 16시간 동안 반응시킨 후, TBST 용액으로 세척하고, 2차 항체로 HRP가 결합된 goat anti-mouse IgG 항체(AbClon, 서울, 한국/ 0.1 ㎍/ml)를 이용하여 16시간 동안 반응시켰다.
그 결과, 도 10의 a에 나타난 바와 같이, HCT116 세포에 신데칸-2 펩타이드를 처리하였을 때, 처리 농도가 증가함에 따라 HIF-1의 발현이 증가함을 확인하였다.
상기와 같은 HIF-1의 발현은 Akt 단백질의 인산화에 의존적이기 때문에 신데칸-2 펩타이드에 의한 Akt 단백질 인산화 정도를 분석한 결과, 신데칸-2 펩타이드를 처리한 경우 처리 농도가 높아질수록 Akt 인산화가 증가함을 확인하였다.
또한, 5 nM의 신데칸-2 펩타이드를 처리한 후, 6시간, 15시간 및 24시간 째의 HIF-1 발현 및 Akt308의 인산화를 살펴본 결과, 음성 대조군인 스크램블 펩타이드를 처리한 경우에 비해 HIF-1 단백질의 발현이 유의적으로 증가하였으며, Akt308의 인산화가 눈에 띄게 증가한 것을 확인할 수 있었다(도 10의 b).
또한, 도 10c에 나타난 바와 같이, 다른 대장암 세포주인 HT29 세포에 신데칸-2 펩타이드 5 nM을 처리한 후, HIF-1 단백질의 발현, Akt308 및 Akt473의 인산화 정도를 살펴보았을 때, 음성 대조군인 스크램블 펩타이드를 처리한 경우에 비해 HIF-1 단백질의 발현 및 Akt 단백질의 인산화가 증가한 것을 확인할 수 있었다.
6-3. 신데칸-2 펩타이드 처리에 의한 VEGF 유전자 발현 증가 확인
상기 6-2에서 신데칸-2 펩타이드를 처리함에 따라 HIF-1 전사인자의 발현이 증가함을 확인함에 따라, 증가된 HIF-1 전사인자가 VEGF mRNA의 안정화 및 발현을 증가시키는 지를 확인하기 위하여, RT-PCR을 통해 암세포 내 VEGF mRNA 양을 확인하였다.
구체적으로, 반응완충액(ELPiS, 한국), 1 mM dNTP(ELPiS, 한국), 1 Unit Taq polymerase(ELPiS, 한국), 0.5 pmole 프라이머(코스모진텍, 한국) 및 1.5 ㎍의 cDNA를 포함하는 PCR 조성물을 사용하였으며, 94℃에서 5분 동안 반응시킨 후(initial denaturation), 94℃에서 denaturation 30초, 54℃에서 annealing 30초, 72℃에서 extension 30초로 구성하여 25 사이클 반응시켰다. 또한 사용한 프라이머 서열은 하기 표 1에 정리하였다.
5'-3' 서열번호
VEGF 정방향 CGAAGTGGTGAAGTTCATGGATG 3
역방향 CTGTATCAGTCTTTCCTGGTG 4
beta-actin 정방향 TGGAATCCTGTGGCATCCATGAAA 5
역방향 TAAAACGCAGCTCAGTAACAGTCCG 6
상기와 같이 HCT116과 HT29 대장암 세포주에 5nM의 신데칸-2 펩타이드를 24시간 동안 처리한 후 VEGF mRNA의 양을 확인한 결과, 상기 두 세포주 모두에서 VEGF mRNA양이 증가한 것을 알 수 있었다(도 11의 a 및 11의 b).
6-4. 저산소 상태 조건에 의한 HIF -1 조절 효과 확인
혈관 주위에 존재하는 암조직의 O2 농도는 혈관에서 멀어질수록 낮아지는데, 이는 하나의 암조직 내에서도 산소 농도가 다양할 수 있음을 의미한다.
이에 따라, 대장암 세포주 HT-29를 serum이 들어있지 않은 배지에서 12시간 동안 배양한 후, 5% O2를 처리하여 저산소 상태의 조건을 확립하였다. 신데칸-2 펩타이드의 HIF-1 안정화 효과는 웨스턴블롯을 통해 확인하였으며, 신데칸-2 펩타이드의 HIF-1 유비퀴틴화(ubiquitination)에 대한 효과는 면역침강반응(immunoprecipitation) 어세이를 통해 확인하였다.
그 결과, 도 12의 a에 나타난 바와 같이, 신데칸-2 펩타이드를 처리한 경우, 정상조건에 비해 5% O2 조건에서 HIF-1의 발현이 증가하는 것을 확인할 수 있었다. 또한, 도 12의 b에 나타난 바와 같이, 신데칸-2 펩타이드를 처리한 경우에 HIF-1 유비퀴틴화는 더욱 감소 되는 것을 확인하였다. 이는 신데칸-2 펩타이드에 의해 HIF의 유비퀴틴화가 감소 되어 HIF 단백질이 안정화된다는 것을 의미하며, 상기 결과를 통해, 신데칸-2 펩타이드는 저산소 상태에서도 혈관 형성을 촉진할 수 있음을 확인하였다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (7)

