WO2016018090A1 - Peptide for promoting angiogenesis and use thereof - Google Patents

Abstract

The present invention relates to: a composition for promoting angiogenesis, containing a novel, isolated peptide; a pharmaceutical composition for preventing or treating angiogenesis-dependent diseases, containing the peptide; a method for promoting angiogenesis, comprising a step of administering the peptide; and a method for treating angiogenesis-dependent diseases, comprising a step of administering the pharmaceutical composition.

Description

Peptides for angiogenesis and uses thereof

The present invention provides a composition for promoting angiogenesis comprising a novel isolated peptide, a pharmaceutical composition for preventing or treating angiogenic dependent diseases comprising the peptide, a method for promoting angiogenesis comprising administering the peptide And it relates to a method of treating angiogenic dependent disease, comprising administering the pharmaceutical composition.

Angiogenesis refers to the process by which new blood vessels are formed, which rarely occurs in normal living conditions, but is an essential process in embryogenesis, corpus luteum formation or wound healing. The angiogenesis process is generally caused by stimulation of angiogenesis factors, resulting in the formation of lumen due to the degradation of the basal membrane, proliferation, proliferation, and differentiation of vascular endothelial cells due to proteases. Consists of being generated. Angiogenesis processes are known to be tightly controlled by several types of promoters and inhibitors, including growth factors, cytokines, lipid metabolites and latent fragments of hemostatic proteins.

Serious disease develops when blood vessel formation, an important process for development, wound healing, and organ formation, does not occur properly. For example, if blood vessels are not formed at the developmental stage, it may cause the development of the placenta and cause miscarriage. Tissue ulceration and ischemia may cause organ dysfunction and further death. Recently, various cardiovascular diseases such as arteriosclerosis, myocardial infarction and angina pectoris, cerebral infarction, and acute limb ischemia have emerged as serious diseases with high mortality due to dietary changes, improved nutrition, and an increase in the elderly population. The development of new therapies and factors that induce or promote neoangiogenesis to treat these ischemic diseases is drawing attention (Duk-Kyung Kim et al, Korean Society of Endocrinology, 16 (3), 328). -338, 2001).

The treatment of angiogenesis using angiogenesis is called angiogenesis treatment. Angiogenesis promoters such as vascular endothelial growth factor (VEGF) are used as treatments for severe ischemia, but the isolation and purification of these factors is difficult and expensive. Therefore, there is a difficulty in clinical application, and the development of new and more effective factors for the treatment of diseases in which symptoms may be improved by vascular tissue repair is continuously required.

The present inventors have made intensive efforts to develop an effective therapeutic agent for a disease requiring the generation of neovascularization, and as a result, 16 amino acid sequences separated by MMP-7 from the extracellular domain of syndecan-2 were produced. By confirming that the peptides increase the proliferation, mobility and angiogenic ability of vascular endothelial cells, and exhibit an angiogenic promoting effect, it was confirmed that it can be used for the treatment of diseases caused by the lack of neovascularization, and completed the present invention.

An object of the present invention is to provide an angiogenesis composition comprising an isolated peptide, consisting of the amino acid sequence represented by SEQ ID NO: 1.

Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of angiogenic dependent diseases comprising the peptide.

Another object of the present invention is to provide a method for promoting angiogenesis, comprising administering the peptide to a subject in need of angiogenesis.

Still another object of the present invention is to provide a method for treating angiogenic dependent disease, comprising administering the pharmaceutical composition to a subject suspected of being an angiogenic dependent disease.

The angiogenic composition comprising the isolated peptide of the present invention increases the ability of neovascularization by increasing the proliferation, mobility, and the like of vascular endothelial cells to treat diseases caused by a lack of neovascularization such as wound healing, ischemic diseases, infertility, and the like. It can be usefully used.

FIG. 1 shows a sequence of a Cindecan-2 peptide consisting of 16 amino acid sequences constructed from some amino acid sequences of a portion cleaved by MMP-7 in the extracellular domain of Cindecan-2.

2 is a graph showing the increase in the growth of vascular endothelial cells in a concentration-dependent manner when treated with Sindecane-2 peptide.

Figure 3 shows that the movement of the vascular endothelial cells when treated with the syndecan-2 peptide by taking a picture of the degree of movement of the cells under a microscope using a transwell analysis. Syndecane-2 peptide is indicated as SDC2 in the figures.

4 is a graph showing the number of cells treated and treated with the dedecane-2 peptide.

Figure 5 is a photograph showing the degree of angiogenesis after treatment with the synthecan-2 peptide under a microscope. VEGF was used as a positive control.

