WO2016003162A1 - Ｄｎａ-ｒｎａ 혼성 입자 및 그 제조방법 - Google Patents

Ｄｎａ-ｒｎａ 혼성 입자 및 그 제조방법 Download PDF

Info

Publication number
WO2016003162A1
WO2016003162A1 PCT/KR2015/006707 KR2015006707W WO2016003162A1 WO 2016003162 A1 WO2016003162 A1 WO 2016003162A1 KR 2015006707 W KR2015006707 W KR 2015006707W WO 2016003162 A1 WO2016003162 A1 WO 2016003162A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
rna
sequence
hybrid particles
rna hybrid
Prior art date
Application number
PCT/KR2015/006707
Other languages
English (en)
French (fr)
Inventor
이종범
박용국
Original Assignee
서울시립대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울시립대학교 산학협력단 filed Critical 서울시립대학교 산학협력단
Priority to US15/321,748 priority Critical patent/US10253317B2/en
Publication of WO2016003162A1 publication Critical patent/WO2016003162A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6867—Replicase-based amplification, e.g. using Q-beta replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/532—Closed or circular
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention relates to a particle introduced into a target cell to inhibit expression of a specific gene and a method for producing the same, and more particularly, to a DNA and an RNA partially complementarily binding to the DNA, wherein the DNA is generated in the target cell.
  • It comprises an aptamer nucleotide sequence that can bind to the target protein to be and the RNA comprises a siRNA sequence that binds to the target RNA in the target cell to inhibit the expression of the target RNA as a protein, drug (siRNA) It can be safely and effectively delivered to target cells to cure diseases, and it is composed of only DNA and RNA, which are biomaterials, so it can be used safely because it is not toxic in the body, and is produced by DNA and RNA complementary binding. And a DNA-RNA hybrid particle having a resistance to RNase and a method of preparing the same.
  • siRNA Small interfering RNA
  • Gene silencing by the siRNA has been in the spotlight as a novel disease treatment (method) due to its excellent efficiency and ability to inhibit selective expression.
  • the treatment of diseases using siRNA can obtain an excellent gene expression inhibitory effect in a small amount, and can provide improved safety with less cytotoxicity.
  • the siRNA is transferred into the cell using an organic material (polymer) as described in the following patent document.
  • the present invention has been made to solve the above problems,
  • the present invention forms a spherical nano-sized particles through partial complementary binding of DNA and RNA, wherein the DNA comprises an aptamer sequence capable of binding to the target protein, the RNA is a target RNA It is an object of the present invention to provide a DNA-RNA hybrid particle and a method for preparing the same, including a siRNA sequence that binds to and inhibits the expression of a gene, thereby safely and effectively delivering a drug (siRNA) into a target cell to treat a disease. .
  • siRNA drug
  • an object of the present invention is to provide a DNA-RNA hybrid particle having a resistance to DNase and RNase, which is a nuclease present in the body, and a method for producing the same.
  • the present invention is implemented by the embodiment having the following configuration in order to achieve the above object.
  • the DNA-RNA hybrid particles according to the present invention include DNA and RNA that partially complementarily binds the DNA, and the DNA may bind to a target protein produced in a target cell. It comprises an aptamer nucleotide sequence, wherein the RNA is characterized in that it comprises an siRNA sequence that binds to the target RNA in the target cell to inhibit the expression of the target RNA as a protein.
  • the DNA-RNA hybrid particles according to the present invention is characterized in that it has the form of spheres.
  • the DNA-RNA hybrid particles according to the invention is characterized in that it has a diameter of 100 to 150nm.
  • the DNA-RNA hybrid particles according to the present invention are characterized in that the DNA strand and the RNA strand are formed by binding and tangling with each other by partially complementary nucleotide sequences.
  • the method for producing a DNA-RNA hybrid particle according to the present invention is to complement the circular transcription DNA by ssDNA and primers comprising a base sequence complementary to a specific siRNA sequence Generating a DNA for transcription;
  • the RNA containing the siRNA sequence is generated by transcribing the circular transcriptional DNA using RNA polymerase, and the DNA containing the aptamer sequence is replicated by replicating the circular replication DNA using DNA polymerase.
  • a double enzymatic chain reaction step of forming particles by partially complementarily combining the RNA including the siRNA sequence and the DNA comprising the aptamer sequence.
  • the RNA including the siRNA base sequence is generated by rolling circle transcription, and the DNA comprising the aptamer base sequence. Is generated by rolling circle replication.
  • the RNA polymerase activation temperature and the DNA polymerase activation temperature are alternated at reaction time intervals. Characterized by sustaining for time.
  • the double enzyme chain reaction step involves mixing the transcriptional DNA and RNA polymerase in one container and activating RNA polymerase temperature.
  • the first step of maintaining the reaction time interval, and the second step of mixing the DNA for replication and DNA polymerase in another container and maintaining the DNA polymerase activation temperature during the reaction time interval, and the first step and the second After the step of mixing the contents of one container and the contents of the other container, it characterized in that it comprises a third step of maintaining the RNA polymerase activation temperature and DNA polymerase activation temperature alternately for the reaction time interval for a certain time.
  • the size and shape of the particle may be controlled by adjusting the reaction time interval.
  • the DNA generation step for transcription is complementary by mixing ssDNA and primers comprising a specific siRNA sequence and complementary base sequence.
  • the step of generating DNA for replication comprises mixing a primer with ssDNA comprising a specific aptamer sequence and a complementary sequence Complementary hybridization step, and after the hybridization step is characterized in that it comprises a ligation step to further add a ligase to the nick portion of the circular ssDNA.
  • the present invention can obtain the following effects by the above embodiment.
  • the present invention has the effect of acting as a drug and at the same time can also play the role of a drug carrier.
  • the present invention forms a spherical nano-sized particles through partial complementary binding of DNA and RNA, wherein the DNA comprises an aptamer sequence capable of binding to the target protein, the RNA is a target RNA Including an siRNA sequence that binds to and inhibits the expression of a gene, the drug (siRNA) is delivered to the target cell safely and effectively to treat the disease.
  • the DNA comprises an aptamer sequence capable of binding to the target protein
  • the RNA is a target RNA
  • siRNA sequence that binds to and inhibits the expression of a gene
  • the present invention is composed of only the biological material DNA and RNA there is no toxicity in the body there is an effect that can be used safely without side effects.
  • the present invention is produced by the complementary binding of DNA and RNA, there is an effect of having resistance to DNase and RNase which are nucleases present in the body.
  • Fig. 1 is a schematic diagram showing the principle of forming circular transcriptional (replicating) DNA.
  • Fig. 2 is a schematic diagram showing the principle of forming hybrid particles using circular transcriptional (cloning) DNA.
  • Figure 3 is a schematic diagram for explaining the process of forming a hybrid particle using a circular transcriptional (replicating) DNA.
  • Figure 4 is a micrograph of a mixed particle according to an embodiment of the present invention.
  • Figure 5 is a micrograph of the hybrid particles prepared according to the change in the concentration of RTI and circular DNA.
  • Figure 6 is a chart showing the size and distribution of DNA-RNA hybrid particles according to RTI changes.
  • FIG. 7 is a diagram showing image cytometry results for confirmation of DNA and RNA complementary binding of DNA-RNA hybrid particles.
  • Figure 8 is an application showing gel electrophoresis results to confirm the complementary binding of DNA-RNA hybrid particles according to RTI change.
  • Figure 9 is an application showing gel electrophoresis results for confirming the nucleic acid enzyme resistance of the DNA-RNA hybrid particles.
  • 10 to 12 is a confocal microscope picture for confirming the delivery capacity of the intracellular hybrid particles.
  • Figure 13 is a chart showing the cell viability assay results for confirming the cytotoxicity of the DNA-RNA hybrid particles.
  • the present invention relates to a DNA-RNA hybrid particle introduced into a target cell to inhibit expression of a target gene, wherein the DNA-RNA hybrid particle includes DNA and RNA that partially complementarily binds to the DNA.
  • the DNA-RNA hybrid particle includes DNA and RNA that partially complementarily binds to the DNA.
  • Small interfering RNA sequence Small interfering RNA sequence.
  • the DNA-RNA hybrid particles have a certain shape and size, but preferably have a spherical shape and have a diameter of 100 to 150 nm.
  • the DNA-RNA hybrid particles are formed by binding and tangling of the DNA strand and the RNA strand to each other by partially complementary sequences.
  • the DNA includes an aptamer sequence capable of binding to a target protein produced in a target cell, and a base sequence for RNA binding such that the DNA is partially complementary to the RNA.
  • the RNA includes an siRNA sequence that binds to a target RNA in a target cell and inhibits expression of the target RNA into a protein, and a base sequence for DNA binding such that the RNA is partially complementary to the DNA.
  • the base sequence for RNA binding and the base sequence for DNA binding have complementary sequences in whole or in part with each other, the DNA and RNA are partially complementary to each other to form tangled DNA-RNA hybrid particles.