  1. 서열번호 1로 표시되는 아미노산 서열로 이루어진, 분리된 펩타이드를 포함하는 혈관신생촉진용 조성물.
  2. 제1항에 있어서, 상기 조성물은 피부판 재생, 상처 및 화상치료, 인공피부이식 및 이식용 혈관 제조용으로 구성된 군으로부터 선택되는 기능을 추가로 수행하는 것인, 조성물.
  3. 서열번호 1로 표시되는 아미노산 서열로 이루어진, 분리된 펩타이드를 포함하는 혈관신생 의존성 질환의 예방 또는 치료용 약학적 조성물.
  4. 제3항에 있어서, 상기 혈관신생 의존성 질환은 허혈, 불임, 당뇨성 족부궤양, 허혈성 뇌졸중, 궤양, 동맥경화증, 심근경색, 협심증, 허혈성 심부전, 욕창, 탈모, 급성 후방지 국소빈혈 및 뇌혈관성 치매로 구성된 군에서 선택되는 것인, 약학적 조성물.
  5. 혈관신생이 필요한, 인간을 제외한 개체에 제1항 또는 제2항의 조성물을 투여하는 단계를 포함하는, 혈관신생을 촉진하는 방법.
  6. 제3항의 조성물을 혈관신생 의존성 질환인 것으로 의심되는 인간 이외의 개체에 투여하는 단계를 포함하는, 혈관신생 의존성 질환의 예방 또는 치료방법.
  7. 제6항에 있어서, 상기 혈관신생 의존성 질환은 허혈, 불임, 당뇨성 족부궤양, 허혈성 뇌졸중, 궤양, 동맥경화증, 심근경색, 협심증, 허혈성 심부전, 욕창, 탈모, 급성 후방지 국소빈혈 및 뇌혈관성 치매로 구성된 군에서 선택되는 1종 이상인, 치료방법.
PCT/KR2015/007968 2014-07-30 2015-07-30 혈관신생촉진용 펩타이드 및 이의 용도 Ceased WO2016018090A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140097265A KR101721733B1 (ko) 2014-07-30 2014-07-30 혈관신생촉진용 펩타이드 및 이의 용도
KR10-2014-0097265 2014-07-30

Publications (1)

Publication Number Publication Date
WO2016018090A1 true WO2016018090A1 (ko) 2016-02-04

Family

ID=55217872

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/007968 Ceased WO2016018090A1 (ko) 2014-07-30 2015-07-30 혈관신생촉진용 펩타이드 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101721733B1 (ko)
WO (1) WO2016018090A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018172031A1 (de) 2017-03-23 2018-09-27 Raimund Beck Nageltechnik Gmbh Nagel insbesondere in einem nagelsetzgerät

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220140176A (ko) 2021-04-09 2022-10-18 경북대학교 산학협력단 혈관신생 촉진용 약학적 조성물

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080020979A1 (en) * 2006-06-09 2008-01-24 Rapraeger Alan C Peptides of Syndecan-1 For Inhibiting Angiogenesis
US20090005295A1 (en) * 2002-01-18 2009-01-01 Ekker Stephen C Syndecans and angiogenesis

