Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
  • C12N2310/141—MicroRNAs, miRNAs
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
  • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
  • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
  • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/40—Vector systems having a special element relevant for transcription being an insulator

Definitions

• the field of the disclosure relates to gene therapy vector compositions comprising a genomic insulator and uses thereof.
• Hematopoietic stem cell gene therapy has already made an impact on the treatment of several inherited diseases.
• Patients with X-linked SCID (1), adenosine deaminase deficiency (2), X- linked adeno-leukodystrophy (3) and beta thalassemia (4) have been cured of their disease or their clinical status was dramatically improved.
• genotoxic side effects secondary to vector- mediated insertional mutagenesis appeared in a proportion of patients, including T-cell leukemia in almost 25% of patients treated in the X-linked SCID gene therapy trials (1).
• Genotoxicity arises from the activation of cellular oncogenes by the enhancers in the viral vectors (reviewed in 5,6).
• Various approaches have been attempted to decrease the risks of insertional mutagenesis.
• compositions and methods described herein are based, in part, on the discovery of a method for identifying a high potency genomic insulator that can provide strong insulator activity when administering an exogenous nucleic acid sequence. Such strong insulator activity can, for example, prevent oncogene activation.
• compositions comprising gene therapy vectors encoding at least one copy of a genomic insulator element and uses thereof.
• the compositions and methods described herein have the advantage of reducing tumor formation compared to gene therapy vectors lacking high potency genomic insulator element(s) as described herein.
• the high potency genomic insulator elements described herein are small in size, such that they can be easily incorporated into gene therapy vectors without significantly affecting viral titers.
• a viral vector composition encoding: at least one copy of a high potency genomic insulator element, wherein the genomic insulator element comprises a sequence less than 400 bp and a CTCF binding site core sequence.
• CTCF is the name given to the CCCTC-binding factor initially discovered as a negative transcriptional regulator of the chicken c-myc gene (Lobanenkov, W. et ah, (1990) Oncogene 5; 1743-1752).
• the viral vector is a retroviral vector.
• the retroviral vector is a lentiviral vector.
• the viral vector is an adenoviral vector or adeno-associated viral vector.
• the viral vector is a gene therapy vector.
• the vector further comprises a sequence encoding a therapeutic agent.
• the core sequence is a 14 bp sequence selected from the group consisting of: CACCAGGTGGCGCT (SEQ ID NO.: 1), CCACCAGGGGGAGC (SEQ ID NO.: 2), TCAGTAGAGGGCGC (SEQ ID NO.: 3), CCACTAGGGGGCAG (SEQ ID NO.: 4), CAGCAGAGGGCGCT (SEQ ID NO.: 5),
• CAGTAGAGGGCGCT SEQ ID NO.: 6
• CCCTCTCCTGGGCA SEQ ID NO.: 7
• the genomic insulator element comprises a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 21, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 31, SEQ ID NO.: 32, SEQ ID NO.: 33, SEQ ID NO.: 34, SEQ ID NO.: 35, and SEQ ID NO.: 36.
• the vector comprises at least two genomic insulator elements.
• the at least two genomic insulator elements are positioned in the vector such that they flank the vector pro virus.
• the vector comprises two copies of the same genomic insulator element.
• the at least two genomic insulator elements are two different genomic insulator elements.
• the at least two genomic insulator elements are each a 14 bp sequence selected from the group consisting of:
• TCAGTAGAGGGCGC SEQ ID NO.: 3
• CCACTAGGGGGCAG SEQ ID NO.: 4
• CAGCAGAGGGCGCT SEQ ID NO.: 5
• CAGTAGAGGGCGCT SEQ ID NO.: 6
• CCCTCTCCTGGGCA SEQ ID NO.: 7
• GCAGCAGAGAGCAA SEQ ID NO.: 8
• the at least two genomic insulator elements each comprise a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 21, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 31, SEQ ID NO.: 32, SEQ ID NO.: 33, SEQ ID NO.: 34, SEQ ID NO.: 35, and SEQ ID NO.: 36.
• CTCF binding site core sequence is a high occupancy CTCF binding site in the human genome.
• the high occupancy site comprises at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% CTCF occupancy.
• the high occupancy site is determined in a K562 myelogenous leukemia immortalized cell line.
• the gene insulator element does not significantly alter viral titers of the vector.
• the sequence of the genomic insulator element is less than 300 bp. In another embodiment of this aspect and all other aspects described herein, the sequence of the genomic insulator elements is less than 400 bp.
• the genomic insulator element does not substantially comprise silencer activity.
• the vector optionally comprises one or more of the following: (a) a promoter, (b) an enhancer, (c) a restriction site, (d) an untranslated region, (e) a DNasel-hypersensitive site, (f) a multiple cloning site, (g) a long terminal repeat, or (h) a sequence encoding a poly A tail.
• the therapeutic agent comprises a gene of interest, a protein, a dominant negative mutant, an RNA interference agent, or an miRNA.
• the therapeutic agent is a zinc finger nuclease, a TALEN, a CRISPR, or a meganuclease.
• the high potency genomic insulator exhibits an enhancer blocking activity greater than that of the cHS4 insulator element. In one embodiment, the high potency genomic insulator exhibits an enhancer blocking activity at least 50% greater than that of the cHS4 insulator element.
• the high potency genomic insulator exhibits an enhancer blocking activity at least 75%, at least 80%, at least 90%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20- fold, at least 50-fold, at least 100-fold (or more) greater than that of the cHS4 insulator element.
• Also provided herein in another aspect is a method for identifying a high potency genomic insulator, the method comprising: (a) determining the occupancy of one or more CTCF binding motifs in a genome by CTCF protein, and (b) testing for enhancer blocking activity, thereby identifying a high potency genomic insulator.
• the method further comprises the following steps after step (a): (i) classifying the one or more CTCF binding motifs determined to have occupancy by CTCF into classes each having a unique CTCF core sequence, (ii) ranking the classes of CTCF binding motifs identified in step (i) by their CTCF occupancy from highest occupancy to lowest, and (iii) selecting one or more CTCF binding motifs within a highly ranked class.
• (a) of determining the occupancy of one or more CTCF binding motifs in a genome comprises the following steps: (i) determining the number of instances of one or more CTCF binding motifs in the genome by scanning a database comprising the substantially complete genomic sequence for the one or more CTCF binding motifs, (ii) identifying the one or more CTCF binding motifs in the genome that function to bind CTCF using a database comprising sequences that bind CTCF determined using ChlP-sequencing technology, (iii) aligning each instance of the one or more CTCF binding motifs of step (i) with the CTCF binding data of step (ii), and (iv) calculating the percentage of CTCF binding motifs instances that function to bind CTCF, thereby determining the occupancy.
• the core sequence is a 14 bp sequence selected from the group consisting of:
• TCAGTAGAGGGCGC SEQ ID NO.: 3
• CCACTAGGGGGCAG SEQ ID NO.: 4
• CAGCAGAGGGCGCT SEQ ID NO.: 5
• CAGTAGAGGGCGCT SEQ ID NO.: 6
• CCCTCTCCTGGGCA SEQ ID NO.: 7
• GCAGCAGAGAGCAA SEQ ID NO.: 8
• CTCF binding motif comprises a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 21, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 31, SEQ ID NO.: 32, SEQ ID NO.: 33, SEQ ID NO.: 34, SEQ ID NO.: 35, and SEQ ID NO.: 36.
• the occupancy of the CTCF binding motif selected for testing exhibits at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% CTCF occupancy in an established cell line or in primary cells.
• CTCF occupancy can be determined relative to the occupancy determined in K562 cells.
• the sequence of the CTCF binding motif is less than 300 bp. In another embodiment of this aspect and all other aspects described herein, the sequence of the CTCF binding motif is less than 400 bp.
• the high potency genomic insulator exhibits an enhancer blocking activity greater than that of the cHS4 insulator element. In one embodiment, the high potency genomic insulator exhibits an enhancer blocking activity at least 50% greater than that of the cHS4 insulator element. In other embodiments, the high potency genomic insulator exhibits an enhancer blocking activity at least 75%, at least 80%, at least 90%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20- fold, at least 50-fold, at least 100-fold (or more) greater than that of the cHS4 insulator element.
• Also provided herein in another aspect is a method for treating a disease, the method comprising administering a vector as described herein, wherein the vector further comprises a sequence encoding a therapeutic agent, and wherein the therapeutic agent mediates treatment of the disease.
• the therapeutic agent comprises a protein, a dominant negative mutant, an RNA interference agent, or an miRNA.
• the high potency genomic insulator exhibits an enhancer blocking activity greater than that of the cHS4 insulator element. In one embodiment, the high potency genomic insulator exhibits an enhancer blocking activity at least 50% greater than that of the cHS4 insulator element. In other embodiments, the high potency genomic insulator exhibits an enhancer blocking activity at least 75%, at least 80%, at least 90%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20- fold, at least 50-fold, at least 100-fold (or more) greater than that of the cHS4 insulator element.
• Another aspect provided herein relates to a method for administering a nucleic acid encoding a therapeutic agent, the method comprising administering to a subject a viral vector encoding: (a) a therapeutic agent, and (b) at least one copy of a high potency genomic insulator element, wherein the genomic insulator element comprises a sequence less than 400 bp and a CTCF binding site core sequence.