  • the DNA-RNA hybrid particles have an aptamer sequence capable of binding to the target protein, the DNA-RNA hybrid particles are efficiently delivered into the target cell, and the DNA-RNA hybrid particles are siRNA sequences that inhibit the expression of the target RNA as a protein. Since it binds to the target RNA in the target cell to inhibit the expression of the gene (RNAi action).
  • the DNA-RNA hybrid particles are made of only biomaterials and have no toxicity in the body, and are formed by complementary binding of DNA-RNA, and thus have relatively high resistance to nucleases (DNase, RNase) present in the body.
  • the DNA-RNA hybrid particles are preferably prepared by the following production method, but are not limited thereto.
  • the method of preparing the DNA-RNA hybrid particles is a method for generating circular transcription DNA by complementarily binding a ssDNA (single strand DNA) and a primer (primer), including a base sequence complementary to a specific siRNA sequence.
  • By transcribing the circular transcriptional DNA using an RNA polymerase an RNA including an siRNA sequence is generated, and the circular replication DNA is replicated using a DNA polymerase.
  • the DNA generation step of the transcription is a step of generating a circular transcriptional DNA by complementary binding of the ssDNA and the primer for transcription, complementary by mixing a transcription ssDNA and primer comprising a specific siRNA sequence and complementary nucleotide sequence A hybridization step of binding, and a ligation step of ligation of the Nick portion of the circular ssDNA by further adding a ligase after the hybridization step.
  • the transcription ssDNA includes a base sequence complementary to the siRNA sequence, and a binding base sequence to enable partial complementary binding to the primer and the copy ssDNA, as shown in FIG.
  • the transcription ssDNA and primer are partially complementary to each other to hybridize, and the ligase causes the Nick portion of the circular ssDNA to be ligated.
  • the binding base sequence of the transcription ssDNA becomes a base sequence for DNA binding in the double enzyme chain reaction step.
  • the replication DNA generation step is to generate a circular replication DNA by complementary binding of the ssDNA and the primer for replication, the complementary ssDNA and primer for replication comprising a specific aptamer base and complementary base sequence Hybridization step (Hbridization) and the ligation step of ligation of the Nick portion of the circular ssDNA by additionally adding a ligase after the hybridization step.
  • the replication ssDNA includes a base sequence complementary to the aptamer base sequence, and a binding base sequence that enables partial complementary binding to the primer and the transcription ssDNA, and as shown in FIG. 1, with the replication ssDNA.
  • the primers are partially complementary to each other to hybridize and the ligase causes the Nick portion of the circular ssDNA to be ligated.
  • the binding base sequence of the ssDNA for replication becomes a base sequence for RNA binding in the double enzyme chain reaction step.
  • the RNA for the siRNA sequence is generated by rolling circular transcription (RCT) using RNA polymerase of the circular transcription DNA.
  • DNA of the aptamer sequence is generated by rolling circle replication (RCA) using DNA polymerase of circular replication, and the RNA and the aptamer sequence including the siRNA sequence Particles are formed by partially complementary binding of the containing DNA.
  • the transcription DNA and RNA polymerase are mixed in one container (A), and the RNA polymerase activation temperature (RPAT) is reacted.
  • the first step of maintaining during the time interval (RTI), and the other DNA (B) is mixed with the DNA for replication and DNA polymerase activation temperature (DNA polymerase activation temperature (DPAT)) reaction time interval (RTI)
  • DNA polymerase activation temperature (DPAT)) reaction time interval (RTI) After maintaining the second step, and after mixing the contents of one container (A) and the contents of another container (B) after the first step and the second step, RNA polymerase activation temperature (RPAT) and DNA polymerase activation And a third step of alternating the temperature DPAT to the reaction time interval RTI for a certain time.
  • the DNA polymerase may bind to transcriptional DNA to generate unnecessary DNA strands. Therefore, RCT and RCA may be stored in different containers in the initial process of the double enzyme chain reaction step to increase the efficiency of the reaction. Each proceeds separately during the reaction time interval. In the process, both transcriptases bind to the target circular DNA.
  • Transcription ssDNA [5] having a binding sequence that enables complementary binding to primers and replication ssDNA at both ends, and having a base sequence complementary to an siRNA sequence (eg, Anti-luciferase siRNA sequence) at the center [5] '-ATAGTGAGTCGTATTAACGTA (SEQ ID NO: 1) -CCAACAACTTACGCTGAGTACTTCGATTACTTGAATCGAAGTACTCAGCGTAAGTTT (SEQ ID NO: 2) -AGAGGCATATCCCT (SEQ ID NO: 3) -3']. And a primer [5'-TAATACGACTCACTATAGGGAT-3 '(SEQ ID NO: 4)] was used.
  • siRNA sequence eg, Anti-luciferase siRNA sequence
  • reaction temperature is maintained at 37 °C and 30 °C 10 minutes (RTI) for 10 minutes each, Mixed particles are prepared by repeating the temperature defense process every 10 minutes for 20 hours.
  • the hybrid particles prepared in Example 3 were identified through a scanning electron microscope (SEM), a transmission electron microscope (TEM), and an atomic force microscope (AFM). Spherical nanoparticles having a diameter of 100 ⁇ 150nm can be confirmed from the SEM photograph of Figure 4 (a). It can be seen from the TEM photograph of FIG. 4 (b) that DNA and RNA are densely packed to form nanoparticles. It can be seen from the AFM photograph of FIG. 4 (c) that the particles have a consistent morphology with the results confirmed in the SEM photograph.
  • SEM scanning electron microscope
  • TEM transmission electron microscope
  • AFM atomic force microscope
  • Example 2 In the manufacturing method of Example 3, except that the RTI was changed from 10 min to 60 min, the same conditions were used to prepare hybrid particles under the same conditions.
  • Example 3 In the manufacturing method of Example 3, the hybrid particles were prepared under the same conditions except that the transcriptional DNA and the replication DNA were changed from 3pmol to 30pmol, respectively.
  • the hybrid particles prepared in 1), 2), and 3) were identified through a scanning electron microscope (SEM) and an atomic force microscope (AFM).
  • 5 (a), (b) and (c) are SEM images of the hybrid particles prepared in Examples 1), 2) and 3), respectively, and FIGS. 5 (d), (e) and (f) ARM images of the hybrid particles prepared in Examples 1), 2), and 3) of Example 5, respectively, show that the spherical particles and the particles aggregated by aggregation coexist when the RTI is increased to 20 minutes. 5 (a), (d)). When the RTI is increased to 1 hour, the spherical particles are almost absent and the aggregated particles form the majority (see FIGS. 5 (b) and 5 (e)).
  • a hybrid particle was prepared in the same manner as in Example 3 except that the rNTP mix including Cy3-UTP was used and the dNTP mix including Cy5-dCTP was used.
  • Example 3 The hybrid particles prepared in Example 3 and Example 1, 1) were confirmed by image cytometry.
  • the results are shown in FIG. Cy3-UTP has orange fluorescent wavelengths as the product of RNA strands, and Cy5-dCTP has strong red fluorescent wavelengths as the product of DNA strands.
  • Cy3-UTP and Cy5-dCTP were not added (Example 3, Unlike (a)) of FIG. 7, two strong fluorescence wavelengths can be seen, indicating that the hybrid particles are made of DNA and RNA.
  • the leftmost lane in FIG. 8 is Lane 1 and the rightmost lane is Lane 7.
  • Lane 1 of FIG. 8 is a 100 base pair ladder.
  • Lane 2 (Example 3), 4 (1 in Example 5), and 6 (2 in Example 5) of FIG. 8 are the results when RNase H enzyme was not added.
  • Lane 3 (Example 3) and 5 (1) of Example 5 and 7 (2 of Example 5) are the results when RNase H is added.
  • Hybrid particles produced with RTI 10 min were completely decomposed by enzymes (compared to Lane 2 and 3), but hybrid particles produced with RTI 20 min (1) in Example 5) and hybrid particles produced with RTI 60 min.
  • (2) of Example 5 it can be confirmed that almost no decomposition (compared to Lane 4 and 5, compared to Lane 6 and 7).
  • RNAPol Reaction buffer 20 ⁇ l 40mM Tris-HCl, 6mM MgCl 2 , 10mM DTT, 2mM spermidine, pH 7.9@25°C
  • rNTP mix 200 nmol
  • total volume 50 ⁇ l After the addition (total volume 50 ⁇ l), and reacted for 20hr at 37 °C (RPAT) to form RNA particles.
  • Lane 2 of Figure 9 is the result of a DNA sample without nuclease (2 of Example 8)
  • Lane 3 is the result of a sample mixed with DNase I and DNA
  • Lane 4 is an RNA sample without nuclease (execution)
  • Lane 5 is the result of the mixed sample of RNase I, III and RNA
  • Lane 6 is the result of the hybridase sample without nuclease (Example 3)
  • Lane 7 is DNase This is the result of the sample mixed with I, RNase I, and III. Particles composed only of DNA were completely degraded by DNase I (compared to Lane 2 and 3), and particles composed only of RNA were also completely degraded by RNase I and III (relative to Lane 4 and 5).
  • nanoparticles formed by complementary binding of DNA and RNA although it was degraded to some extent by a degrading enzyme, a relatively large amount remained. This confirms that the nanoparticles are resistant to degrading enzymes (compared to Lane 6 and 7).
  • a hybrid particle was prepared in the same manner as in Example 3 except for using dNTP mix containing Cy5-dCTP (red fluorescent dye).
  • Example 9 The aptamer function of the ssDNA for replication in the ninth embodiment of the ninth embodiment of the ninth embodiment (NCL (necleolin) -aptamer sequence) and complementary base sequence (CCACCACCACCACCACAACCACCACCACCACC (SEQ ID NO: 6)) in Example 9 is not performed.
  • a hybrid particle was prepared under the same conditions except for using a copying ssDNA substituted with a nonsense base sequence (CGACCACTAGGATTACAGCCACCTTCACC (SEQ ID NO: 9)).
  • FIGS. 11 and 12 show magnified magnifications of only some cells compared to FIG. 10.
  • the luciferase expressed by the cells decreases as the concentration of the hybrid particles increases.
  • the RNA strands constituting the hybrid particles are decomposed into siRNA fragments by dicer enzymes present in the cells, and the siRNA fragments can induce RNAi action inside the cells.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Cell Biology (AREA)