6 is a graph showing the treatment of the syndecan-2 peptide and measuring the length of the blood vessel formed. VEGF was used as a positive control.

Figure 7 shows by observing through the microscope the appearance of microvascularization when treated with syndecane-2 in vivo .

Figure 8 is a graph showing the measurement of the number of micro-vascular generated when treated with indecane-2 in vivo .

FIG. 9 is an image of Western blot results of analyzing expression of vascular endothelial protein. Figure 9a shows the increase in tyrosine phosphorylation of the proteins when treated with the dedecane-2 peptide, Western blot, Figure 9b shows VEGFR, PI3K, Akt and JNK when treated with the dedecane-2 peptide Phosphorylation was increased by Western blot, and Figure 9c shows that the expression level of αvβ4 integrin was increased by comparing the expression level of integrin after the treatment of syndecan-2 peptide.

10 is an image of a western blot result of analyzing protein expression of cancer cells. Figure 10a shows that the expression of HIF-1 and the phosphorylation of Akt308 increased as the treatment concentration increased when the HCT116 cell line treated with the dedecane-2, Figure 10b shows the HCT116 cell line, The increase in HIF-1 expression and phosphorylation of Akt308 when treated with 5 nM of the Sindecane-2 peptide was shown by Western blot. FIG. 10C shows that HIF- was treated when 5 nM of the dec29-2 peptide line was treated with Sindecane-2 peptide. 1 Expression of protein, increased phosphorylation of Akt308 and Akt473 is shown by Western blot.

FIG. 11 is an image of RT-PCR results confirming the increase in VEGF gene expression by synthecan-2 peptide treatment. FIG. Figure 11a shows the amount of VEGF mRNA after 24 hours treatment with 5nM of the decane-2 peptide in the HCT116 cell line through RT-PCR, Figure 11b is 5nM of the dec29- in the HT29 cell line After 24 hours of treatment with 2 peptides, the amount of VEGF mRNA was confirmed by RT-PCR.

12 is an image of the result of confirming the state of HIF-1 protein by synthecan-2 peptide treatment in a hypoxic state (5% O ₂ ). 12 a shows the amount of HIF-1 protein expression in the HT29 cell line through Western blot, and FIG. 12 b shows the immunoprecipitation of ubiquitination of the HIF-1 protein in the HT29 cell line. ) Is shown through the assay.

In order to achieve the above object, the present invention provides an angiogenesis composition comprising an isolated peptide, consisting of an amino acid sequence represented by SEQ ID NO: 1 as an aspect.

Amino acid sequences used in the present invention are abbreviated as follows according to the IUPAC-IUB nomenclature.

Alanine A Arginine R

Asparagine N Aspartic Acid D

Cysteine C Glutamic Acid E

Glutamine Q Glycine G

Histidine H isoleucine I

Leucine L Lysine K

Methionine M-Phenylalanine F

Proline P Serine S

Threonine T Tryptophan W

Tyrosine Y Valine V

"Peptide or isolated peptide" of the present invention refers to a peptide having angiogenic activity.

In the present invention, the peptide is a peptide comprising an amino acid sequence represented by SEQ ID NO: 1 may be specifically composed of 16 amino acids, but is not limited thereto.

In addition, the peptide comprising the amino acid of SEQ ID NO: 1 is added or removed at the terminal portion of the sequence, as long as it exhibits angiogenic activity, or even if some amino acids of the sequence is mutated in the scope of the present invention Inclusion is self-evident. In particular, the peptide comprising the amino acid sequence of SEQ ID NO: 1 is an amino acid sequence 90% or more, specifically 96%, more specifically 98% or more, even more specifically 99% or more identical to the sequence, and promote angiogenesis Peptides with activity are also included within the scope of the present invention.

The peptide of the present invention may be protected from protein cleavage enzymes in vivo, and its N-terminus and / or C-terminus may be chemically modified or protected with an organic terminus, or amino acids may be added to the peptide terminus. It may be in a modified form. In particular, in the case of chemically synthesized peptides, since the N- and C-terminus are charged, acetylation of the N-terminus and / or amidation of the C-terminus are performed to remove such charges. It may be, but is not particularly limited thereto.

The peptides of the present invention can be synthesized by methods well known in the art, for example by automated peptide synthesizers, depending on their length, and can also be produced by genetic engineering techniques. For example, through genetic engineering, a fusion gene encoding a fusion protein, comprising a fusion partner and a peptide of the present invention, is prepared and transformed into a host cell, and then expressed in the form of a fusion protein, a protease or compound The peptide of the present invention may be cleaved and separated from the fusion protein to produce a desired peptide. To this end, for example, a DNA sequence encoding an amino acid residue that can be cleaved by a protease such as Factor Xa or enterokinase, a compound such as CNBr or hydroxylamine, is fused to a fusion partner and a polynucleotide encoding the peptide of the invention. Can be inserted in between.