• the gene therapy vector reduces tumor formation in the subject by at least 50% compared to a gene therapy vector lacking the high potency genomic insulator element.
• the vector produces an at least 10-fold reduction in rate of tumor production compared to the same vector lacking the high potency genomic insulator element. In other embodiments, the vector produces an at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 100-fold or more reduction in rate of tumor production compared to the same vector lacking the high potency genomic insulator element.
• the viral vector is a retroviral vector.
• the retroviral vector is a lentiviral vector.
• the viral vector is an adenoviral vector or adeno-associated viral vector.
• the core sequence is a 14 bp sequence selected from the group consisting of:
• TCAGTAGAGGGCGC SEQ ID NO.: 3
• CCACTAGGGGGCAG SEQ ID NO.: 4
• CAGCAGAGGGCGCT SEQ ID NO.: 5
• CAGTAGAGGGCGCT SEQ ID NO.: 6
• CCCTCTCCTGGGCA SEQ ID NO.: 7
• GCAGCAGAGAGCAA SEQ ID NO.: 8
• the genomic insulator element comprises a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 21, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 31, SEQ ID NO.: 32, SEQ ID NO.: 33, SEQ ID NO.: 34, SEQ ID NO.: 35, and SEQ ID NO.: 36.
• the vector comprises at least two genomic insulator elements.
• the at least two genomic insulator elements are positioned in the vector such that they flank the vector pro virus.
• the vector comprises at least two copies of the same genomic insulator element.
• the at least two genomic insulator elements are at least two different genomic insulator elements.
• the at least two genomic insulator elements are each a 14 bp sequence selected from the group consisting of: CACCAGGTGGCGCT (SEQ ID NO.: 1), CCACCAGGGGGAGC (SEQ ID NO.: 2),
• TCAGTAGAGGGCGC SEQ ID NO.: 3
• CCACTAGGGGGCAG SEQ ID NO.: 4
• CAGCAGAGGGCGCT SEQ ID NO.: 5
• CAGTAGAGGGCGCT SEQ ID NO.: 6
• CCCTCTCCTGGGCA SEQ ID NO.: 7
• GCAGCAGAGAGCAA SEQ ID NO.: 8
• the at least two genomic insulator elements each comprise a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 21, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 31, SEQ ID NO.: 32, SEQ ID NO.: 33, SEQ ID NO.: 34, SEQ ID NO.: 35, and SEQ ID NO.: 36.
• CTCF binding site core sequence is a high occupancy CTCF binding site in the human genome.
• the high occupancy site comprises a least 95%, at least 98%, at least 99% or 100% CTCF occupancy.
• the gene insulator element does not significantly alter viral titers of the vector.
• the sequence of the genomic insulator element is less than 300 bp. In another embodiment of this aspect and all other aspects described herein, the sequence of the genomic insulator elements is less than 400 bp.
• the genomic insulator element does not comprise silencer activity.
• the vector optionally comprises one or more of the following: (a) a promoter, (b) an enhancer, (c) a restriction site, (d) an untranslated region, (e) a DNasel-hypersensitivity site, (f) a multiple cloning site, and (g) a sequence encoding a poly A tail.
• the therapeutic agent comprises a gene of interest, a protein, a dominant negative mutant, an RNA interference agent, or an miRNA.
• the high potency genomic insulator exhibits an enhancer blocking activity greater than that of the cHS4 insulator element. In one embodiment, the high potency genomic insulator exhibits an enhancer blocking activity at least 50% greater than that of the cHS4 insulator element. In other embodiments, the high potency genomic insulator exhibits an enhancer blocking activity at least 75%, at least 80%, at least 90%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20- fold, at least 50-fold, at least 100-fold (or more) greater than that of the cHS4 insulator element.
• FIG. 1 Identification of putative insulators by genomic profiling.
• CTCF sites are marked by the presence of a sequence motif (Top right) and by ChlP-seq occupancy (shown in human K562 erythro leukemia cells).
• Sites were grouped into classes based on sharing identical 14 bp core sequences. Classes were then ranked according to genome-wide occupancy per class. Candidate sites for each class were tested for enhancer-blocker activity as described in the text.
• FIGs. 2A-2D Functional identification of enhancer-blocking insulators.
• the reporter plasmid pJC5-4/P4-P2K contains an expression cassette for GFP transcribed from the ⁇ -globin gene promoter (ypro), and erythroid specific HS2 enhancer (HS2).
• ypro ⁇ -globin gene promoter
• HS2 erythroid specific HS2 enhancer
• Candidate fragments were inserted at two locations: upstream of the ⁇ -globin-globin gene promoter, and between the neo gene (Neo) and the HS2 enhancer. In this configuration, the 3' insertion site allows the candidate insulator to physically block the communication between the HS2 enhancer and ⁇ -globin-globin gene promoter.
• FIG. 2B Frequency of G418 -resistant colonies as a percent of the neutral control.
• FIG. 2C Histograms represent the mean ⁇ standard deviation from 4 independent experiments, and are reported as a percentage of the mean colony formation obtained with the spacer control (set at 100%).
• FIG. 2C Degree of insulation expressed as fold changed compared to the cHS4 control. The fold changes were calculated using the mean of colony numbers listed in Table 2.
• FIG. 2D Insulator activity as a function of the insulator class. Data are the same as in panel (FIG. 2B), but arranged according to insulator classes.
• FIGs. 3A-3D Assessing the enhancer-blocking insulators for silencer activity and effects on lentiviral vector titers.
• FIG. 3A Silencer assay design. The reporter plasmid is similar to that used for the enhancer-blocking assay (FIG. 3A), except that the 3' insertion site was located distal to the HS2 enhancer, allowing for uninterrupted communication between the HS2 enhancer and the ⁇ -globin gene promoter.
• FIG. 3B Frequency of G418 -resistant colonies as a percent of the neutral control. Histograms represent the mean ⁇ standard deviation from 3 or more independent experiments, and are reported as a percentage of the mean colony formation obtained with the spacer control (set at 100%).
• FIG. 3C Lentiviral vector titer assay design.
• the third-generation lentiviral reporter vector expresses GFP from an internal Pgk gene promoter, and was flanked with the insulator candidates by insertion in the "double-copy" position of the 3' LTR.
• FIGs. 4A-4C Genotoxicity assay.
• FIG. 4A Assay design for assessing the ability of insulators to reduce the rate of vector mediated genotoxicity. Insulator Al was inserted into the proximal end of the 3' LTR of a gammaretroviral vector. During generation of vector provirus, this insert is copied to the 5' LTR, effectively flanking the internal expression cassettes. Supernatant from ecotropic vector producer lines matched for titer was used to transduce the IL-3 dependent cell line 32D. Independent sub-pools were subsequently expanded and transplanted into congenic mice (one independent sub-pool per mouse). Recipients were subsequently monitored for tumor formation (typically manifesting as splenomegaly) (24).
• FIG. 4B Kaplan-Myer tumor- free survival curves for mice transplanted with 32D cells that were mock-transduced or transduced with a vector containing insulator Al , or the 1.2 kb cHS4, or a 790 bp fragment from a portion of the cDNA for the mouse G6PD gene (as a neutral control), or no insert.
• FIG. 4C The underlying rate of transformation (tumors per 10 5 provirus) was calculated by first estimating the number of transformation events based on the fraction of tumor-free animals at 28 weeks and the Poisson distribution, and then dividing these by the estimated number of cells that were transduced in the original cultures as described (24). P values were based on z-test for two proportions.
• FIGs. 5A-5B Correlation of specific CTCF binding motifs with in vivo occupancy.
• FIG. 5A The number of CTCF sites for each CTCF occupancy class that are bound or not bound by CTCF are shown for each of the top 1000 CTCF occupancy classes. CTCF occupancy classes sharing identical 14 bp core sequences were selected to have >50 sites.
• FIG. 5B Similar analysis showing the relative proportion of CTCF sites for each CTCF occupancy class that are bound by CTCF. Data from both panels are based on ChlP-seq studies in K562 cells.
• FIG. 6 Correlation between CTCF occupancy class and CTCF occupancy in multiple cell types.
• the CTCF occupancy of each member of the 1000 CTCF occupancy classes was assessed in 19 different cells types by ChlP-seq, and was then used to determine the average number of cells exhibiting occupancy of each CTCF occupancy class (one data point for each of 1000 classes). See FIG. 7 for the list of cell types.
• the trend line represents the LOESS fit.
• the locations of the high-occupancy classes A-F and low-occupancy classes G, H, and J are indicated.
• the R values are shown for the overall data set.
• FIG. 7 DNase I hypersensitivity of high-occupancy insulator candidates in multiple cell types.
• the DNase I hypersensitivity profiles across the genomic regions of the indicated high-occupancy insulator candidates are shown for 19 different cell lines.
• Y axis read density tracks based on DNase I-seq analysis;
• X axis windows extending 1000 bp on either side of the candidate insulator sequences (see Table 2 for insulator coordinates).
• DNasel profiles were derived from ENCODE.
• FIG. 8 Genomic organization of intergenic insulators.
• the upper graph of each panel shows the genomic organization of candidate insulators located between two genes.
• the chromosome numbers and hgl9-based coordinates for each insulator are provided at the top, while the locations of the insulators relative to the surrounding genes are indicated by arrows adjacent to the insulator IDs.