Abstract

본 발명은 표적 세포 내로 유입되어 특정 유전자의 발현을 억제하는 입자 및 그 제조방법에 대한 것으로, 더욱 상세하게는 DNA와 상기 DNA와 부분적으로 상보적 결합하는 RNA를 포함하며 상기 DNA는 표적 세포에서 생성되는 표적 단백질과 결합할 수 있는 압타머 염기서열을 포함하고 상기 RNA는 상기 표적 세포 내의 표적 RNA에 결합하여 상기 표적 RNA가 단백질로 발현되는 것을 억제하는 siRNA 염기서열을 포함하여, 약물(siRNA)을 안전하고 효과적으로 표적 세포 내로 전달하여 질병을 치료할 수 있고, 생체물질인 DNA와 RNA로만 이루어져 체내 독성이 없어 안전하게 사용할 수 있으며, DNA와 RNA 상보적 결합에 의해 생성되므로 체내에 존재하는 핵산분해효소인 DNase와 RNase에 대해 저항성을 가지는 DNA-RNA 혼성 입자 및 그 제조방법에 대한 것이다.

Description

ＤＮＡ-ＲＮＡ 혼성 입자 및 그 제조방법
본 발명은 표적 세포 내로 유입되어 특정 유전자의 발현을 억제하는 입자 및 그 제조방법에 대한 것으로, 더욱 상세하게는 DNA와 상기 DNA와 부분적으로 상보적 결합하는 RNA를 포함하며 상기 DNA는 표적 세포에서 생성되는 표적 단백질과 결합할 수 있는 압타머 염기서열을 포함하고 상기 RNA는 상기 표적 세포 내의 표적 RNA에 결합하여 상기 표적 RNA가 단백질로 발현되는 것을 억제하는 siRNA 염기서열을 포함하여, 약물(siRNA)을 안전하고 효과적으로 표적 세포 내로 전달하여 질병을 치료할 수 있고, 생체물질인 DNA와 RNA로만 이루어져 체내 독성이 없어 안전하게 사용할 수 있으며, DNA와 RNA 상보적 결합에 의해 생성되므로 체내에 존재하는 핵산분해효소인 DNase와 RNase에 대해 저항성을 가지는 DNA-RNA 혼성 입자 및 그 제조방법에 대한 것이다.
siRNA(small interfering RNA)는 표적 RNA에 결합하여 상기 표적 RNA가 단백질로 발현(즉, 특정 유전자의 발현)되는 것을 억제한다. 상기 siRNA에 의한 유전자 발현억제(gene silencing)는 그 효율 및 선택적 발현 저해능력이 뛰어나 새로운 질병 치료제(법)로 각광받고 있다. 특히, 종래의 안티센스 올리고뉴클레오타이드(anti-sense oligonucleotide)를 이용한 치료법에 비해, siRNA를 이용한 질병 치료법은 적은 양으로 뛰어난 유전자 발현 억제 효과를 얻을 수 있고, 세포 독성이 적어 향상된 안전성을 제공할 수 있다. 위와 같은 효과를 충분히 얻기 위해서는 표적 RNA가 존재하는 세포 내로 상기 siRNA를 효과적으로 전달하는 것이 필수적인데, 일 예로 하기의 특허문헌과 같이 유기 재료(고분자)를 이용하여 siRNA를 세포 내에 전달한다.
<특허문헌>
공개 특허 제10-2007-0061770호(2007. 06. 14. 공개) "siRNA의 세포내 전달을 위한 siRNA와 친수성 고분자 간의 접합체 및 그의 제조방법"
하지만, 상기 특허문헌을 포함하는 siRNA를 표적 세포 내에 전달하기 위한 종래의 전달체는 여전히 세포막을 통해 세포 내로 섭취(uptake)되는 것과 세포 내에서 엔도좀(endosome)을 빠져 나와 세포질로 siRNA를 전달하는 것에서 어려움을 겪고 있으며, 생체 내에 존재하는 분해 효소로 인해 siRNA가 분해될 수 있기 때문에 전달 효율이 떨어지는 한계점이 존재하고, 전달체로 유무기 재료가 사용되므로 인체에 대한 안전성을 담보할 수 없는 문제가 있다.
본 발명은 상기와 같은 문제점을 해결하기 위해 안출된 것으로,
본 발명은 하나의 약물로 작용하며 동시에 약물 전달체의 역할 또한 수행할 수 있는 DNA-RNA 혼성 입자 및 그 제조방법을 제공하는데 그 목적이 있다.
또한, 본 발명은 DNA와 RNA가 부분적으로 상보적 결합을 통해 구형 형태의 나노크기의 입자를 형성하며, 상기 DNA는 표적 단백질과 결합할 수 있는 압타머 염기서열을 포함하고, 상기 RNA는 표적 RNA에 결합하여 유전자의 발현을 억제하는 siRNA 염기서열을 포함하여, 약물(siRNA)을 안전하고 효과적으로 표적 세포 내로 전달하여 질병을 치료할 수 있는 DNA-RNA 혼성 입자 및 그 제조방법을 제공하는데 그 목적이 있다.
또한, 본 발명은 생체물질인 DNA와 RNA로만 이루어져 체내 독성이 없어 부작용이 없이 안전하게 사용할 수 있는 DNA-RNA 혼성 입자 및 그 제조방법을 제공하는데 그 목적이 있다.
또한, 본 발명은 DNA와 RNA의 상보적 결합에 의해 생성되므로, 체내에 존재하는 핵산분해효소인 DNase와 RNase에 대해 저항성을 가지는 DNA-RNA 혼성 입자 및 그 제조방법을 제공하는데 그 목적이 있다.
본 발명은 앞서 본 목적을 달성하기 위하여 다음과 같은 구성을 가진 실시예에 의해 구현된다.
본 발명의 일 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자는 DNA와, 상기 DNA와 부분적으로 상보적 결합하는 RNA를 포함하며, 상기 DNA는 표적 세포에서 생성되는 표적 단백질과 결합할 수 있는 압타머 염기서열을 포함하고, 상기 RNA는 상기 표적 세포 내의 표적 RNA에 결합하여 상기 표적 RNA가 단백질로 발현되는 것을 억제하는 siRNA 염기서열을 포함하는 것을 특징으로 한다.
본 발명의 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자는 구의 형태를 가지는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자는 100 내지 150nm의 직경을 가지는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자는 DNA 가닥과 RNA 가닥이 부분적으로 상보적인 염기서열에 의해 서로 결합하고 엉키면서 형성되는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자의 제조방법은 특정 siRNA 염기서열과 상보적인 염기서열을 포함하는 ssDNA와 프라이머를 상보적으로 결합시킴으로써 원형의 전사용 DNA를 생성하는 전사용DNA생성단계와; 특정 압타머 염기서열과 상보적인 염기서열을 포함하는 ssDNA와 프라이머를 상보적으로 결합시킴으로써 원형의 복제용 DNA를 생성하는 복제용DNA생성단계와; 상기 원형의 전사용 DNA를 RNA중합효소를 사용하여 전사시킴으로써 siRNA 염기서열을 포함하는 RNA를 생성하고, 상기 원형의 복제용 DNA를 DNA중합효소를 사용하여 복제시킴으로써 압타머 염기서열을 포함하는 DNA를 생성하며, 상기 siRNA 염기서열을 포함하는 RNA와 상기 압타머 염기서열을 포함하는 DNA를 부분적으로 상보적 결합시킴으로써 입자를 형성하는 이중효소연쇄반응단계;를 포함하는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자의 제조방법에 있어서 상기 siRNA 염기서열을 포함하는 RNA는 롤링 서클 전사에 의해 생성되며, 상기 압타머 염기서열을 포함하는 DNA는 롤링 서클 복제에 의해 생성되는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자의 제조방법에 있어서 상기 이중효소연쇄반응단계에서는 RNA중합효소 활성화온도와 DNA중합효소 활성화온도를 반응시간간격으로 번갈아 가며 일정 시간 동안 지속시키는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자의 제조방법에 있어서 상기 이중효소연쇄반응단계는 일 용기에 상기 전사용 DNA와 RNA중합효소를 혼합하고 RNA중합효소 활성화온도를 반응시간간격동안 유지하는 제1단계와, 타 용기에 상기 복제용 DNA와 DNA중합효소를 혼합하고 DNA중합효소 활성화온도를 반응시간간격동안 유지하는 제2단계와, 상기 제1단계와 제2단계 후에 일 용기의 내용물과 타 용기의 내용물을 혼합한 후, RNA중합효소 활성화온도와 DNA중합효소 활성화온도를 반응시간간격으로 번갈아 가며 일정 시간 동안 지속시키는 제3단계를 포함하는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자의 제조방법에 있어서 상기 반응시간간격을 조절하여 입자의 크기 및 형태를 조절할 수 있는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자의 제조방법에 있어서 상기 전사용DNA생성단계는 특정 siRNA 염기서열과 상보적인 염기서열을 포함하는 ssDNA와 프라이머를 혼합하여 상보적 결합시키는 혼성화단계와, 상기 혼성화단계 후에 라가아제를 추가로 첨가하여 원형의 ssDNA의 nick 부분을 리게이션하는 리게이션단계를 포함하는 것을 특징으로 한다.
본 발명의 또 다른 실시예에 따르면, 본 발명에 따른 DNA-RNA 혼성 입자의 제조방법에 있어서 상기 복제용DNA생성단계는 특정 압타머 염기서열과 상보적인 염기서열을 포함하는 ssDNA와 프라이머를 혼합하여 상보적 결합시키는 혼성화단계와, 상기 혼성화단계 후에 라가아제를 추가로 첨가하여 원형의 ssDNA의 nick 부분을 리게이션하는 리게이션단계를 포함하는 것을 특징으로 한다.
본 발명은 앞서 본 실시예에 의해 다음과 같은 효과를 얻을 수 있다.
본 발명은 하나의 약물로 작용하며 동시에 약물 전달체의 역할 또한 수행할 수 있는 효과가 있다.
또한, 본 발명은 DNA와 RNA가 부분적으로 상보적 결합을 통해 구형 형태의 나노크기의 입자를 형성하며, 상기 DNA는 표적 단백질과 결합할 수 있는 압타머 염기서열을 포함하고, 상기 RNA는 표적 RNA에 결합하여 유전자의 발현을 억제하는 siRNA 염기서열을 포함하여, 약물(siRNA)을 안전하고 효과적으로 표적 세포 내로 전달하여 질병을 치료할 수 있는 효과가 있다.