According to an aspect of the present invention, the peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 is prepared based on the sequence of syndecane-2.

As used herein, the term “Syndecan-2” protein is a cell binding receptor present on the cell surface and is a transmembrane heparan-sulfate proteoglycan. In relation to the use of syndecane-2, it has been reported that it can be used for diagnosing bowel cancer by quantitatively analyzing the methylation of the syndecane-2 gene (Korean Patent No. 1,145,406), but a specific site thereof, in particular SEQ ID NO: 1 Peptide sites comprising the amino acid sequence of have not yet been associated with angiogenesis.

The syndecan-2 gene and protein information may be obtained from a known database such as the National Center for Biotechnology Information (NCBI), for example, NM_002998 and NP_002989 registered with the NCBI, but one mutated sequence having the activity thereof may be used. It can include without limitation.

In the present invention, the term "angiogenesis" refers to any phenomenon in which blood vessels are newly formed as new blood vessels are formed. For example, cells constituting existing blood vessels proliferate and migrate to form new blood vessels. It may refer to a phenomenon, and may include a phenomenon in which blood vessels are newly generated by progenitor cells that make blood vessels.

In the present invention, "angiogenesis promotion" means to promote angiogenesis such that the production of blood vessels such as capillaries can be made in a faster time and / or more blood vessels. The formation and growth of the fetus, the formation of organs, and the healing of wounds are essential for the formation of blood vessels and the circulation of blood. Can be.

Specifically, the isolated syndecane-2 peptide for angiogenesis promotion of the present invention may be characterized by increasing the proliferative capacity of vascular endothelial cells, the ability of vascular endothelial cells to move, angiogenesis and angiogenesis.

In one embodiment of the present invention it was confirmed that the growth of vascular endothelial cells increased depending on the concentration when treated with the isolated Shindecan-2 peptide (Fig. 2), also through the transwell movement analysis of vascular endothelial cells It was confirmed that the increase (Fig. 3 and 4). From this, it can be seen that the level similar to the proliferation and migration of vascular endothelial cells induced by VEGF treated with a positive control. In addition, as shown in FIG. 5 and FIG. 6, it was confirmed that angiogenesis of vascular endothelial cells was increased by the syndecan-2 peptide.

In another embodiment of the present invention to determine the angiogenesis promoting ability of the peptide of the present invention in vivo CAM (chick chorioallantoic membrane) assay was performed, it was confirmed that the newly formed blood vessels increased in the CAM treated with the dedecane-2 peptide (Fig. 7). In addition, as a result of measuring the number of generated microvessels (microvessel) as a graph, and confirming that the number of micro-vessels showed a significant increase compared to the negative control, as in the case of treatment with the positive control group PMA, It was found that decan-2 peptide has an effect of promoting angiogenesis in vivo (FIG. 8).

In another embodiment of the present invention by treating the peptide of the present invention, the expression of vascular endothelial protein, a factor that increases angiogenesis ability (FIG. 9), HIF protein expression of cancer cells and phosphorylation of Akt protein (FIG. 10), and VEGF It was confirmed that all levels of gene expression (FIG. 11) were increased, and in addition, expression of HIF protein, a transcription factor involved in angiogenesis, was increased even in a hypoxic state (FIG. 12).

The composition of the present invention comprising the syndecane-2 peptide may be a composition for promoting angiogenesis, and in particular, may be a composition for preparing blood vessels for skin plate regeneration, wound and burn treatment, artificial skin transplantation and transplantation, but is not limited thereto. It is not. In the case of skin plate regeneration, wound and burn treatment, artificial skin transplantation and implantation of blood vessels to induce the formation of tissues, the smooth supply of blood is essential, promoting the angiogenesis using the peptide of the present invention to increase the effect Can be.

As another aspect of the invention, there is provided a pharmaceutical composition for the prevention or treatment of angiogenic dependent diseases comprising the isolated peptide.

The angiogenesis-dependent disease refers to a disease that occurs or worsens due to inability to supply blood or oxygen due to abnormal blood vessels caused by various causes, and specifically refers to a disease requiring angiogenesis, but is not limited thereto. For example, one or more days selected from the group consisting of ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, pressure sores, alopecia, acute posterior limb ischemia and cerebrovascular dementia May be, but is not limited thereto.