• Also displayed are the genomic configurations of the flanking genes with the gene symbols listed below.
• the lower graph of each panel shows the DNase I hypersensitivity profiles across the corresponding genomic regions based on DNase I-seq studies in K562 cells.
• FIG. 9 Genomic organization of intragenic insulators.
• the upper graph of each panel shows the genomic organization of candidate insulators located within gene bodies.
• the chromosome numbers and hgl9-based coordinates for each insulator are provided at the top, while the locations of the insulators relative to the specific genes are indicated by arrows adjacent to the insulator IDs.
• Also displayed are the genomic configurations of the specific genes with the gene symbols listed below.
• the lower graph of each panel shows the DNase I hypersensitivity profiles across the corresponding genomic regions based on DNase I-seq studies in K562 cells.
• FIG. 10 Relationship between CTCF occupancy class and CTCF density.
• the average density of CTCF binding is shown for each CTCF occupancy class based on ChlP-seq studies in K562 cells (one data point for each of 1000 classes).
• the trend line represents LOESS fit.
• the locations of the high-occupancy classes A-F, and the low-occupancy classes G, H, and J are indicated by arrows. Note that the higher-occupancy insulators tend to exhibit a higher density of CTCF binding.
• R Pearson correlation.
• FIG. 11 Transcription factor recognition sequences associated with high occupancy insulator candidates. Potential sites of transcription factor binding were identified by scanning the sequences of candidate insulator elements cloned for functional studies (see Table 3) for recognition sequence matches with a threshold P ⁇ 10 "4 using the program FIMO (Grant et al. 201 1). Position weight matrices were obtained from four major transcription factor binding motif collections: TPvANSFAC (Matys et al. 2006); JASPAR (Portales-Casamar et al. 2010); UniPROBE (Newburger et al. 2009); and a published SELEX dataset (Jolma et al. 2013). Similar motifs were then clustered into families.
• Position weight matrices were also included that were derived de novo from genome- wide DNase I footprinting across 41 human cell types; only those not matching any other motifs were included (*) (Neph et al. 2012). Transcription factor recognition sequences were required to overlap a DNase I footprint by at least 3 bp in K562 cells with a footprint occupancy score less than 0.95 (i.e., stronger) (Neph et al. 2012) and were excluded if they overlapped a CTCF recognition sequence. Data are shown for transcription factor recognition sequences present in 5 or more elements. Presence of at least one recognition motif is indicated by gray, while absence of a recognition motif is indicated by white. Recognition sequences and insulator elements are ordered by hierarchical clustering. Note the absence of correlation between transcription factor recognition sequences and specific CTCF occupancy classes or potent insulator function.
• FIGs. 12A-12C Correlation between CTCF occupancy class and cohesin.
• FIGs. 13A-13B Relationship between CTCF occupancy class and CTCF binding mode.
• FIG. 13A Schematic showing the consensus sequences for the CTCF core and the extended recognition sequences. The spacing between the extended upstream motif and the core motif can vary (+0 or +1 bp), resulting in three modes of potential binding (Nakahashi et al. 2013).
• Trend lines are shown for the proportion of instances involved overlapping the extended upstream motif with +0 spacing, +1 spacing, or either spacing as determined by LOESS fit. Note the inverse correlation between binding modes involving the upstream motifs and the CTCF occupancy class rank. R, Pearson correlation.
• FIGs. 14A-14C Relation of CTCF occupancy class and long-range genomic interactions.
• FIG. 14A Average number of RNA Polymerase II -mediated interactions spanning CTCF class instances in K562 cells; sum of two replicates (31).
• FIG. 14B Average number of CTCF-mediated interactions within 25 kb of class instances in K562 cells (31).
• FIG. 14C Average number of CTCF-mediated interactions within 25 kb of class instances in K562 cells.
• FIG. 15 Effects of insulators on GFP expression of lentiviral vectors. Insulator elements were inserted into the "double-copy" position of a lentiviral vector expressing GFP, and used to transduce human HT1080 cells. After 3 days, cultures were analyzed by flow cytometry to determine the amount of vector GFP expression in the GFP-positive cells. Cultures with low transduction rates (12.4 ⁇ 9.2 percent GFP-positive) were used to assure that most of the GFP-positive cells had one or a few vector copies. Expression data are shown as a percentage of the no-insert control.
• Histograms represent the mean ⁇ standard deviation from 4 independent experiments, and are reported as a percentage of the expression (mean fluorescent units of the GFP-positive cells) determined of the no-insert control (set at 100%). No samples were statistically different from the control after Bonferroni correction for multiple testing.
• FIG. 16 Capacity of insulator elements to bind CTCF in the context of lentiviral vectors.
• Insulator candidates A2 (high- affinity) and G2 (low affinity) were inserted into the long- terminal repeats of a lentiviral reporter vector using the double-copy arrangement.
• K562 cells were transduced with the resulting vectors at a low multiplicity of infection (5%GFP(+) cells) in order to target only one vector provirus per cell, and a pool of transduced cells were selected by cell sorting for GFP.
• the resulting pools (-98% GFP(+), approximately one vector provirus per cell) were then analyzed by conventional chromatin immunoprecipitation (ChIP) for CTCF binding at A2 or G2.
• ChoIP chromatin immunoprecipitation
• kits for identifying high potency genomic insulator elements that can be used in a vector composition e.g., that are useful for preventing unwanted expression of neighboring genes, such as proto-oncogenes, when administered to a subject in need thereof.
• vectors comprising such elements, methods for treating disease and methods for administering a nucleic acid to a subject using such vectors.
• the term "vector,” refers to a nucleic acid vehicle that contains a combination of recombinant DNA sequence components for directing transgene expression.
• the vector is a viral vector including, but not limited to, retroviral vectors ⁇ e.g., lentiviral vectors), adenoviral vectors, or adeno-associated viral vectors.
• the vector is a gene therapy vector.
• Retrovirus refers an RNA virus that reverse transcribes its genomic RNA into a linear double-stranded DNA copy and subsequently covalently integrates its genomic DNA into a host genome. Retroviruses belong to the family Retroviridae, which is composed of numerous non-icosahedral, enveloped viruses which possess two copies of a single-stranded RNA genome that has a short dimerized region. Retroviruses are a common tool for gene delivery (Miller, 2000, Nature. 357: 455-460).
• the provirus serves as a template for RNA polymerase II and directs the expression of RNA molecules which encode the structural proteins and enzymes needed to produce new viral particles.
• Illustrative retroviruses include, but are not limited to: Moloney murine leukemia virus (M- MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, Murine Stem Cell Virus (MSCV) and Rous Sarcoma Virus (RSV)) and lentivirus.
• M- MuLV Moloney murine leukemia virus
• MoMSV Moloney murine sarcoma virus
• Harvey murine sarcoma virus HaMuSV
• murine mammary tumor virus MuMTV
• lentivirus refers to a group (or genus) of complex retroviruses.
• retroviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1, and HIV type 2); visna-maedi virus (VMV) virus; the caprine arthritis- encephalitis virus (CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immune deficiency virus (BIV); and simian immunodeficiency virus (SIV).
• HIV based vector backbones i.e., HIV cis-acting sequence elements
• HIV cis-acting sequence elements are preferred.
• genomic insulator element refers to a nucleic acid sequence that prevents the read-through expression of a gene (e.g., a neighboring gene). Such genomic insulator elements can comprise a barrier function to protect chromosomal domains from heterchromatinization and/or an enhancer-blocking function to prevent the interaction between regulatory elements of different chromatin domains.
• the genomic insulator element can include, for example, a CTCF core sequence or a CTCF binding motif that includes a CTCF core sequence.
• the genomic insulator element comprises a CTCF binding motif.
• the genomic insulator element comprises, at a minimum, a CTCF binding site core sequence.
• high potency genomic insulator element refers to a genomic insulator element that prevents read-through expression of a neighboring gene or genomic sequence from a vector promoter by at least 50% compared to an identical vector lacking the genomic insulator element (as determined using an enhancer blocking assay as described herein in the working
• the high potency genomic insulator element prevents read-through expression by at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or even 100% (i.e., no read-through expression detected) compared to the identical vector lacking the genomic insulator element.
• CTCF binding site core sequence or “core sequence” are used interchangeably herein and refer, at a minimum, to a 14 bp nucleic acid sequence comprising a GC-rich region that is sufficient to engage at least one of zinc fingers 4-8 of CTCF.
• CTCF binding motifs in a genome can be classified into sub-groups or "classes" of genomic insulator elements based on this 14bp core sequence. That is, CTCF binding motifs can be classified based on the unique 14 bp core sequence to which CTCF binds.
• high occupancy CTCF binding site refers to a nucleic acid sequence comprising a CTCF binding site core sequence that is occupied by CTCF at a frequency of at least 85% over the total number of instances of the core sequence in a given genome (e.g., a human genome, a K562 cell genome etc.). That is, at least 85% of the time that the given CTCF core sequence appears in a given genome, it is bound by CTCF as determined using e.g., ChlP-sequencing data.
• the high occupancy CTCF binding site is at 90% occupied, at least 95% occupied, at least 96% occupied, at least 97% occupied, at least 98% occupied, at least 99% occupied, or even 100% occupied (i.e., CTCF binds to every instance in the genome where the core sequence is detected).