또한, 본 발명은 생체물질인 DNA와 RNA로만 이루어져 체내 독성이 없어 부작용이 없이 안전하게 사용할 수 있는 효과가 있다.
또한, 본 발명은 DNA와 RNA의 상보적 결합에 의해 생성되므로, 체내에 존재하는 핵산분해효소인 DNase와 RNase에 대해 저항성을 가지는 효과가 있다.
도 1은 원형의 전사용(복제용) DNA를 형성하는 원리를 나타내는 개략도.
도 2는 원형의 전사용(복제용) DNA를 이용하여 혼성입자를 형성하는 원리를 나타내는 개략도.
도 3은 원형의 전사용(복제용) DNA를 이용하여 혼성입자를 형성하는 과정을 설명하기 위한 개략도.
도 4는 본 발명의 일 실시예에 따른 혼성입자 현미경 사진.
도 5는 RTI와 원형 DNA의 농도변화에 따라 제조된 혼성입자의 현미경 사진.
도 6은 RTI 변화에 따른 DNA-RNA 혼성입자의 크기 및 분포를 나타내는 도표.
도 7은 DNA-RNA 혼성입자의 DNA와 RNA 상보적 결합의 확인 위한 image cytometry 결과를 나타내는 도표.
도 8은 RTI 변화에 따른 DNA-RNA 혼성입자의 상보적 결합을 확인 위한 gel electrophoresis 결과를 나타내는 도포.
도 9는 DNA-RNA 혼성입자의 핵산효소 저항성을 확인 위한 gel electrophoresis 결과를 나타내는 도포.
도 10 내지 12는 세포 내 혼성입자의 전달능력을 확인하기 위한 confocal microscope 사진.
도 13은 DNA-RNA 혼성입자의 세포독성을 확인하기 위한 cell viability assay 결과를 나타내는 도표.
도 14는 DNA-RNA 혼성입자의 RNAi 작용을 확인하기 위한 실험 결과를 나타내는 도표.
이하에서는 본 발명에 따른 DNA-RNA 혼성 입자 및 그 제조방법을 첨부된 도면을 참조하여 상세히 설명한다. 특별한 정의가 없는 한 본 명세서의 모든 용어는 본 발명이 속하는 기술분야의 통상의 지식을 가진 기술자가 이해하는 당해 용어의 일반적 의미와 동일하고 만약 본 명세서에 사용된 용어의 의미와 충돌하는 경우에는 본 명세서에 사용된 정의에 따른다. 또한, 본 발명의 요지를 불필요하게 흐릴 수 있는 공지 기능 및 구성에 대해 상세한 설명은 생략한다. 명세서 전체에서, 어떤 부분이 어떤 구성요소를 "포함"한다고 할 때 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성요소를 더 포함할 수 있는 것을 의미한다.
본 발명은 표적 세포 내로 유입되어 표적 유전자의 발현을 억제하는 DNA-RNA 혼성 입자에 대한 것으로, 상기 DNA-RNA 혼성 입자는 DNA와, 상기 DNA와 부분적으로 상보적 결합하는 RNA를 포함하며, 상기 DNA는 표적 세포에서 생성되는 표적 단백질과 결합할 수 있는 압타머 염기서열(aptamer sequence)을 포함하고, 상기 RNA는 상기 표적 세포 내의 표적 RNA에 결합하여 상기 표적 RNA가 단백질로 발현되는 것을 억제하는 siRNA 염기서열(small interfering RNA sequence)을 포함한다. 상기 DNA-RNA 혼성 입자는 일정한 형태와 크기를 가지나 바람직하게는 구의 형태를 가지고 100 내지 150nm의 직경을 가진다. 상기 DNA-RNA 혼성입자는 DNA 가닥과 RNA 가닥이 부분적으로 상보적인 염기서열에 의해 서로 결합하고 엉키면서 형성되게 된다.
상기 DNA는 표적 세포에서 생성되는 표적 단백질과 결합할 수 있는 압타머 염기서열과, 상기 DNA가 상기 RNA와 부분적으로 상보적인 결합이 가능하도록 RNA결합 위한 염기서열을 포함한다. 상기 RNA는 표적 세포 내의 표적 RNA에 결합하여 상기 표적 RNA가 단백질로 발현되는 것을 억제하는 siRNA 염기서열과, 상기 RNA가 상기 DNA와 부분적으로 상보적인 결합이 가능하도록 DNA결합 위한 염기서열을 포함한다. 그리고, 상기 RNA결합 위한 염기서열과 상기 DNA결합 위한 염기서열은 전체적으로 또는 부분적으로 서로 상보적인 염기서열을 가지므로 상기 DNA와 RNA는 서로 부분적으로 상보적 결합하여 엉키면서 DNA-RNA 혼성입자를 형성하고, 상기 DNA-RNA 혼성입자는 표적 단백질과 결합할 수 있는 압타머 염기서열을 가지므로 표적세포 내로 효율적으로 전달되고, 상기 DNA-RNA 혼성입자는 표적 RNA가 단백질로 발현되는 것을 억제하는 siRNA 염기서열을 가지므로 표적세포 내의 표적 RNA와 결합하여 유전자의 발현을 억제(RNAi 작용)하게 된다. 또한, DNA-RNA 혼성입자는 생체물질로만 이루어져 체내 독성이 없으며, DNA-RNA의 상보적인 결합에 의해 형성되므로 신체 내에 존재하는 핵산분해효소(DNase, RNase)에 대해 상대적으로 큰 저항성을 가진다.
상기와 같은 DNA-RNA 혼성입자를 제조하는 방법을 이하에서 설명하기로 한다. 상기 DNA-RNA 혼성입자는 이하의 제조방법에 의해 제조되는 것이 바람직하나 이에 한정되는 것은 아니다.
상기 DNA-RNA 혼성입자의 제조방법은 특정 siRNA 염기서열과 상보적인 염기서열을 포함하는 전사용 ssDNA(single strand DNA)와 프라이머(primer)를 상보적으로 결합시킴으로써 원형의 전사용 DNA를 생성하는 전사용DNA생성단계와; 특정 압타머 염기서열과 상보적인 염기서열을 포함하는 복제용 ssDNA와 프라이머를 상보적으로 결합시킴으로써 원형의 복제용 DNA를 생성하는 복제용DNA생성단계와; 상기 원형의 전사용 DNA를 RNA중합효소(RNA polymerase)를 사용하여 전사시킴으로써 siRNA 염기서열을 포함하는 RNA를 생성하고, 상기 원형의 복제용 DNA를 DNA중합효소(DNA polymerase)를 사용하여 복제시킴으로써 압타머 염기서열을 포함하는 DNA를 생성하며, 상기 siRNA 염기서열을 포함하는 RNA와 상기 압타머 염기서열을 포함하는 DNA를 부분적으로 상보적 결합시킴으로써 입자를 형성하는 이중효소연쇄반응단계;를 포함한다.
상기 전사용DNA생성단계는 전사용 ssDNA와 프라이머를 상보적 결합시킴으로써 원형의 전사용 DNA를 생성하는 단계로, 특정 siRNA 염기서열과 상보적인 염기서열을 포함하는 전사용 ssDNA와 프라이머를 혼합하여 상보적 결합시키는 혼성화(hybridization)단계와, 상기 혼성화단계 후에 리가아제(ligase)를 추가로 첨가하여 원형의 ssDNA의 Nick 부분을 리게이션(ligation)하는 리게이션단계를 포함한다. 상기 전사용 ssDNA는 siRNA 염기서열과 상보적인 염기서열과, 프라이머 및 복제용 ssDNA와 부분적으로 상보적인 결합이 가능하도록 하는 결합 염기서열을 포함하여, 도 1에 도시된 바와 같이 상기 전사용 ssDNA와 프라이머는 서로 부분적으로 상보적 결합하여 혼성화되고 리가아제에 의해 원형의 ssDNA의 Nick 부분은 리게이션되게 된다. 상기 전사용 ssDNA의 결합 염기서열은 이중효소연쇄반응단계에서 DNA결합 위한 염기서열이 되게 된다.
상기 복제용DNA생성단계는 복제용 ssDNA와 프라이머를 상보적 결합시킴으로써 원형의 복제용 DNA를 생성하는 단계로, 특정 압타머 염기서열과 상보적인 염기서열을 포함하는 복제용 ssDNA와 프라이머를 혼합하여 상보적 결합시키는 혼성화(hybridization)단계와, 상기 혼성화단계 후에 리가아제(ligase)를 추가로 첨가하여 원형의 ssDNA의 Nick 부분을 리게이션(ligation)하는 리게이션단계를 포함한다. 상기 복제용 ssDNA는 압타머 염기서열과 상보적인 염기서열과, 프라이머 및 전사용 ssDNA와 부분적으로 상보적인 결합이 가능하도록 하는 결합 염기서열을 포함하여, 도 1에 도시된 바와 같이 상기 복제용 ssDNA와 프라이머는 서로 부분적으로 상보적 결합하여 혼성화되고 리가아제에 의해 원형의 ssDNA의 Nick 부분은 리게이션되게 된다. 상기 복제용 ssDNA의 결합 염기서열은 이중효소연쇄반응단계에서 RNA결합 위한 염기서열이 되게 된다.
상기 이중효소연쇄반응단계는 도 2에 도시된 바와 같이 상기 원형의 전사용 DNA를 RNA중합효소를 사용하여 롤링 서클 전사(rolling circle transcription, RCT)시킴으로써 siRNA 염기서열을 포함하는 RNA를 생성하고, 상기 원형의 복제용 DNA를 DNA중합효소를 사용하여 롤링 서클 복제(rolling circle amplication, RCA)시킴으로써 압타머 염기서열을 포함하는 DNA를 생성하며, 상기 siRNA 염기서열을 포함하는 RNA와 상기 압타머 염기서열을 포함하는 DNA를 부분적으로 상보적 결합시킴으로써 입자를 형성한다. 상기 이중효소연쇄반응단계는 도 3에 도시된 바와 같이 일 용기(A)에 상기 전사용 DNA와 RNA중합효소를 혼합하고 RNA중합효소 활성화온도(RNA polymerase activation temperature, RPAT)를 반응시간간격(reaction time interval, RTI)동안 유지하는 제1단계와, 타 용기(B)에 상기 복제용 DNA와 DNA중합효소를 혼합하고 DNA중합효소 활성화온도(DNA polymerase activation temperature, DPAT)를 반응시간간격(RTI)동안 유지하는 제2단계와, 상기 제1단계와 제2단계 후에 일 용기(A)의 내용물과 타 용기(B)의 내용물을 혼합한 후, RNA중합효소 활성화온도(RPAT)와 DNA중합효소 활성화온도(DPAT)를 반응시간간격(RTI)으로 번갈아 가며 일정 시간 동안 지속시키는 제3단계를 포함함으로써 이루어지게 된다. 상기 이중효소연쇄반응단계에서 DNA중합효소의 경우 전사용 DNA에 결합하여 불필요한 DNA 가닥을 생성할 수 있으므로, 반응의 효율을 높이기 위해 이중효소연쇄반응단계의 초기과정에서 RCT와 RCA를 서로 다른 용기에 각기 따로 반응시간간격 동안 진행하게 된다. 이 과정에서 두 복제효소는 목표로 하는 원형 DNA에 결합하게 된다.