Ischemia, ischemic stroke, atherosclerosis, myocardial infarction, and angina are caused by blockage or narrowing of blood vessels, which can lead to disorders of body tissues and organs if oxygen and nutrients are not properly supplied through blood vessels. When this vascular dysfunction occurs in the heart muscle, the heart stops and myocardial infarction, angina pectoris, etc. occurs in the hands or the tip of the foot, ischemic retardation disease, and when it occurs in the brain, ischemic stroke, cerebrovascular dementia, etc. Can be.

Ischemic heart failure and acute posterior limb ischemia can also be caused by lack of oxygen due to inadequate blood supply due to blockage or narrowing of the ducts.

Diabetic foot ulcers are the most common complications of diabetes and are caused by high blood sugar levels in the blood vessels of diabetic patients.

Ulcers, burns, wounds, etc., such as digestive ulcers, skin ulcers, and the like, are caused by tissue damage, and a conventional treatment method is waiting for the damaged area to be healed by natural recovery power after treatment, but it takes a long time. The cure of such a disease depends on the formation of new connective tissue and epithelial tissue by cell proliferation, and it is effective to promote or stimulate the proliferation and differentiation of cells.

In addition, pressure sores are also called pressure ulcers, and vascular ulcers are caused by dying tissues due to constant or repeated pressure applied to any part of the body. Can be.

In addition, infertility may be caused by poor blood circulation in the uterus and blood circulation in the capillaries, resulting in poor conception of fertilized eggs. It can be cured.

In addition, hair loss refers to an abnormally high number of hair dropouts, and may occur when blood supply is insufficient. One of the methods of treating hair loss is a method of promoting blood circulation through the expansion of capillaries, and by promoting the angiogenesis using the peptide of the present invention can prevent or treat hair loss or promote hair growth.

The diseases may be alleviated or ameliorated by a method such as transplanting blood vessels or angiogenesis by bypassing blood vessels, and the disease may be caused by angiogenesis or transplantation of blood vessels through a pharmaceutical composition comprising the peptide of the present invention. Improve or heal them.

As one specific aspect of the present invention, the pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier.

As used herein, the term "pharmaceutically acceptable carrier" may refer to a carrier or diluent that does not interfere with the biological activity and properties of the compound to be injected without stimulating the organism. The kind of the carrier usable in the present invention is not particularly limited, and any carrier can be used as long as it is a conventionally used and pharmaceutically acceptable carrier in the art. Non-limiting examples of the carrier include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol and the like. These may be used alone or in combination of two or more thereof. The carrier may include a non-naturally occuring carrier.

The composition comprising a pharmaceutically acceptable carrier may be in various oral or parenteral formulations. When formulated, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used. Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, which form at least one excipient such as starch, calcium carbonate, sucrose or lactose (at least one compound). lactose), gelatin and the like can be mixed. In addition to simple excipients, lubricants such as magnesium stearate, talc and the like can also be used. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, and syrups, and various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable esterol such as ethyl oleate, and the like can be used.

The pharmaceutical composition is any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquid solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories. It can have one formulation.

The composition of the present invention may be administered in a pharmaceutically effective amount.

As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level refers to an individual's type and severity, age, sex, activity of the drug. , Drug sensitivity, time of administration, route of administration and rate of release, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical arts.

Preventive agent for angiogenic dependent diseases such as ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, pressure sores, alopecia, acute posterior limb ischemia or cerebrovascular dementia or The therapeutic agent may be administered daily or intermittently, and the number of administrations per day may be administered once or divided into two or three times. In addition, the compositions of the present invention can be used alone or in combination with other drug treatments for the prevention or treatment of angiogenic dependent diseases. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.

In still another aspect of the present invention, there is provided a method for promoting angiogenesis, comprising administering the angiogenic composition to a site in need of angiogenesis.

As used herein, the term "individual" means all animals including humans in need of angiogenesis, and the angiogenesis composition may be administered to an individual to promote angiogenesis. The subject means an entire mammal including a dog, cow, horse, rabbit, mouse, rat, chicken or human, but the mammal of the present invention is not limited to the above examples. Specifically, the subject may be an individual except a human.

In one embodiment of the present invention, it was confirmed that the isolated syndecane-2 peptide of the present invention exhibited an effect of promoting angiogenesis even in vivo (FIGS. 7 and 8), and promoting angiogenesis including the peptide. The composition can be administered to promote angiogenesis.

Another aspect of the present invention provides a method for treating angiogenic dependent disease, comprising administering the pharmaceutical composition for preventing or treating angiogenic dependent disease to a subject suspected of being angiogenic dependent disease.