• the term "high affinity CTCF binding site” is used interchangeably with the term "high occupancy CTCF binding site.”
• a "low affinity CTCF binding site” or “low occupancy CTCF binding site” refers to a site that is occupied at a frequency of less than 10% of the time.
• An "intermediate affinity CTCF binding site” or “intermediate occupancy CTCF site” refers to a site that is occupied at a frequency of between 10% and 85% of the time, for example, 15-85%, 25- 85%, 50-85%, 75-85%, 15-75%, 15-50%, 15-25%, 25-75%, 25-50%, 50-75%, or any range therebetween.
• the phrase "does not significantly alter viral titers of the vector” indicates that a vector comprising at least one genomic insulator element has, in one embodiment, substantially the same viral titer as the identical vector lacking the at least one genomic insulator element, for example, in a lentiviral vector titer assay as described herein.
• the viral titer of the vector comprising a genomic insulator element is modulated (i.e., increased titer or decreased titer) by less than 20%, less than 15%, less than 10%, less than 5%, less than 2%, or less than 1% as compared to an identical vector lacking the genomic insulator element.
• silencer activity refers to the ability of a nucleic acid sequence to bind a repressor to prevent protein expression from a gene.
• silencer activity can be assessed by cloning the candidate insulator into a neo reporter construct such that the insertion brackets, rather than blocks, the enhancer and promoter. The constructs are then analyzed for the rate of colony formation under G418 selection in K652 cells.
• the term "does not substantially comprise silencer activity” indicates that the genomic insulator element comprises substantially the same silencer activity as a negative control insert.
• the term "therapeutic agent” refers to a molecule or composition that when administered can mediate treatment of a disease or disorder.
• the molecule or composition can be a protein, a nucleic acid sequence encoding a protein or a nucleic acid that comprises activity itself (e.g., miR A).
• the therapeutic agent can be used to augment or replace functionality of a protein associated with a disease (i.e., due to misfolding, truncation, impaired activity, increased protein degradation, and the like).
• the therapeutic agent can be used to inhibit, reduce or depress function of an in vivo target.
• a therapeutic agent can be an antibody, an antibody fragment, a protein, a dominant negative mutant, an RNA interference agent (e.g., an siRNA, an shRNA), or an miRNA, among others, each of which can be expressed from the viral vector(s) described herein.
• an RNA interference agent e.g., an siRNA, an shRNA
• miRNA miRNA
• the term “highly ranked class” refers to a set of CTCF binding motifs classified by a unique 14 bp core sequence, which is among the top 20% (e.g., the top 15%, the top 10%, the top 5%, the top 2%, the top 1%) of the classes when they are ranked from highest occupancy to lowest.
• the term “highly ranked class” can refer to the top 5, 4, 3, 2, or 1 classes of CTCF binding motifs when they are ranked from highest occupancy to lowest.
• operably linked refers to the joining of distinct DNA molecules, or DNA sequences, to produce a functional transcriptional unit.
• the terms "gene,” “gene of interest,” “transgene,” and “nucleic acid sequence encoding a therapeutic agent” are used interchangeably herein. Generally, the terms refer to a nucleic acid sequence (e.g., DNA), that contains a coding sequence for a particular polypeptide, for example, a recombinant protein of interest such as a therapeutic antibody or a replacement enzyme. A transgene can also contain heterologous sequences to encode a fusion protein.
• the terms “gene,” “gene of interest,” “transgene,” and “therapeutic agent” are not intended to include polyadenylation sites, promoters, enhancers, and insulators.
• promoter refers to a nucleic acid sequence, that is typically positioned upstream of a gene and that recruits transcriptional machinery, such as the RNA polymerase and associated factors, that, in turn, initiates transcription of the gene.
• the term “enhancer” refers to a nucleic acid sequence that can recruit transcriptional regulatory proteins, such as transcriptional activators, to enhance the transcriptional activation of a gene in an essentially position and orientation independent manner. Thus, unlike a promoter, an enhancer can be located upstream, downstream, or even within an intron of a transcription unit.
• Enhancer elements from heterologous sources can be used as a component within expression vectors that represent embodiments of the compositions and methods described herein.
• the term "flanking" refers to a relative position of one nucleic acid sequence with respect to another nucleic acid sequence.
• a flanking sequence precedes or follows a flanked sequence but need not be contiguous with, or immediately adjacent to the flanked sequence.
• the genomic insulator element can be placed at either (or both) ends of the nucleic acid encoding the therapeutic agent.
• the terms "homology,” “identity,” and “similarity” refer to the degree of sequence similarity between two polypeptides or between two nucleic acid molecules being compared by sequence alignment.
• the degree of homology between two discrete nucleic acid sequences being compared is a function of the number of identical, or matching, nucleotides at comparable positions.
• the degree of homology between two discrete amino acid sequences being compared is a function of the number of identical, or matching, amino acids at comparable positions.
• RNA interference agent and "RNA interference” as they are used herein are intended to encompass those forms of gene silencing mediated by double-stranded RNA, regardless of whether the RNA interfering agent comprises an siRNA, miRNA, shRNA or other double-stranded RNA molecule.
• siRNA short interfering RNA
• small interfering RNA is defined as an RNA agent which functions to inhibit expression of a target gene, e.g., by RNAi.
• An siRNA can be chemically synthesized, can be produced by in vitro transcription, or can be produced within a host cell.
• siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21 , 22, or 23 nucleotides in length, and can contain a 3' and/or 5' overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides.
• the length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand.
• the siRNA is capable of promoting RNA interference through degradation or specific post-transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA).
• PTGS post-transcriptional gene silencing
• pharmaceutically acceptable refers to compounds and compositions which can be administered to mammals without undue toxicity.
• the term "pharmaceutically acceptable carrier” includes any material which, when combined with an active ingredient, allows the ingredient to retain biological activity and is non-reactive with the subject's immune system.
• examples include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution, water, emulsions such as oil/water emulsion, and various types of wetting agents.
• Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline.
• Compositions comprising such carriers are formulated by conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, PA, 1990).
• the term "pharmaceutically acceptable carriers” excludes tissue culture medium.
• a or “an” means at least one, unless clearly indicated otherwise.
• to "prevent” or “protect against” a condition or disease means to hinder, reduce or delay the onset or progression of the condition or disease.
• “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount.
• “reduce,” “reduction” or “decrease” or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g., the absence of a given treatment) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more.
• “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level.
• “Complete inhibition” is a 100% inhibition as compared to a reference level.
• a decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.
• the terms “increased” /'increase” or “enhance” or “activate” are all used herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms “increased”, “increase” or “enhance” or “activate” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10- 100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, at least about a 20-fold increase, at least about a 50-fold increase, at least about a 100-fold increase, at least about a 1000-fold increase or more as
• the term "statistically significant” or “significantly” refers to statistical significance and generally means two standard deviations (2SD) or more above or below normal or a reference. The term refers to statistical evidence that there is a difference. It is defined as the probability of making a decision to reject the null hypothesis when the null hypothesis is actually true. The decision is often made using the p-value.
• the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation. [00104] As used herein the term “consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
• compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
• Chromatin insulators can decrease the risk of insertional mutagenesis by disrupting the interactions between the enhancers in the vectors and the regulatory elements of cellular oncogenes (6,7).
• chromatin insulators There are two kinds of chromatin insulators: barrier insulators, which protect chromosomal domains from heterochromatinization, and enhancer-blocking insulators, which prevent the interaction between regulatory elements of different chromatin domains (8).
• Certain elements combine barrier- and enhancer-blocking activities.
• the most extensively studied chromatin insulator is located in DNase I hypersensitive site 4 of the Locus Control Region of the chicken beta globin locus (cHS4) (9, 10).
• CTCF transcriptional factor
• cHS4 decreases the probability of vector silencing by its barrier function (20,21), the probability of activation of proximal regulatory elements by its enhancer-blocking function (22-24), and the risk of genotoxicity in ex vivo and in vivo assays (24-26).
• the cHS4 insulator has two noteworthy disadvantages: the fully active cHS4 element is very large (1.2 kb) and consumes precious space in viral vectors; and the incorporation of the full-length cHS4 often results in diminished vector titers.
• genomic insulator elements provided herein comprise enhancer-blocking to reduce the probability of activation of proximal regulatory elements.
• genomic insulator elements described herein are shorter than the active cHS4 element and can be easily incorporated into viral vectors without substantial loss of viral titers.
• genomic insulator elements described herein are less than
• the genomic insulator elements are less than 550 bp, less than 500 bp, less than 450 bp, less than 400 bp, less than 350 bp, less than 325 bp, less than 300 bp, less than 290 bp, less than 280 bp, less than 270 bp, less than 260 bp, less than 250 bp, less than 240 bp, less than 230 bp, less than 220 bp, less than 210 bp, less than 200 bp, less than 190 bp, less than 180 bp, less than 170 bp, less than 160 bp, less than 150 bp, less than 125 bp, less than 100 bp, less than 50 bp, less than 25 bp, less than 15 bp, or smaller.
• the genomic insulator element is 14 bp in length.