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5486599A (en) * 1989-03-29 1996-01-23 The Board Of Trustees Of The Leland Stanford Junior University Construction and use of synthetic constructs encoding syndecan
WO2014157952A1 (ko) * 2013-03-26 2014-10-02 이화여자대학교 산학협력단 신규한 신데칸-2 단편 및 이의 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090005295A1 (en) * 2002-01-18 2009-01-01 Ekker Stephen C Syndecans and angiogenesis
US20080020979A1 (en) * 2006-06-09 2008-01-24 Rapraeger Alan C Peptides of Syndecan-1 For Inhibiting Angiogenesis

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI. 3 February 2014 (2014-02-03), Database accession no. XP_005251077 .1 *
FEARS ET AL.: "Syndecan-2 is expressed tin the microvasculature of gliomas and regulates angiogenic processes in microvascular endothelial cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 281, no. 21, 2006, pages 14533 - 14536 *
NOGUER ET AL.: "Is syndecan-2 a key angiogenic element?", THE SCIENTIFIC WORLD JOURNAL, vol. 9, 2009, pages 729 - 73 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018172031A1 (de) 2017-03-23 2018-09-27 Raimund Beck Nageltechnik Gmbh Nagel insbesondere in einem nagelsetzgerät

Also Published As

Publication number Publication date
KR101721733B1 (ko) 2017-03-31
KR20160015462A (ko) 2016-02-15

Similar Documents

Publication Publication Date Title
Klöting et al. Adipocyte dysfunction, inflammation and metabolic syndrome
US8158589B2 (en) Peptides with the capacity to bind to transforming growth factor β1 (TGF-β1)
Li et al. A frog peptide provides new strategies for the intervention against skin wound healing
WO2018074682A1 (ko) 항비만 및 항당뇨 효능을 갖는 펩타이드 및 이의 용도
WO2015156649A1 (ko) 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
Barbon et al. In vitro assessment of TAT—Ciliary Neurotrophic Factor therapeutic potential for peripheral nerve regeneration
WO2014178653A1 (ko) 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도
WO2016018090A1 (ko) 혈관신생촉진용 펩타이드 및 이의 용도
WO2021256751A1 (ko) 섬유아세포 유래 세포외 소포체를 유효성분으로 함유하는 피부 및 점막 창상 치료용 조성물
JP4548335B2 (ja) 腸管細胞のインスリン産生細胞への変換誘導剤、及び糖尿病治療剤
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2012161519A1 (en) An adult stem cell line introduced with hepatocyte growth factor gene and neurogenic transcription factor gene with basic helix-loop-helix motif and uses thereof
Zhang et al. Novel pro-myogenic factor neoruscogenin induces muscle fiber hypertrophy by inhibiting MSTN maturation and activating the Akt/mTOR pathway
WO2022220632A1 (ko) 세포 투과 펩티드, 항암 펩티드 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물
WO2018021771A1 (ko) TIF1γ의 발현 또는 활성 증강제를 유효성분으로 포함하는 간 섬유화 또는 간경화 예방 또는 치료용 조성물
WO2019143145A1 (ko) 레졸빈 d2를 유효성분으로 함유하는 피부 염증 치료용 조성물
WO2023153763A1 (ko) C-met의 에피토프 및 hif1alpha의 에피토프를 포함하는 암 백신 및 이의 용도
WO2023224431A1 (ko) 삼차원 시상하부 오가노이드로부터 유래된 신경줄기세포를 포함하는 노인성 질환 예방 및 치료용 약학 조성물 및 그의 용도
Hampel et al. Somatostatin supports corneal wound healing in vivo
WO2014178649A1 (ko) 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도
WO2014109417A1 (ko) 콜라겐 합성능이 있는 신규 펩타이드 및 그의 용도
KR101337767B1 (ko) Ｖｅｇｆ 발현을 증가시키는 신규한 펩타이드 및 이를 함유하는 약학적 조성물
WO2022250413A1 (ko) Ncapg2의 1010번째 트레오닌의 인산화 특이적 반응 여부를 확인하기 위한 항체 및 이의 이용
WO2023033534A1 (ko) Kai1 폴리펩타이드를 포함하는 간 섬유화 억제용 약학 조성물 및 이의 용도
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15828008

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15828008

Country of ref document: EP

Kind code of ref document: A1