The term “individual” means all animals including humans in need of preventing or treating angiogenic dependent diseases, and the disease can be effectively prevented and treated by administering the pharmaceutical composition. The subject means an entire mammal including a dog, cow, horse, rabbit, mouse, rat, chicken or human, but the mammal of the present invention is not limited to the above examples. Specifically, the subject may be an individual except a human.

The route of administration of the pharmaceutical composition may be administered via any general route as long as it can reach the target tissue. The composition of the present invention may be administered parenterally, intraperitoneally, intravenously, subcutaneously, subcutaneously, or orally, as desired. The composition may also be administered by any device in which the active agent may migrate to the target cell. Frequency of administration is as described above.

Specifically, the angiogenic dependent disease is a group consisting of ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, pressure sores, hair loss, acute posterior limb ischemia and cerebrovascular dementia It may be at least one selected from.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, the present invention is not limited by the following examples.

Example 1 Preparation of Syndecan-2 Peptides and Cell Culture

1-1. Construction of Syndecane-2 Peptides

Residues 79-94 (named hS2LQ: LTSAAPKVETTTLNIQ; SEQ ID NO: 1) of syndecan-2, a peptide consisting of 16 amino acid sequences in the syndecan-2 extracellular domain, were constructed. In addition, scrambled peptides for hS2LQ (Scr: IPNTSVKTLTAQLAET; SEQ ID NO: 2) as a control were synthesized using an improved version of the solid-phase method using Fmoc chemistry (Anygen Inc., Gwangju, Korea) (FIG. 1). .

1-2. Cell culture

Human umbilical vein endothelial cells (HUVEC) isolated from human umbilical cord (HUVEC) in 1% gelatin coated dish 20% FBS, 1% penicillin / streptomycin, 5 unit / Incubated in a 37 ° C. thermostat with 5% carbon dioxide using M199 (Hyclone, Logan) medium containing ml Heparin and 2 ng / ml basic-fibroblast growth factor (bFGF). Colon cancer cell lines HCT116 and HT29 cells were cultured in a 37 ° C thermostat with 5% carbon dioxide using McCoy 5A medium (Welgene, Seoul, Korea) containing 10% FBS, 1% penicillin / streptomycin.

Example 2. Confirmation of vascular endothelial cell proliferation effect of syndecan-2 peptide

In order to confirm the effect of the syndecan-2 peptide prepared in Example 1-1 on the proliferative capacity of vascular endothelial cells, vascular endothelial cells were dispensed in a 96-well plate coated with 1% gelatin, 20% FBS, 1 After culturing for about 24 hours in M199 medium containing% penicillin / streptomycin, 5 unit / ml heparin, and 2 ng / ml bFGF, it was changed to low serum medium (M199 medium containing 0.5% FBS) and incubated for 16 hours. The effect of growth factors was removed. Subsequently, after further incubating for 24 hours by treating various concentrations of the dedecane-2 peptide, cell proliferation ELISA and BrdU (Roche) were used to determine the proliferation ability according to the concentration of the dedecane-2 peptide. The vascular endothelial growth factor (VEGF) of 20 ng / ml was observed by treating the cells as a positive control. Specifically, after 4 hours of treatment with BrdU, the medium was removed and fixed with Fix Denat for 30 minutes. The anti-BrdU-POD working solution was treated for 90 minutes, washed three times with PBS, and treated with Substrate solution to measure absorbance at 370 nm (ref. 492 nm).

As a result, as shown in FIG. 2, the proliferative capacity of vascular endothelial cells was increased when treated with the dedecane-2 peptide, and the proliferative capacity was increased to 5 nM or more.

Example 3. Confirmation of the vascular endothelial cell mobility promoting effect of the syndecan-2 peptide

The effect of syndecan-2 peptide on the motility of vascular endothelial cells was observed using a transwell migration assay. A 24-well transwell (Costar, 8 μm pore size) was coated with type I collagen (0.5 mg / ml) and used after drying for 1 hour at room temperature. Under the chamber, a 10 nM synthecan-2 peptide-treated medium was placed and the chamber was incubated for 24 hours with the same number of vascular endothelial cells along with a medium without FBS, and the number of cells passing through the membrane was counted. In addition, 20 ng / ml VEGF was treated as a positive control. The separated cells were fixed with methanol for 1 minute, stained with hematoxylin for 10 minutes, and eosin for 4 minutes, and the cells on the unmoved membrane were removed with a cotton swab and balsam on slide glass. The membranes were fixed by staining and the stained cells were checked under a microscope. And counting the number of cells moved to the graph.