• genomic insulator elements described herein are between
• 100-600 bp in length between 100-500 bp, between 100-400 bp, between 100-300 bp, between 100- 250 bp, between 100-200 bp, between 100- 175 bp, between 100-150 bp, between 150-600 bp, between 200-600 bp, between 300-600 bp, between 400-600 bp, between 500-600 bp, between 125- 300 bp, between 150-300 bp, between 175-300 bp, between 200-300 bp, between 225-300 bp, between 250-300 bp, between 275-300 bp, and any range therebetween.
• a genomic insulator element provided herein comprises a 14 bp core sequence selected from the group consisting of:
• TCAGTAGAGGGCGC SEQ ID NO.: 3
• CCACTAGGGGGCAG SEQ ID NO.: 4
• CAGCAGAGGGCGCT SEQ ID NO.: 5
• CAGTAGAGGGCGCT SEQ ID NO.: 6
• CCCTCTCCTGGGCA SEQ ID NO.: 7
• GCAGCAGAGAGCAA SEQ ID NO.: 8
• a genomic insulator element as provided herein comprises a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 21, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 31, SEQ ID NO.: 32, SEQ ID NO.: 33, SEQ ID NO.: 34, SEQ ID NO.: 35, and SEQ ID NO.: 36 (see e.g., Table 7).
• variants or homologues of the genomic insulator elements listed in Table 7 provided that the variants or homologues retain at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or even 100% of the enhancer- blocking activity of the genomic insulator elements (determined, for example, using an enhancer- blocking assay as described in the working Examples).
• a variant or homologue of a genomic insulator element listed in Table 7 will have greater enhancer-blocking activity than the sequences provided in Table 7.
• a variant and/or homologue can have an activity at least 20% higher than the activity of a genomic insulator element sequence listed in Table 7.
• the variant and/or homologue can have an activity at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 85% higher, at least 90% higher, at least 95% higher, at least 98% higher, at least 99% higher, at least 1-fold higher, at least 2-fold higher, at least 5-fold higher, at least 10-fold higher, at least 20-fold higher, at least 50-fold higher, at least 75-fold higher, at least 100-fold higher, at least 150-fold higher, at least 200-fold higher, at least 500-fold higher, at least 1000-fold higher activity, or more compared to the activity of a genomic insulator element listed in Table 7.
• a variant of a genomic insulator element comprises a sequence at least 80% identical to a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO. : 17, SEQ ID NO. : 18, SEQ ID NO. : 19, SEQ ID NO. : 20, SEQ ID NO.
• SEQ ID NO.: 21 SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 31, SEQ ID NO.: 32, SEQ ID NO.: 33, SEQ ID NO.: 34, SEQ ID NO.: 35, and SEQ ID NO.: 36.
• the sequence of a genomic insulator element as described herein comprises a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 21, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 31, SEQ ID NO.: 32, SEQ ID NO.: 33, SEQ ID NO.: 34, SEQ ID NO.:
• the genomic insulator element(s) described herein retain 100% identity within the 14 bp core sequence but the sequences outside of the core sequence (e.g., on either side of the core sequence) can comprise a sequence at least at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the regions outside of the 14 bp core sequence in a sequence selected from the group consisting of: SEQ ID NO.: 10, SEQ ID NO.: 1 1, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 16, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 21, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 26, SEQ ID NO.: 27, SEQ ID NO.: 28,
• the genomic insulator elements described herein can be used in the design of a vector composition e.g., for effecting gene therapy and/or treating a disease.
• the viral vectors described herein comprise at least one copy of a high potency genomic insulator element.
• viral vectors comprising multiple copies (i.e., 2 or more) of a single genomic insulator element or viral vectors comprising multiple different genomic insulator elements are also contemplated herein.
• the vector comprises at least 1, at least 2, at least
• the vector comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more copies of a single genomic insulator element.
• the vector comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or more different genomic insulator elements.
• Vectors that comprise at least two different genomic insulator elements can also comprise at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more copies of one or more of the genomic insulator elements.
• One of skill in the art can readily design vectors to include multiple copies or multiple genomic insulator elements which can balance the enhancer blocking activity of the vector with an overall insert size conducive for viral vector constraints.
• viral vector is widely used to refer either to a nucleic acid molecule (e.g., a transfer plasmid) that includes virus-derived nucleic acid elements that typically facilitate transfer of the nucleic acid molecule or integration into the genome of a cell or to a viral particle that mediates nucleic acid transfer.
• Viral particles will typically include various viral components and sometimes also host cell components in addition to nucleic acid(s).
• any viral vector can be used with the compositions and methods described herein, particularly since the use of the genomic insulator elements described herein can prevent inappropriate read-through of expression and therefore mitigates the carcinogenic effect of the viral vector in a subject.
• the viral vector comprising a genomic insulator element as described herein is a retroviral vector.
• retroviral vector refers to a viral vector or plasmid containing structural and functional genetic elements that are primarily derived from a retrovirus.
• retrovirus is intended to encompass lentiviral vectors.
• hybrid vectors also contemplated for use herein are “hybrid vectors.”
• the term “hybrid” refers to a vector, LTR or other nucleic acid containing both retroviral, (e.g., lentiviral sequences) and non- lentiviral viral sequences.
• retroviral e.g., lentiviral sequences
• non-lentiviral viral sequences e.g., lentiviral sequences
• viral sequences can include, for example, sequences for reverse transcription, replication, integration and/or packaging sequences, non-structural proteins, and/or polymerase recognition sites.
• genomic insulator element is particularly important in vectors that are incorporated into the genome (e.g., retroviral vectors), however the use of an adenoviral vector, an adeno-associated viral vector (AAV), or components thereof can also include a genomic insulator element.
• the AAV vector can be selected from the group consisting of serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 or a chimeric AAV derived therefrom (Wu et al., 2006, Mol Therapy 14:316-27; Bowles et al., 2012, Mol Therapy 20:443-455).
• AAV serotype 6 and AAV serotype 9 are particularly suitable, while for gene transfer into a human, AAV serotypes 1 , 6, 8 and 9 are preferred.
• Recombinant viral vectors can be generated according to standard techniques. Prior to their in vivo application viral vectors may be desalted by gel filtration methods, such as sepharose columns, and purified by subsequent filtering. Purification reduces potential deleterious effects in the subject to which the vectors are administered.
• the administered virus is substantially free of wild-type and replication-competent virus. The purity of the virus can be proven by suitable methods, such as sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by silver staining.
• viral vectors are typically preferred for administration of nucleic acid sequences to a subject (e.g., a human), however the genomic insulator element(s) described herein are contemplated for use with any suitable gene therapy vector or even with plasmid or naked nucleic acid sequences.
• a subject e.g., a human
• genomic insulator element(s) described herein are contemplated for use with any suitable gene therapy vector or even with plasmid or naked nucleic acid sequences.
• the vectors described herein can include any number of sequences known to those of skill in the art, such as promoters (e.g., constitutive or inducible), enhancers, long-terminal repeats (LTRs), multiple cloning sites, restriction sequences, and the like. It will be appreciated by those of ordinary skill in the art that a vector can be designed to include any number of optional sequences e.g., to enhance expression of a therapeutic agent in a subject. Some non-limiting examples of these sequences, referred to herein as "viral components" are described herein.
• the vectors described herein can contain zero, one or more of the following components: promoters and/or enhancers, untranslated regions (UTRs), Kozak sequences, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, internal ribosomal entry sites (IRES), recombinase recognition sites (e.g., LoxP, FRT, and Att sites), termination codons, transcriptional termination signals, and polynucleotides encoding self-cleaving polypeptides, or epitope tags.
• promoters and/or enhancers can contain zero, one or more of the following components: promoters and/or enhancers, untranslated regions (UTRs), Kozak sequences, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, internal ribosomal entry sites (IRES), recombinase recognition sites (e.g., LoxP, FRT, and Att sites), termination codons, transcriptional termination signals,
• Promoters used with the vector compositions described herein can be constitutive, inducible, or tissue-specific.
• constitutive promoter refers to a promoter that continually or continuously allows for transcription of an operably linked sequence.
• Constitutive promoters may be a "ubiquitous promoter” that allows expression in a wide variety of cell and tissue types or a "tissue-specific promoter” that allows expression in a restricted variety of cell and tissue types.
• Illustrative ubiquitous promoters include, but are not limited to, a cytomegalovirus (CMV) immediate early promoter, a viral simian virus 40 (SV40) (e.g., early or late), a Moloney murine leukemia virus (MoMLV) LTR promoter, a Rous sarcoma virus (RSV) LTR, a herpes simplex virus (HSV)
• CMV cytomegalovirus
• SV40 viral simian virus 40
• MoMLV Moloney murine leukemia virus
• RSV Rous sarcoma virus
• HSV herpes simplex virus
• thymidine kinase promoter H5, P7.5, and PI 1 promoters from vaccinia virus, an elongation factor 1 -alpha (EFla) promoter, early growth response 1 (EGR1), ferritin H (FerH), ferritin L (FerL), Glyceraldehyde 3 -phosphate dehydrogenase (GAPDH), eukaryotic translation initiation factor 4A1 (EIF4A1), heat shock 70 kDa protein 5 (HSPA5), heat shock protein 90 kDa beta, member 1
• EGR1 early growth response 1
• FeH ferritin H
• FeL ferritin L
• GPDH Glyceraldehyde 3 -phosphate dehydrogenase
• EIF4A1 eukaryotic translation initiation factor 4A1
• HSPA5 heat shock 70 kDa protein 5
• heat shock protein 90 kDa beta member 1
• HSP90B 1 heat shock protein 70 kDa (HSP70), ⁇ -kinesin ( ⁇ - ⁇ ), the human ROSA 26 locus (Irions et al., Nature Biotechnology 25, 1477- 1482 (2007)), a Ubiquitin C promoter (UBC), a phosphoglycerate kinase- 1 (PGK) promoter, a cytomegalovirus enhancer/chicken ⁇ -actin (CAG) promoter, and a ⁇ -actin promoter.