이하, 실시예를 통해서 본 발명을 보다 상세히 설명하기로 한다. 하지만, 이들은 본 발명을 보다 상세하게 설명하기 위한 것일 뿐 본 발명의 권리범위가 이에 한정되는 것은 아니다.
<실시예 1> 원형의 전사용 DNA의 제조
1) 양 말단에 프라이머 및 복제용 ssDNA와 상보적인 결합이 가능하도록 하는 결합 염기서열을 가지고, 중앙에 siRNA 염기서열(일 예로 Anti-luciferase siRNA sequence)과 상보적인 염기서열을 가지는 전사용 ssDNA[5'-ATAGTGAGTCGTATTAACGTA(서열번호:1)-CCAACAACTTACGCTGAGTACTTCGATTACTTGAATCGAAGTACTCAGCGTAAGTTT(서열번호:2)-AGAGGCATATCCCT(서열번호:3)-3']를 설계하였다. 그리고, 프라이머[5'-TAATACGACTCACTATAGGGAT-3'(서열번호:4)]를 사용하였다.
2) 상기 전사용 ssDNA와 프라이머가 3μM이 되도록 하나의 튜브(Tube)에 넣은 후 thermal cycler를 이용하여 전사용 ssDNA와 프라이머가 결합되도록 하였다(전체 부피 100㎕). 상기 과정에서 전사용 ssDNA의 결합 염기서열은 프라이머와 상보적으로 결합하여 원형의 DNA가 형성되게 된다.
3) 이후, ssDNA가 완전한 원형이 될 수 있도록 Ligase buffer와 T4 Ligase를 각각 전체 부피의 1/10, 1/50의 비율로 넣어주고, 상온에서 8시간 이상 리케이션(ligation)시켜 원형의 전사용 DNA를 제조하였다.
<실시예 2> 원형의 복제용 DNA의 제조
1) 양 말단에 프라이머 및 전사용 ssDNA와 상보적인 결합이 가능하도록 하는 결합 염기서열을 가지고, 중앙에 압타머 염기서열(일 예로 NCL(necleolin)-aptamer sequence)과 상보적인 염기서열을 가지는 복제용 ssDNA[5'-AGGGATATGCCTCTAATAAATATTAA(서열번호:5)-CCACCACCACCACCACAACCACCACCACC(서열번호:6)-AATAATAAGAAGTTGGTACGTTAATACGACTCACTAT(서열번호:7)-3']를 설계하였다. 그리고, 프라이머[5'-TTAGAGGCATATCCCTATAGTG-3'(서열번호:8)]를 사용하였다.
2) 상기 복제용 ssDNA와 프라이머가 3μM이 되도록 하나의 튜브(Tube)에 넣은 후 thermal cycler를 이용하여 복제용 ssDNA와 프라이머가 결합되도록 하였다(전체 부피 100㎕). 상기 과정에서 복제용 ssDNA의 결합 염기서열은 프라이머와 상보적으로 결합하여 원형의 DNA가 형성되게 된다.
3) 이후, ssDNA가 완전한 원형이 될 수 있도록 Ligase buffer와 T4 Ligase를 각각 전체 부피의 1/10, 1/50의 비율로 넣어주고, 상온에서 8시간 이상 리케이션(ligation)시켜 원형의 복제용 DNA를 제조하였다.
<실시예 3> DNA-RNA 혼성입자의 제조
1) 도 3에 기재된 바와 같이 튜브(A)에 전사용 DNA 3pmol, T7 RNA Polymerase(500unit), RNAPol Reaction buffer 20㎕(40mM Tris-HCl, 6mM MgCl2, 10mM DTT, 2mM spermidine, pH 7.9@25℃), rNTP mix(200 nmol)를 넣어준 후(전체부피 50㎕), 37℃(RPAT)로 10min(RTI) 동안 반응시킨다.
2) 도 3에 기재된 바와 같이 튜브(B)에 복제용 DNA 3pmol, Phi29 DNA Polymerase(500unit), Reaction buffer 20㎕(400mM Tris-HCl, 500mM KCl, 100mM MgCl2, 50mM (NH4)2SO4, 40mM DTT), dNTP mix(200 nmol)를 넣어준 후(전체부피 50㎕), 30℃(DPAT)로 10min(RTI) 동안 반응시킨다.
3) 이후, 도 3에 기재된 바와 같이 상기 튜브(A)와 튜브(B)의 내용물을 혼합하고 thermal cycler에 넣고, 반응온도를 37℃와 30℃로 각각 10분(RTI)씩 유지시키고, 매 10분마다 온도변호 과정을 반복해 20시간 진행함으로써 혼성입자를 제조한다.
<실시예 4> DNA-RNA 혼성입자의 크기 및 형태의 확인
실시예 3에서 제조된 혼성입자를 SEM(scanning electron microscope), TEM(transmission electron microscope), AFM(atomic force microscope)을 통해 확인하였다. 도 4 (a)의 SEM사진으로부터 100~150nm의 직경을 갖는 구형의 나노입자를 확인할 수 있다. 도 4 (b)의 TEM사진으로부터 DNA와 RNA가 빽빽하게 밀집되어 나노입자가 형성된 것을 확인할 수 있다. 도 4 (c)의 AFM사진으로부터 SEM사진에서 확인한 결과와 일관된 입자의 형태를 가짐을 확인할 수 있다.
<실시예 5> RTI와 원형 DNA 농도 변화에 따른 DNA-RNA 혼성입자의 크기 및 형태의 확인
1) 실시예 3의 제조방법에서 RTI를 10min에서 20min로 변경한 것을 제외하고는 다른 조건을 동일하게 하여 혼성입자를 제조하였다.
2) 실시예 3의 제조방법에서 RTI를 10min에서 60min로 변경한 것을 제외하고는 다른 조건을 동일하게 하여 혼성입자를 제조하였다.
3) 실시예 3의 제조방법에서 전사용 DNA와 복제용 DNA를 각각 3pmol에서 30pmol로 변경한 것을 제외하고는 다른 조건을 동일하게 하여 혼성입자를 제조하였다.
4) 상기 1), 2), 3)에서 제조된 혼성입자를 SEM(scanning electron microscope), AFM(atomic force microscope)을 통해 확인하였다. 도 5 (a), (b), (c)는 각각 실시예 5의 1), 2), 3)에서 제조된 혼성입자의 SEM사진이고 도 5 (d), (e), (f)는 각각 실시예 5의 1), 2), 3)에서 제조된 혼성입자의 ARM사진인데, 이를 통해 RTI가 20분으로 늘어나면 구형의 particle과 aggregation에 의해 뭉쳐지는 particle이 공존하는 양상을 보인다(도 5 (a), (d) 참조). RTI가 1시간으로 늘어나면 구형의 particle은 거의 존재하지 않고 뭉쳐진 particle이 대부분을 이루는 형태를 하고 있다(도 5 (b), (e) 참조). 이 결과를 통해 RTI가 증가할수록 particle이 구형의 형태보다는 그물형태로 서로 뭉쳐지는 경향을 확인할 수 있다. 그 이유는 RTI가 증가하면 RCA와 RCT가 서로 전환되는 횟수가 줄어들고, 한번의 cycle에서 DNA와 RNA 가닥이 생성되는 시간은 증가한다. 따라서, 한번의 cycle에서 생성되는 DNA와 RNA 가닥의 길이 또한 증가하게 된다. 그러한, 긴 길이의 DNA와 RNA 가닥은 구형의 나노입자를 생성하기보다 그물을 엮는 실처럼 작용하여 그물 구조를 이루게 된다. 원형 DNA 농도를 높여줄 경우, RTI를 유지시키더라도 나노입자끼리의 뭉침에 의해 그물 구조가 형성되는 것을 확인할 수 있다(도 5 (c), (f) 참조).
<실시예 6> RTI 변화에 따른 DNA-RNA 혼성입자의 크기 및 분포의 확인
실시예 3, 실시예 5의 1) 및 실시예 5의 2)에 의해 제조된 혼성입자의 Dynamic Light Scattering(Particle Size Analyzer WI30i 입도분석기 사용)을 실시하여 그 결과 도 6에 표시하였다. RTI가 증가할수록 혼성입자의 평균 크기가 증가하고, 200nm 이하의 크기를 갖는 혼성입자는 감소하는 경향이 나타난다. 이는, 온도간격이 증가함에 따라 구형의 나노입자보다는 그물구조를 형성하기 때문이다.
<실시예 7> DNA-RNA 혼성입자의 DNA와 RNA 상보적 결합의 확인
1) 실시예 3의 제조방법에서 Cy3-UTP가 포함된 rNTP mix를 사용하고, Cy5-dCTP가 포함된 dNTP mix를 사용하는 것을 제외하고는 다른 조건을 동일하게 하여 혼성입자를 제조하였다.
2) 실시예 3 및 실시예 7의 1)에 의해 제조된 혼성입자를 image cytometry를 이용하여 확인하였다. 그 결과는 도 7에 표시하였다. Cy3-UTP는 RNA 가닥의 생성물로써 오렌지 형광파장을 띄고, Cy5-dCTP는 DNA 가닥의 생성물로써 강한 빨간색의 형광파장을 띈다. 이러한 과정을 통해 생성된 혼성입자를 image cytometry로 측정한 결과(실시예 7의 1), 도 7의 (b))를 봤을 때 Cy3-UTP와 Cy5-dCTP를 첨가하지 않았을 때(실시예 3, 도 7의 (a))와 달리 강한 두 가지 형광파장을 띄는 것을 확인할 수 있어, 혼성입자가 DNA와 RNA로 이루어짐을 알 수 있다.
3) 실시예 3, 실시예 5의 1) 및 실시예 5의 2)에 의해 제조된 혼성입자에 DNA와 RNA의 상보적 결합을 분해하는 RNase H효소(2,000 U/mL)를 혼합하여 혼성입자를 24시간 동안 반응시킨 후 gel electrophoresis를 실시하여 그 결과를 도 8에 표시하였다. 도 8의 가장 왼쪽에 위하는 Lane이 Lane 1이고 가장 오른쪽에 위치하는 Lane이 Lane 7이다. 도 8의 Lane 1은 100 base pair ladder이다. 도 8의 Lane 2(실시예 3), 4(실시예 5의 1), 6(실시예 5의 2)은 RNase H효소를 첨가하지 않았을 때의 결과이고, Lane 3(실시예 3), 5(실시예 5의 1), 7(실시예 5의 2)은 RNase H를 첨가하였을 때의 결과이다. RTI 10min로 생성한 혼성입자(실시예 3) 경우 효소에 의해 완전히 분해되었지만(Lane 2와 3 비교), RTI 20min로 생성한 혼성입자(실시예 5의 1))와 RTI 60min로 생성한 혼성입자(실시예 5의 2))의 경우 거의 분해되지 않은 것을 확인할 수 있다(Lane 4과 5 비교, Lane 6과 7 비교). 이러한 결과를 통해 혼성입자는 DNA와 RNA로 이루어지고 온도 간격이 증가함에 따라 길게 생성되는 DNA와 RNA 가닥이 상보적 결합보다는 그물구조를 형성하는 섬유와 같은 형태로 생성되어 진다는 것을 확인할 수 있다.