As shown in Figure 3 it was observed through the microscope that the movement of vascular endothelial cells by the syndecan-2 peptide. In addition, as a result of measuring the number of cells moved as shown in FIG. 4 as a graph, it was confirmed that the mobility of vascular endothelial cells was significantly increased when treated with the syndecane-2 peptide compared to the negative control group, It was almost similar to the migration of HUVEC induced by VEGF, an endothelial cell growth factor.

Example 4 Confirmation of the Synthecan-2 Peptide Promoting Vascular Endothelial Ability

The effect of the syndecan-2 peptide on the vascular endothelial ability of vascular endothelial cells was observed using a tube formation assay. Specifically, 60 μl of Matrigel (Matrigel, BD) was laid on a 96-well plate, and then gelled at 37 ° C. for 30 minutes. After culturing the vascular endothelial cells in a medium treated with 10 nM syndecane-2 peptide 8 hours later, tube formation was confirmed under a microscope. Medium treated with 20 ng / ml VEGF was used as a positive control. In addition, the length of the formed tube was measured and graphed.

As shown in FIG. 5, an increase in angiogenesis of vascular endothelial cells by synthecan-2 peptide was observed under a microscope. In addition, as a result of measuring the length of the tube formed as shown in Figure 6 as a graph, it was confirmed that significantly improved blood vessel formation capacity when treated with the dedecane-2 peptide compared to the negative control.

Example 5 Synthecan-2 Peptides in vivo  To promote angiogenesis in

In order to confirm the angiogenic effect of the syndecan-2 peptide in vivo , CAM (chick chorioallantoic membrane) assay was performed. Specifically, the purchased fertilized egg was raised for 3 days while maintaining a saturation humidity of 90% in an incubator at 37 ℃, after removing about 3 ml of albumin using a syringe, the egg shell was broken and a window of a certain size was identified, and confirmed as a fertilized egg Only one was sealed with glass tape. After 6 days of incubation, 10 nM of syndecan-2 peptide was applied to the Thermanox cover slip, dried, placed on the CAM site, sealed with tape, and incubated for 3 days. 100 ng of PMA (phorobol 12-myristate 13-acetate) was used as a positive control. After injecting 10% fat emulsion (intralipid) inside the CAM membrane, the degree of angiogenesis was observed under a microscope and photographed. The scores were scored according to the presence and extent of newly formed microvessels and the percentage of positive eggs in the total number of eggs examined was determined.

As a result, as shown in Figure 7, it was confirmed that the newly formed blood vessels increased in the CAM treated with the dedecane-2 peptide. In addition, as a result of measuring the number of generated microvessels (microvessel) as shown in FIG. 8 as a graph, it was confirmed that the number of microvessels showed a significant increase compared to the negative control, as in the case of treatment with PMA, a positive control. Through this, it was found that the syndecan-2 peptide has an effect of promoting angiogenesis in vivo .

Example 6 Analysis of Factors Increasing Angiogenesis by Syndecane-2 Peptides

6-1. Western blot  Expression Analysis of Internal Vascular Endothelial Proteins

In order to analyze the causes of angiogenesis of vascular endothelial cells by synthecan-2 peptide, the protein changes in vascular endothelial cells were analyzed by Western blot after treatment with synthecan-2 peptide. Specifically, after treatment with 10 nM syndecan-2 peptide to vascular endothelial cells, cells were recovered after 24 hours, lysed cells using RIPA buffer, and protein phosphorylation and expression changes were confirmed by Western blot. The negative control was observed by treating the scrambled peptide (Scr).

After reacting anti-phosphorylated tyrosine (22hosphor-tyrosine) antibody (Upstate Biotechnology, Inc., Lake Placid, NY / 0.5 μg / ml) as the primary antibody for 16 hours, Tris-Buffered Saline and Tween-20 (TBST) The solution was washed and reacted for 16 hours using a goat anti-mouse IgG antibody (AbClon, Seoul, Korea / 0.1 μg / ml) bound to HRP as a secondary antibody. As a result, as shown in a of FIG. 9, it was confirmed that tyrosine phosphorylation of various proteins was increased when syndecan-2 peptide was treated as in the case of the positive control VEGF.

In addition, VEGF receptors (VEGFR), phosphoinositide 3-kinase (PI3K), AKT, Erk, p38 and c-JUN N-terminal kinase (JNK) are known to affect vascular proliferation of vascular endothelial cells. The degree of phosphorylation by bipeptide treatment was observed through Western blot.