• UBC Ubiquitin C promoter
• PGK phosphoglycerate kinase- 1
• CAG cytomegalovirus enhancer/chicken ⁇ -actin
• ⁇ -actin promoter a ⁇ -actin promoter.
• tissue-specific promoter it may be desirable to use a tissue-specific promoter to achieve cell type specific, lineage specific, or tissue- specific expression of a desired polynucleotide sequence.
• tissue specific promoters include, but are not limited to: an B29 promoter (B cell expression), a runt transcription factor (CBFa2) promoter (stem cell specific expression), an CD 14 promoter (monocytic cell expression), an CD43 promoter (leukocyte and platelet expression), an CD45 promoter (hematopoietic cell expression), an CD68 promoter (macrophage expression), a CYP450 3A4 promoter (hepatocyte expression), an desmin promoter (muscle expression), an elastase 1 promoter (pancreatic acinar cell expression, an endoglin promoter (endothelial cell expression), a fibroblast specific protein 1 promoter (FSP1) promoter (fibroblast cell expression), a fibronectin promoter (fibroblast cell expression),
• ⁇ hematopoietic cells
• IFN- ⁇ interferon beta
• keratin 5 keratinocyte expression
• myoglobin MB
• MYOD1 promoter Muscle expression
• a nephrin promoter podocyte expression
• a bone gamma- carboxyglutamate protein 2 (OG-2) promoter osteoblast expression
• an 3-oxoacid CoA transferase 2B Oxct2B
• haploid-spermatid expression haploid-spermatid expression
• SP-B surfactant protein B
• synapsin promoter hematopoietic cell expression
• WASP Wiskott-Aldrich syndrome protein
• conditional expression may refer to any type of conditional expression including, but not limited to, inducible expression; repressible expression; expression in cells or tissues having a particular physiological, biological, or disease state, etc. This definition is not intended to exclude cell type or tissue-specific expression. Certain embodiments of the methods and compositions herein provide conditional expression of a polynucleotide-of-interest, e.g., expression is controlled by subjecting a cell, tissue, organism, etc., to a treatment or condition that causes the polynucleotide to be expressed or that causes an increase or decrease in expression of the
• inducible promoters/systems include, but are not limited to, steroid-inducible promoters such as promoters for genes encoding glucocorticoid or estrogen receptors (inducible by treatment with the corresponding hormone), metallothionine promoter (inducible by treatment with various heavy metals), MX- 1 promoter (inducible by interferon), the "GeneSwitch” mifepristone -regulatable system (Sirin et al., 2003, Gene, 323:67), the cumate inducible gene switch (WO 2002/088346), tetracycline-dependent regulatory systems, etc.
• steroid-inducible promoters such as promoters for genes encoding glucocorticoid or estrogen receptors (inducible by treatment with the corresponding hormone), metallothionine promoter (inducible by treatment with various heavy metals), MX- 1 promoter (inducible by interferon), the "GeneSwitch
• Conditional expression can also be achieved by using a site-specific DNA
• the vector comprises at least one (typically two) site(s) for recombination mediated by a site-specific recombinase.
• site-specific recombinase As used herein, the terms
• recombinase or “site-specific recombinase” include excisive or integrative proteins, enzymes, co- factors or associated proteins that are involved in recombination reactions involving one or more recombination sites (e.g., two, three, four, five, seven, ten, twelve, fifteen, twenty, thirty, fifty, etc.), which may be wild-type proteins (see Landy, Current Opinion in Biotechnology 3:699-707 (1993)), or mutants, derivatives (e.g., fusion proteins containing the recombination protein sequences or fragments thereof), fragments, and variants thereof.
• Illustrative examples of recombinases suitable for use in particular embodiments include, but are not limited to: Cre, Int, IHF, Xis, Flp, Fis, Hin, Gin, OC31, Cin, Tn3 resolvase, TndX, XerC, XerD, TnpX, Hjc, Gin, SpCCEl, and ParA.
• the vectors may comprise one or more recombination sites for any of a wide variety of site-specific recombinases. It is to be understood that the target site for a site-specific recombinase is in addition to any site(s) required for integration of a vector, e.g., a retroviral vector or lentiviral vector.
• the terms "recombination sequence,” “recombination site,” or “site-specific recombination site” refer to a particular nucleic acid sequence which a recombinase recognizes and binds.
• one recombination site for Cre recombinase is loxP which is a 34 base pair sequence comprising two 13 base pair inverted repeats (serving as the recombinase binding sites) flanking an 8 base pair core sequence (see e.g., Sauer, B., Current Opinion in Biotechnology 5:521- 527 (1994)).
• exemplary loxP sites include, but are not limited to: lox51 1 (Hoess et al., 1996; Bethke and Sauer, 1997), lox5171 (Lee and Saito, 1998), lox2272 (Lee and Saito, 1998), m2 (Langer et al., 2002), lox71 (Albert et al., 1995), and lox66 (Albert et al., 1995).
• Suitable recognition sites for the FLP recombinase include, but are not limited to:
• FRT (McLeod, et al., 1996), Fl, F2, F3 (Schlake and Bode, 1994), F4, F5 (Schlake and Bode, 1994), FRT(LE) (Senecoff et al., 1988), FRT(RE) (Senecoff et al., 1988).
• recognition sequences are the attB, attP, attL, and attR sequences, which are recognized by the recombinase enzyme ⁇ Integrase, e.g, phi-c31.
• the cpC31 SSR mediates recombination only between the heterotypic sites attB (34 bp in length) and attP (39 bp in length) (Groth et al., 2000).
• the vectors described herein can include an "internal ribosome entry site” or “IRES,” which refers to an element that promotes direct internal ribosome entry to the initiation codon, such as ATG, of a cistron (a protein encoding region), thereby leading to the cap- independent translation of the gene.
• the vectors contemplated herein may include one or more genes of interest that encode one or more polypeptides (e.g., therapeutic proteins).
• the polynucleotide sequences can be separated by one or more IRES sequences or polynucleotide sequences encoding self-cleaving polypeptides.
• Kozak sequence refers to a short nucleotide sequence that greatly facilitates the initial binding of mRNA to the small subunit of the ribosome and increases translation.
• the consensus Kozak sequence is (GCC)RCCATGG, where R is a purine (A or G) (Kozak, 1986. Cell. 44(2):283-92, and Kozak, 1987. Nucleic Acids Res. 15(20):8125-48).
• vectors comprise a polyadenylation sequence 3' of a polynucleotide encoding a polypeptide to be expressed.
• Polyadenylation sequences can promote mRNA stability by addition of a polyA tail to the 3' end of the coding sequence and thus, contribute to increased translational efficiency. Recognized polyadenylation sites include an ideal polyA sequence (e.g., ATT AAA, ATT AAA AGTAAA), a bovine growth hormone polyA sequence (BGHpA), a rabbit ⁇ -globin polyA sequence (r gpA), or another suitable heterologous or endogenous polyA sequence known in the art.
• an ideal polyA sequence e.g., ATT AAA, ATT AAA AGTAAA
• BGHpA bovine growth hormone polyA sequence
• r gpA rabbit ⁇ -globin polyA sequence
• the vectors described herein can comprise a selection gene, also termed a selectable marker.
• Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, hygromycin, methotrexate, Zeocin, Blastocidin, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli. Any number of selection systems may be used to recover transformed cell lines.
• herpes simplex virus thymidine kinase (Wigler et al., 1977. Cell 1 1 :223-232) and adenine phosphoribosyltransferase (Lowy et al., 1990. Cell 22:817-823) genes which can be employed in tk- or aprt- cells, respectively.
• the vector composition described herein comprises a long- terminal repeat.
• LTR long terminal repeat
• the term "long terminal repeat (LTR)" typically refers to domains of base pairs located at the ends of retroviral DNAs which, in their natural sequence context, are direct repeats and contain U3, R and U5 regions. LTRs generally provide functions fundamental to the expression of retroviral genes (e.g., promotion, initiation and polyadenylation of gene transcripts) and to viral replication. The LTR contains numerous regulatory signals including transcriptional control elements, polyadenylation signals and sequences needed for replication and integration of the viral genome.
• the vectors described herein can comprise an entire LTR or can comprise one or more regions selected from the group consisting of the U3, R, and U5 regions.
• the vector can comprise modified 5' and/or 3' LTRs.
• Modifications of the 3' LTR are often made to improve the safety of lentiviral or retroviral systems by rendering viruses replication-defective.
• replication-defective refers to a virus that is not capable of complete, effective replication such that infective virions are not produced (e.g., replication-defective lentiviral progeny).
• replication-competent refers to wild-type virus or mutant virus that is capable of replication, such that viral replication of the virus is capable of producing infective virions (e.g., replication-competent lentiviral progeny).