<실시예 8> DNA-RNA 혼성입자의 핵산분해효소에 대한 저항성 확인
1) 상기 전사용 DNA 3pmol, T7 RNA Polymerase(500unit), RNAPol Reaction buffer 20㎕(40mM Tris-HCl, 6mM MgCl2, 10mM DTT, 2mM spermidine, pH 7.9@25℃), rNTP mix(200 nmol)를 넣어준 후(전체부피 50㎕), 37℃(RPAT)로 20hr 동안 반응시켜 RNA입자를 형성하였다.
2) 상기 복제용 DNA 3pmol, Phi29 DNA Polymerase(500unit), Reaction buffer 20㎕(400mM Tris-HCl, 500mM KCl, 100mM MgCl2, 50mM (NH4)2SO4, 40mM DTT), dNTP mix(200 nmol)를 넣어준 후,(전체부피 50㎕), 30℃(DPAT)로 20hr 동안 반응시켜 DNA입자를 형성하였다.
3) 실시예 3, 실시예 8의 1) 및 실시예 8의 2)에 의해 제조된 혼성입자에 핵산분해효소를 혼합하여 5시간 반응시킨 후 gel electrophoresis를 실시하여 그 결과를 도 9에 표시하였다. 도 9의 가장 왼쪽에 위하는 Lane이 Lane 1이고 가장 오른쪽에 위치하는 Lane이 Lane 7이다. 도 9의 Lane 1은 100 base pair ladder이다. 도 9의 Lane 2는 핵산분해효소 없는 DNA시료(실시예 8의 2))의 결과이고, Lane 3은 DNase Ⅰ과 DNA가 혼합된 시료의 결과이며, Lane 4는 핵산분해효소 없는 RNA시료(실시예 8의 1))의 결과이고, Lane 5는 RNase Ⅰ, Ⅲ와 RNA가 혼합된 시료의 결과이며, Lane 6은 핵산분해효소 없는 혼성입자시료(실시예 3)의 결과이고, Lane 7은 DNase Ⅰ, RNase Ⅰ, Ⅲ와 혼성입자가 혼합된 시료의 결과이다. DNA로만 이루어진 입자의 경우 DNase I에 의해 완전히 분해되었고(Lane 2과 3 비교), RNA로만 이루어진 입자 역시 RNase I, Ⅲ에 의해 완전히 분해되었다(Lane 4과 5 대비). 하지만 DNA와 RNA의 상보적 결합에 의해 형성된 나노입자의 경우 분해효소에 의해 어느 정도 분해되기는 하였지만 여전히 상대적으로 많은 양이 남아있는 것을 확인할 수 있다. 이를 통해 나노입자가 분해효소에 대해 저항성을 지니고 있음을 확인할 수 있다(Lane 6와 7 대비).
<실시예 9> DNA-RNA 혼성입자의 표적 세포 내 전달 능력 확인
1) 실시예 3의 제조방법에서 Cy5-dCTP(red 형광 dye)가 포함된 dNTP mix를 사용하는 것을 제외하고는 다른 조건을 동일하게 하여 혼성입자를 제조하였다.
2) 실시예 9의 1) 제조방법에서 복제용 ssDNA의 압타머 염기서열(NCL(necleolin)-aptamer sequence)과 상보적인 염기서열(CCACCACCACCACCACAACCACCACCACC(서열번호:6)) 대신에 압타머 기능을 수행하지 않는 무의미한 염기서열(CGACCACTAGGATTACAGCCACCTTCACC(서열번호:9))로 치환한 복제용 ssDNA를 사용하는 것을 제외하고는 다른 조건을 동일하게 하여 혼성입자를 제조하였다.
3) ① 96well plate에 7,000 cell/well의 조건으로 cell(MDA-MB-231(NCL을 가짐))을 처리하고, ② 처리된 cell이 well 바닥에 완전히 붙도록 24시간 동안 incubation시키고, ③ growth medium을 제거하고 opti-mem과 sample(실시예 9의 1)에 의해 제조된 혼성입자)을 3:1로 혼합한 후 각 well에 넣고, ④ 4시간 incubation 후 opti-mem과 sample 혼합물을 제거하고 고정액(4% Paraformaldehyde)을 넣고, ⑤ 10분 후 고정액을 제거하고 Actin-dye를 각 well에 넣어 세포질을 염색하고, ⑥ 10분 후 Actin-dye solution을 제거하고 mounting solution을 slide 표면에 처리하고, ⑦ cover glass로 slide를 덮은 후 confocal microscope를 통해 세포 내부를 확인하여 그 결과를 도 10의 (b), 도 11 및 도 12의 (a)에 나타내었다.
4) 실시예 9의 3)에서 sample을 사용하지 않은 것을 제외하고는 동일하게 실험하여 그 결과를 도 10의 (a)에 나타내었다.
5) 실시예 9의 3)에서 sample을 실시예 9의 1)에 의해 제조된 혼성입자에서 실시예 9의 2)에 의해 제조된 혼성입자로 변경한 것을 제외하고는 동일하게 실험하여 그 결과를 도 12의 (b)에 나타내었다. 참고로, 도 11 및 12는 도 10에 비해 현미경의 배율을 높여 일부 세포만을 확대하여 나타내었다.
6) transfection되지 않은 세포(실시예 9의 4))와 달리 transfection된 세포(실시에 9의 3))의 세포질 내부에 빨간색의 형광이 나타나는 것을 볼 수 있다(도 10의 (a)와 (b) 비교). 도 11을 보면, 세포질 내부와 세포막 주위(파란색으로 표기)에 혼성입자(빨간색으로 표기)가 다수 존재하는 것을 알 수 있다. 도 12의 (a)를 보면 NCL-압타머가 존재하는 혼성입자(빨간색으로 표기)는 세포질(녹색, 파란색으로 표기) 내부에 존재하나 무의미한 염기서열이 존재하는 혼성입자는 세포질 내부에 존재하지 않음을 알 수 있다. 따라서, NCL-압타머를 가지는 혼성입자는 세포막 주위 및 내부에 다수가 위치하는 것을 확인할 수 있어 혼성입자를 효과적으로 세포에 전달할 수 있음을 알 수 있다.
<실시예 10> DNA-RNA 혼성입자의 세포 내 독성 확인
1) ① 96well plate에 7,000 cell/well의 조건으로 cell(hela)을 처리하고, ② 처리된 cell이 well 바닥에 완전히 붙도록 24시간 동안 incubation한 후, ③ growth medium을 제거하고 opti-mem과 sample(실시예 3)을 혼합한 후(혼성입자가 0, 0.04, 0.2, 1, 5fM이 되도록) 각 well에 넣고, ④ 4시간 incubation 후 opti-mem과 sample 혼합물을 제거하고 growth medium으로 교체하고, ⑤ medium 교체 후 48시간 동안 세포를 incubation하고, ⑥ 48시간 이후 growth medium을 제거하고 MTT(3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) stock solution을 각 well에 넣고, ⑦ MTT stock solution을 넣고 4시간을 기다린 후 formazan crystal 용해 용매를 각 well에 넣어 crystal을 solution상태로 녹인 후, ⑧ Microplate reader 장비를 이용하여 formazan crystal이 녹아있는 각 well의 solution의 흡광도(570nm)를 측정하고, ⑩ 아무 처리를 하지 않은(혼성입자를 혼합하지 않은) 세포가 있는 well의 흡광도와 비교하여 상대적인 비율을 계산하여, 그 결과를 도 13에 나타내었다.
2) 도 13을 통해, 혼성입자의 농도를 높여가며 세포에 처리하여도 세포는 95% 이상 생존하는 것을 알 수 있다. 따라서, 혼성입자는 DNA와 RNA로만 이루어져 있기 때문에 체내적합성이 매우 뛰어나다는 것을 알 수 있다.
<실시예 11> DNA-RNA 혼성입자의 RNAi 작용 확인
1) ① 96well plate에 7,000 cell/well의 조건으로 cell(hela 세포에 luciferase 유전자를 도입한 세포)을 처리한 후, ② 처리된 cell이 well 바닥에 완전히 붙도록 24시간 동안 incubation한 후, ③ growth medium을 제거하고 opti-mem과 sample(실시예 3)을 혼합한 후(혼성입자가 0, 1, 2.5, 5fM이 되도록) 각 well에 넣고, ④ 4시간 incubation한 후 opti-mem과 sample 혼합물을 제거하고 growth medium으로 교체하고, ⑤ medium 교체 후 48시간 동안 세포를 incubation하고, ⑥ 48시간 이후 각 well에 Dual-Glo luciferase stock solution을 넣고 10분 후 Microplate reader 장비를 이용하여 각 well의 luminescence(590nm)를 측정하고, ⑦ 48시간 이후 각 well에 Dual-Glo stop&Glo stock solution을 넣고 10분 후 Microplate reader 장비를 이용하여 각 well의 luminescence (590nm)를 측정하고, ⑧ 위에서 측정한 형광도의 비율을 통해 각 well의 luciferase 형광 발현도를 확인하여, 도 14에 나타내었다.
2) 도 14를 통해, 혼성입자의 농도를 더 높여줄수록 세포가 발현하는 luciferase가 감소하는 것을 확인할 수 있다. 이를 통해 세포 내부에 존재하는 dicer 효소에 의해 혼성입자를 이루고 있는 RNA 가닥들이 siRNA 단편으로 분해되고, 그러한 siRNA 단편들은 세포 내부에서 RNAi 작용을 유도할 수 있음을 알 수 있다.
이상에서, 출원인은 본 발명의 바람직한 실시예들을 설명하였지만, 이와 같은 실시예들은 본 발명의 기술적 사상을 구현하는 일 실시예일 뿐이며 본 발명의 기술적 사상을 구현하는 한 어떠한 변경예 또는 수정예도 본 발명의 범위에 속하는 것으로 해석되어야 한다.