Primary antibodies include anti-phosphorylated VEGF receptor (hosphor-VEGFR) antibodies, anti-phosphorylated phosphoinositide 3-kinase (hosphor-PI3K) antibodies, anti-phosphorylated hosphor-AKT (AKT) antibodies, anti-phosphorylated Erk (hosphor-Erk) , Anti-phosphorylated p38 (hosphor-p38) and anti-phosphorylated c-JUN N-terminal kinase (hosphor-JNK) antibodies were reacted for 16 hours. The primary antibodies were purchased from Cell Signaling (Cell Signaling, Danvers, MA, USA) and reacted at a concentration of 0.2 μg / ml. Thereafter, the mixture was washed with TBST solution and reacted for 16 hours using an anti-mouse (or rabbit) IgG antibody (AbClon, Seoul, Korea / 0.1 μg / ml) in which HRP was bound as a secondary antibody.

As a result, as shown in b of FIG. 9, when treated with the syndecane-2 peptide, phosphorylation of VEGFR, phosphoinositide 3-kinase (PI3K), AKT, Erk, p38 and c-JUN N-termianl kinase (JNK) It was confirmed that the increase. Beta-actin was used to confirm that the same amount was loaded in the Western blot.

In addition, the expression of integrin, one of the adhesion receptors known to increase expression when angiogenesis was increased through Western blot.

The primary antibody was reacted for 16 hours with anti-αv antibody, anti-α5 antibody, anti-α6 antibody, anti-β1 antibody, anti-β3 antibody and anti-β4 antibody. The primary antibodies were purchased from Cell Signaling (Cell Signaling, Danvers, MA, USA) and reacted at a concentration of 0.2 μg / ml. Then, the solution was washed with TBST solution and reacted for 16 hours using HRP-coupled goat anti-rabbit IgG antibody (AbClon, Seoul, Korea / 0.1 μg / ml) as a secondary antibody.

As a result, as shown in c of FIG. 9, it was confirmed that the expression of αvβ4 was increased when the syndecan-2 peptide was treated. αvβ4 integrin is known to play an important role in the vascular endothelial cell migration and capillary formation in angiogenesis, it was confirmed that the treatment of syndecan-2 peptide can promote angiogenesis.

6-2. Analysis of Protein Expression in Cancer Cells by Western Blot

Since the increase in neovascularization is affected by the change in the signaling of cancer cells, the changes in the expression and phosphorylation of protein of cancer cells by synthecan-2 peptide were analyzed. The neovascularization increases the expression of various genes by increasing the transcription factor of HIF (hypoxia inducible factor) due to the hypoxic state in the tissue by cancer cells and binding to the HRE (hypoxia response element), the promoter region of the VEGF gene. Stabilized. The resulting VEGF promotes cell growth and migration specific to vascular endothelial cells and increases vascular permeability.

Accordingly, the change in HIF expression of cancer cells by synthecan-2 peptide was confirmed by Western blot. First, HCT116 cells were treated at various concentrations and time periods in HCT116 cells, which are colorectal cancer cell lines, and HIF-1 expression levels were compared. In addition, HT29 cells, which are other colorectal cancer cell lines, were treated with 5 nM of Sindecan-2 peptide for 24 hours, and then Western blot was used to analyze protein expression changes.

As primary antibodies, anti-HIF-1 antibodies (BD science, San Jose, California, USA / 0.2 μg / ml), anti-phosphorylated Akt ³⁰⁸ antibody and anti-phosphorylated Akt ⁴⁷³ antibody (Cell Signaling (Danvers, MA, USA) / 0.2 ㎍ / ml) after 16 hours, washed with TBST solution, 16 hours using goat anti-mouse IgG antibody (AbClon, Seoul, Korea / 0.1 ㎍ / ml) bound to HRP as a secondary antibody Reacted for a while.

As a result, as shown in a of FIG. 10, when HCT116 cells were treated with the syndecane-2 peptide, it was confirmed that the expression of HIF-1 increased as the treatment concentration increased.

Since the expression of HIF-1 is dependent on the phosphorylation of Akt protein, the analysis of the degree of Akt protein phosphorylation by synthecan-2 peptide revealed that Akt phosphorylation was increased with higher treatment concentration. It was confirmed to increase.

In addition, HIF-1 expression and phosphorylation of Akt ³⁰⁸ at 6, 15 and 24 hours after treatment with 5 nM of the Sindecan-2 peptide were compared to the case of treatment with scrambled peptide, a negative control. Expression of -1 protein was significantly increased, and it was confirmed that phosphorylation of Akt ³⁰⁸ was significantly increased (FIG. 10B).