• the vectors described herein can also be "self-inactivating" (SIN) vectors, e.g., a replication-defective vector in which the right (3') LTR enhancer-promoter region, known as the U3 region, has been modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication.
• the 3' LTR is modified such that the U5 region is replaced, for example, with an ideal poly(A) sequence.
• An additional safety enhancement can be provided by replacing the U3 region of the
• heterologous promoters include, for example, simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (CMV) (e.g., immediate early), Moloney murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus (HSV) (thymidine kinase) promoters.
• SV40 simian virus 40
• CMV cytomegalovirus
• MoMLV Moloney murine leukemia virus
• RSV Rous sarcoma virus
• HSV herpes simplex virus
• Typical promoters are able to drive high levels of transcription in a Tat- independent manner. This replacement reduces the possibility of recombination to generate replication-competent virus because there is no complete U3 sequence in the virus production system.
• a vector can further contain a packaging sequence (e.g., the psi sequence), a "trans-activation response" genetic element, an "R-region", a reverse transcription site, a FLAP element, an export element, a posttranscriptional regulatory element, and/or a polyadenylation site, among others.
• a packaging sequence e.g., the psi sequence
• a trans-activation response genetic element
• an "R-region” e.g., a reverse transcription site
• FLAP element e.g., an export element, a posttranscriptional regulatory element, and/or a polyadenylation site, among others.
• the vector can further contain at least one element directing the efficient termination and polyadenylation of the heterologous nucleic acid transcripts to increase heterologous gene expression.
• Transcription termination signals are generally found downstream of the polyadenylation signal.
• the term "polyA site” or "polyA sequence” as used herein denotes a DNA sequence which directs both the termination and polyadenylation of the nascent RNA transcript by RNA polymerase II. Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a poly A tail are unstable and are rapidly degraded.
• an ideal polyA sequence e.g., AATAAA, ATT AAA AGTAAA
• BGHpA bovine growth hormone polyA sequence
• r gpA rabbit ⁇ -globin polyA sequence
• another suitable heterologous or endogenous polyA sequence known in the art e.g., AATAAA, ATT AAA AGTAAA
• a therapeutic agent when used for gene therapy, can permit expression of a therapeutic agent.
• a therapeutic agent can be a bioactive protein, a therapeutic protein, a dominant negative mutant, an RNA interference agent, or an miRNA.
• the sequence encoding the therapeutic agent is included in a nucleic acid cassette.
• nucleic acid cassette refers to genetic sequences within the vector which can express an RNA, and subsequently a protein of interest.
• the nucleic acid cassette is positionally and sequentially oriented within the vector such that the nucleic acid in the cassette can be transcribed into RNA, and when necessary, translated into a protein or a polypeptide, undergo appropriate post-translational modifications required for activity in the transformed cell, and be translocated to the appropriate compartment for biological activity by targeting to appropriate intracellular compartments or secretion into extracellular compartments.
• the cassette has its 3' and 5' ends adapted for ready insertion into a vector, e.g., it has restriction endonuclease sites at each end.
• the nucleic acid cassette contains the sequence of a therapeutic gene used to treat disease.
• the cassette can be removed and inserted into a plasmid or viral vector as a single unit.
• Viral particles are produced by transfecting a transfer vector into a packaging cell line that comprises viral structural and/or accessory genes, e.g., gag, pol, env, tat, rev, vif, vpr, vpu, vpx, or nef genes or other retroviral genes.
• packaging vector refers to an expression vector or viral vector that lacks a packaging signal and comprises a polynucleotide encoding one, two, three, four or more viral structural and/or accessory genes.
• the packaging vectors are included in a packaging cell, and are introduced into the cell via transfection, transduction or infection. Methods for transfection, transduction or infection are known by those of skill in the art.
• a retroviral/lentiviral transfer vector can be introduced into a packaging cell line, via transfection, transduction or infection, to generate a producer cell or cell line.
• the packaging vectors can be introduced into human cells or cell lines by standard methods including, e.g., calcium phosphate transfection, lipofection or electroporation.
• the packaging vectors are introduced into the cells together with a dominant selectable marker, such as neomycin, hygromycin, puromycin, blastocidin, zeocin, thymidine kinase, DHFR, Gin synthetase or ADA, followed by selection in the presence of the appropriate drug and isolation of clones.
• a selectable marker gene can be linked physically to genes encoding by the packaging vector, e.g., by IRES or self-cleaving viral peptides.
• Viral envelope proteins determine the range of host cells which can ultimately be infected and transformed by recombinant retroviruses generated from the cell lines.
• the env proteins include gp41 and gpl20.
• the viral env proteins expressed by packaging cells are encoded on a separate vector from the viral gag and pol genes, as has been previously described.
• retroviral-derived env genes which can be employed in the vectors and constructs described herein include, but are not limited to: MLV envelopes, 10A1 envelope, BAEV, FeLV-B, RD1 14, SSAV, Ebola, Sendai, FPV (Fowl plague virus), and influenza virus envelopes.
• genes encoding envelopes from RNA viruses e.g., RNA virus families of RNA viruses.
• Poxyiridae, and Iridoviridae may be utilized.
• Representative examples include, FeLV, VEE, HFVW, WDSV, SFV, Rabies, ALV, BIV, BLV, EBV, CAEV, SNV, ChTLV, STLV, MPMV, SMRV, RAV, FuSV, MH2, AEV, AMV, CT10, EIAV.
• envelope proteins for pseudotyping a virus as useful for vectors or constructs described herein include, but are not limited to any of the following virus:
• Influenza A such as H1N1, H1N2, H3N2 and H5N1 (bird flu)
• Influenza B Influenza C virus
• Hepatitis A virus Hepatitis B virus
• Hepatitis C virus Hepatitis D virus
• Hepatitis E virus Rotavirus
• any virus of the Norwalk virus group enteric adenoviruses, parvovirus, Dengue fever virus, Monkey pox, Mononegavirales, Lyssavirus such as rabies virus, Lagos bat virus, Mokola virus, Duvenhage virus, European bat virus 1 & 2 and Australian bat virus
• Ephemerovirus Vesiculovirus
• Herpes viruses such as Herpes simplex virus types 1 and 2, varicella zoster, cytomegalovirus, Epstein-Bar virus (EBV), human herpes viruses (HHV), human herpes virus type 6 and 8, Human immunodeficiency virus (HIV), papillo
• the vector tropism can be modified by expression of an antibody or antigen binding fragment on the surface of the vector particle.
• the methods comprise assessing the number of instances of a CTCF binding motif in a genome and aligning them with data from ChIP sequencing for CTCF to determine CTCF binding motifs with high occupancy, optionally classifying the CTCF binding motifs by the presence of a 14 bp core sequence, optionally ranking the classes from highest occupancy to lowest (or vice versa), selecting candidates for functional study and testing for enhancer blocking activity.
• the method for identifying a high potency genomic insulator element comprises the steps outlined in FIG. 1.
• the method for identifying a high potency genomic insulator element comprises the methods outlined in the working examples.
• gene therapy vectors in human is limited by their toxicity, particularly the tendency to produce genotoxicity from the activation of cellular oncogenes by the enhancers present in the viral vector. Such genotoxicity is evidenced by, for example, the appearance of hematopoietic malignancies in humans treated with gene therapy vectors, and, for example, an increased number of tumors in experimental animals administered viral vectors.
• genotoxicity at any level is generally undesirable, the incidence of animals with tumors associated with genotoxicity of the vectors described herein is reduced by at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or more as compared to a vector lacking the genomic insulator element(s) but otherwise identical.
• the incidence of tumors associated with genotoxicity of the vectors described herein is reduced by at least 1-fold, at least 2-fold, at least 5- fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, at least 40-fold, at least 45-fold, at least 50-fold, at least 100-fold, at least 200-fold or more compared to a vector lacking the genomic insulator element(s) but otherwise identical.
• Genotoxicity can be determined with various in vitro and in vivo methods including measuring the number or extent of tumors associated with vector administration.
• genotoxicity is determined using a tumor transplant genotoxicity assay.
• a cell line transduced with gammaretroviral vectors is transplanted into mice and the number of tumors or rates of tumor free survival are determined in the mice.
• This assay allows quantification of genotoxic effects by assessing e.g., rates of tumor free survival or overall rate of tumor formation.
• the terms “treat,” “treatment,” “treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder.
• treating includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder. Treatment is generally “effective” if one or more symptoms or clinical markers are reduced.
• treatment is "effective" if the progression of a disease is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or markers, but can also include a cessation or at least slowing of progress or worsening of symptoms that would be expected in absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s) of a given disease or disorder, diminishment of extent of disease, stabilized disease (i.e., not worsening), delay or slowing of progression of the disease, amelioration or palliation of the disease state, and remission (whether partial or total).
• treatment also includes providing at least partial relief from the symptoms or side-effects of the disease (including palliative treatment).
• prevention refers to stopping, hindering, and/or slowing the development of a given disease or disorder.