Claims (11)

  1. 표적 세포 내로 유입되어 표적 유전자의 발현을 억제하는 입자에 있어서,
    상기 입자는 DNA와, 상기 DNA와 부분적으로 상보적 결합하는 RNA를 포함하며, 상기 DNA는 표적 세포에서 생성되는 표적 단백질과 결합할 수 있는 압타머 염기서열을 포함하고, 상기 RNA는 상기 표적 세포 내의 표적 RNA에 결합하여 상기 표적 RNA가 단백질로 발현되는 것을 억제하는 siRNA 염기서열을 포함하는 것을 특징으로 하는 DNA-RNA 혼성 입자.
  2. 제1항에 있어서, 상기 DNA-RNA 혼성 입자는
    구의 형태를 가지는 것을 특징으로 하는 DNA-RNA 혼성 입자.
  3. 제2항에 있어서, 상기 DNA-RNA 혼성 입자는
    100 내지 150nm의 직경을 가지는 것을 특징으로 하는 DNA-RNA 혼성 입자.
  4. 제1항에 있어서, 상기 DNA-RNA 혼성 입자는
    DNA 가닥과 RNA 가닥이 부분적으로 상보적인 염기서열에 의해 서로 결합하고 엉키면서 형성되는 것을 특징으로 하는 DNA-RNA 혼성 입자.
  5. 특정 siRNA 염기서열과 상보적인 염기서열을 포함하는 전사용 ssDNA와 프라이머를 상보적으로 결합시킴으로써 원형의 전사용 DNA를 생성하는 전사용DNA생성단계와;
    특정 압타머 염기서열과 상보적인 염기서열을 포함하는 복제용 ssDNA와 프라이머를 상보적으로 결합시킴으로써 원형의 복제용 DNA를 생성하는 복제용DNA생성단계와;
    상기 원형의 전사용 DNA를 RNA중합효소를 사용하여 전사시킴으로써 siRNA 염기서열을 포함하는 RNA를 생성하고, 상기 원형의 복제용 DNA를 DNA중합효소를 사용하여 복제시킴으로써 압타머 염기서열을 포함하는 DNA를 생성하며, 상기 siRNA 염기서열을 포함하는 RNA와 상기 압타머 염기서열을 포함하는 DNA를 부분적으로 상보적 결합시킴으로써 입자를 형성하는 이중효소연쇄반응단계;를 포함하는 것을 특징으로 하는 DNA-RNA 혼성 입자의 제조방법.
  6. 제5항에 있어서,
    상기 siRNA 염기서열을 포함하는 RNA는 롤링 서클 전사에 의해 생성되며, 상기 압타머 염기서열을 포함하는 DNA는 롤링 서클 복제에 의해 생성되는 것을 특징으로 하는 DNA-RNA 혼성 입자의 제조방법.
  7. 제5항에 있어서, 상기 이중효소연쇄반응단계에서는
    RNA중합효소 활성화온도와 DNA중합효소 활성화온도를 반응시간간격으로 번갈아 가며 일정 시간 동안 지속시키는 것을 특징으로 하는 DNA-RNA 혼성입자의 제조방법.
  8. 제5항에 있어서, 상기 이중효소연쇄반응단계는
    일 용기에 상기 전사용 DNA와 RNA중합효소를 혼합하고 RNA중합효소 활성화온도를 반응시간간격동안 유지하는 제1단계와; 타 용기에 상기 복제용 DNA와 DNA중합효소를 혼합하고 DNA중합효소 활성화온도를 반응시간간격동안 유지하는 제2단계와; 상기 제1단계와 제2단계 후에 일 용기의 내용물과 타 용기의 내용물을 혼합한 후, RNA중합효소 활성화온도와 DNA중합효소 활성화온도를 반응시간간격으로 번갈아 가며 일정 시간 동안 지속시키는 제3단계;를 포함하는 것을 특징으로 하는 DNA-RNA 혼성입자의 제조방법.
  9. 제7항에 있어서,
    상기 반응시간간격을 조절하여 입자의 크기 및 형태를 조절할 수 있는 것을 특징으로 하는 DNA-RNA 혼성 입자의 제조방법.
  10. 제5항에 있어서, 상기 전사용DNA생성단계는
    특정 siRNA 염기서열과 상보적인 염기서열을 포함하는 전사용 ssDNA와 프라이머를 혼합하여 상보적 결합시키는 혼성화단계와, 상기 혼성화단계 후에 라가아제를 추가로 첨가하여 원형의 ssDNA의 Nick 부분을 리게이션하는 리게이션단계를 포함하는 것을 특징으로 하는 DNA-RNA 혼성 입자의 제조방법.
  11. 제5항에 있어서, 상기 복제용DNA생성단계는
    특정 압타머 염기서열과 상보적인 염기서열을 포함하는 복제용 ssDNA와 프라이머를 혼합하여 상보적 결합시키는 혼성화단계와, 상기 혼성화단계 후에 라가아제를 추가로 첨가하여 원형의 ssDNA의 Nick 부분을 리게이션하는 리게이션단계를 포함하는 것을 특징으로 하는 DNA-RNA 혼성 입자의 제조방법.
PCT/KR2015/006707 2014-06-30 2015-06-30 Ｄｎａ-ｒｎａ 혼성 입자 및 그 제조방법 WO2016003162A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/321,748 US10253317B2 (en) 2014-06-30 2015-06-30 DNA-RNA hybrid particles and manufacturing method thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140080448A KR101660016B1 (ko) 2014-06-30 2014-06-30 Ｄｎａ―ｒｎａ 혼성 입자 및 그 제조방법
KR10-2014-0080448 2014-06-30