In addition, as shown in Figure 10c, after treatment with the synthecan-2 peptide 5 nM to HT29 cells, which is another colon cancer cell line, the expression of HIF-1 protein, the degree of phosphorylation of Akt ³⁰⁸ and Akt ⁴⁷³ , negative It was confirmed that the expression of HIF-1 protein and phosphorylation of Akt protein were increased compared to the case of the control of scrambled peptide.

6-3. Confirmation of VEGF Gene Expression Increase by Syndecan-2 Peptide Treatment

In order to confirm that the expression of HIF-1 transcription factor is increased by treating the dedecane-2 peptide at 6-2, to confirm whether the increased HIF-1 transcription factor increases stabilization and expression of VEGF mRNA. , RT-PCR confirmed the amount of VEGF mRNA in cancer cells.

Specifically, a PCR composition comprising a reaction buffer (ELPiS, Korea), 1 mM dNTP (ELPiS, Korea), 1 Unit Taq polymerase (ELPiS, Korea), 0.5 pmole primer (Cosmogenetech, Korea) and 1.5 μg cDNA After the reaction for 5 minutes at 94 ℃ (initial denaturation), 30 seconds of denaturation at 94 ℃, annealing at 54 ℃ 30 seconds, extension 30 seconds at 72 ℃ was 25 cycles. In addition, the primer sequences used are summarized in Table 1 below.

		5'-3 '	SEQ ID NO:
VEGF	Forward direction		CGAAGTGGTGAAGTTCATGGATG	3
	Reverse	CTGTATCAGTCTTTCCTGGTG	4
beta-actin	Forward direction		TGGAATCCTGTGGCATCCATGAAA	5
	Reverse		TAAAACGCAGCTCAGTAACAGTCCG	6

As described above, the amount of VEGF mRNA was confirmed after 24 hours treatment of 5 nM syndecan-2 peptide to HCT116 and HT29 colorectal cancer cell lines, indicating that the amount of VEGF mRNA was increased in both cell lines (FIG. 11). b) of a and 11;

6-4. Due to hypoxic conditions HIF -1 Adjust effect

O _{2 in} cancerous tissue around blood vessels The concentration decreases further away from blood vessels, which means that oxygen concentrations can vary within a single cancerous tissue.

Accordingly, the colon cancer cell line HT-29 was incubated in a serum-free medium for 12 hours, and then treated with 5% O ₂ to establish a hypoxic condition. The HIF-1 stabilizing effect of the syndecan-2 peptide was confirmed by Western blot, and the effect of the syndecane-2 peptide on the HIF-1 ubiquitination was confirmed by an immunoprecipitation assay.

As a result, as shown in Figure 12a, when treated with the dedecane-2 peptide, it was confirmed that the expression of HIF-1 increased in 5% O ₂ conditions compared to the normal conditions. In addition, as shown in b of FIG. 12, HIF-1 ubiquitination was further reduced when the syndecan-2 peptide was treated. This means that the ubiquitination of HIF is reduced by the syndecane-2 peptide, which stabilizes the HIF protein. From the above results, the syndecane-2 peptide was able to promote angiogenesis even in a hypoxic state.

From the above description, those skilled in the art will appreciate that the present invention can be implemented in other specific forms without changing the technical spirit or essential features. In this regard, the embodiments described above are to be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the following claims and equivalent concepts rather than the detailed description are included in the scope of the present invention.

Claims (7)

1. Composition for promoting angiogenesis comprising an isolated peptide consisting of the amino acid sequence represented by SEQ ID NO: 1.
2. The composition of claim 1, wherein the composition further performs a function selected from the group consisting of skin flap regeneration, wound and burn treatment, artificial skin graft and implantation of blood vessels.
3. Pharmaceutical composition for the prevention or treatment of angiogenic dependent diseases comprising an isolated peptide, consisting of the amino acid sequence represented by SEQ ID NO: 1.
4. 4. The method of claim 3, wherein the angiogenic dependent disease is ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, pressure sores, hair loss, acute posterior limb ischemia and cerebrovascular dementia Will be selected from the group consisting of, the pharmaceutical composition.
5. A method for promoting angiogenesis, comprising administering the composition of claim 1 to an individual other than a human being in need of angiogenesis.
6. A method of preventing or treating angiogenic dependent diseases, comprising administering the composition of claim 3 to a subject other than a human suspected of being an angiogenic dependent disease.
7. 7. The method of claim 6, wherein the angiogenic dependent disease is ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, pressure sores, hair loss, acute posterior limb ischemia and cerebrovascular dementia At least one selected from the group consisting of, the method of treatment.

Images