Publications (1)

Publication Number Publication Date
WO2016003162A1 true WO2016003162A1 (ko) 2016-01-07

Family

ID=55019618

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/006707 WO2016003162A1 (ko) 2014-06-30 2015-06-30 Ｄｎａ-ｒｎａ 혼성 입자 및 그 제조방법

Country Status (3)

Country Link
US (1) US10253317B2 (ko)
KR (1) KR101660016B1 (ko)
WO (1) WO2016003162A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108753929A (zh) * 2018-04-24 2018-11-06 绿城农科检测技术有限公司 一种微流体芯片及其改性方法和在检测食品细菌数量上的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050057290A (ko) * 2002-09-09 2005-06-16 더 리전트 오브 더 유니버시티 오브 캘리포니아 짧은 간섭 핵산 하이브리드 및 그 제조방법
US20050164212A1 (en) * 2003-03-06 2005-07-28 Todd Hauser Modulation of gene expression using DNA-RNA hybrids
WO2007087544A2 (en) * 2006-01-23 2007-08-02 Trilink Biotechnologies, Inc. Novel compositions of chemically modified small interfering rna
US20090317906A1 (en) * 2004-11-16 2009-12-24 Qiagen Gmbh Gene silencing using sense dna and antisense rna hybrid constructs coupled to peptides facilitating the uptake into cells

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2006280600B2 (en) 2005-08-17 2012-01-19 Bioneer Corporation Sirna-hydrophilic polymer conjugates for intracellular delivery of siRNA and method thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050057290A (ko) * 2002-09-09 2005-06-16 더 리전트 오브 더 유니버시티 오브 캘리포니아 짧은 간섭 핵산 하이브리드 및 그 제조방법
US20050164212A1 (en) * 2003-03-06 2005-07-28 Todd Hauser Modulation of gene expression using DNA-RNA hybrids
US20090317906A1 (en) * 2004-11-16 2009-12-24 Qiagen Gmbh Gene silencing using sense dna and antisense rna hybrid constructs coupled to peptides facilitating the uptake into cells
WO2007087544A2 (en) * 2006-01-23 2007-08-02 Trilink Biotechnologies, Inc. Novel compositions of chemically modified small interfering rna

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PARK, YONG GUK ET AL.: "Synthesis of DNA-RNA hybrid nanoparticles by circle reaction for efficient siRNA delivery", SPRING CONFERENCE OF THE KOREAN SOCIETY OF INDUSTRIAL AND ENGINEERING CHEMISTRY POSTER PUBLICATION., 2 May 2014 (2014-05-02) *

Also Published As

Publication number Publication date
KR101660016B1 (ko) 2016-09-30
US10253317B2 (en) 2019-04-09
KR20160001938A (ko) 2016-01-07
US20170240889A1 (en) 2017-08-24

Similar Documents

Publication Publication Date Title
US11634713B2 (en) Extended dicer substrate agents and methods for the specific inhibition of gene expression
Wilhelm et al. SMC condensin entraps chromosomal DNA by an ATP hydrolysis dependent loading mechanism in Bacillus subtilis
JP7032452B2 (ja) ヌクレオチド配列決定のためのヒドロゲルビーズ
Shopsowitz et al. RNAi‐microsponges form through self‐assembly of the organic and inorganic products of transcription
Schneider Bacteriophage-mediated horizontal gene transfer: transduction
US9932566B2 (en) CIS-blocked guide RNA
Shi et al. MicroRNA-responsive release of Cas9/sgRNA from DNA nanoflower for cytosolic protein delivery and enhanced genome editing
CN102325534B (zh) 延长的dicer酶底物和特异性抑制基因表达的方法
Kotay et al. Biocontrol of biomass bulking caused by Haliscomenobacter hydrossis using a newly isolated lytic bacteriophage
EP2633067B1 (en) Luminophore-labeled molecules coupled with particles for microarray-based assays
Zhang et al. Comparative analysis of microRNA expression profiles of exosomes derived from normal and hypoxic preconditioning human neural stem cells by next generation sequencing
Piano et al. Recombination-dependent concatemeric viral DNA replication
US20180201998A1 (en) Compositions and methods for detection of genetic deafness gene mutation
US10982267B2 (en) Luminophore-labeled molecules coupled with particles for microarray-based assays
AU2018345683A1 (en) Modified Cpf1 guide RNA
RO120410B1 (ro) Molecule de adn catalitic, cu activitate endonucleazică
CN107569448B (zh) 一种自组装dna水凝胶的制备方法及其应用
CN113943764B (zh) 一种制备双链rna的方法
WO2016003162A1 (ko) Ｄｎａ-ｒｎａ 혼성 입자 및 그 제조방법
Chen et al. The morpholino molecular beacon for specific RNA visualization in vivo
Watkins et al. Regulatory roles of small rnas in prokaryotes: Parallels and contrast with eukaryotic mirna
Chen et al. Recent advances in fluorescence resonance energy transfer-based probes in nucleic acid diagnosis
CN104962555B (zh) 利用级联的dna链替换反应的细胞内非编码rna检测方法
Asanuma et al. De novo design of functional oligonucleotides with acyclic scaffolds
CN108676799A (zh) 基于编码悬浮微芯片的级联扩增检测miRNAs的探针、试剂盒及方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15814441

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15321748

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 15814441

Country of ref document: EP

Kind code of ref document: A1