• the term "therapeutically effective amount” means that amount necessary, at least partly, to attain the desired effect, or to delay the onset of, inhibit the progression of, or halt altogether, the onset or progression of the particular disease or disorder being treated. Such amounts will depend, of course, on the particular condition being treated, the severity of the condition and individual patient parameters including age, physical condition, size, weight and concurrent treatment. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. In some embodiments, a maximum dose of a therapeutic agent is used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a lower dose or tolerable dose that is effective can be administered for medical reasons, psychological reasons or for virtually any other reason.
• a therapeutically effective amount of a pharmaceutical formulation, or a composition described herein for a method of treating a given disease or disorder is an amount sufficient to reduce the level of at least one symptom of the disease or disorder as compared to the level in the absence of the compound, the combination of compounds, the pharmaceutical composition/formulation of the composition.
• the amount of the composition administered is preferably safe and sufficient to treat, delay the development of disease, and/or delay onset of the disease.
• the amount can thus cure or result in amelioration of the symptoms of the disease, slow the course of the disease, slow or inhibit a symptom of the disease, or slow or inhibit the establishment or development of secondary symptoms associated with the disease.
• an effective treatment need not necessarily initiate complete regression of the disease, such effect would be effective treatment.
• the effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal to receive the therapeutic agent, and the purpose of the administration. Thus, it is not possible or prudent to specify an exact “therapeutically effective amount.” However, for any given case, an appropriate "effective amount" can be determined by a skilled artisan according to established methods in the art using only routine experimentation.
• compositions that are useful for treating and preventing a variety of different diseases and/or disorders in a subject.
• the composition is a pharmaceutical composition.
• the composition can comprise a therapeutically or prophylactically effective amount of a vector encoding a polynucleotide or therapeutic agent.
• composition can optionally include a carrier, such as a pharmaceutically acceptable carrier.
• a carrier such as a pharmaceutically acceptable carrier.
• Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions. Formulations suitable for parenteral administration can be formulated, for example, for intravenous, intramuscular, intradermal, intraperitoneal, and subcutaneous routes.
• Carriers can include aqueous isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, preservatives, liposomes, microspheres and emulsions.
• aqueous isotonic sterile injection solutions which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient
• aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, preservatives, liposomes, microspheres and emulsions.
• compositions contain a physiologically tolerable carrier together with the vectors described herein, dissolved or dispersed therein as an active ingredient.
• pharmaceutically acceptable “physiologically tolerable” and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to or upon a mammal without the production of undesirable physiological effects such as nausea, dizziness, gastric upset and the like.
• compositions that contains active ingredients dissolved or dispersed therein are understood in the art and need not be limited based on formulation. Typically such compositions are prepared as injectable either as liquid solutions or suspensions; however, solid forms suitable for solution, or suspension in liquid prior to use can also be prepared. The preparation can also be emulsified or presented as a liposome composition.
• the active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient and in amounts suitable for use in the therapeutic methods described herein.
• Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol or the like and combinations thereof.
• the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like which enhance the effectiveness of the active ingredient.
• the therapeutic composition for use with the methods described herein can include pharmaceutically acceptable salts of the components therein.
• Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like.
• Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.
• Physiologically tolerable carriers are well known in the art.
• Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline.
• aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes.
• Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Examples of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions.
• the amount of a vector to be administered herein that will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, the expression of the therapeutic agent, and can be determined by standard clinical techniques. [00170] While any suitable carrier known to those of ordinary skill in the art can be employed in the pharmaceutical composition, the type of carrier will vary depending on the mode of administration.
• compositions for use as described herein can be formulated for any appropriate manner of administration, including for example, topical, oral, nasal, intravenous, intracranial, intraperitoneal, subcutaneous or intramuscular administration.
• the carrier preferably comprises water, saline, alcohol, a fat, a wax or a buffer.
• any of the above carriers or a solid carrier such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, and magnesium carbonate, may be employed.
• Biodegradable microspheres e.g., polylactate polyglycolate
• compositions can also comprise buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide) and/or preservatives.
• buffers e.g., neutral buffered saline or phosphate buffered saline
• carbohydrates e.g., glucose, mannose, sucrose or dextrans
• mannitol proteins
• proteins polypeptides or amino acids
• proteins e.glycine
• antioxidants e.g., glycine
• chelating agents such as EDTA or glutathione
• adjuvants e.g., aluminum hydroxide
• preservatives e.g., aluminum hydroxide
• compositions described herein can be administered as part of a sustained release formulation (i.e., a formulation such as a capsule or sponge that affects a slow release of the vectors following administration).
• sustained release formulations can generally be prepared using well known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site.
• Sustained-release formulations can contain a vector, polypeptide, polynucleotide dispersed in a carrier matrix and/or contained within a reservoir surrounded by a rate controlling membrane.
• Carriers for use within such formulations are biocompatible, and can also be
• biodegradable preferably the formulation provides a relatively constant level of active component release.
• the amount of active compound contained within a sustained release formulation depends upon the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented.
• Treatment includes prophylaxis and therapy.
• Prophylaxis or treatment can be accomplished by a single direct injection at a single time point or multiple time points. Administration can also be nearly simultaneous to multiple sites.
• Patients or subjects include mammals, such as human, bovine, equine, canine, feline, porcine, and ovine animals as well as other veterinary subjects. Preferably, the patients or subjects are human.
• the methods described herein provide a method for treating a disease or disorder in a subject.
• the subject can be a mammal.
• the mammal can be a human, although the approach is effective with respect to all mammals.
• the method comprises administering to the subject an effective amount of a pharmaceutical composition comprising a vector as described herein in a pharmaceutically acceptable carrier.
• the dosage range for the agent depends upon the potency, the expression level of the therapeutic agent and includes amounts large enough to produce the desired effect, e.g., reduction in at least one symptom of the disease to be treated.
• the dosage should not be so large as to cause unacceptable adverse side effects.
• the dosage will vary with the type of inhibitor expressed from the vector (e.g., an antibody or fragment, small molecule, siRNA, etc.) or activator (e.g., recombinant polypeptide, peptide, peptidomimetic, small molecule, etc.), and with the age, condition, and sex of the patient.
• the dosage can be determined by one of skill in the art and can also be adjusted by the individual physician in the event of any complication.
• the dosage of the therapeutic agent and/or the vector composition ranges from O.OOlmg/kg body weight to 5 g/kg body weight.
• the dosage range is from 0.001 mg/kg body weight to lg/kg body weight, from 0.001 mg/kg body weight to 0.5 g/kg body weight, from 0.001 mg/kg body weight to 0.1 g/kg body weight, from 0.001 mg/kg body weight to 50 mg/kg body weight, from 0.001 mg/kg body weight to 25 mg/kg body weight, from 0.001 mg/kg body weight to 10 mg/kg body weight, from 0.001 mg/kg body weight to 5 mg/kg body weight, from 0.001 mg/kg body weight to 1 mg/kg body weight, from 0.001 mg/kg body weight to 0.1 mg/kg body weight, from 0.001 mg/kg body weight to 0.005 mg/kg body weight.
• the dosage range is from 0.1 g/kg body weight to 5 g/kg body weight, from 0.5 g/kg body weight to 5 g/kg body weight, from 1 g/kg body weight to 5 g/kg body weight, from 1.5 g/kg body weight to 5 g/kg body weight, from 2 g/kg body weight to 5 g/kg body weight, from 2.5 g/kg body weight to 5 g/kg body weight, from 3 g/kg body weight to 5 g/kg body weight, from 3.5 g/kg body weight to 5 g/kg body weight, from 4 g/kg body weight to 5 g/kg body weight, from 4.5 g/kg body weight to 5 g/kg body weight, from 4.8 g/kg body weight to 5 g/kg body weight.
• the dose range is from 5 ⁇ g/kg body weight to 30 ⁇ g/kg body weight.
• the vectors are administered at a multiplicity of infection (MOI) of at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 500 or more.
• MOI multiplicity of infection
• the vectors are administered at a titer of at least lx 10 5 , 1 x 10 6 ' 1 x 10 7 , 1 x 10 8 , 1 x 10 9 , 1 x 10 10 , 1 x 10 11 , 1 x 10 12 or more.
• a therapeutically effective amount is an amount of a vector or expressed therapeutic agent that is sufficient to produce a statistically significant, measurable change in at least one symptom of a disease (see “Efficacy Measurement” below).
• a therapeutically effective amount is an amount of an agent that is sufficient to produce a statistically significant, measurable change in the expression level of a biomarker associated with the disease in the subject. Such effective amounts can be gauged in clinical trials as well as animal studies for a given agent.
• the vector compositions can be administered directly to a particular site (e.g., intramuscular injection, intravenous, into a specific organ) or can be administered orally. It is also contemplated herein that the agents can also be delivered intravenously (by bolus or continuous infusion), by inhalation, intranasally, intraperitoneally, intramuscularly, subcutaneously, intracavity, and can be delivered by peristaltic means, if desired, or by other means known by those skilled in the art. The agent can be administered systemically, if so desired.
• compositions containing at least one agent can be conventionally administered in a unit dose.
• unit dose when used in reference to a therapeutic composition refers to physically discrete units suitable as unitary dosage for the subject, each unit containing a
• predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required physiologically acceptable diluent, i.e., carrier, or vehicle.
• Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are particular to each individual. However, suitable dosage ranges for systemic application are disclosed herein and depend on the route of administration. Suitable regimes for administration are also variable, but are typified by an initial administration followed by repeated doses at one or more intervals by a subsequent injection or other administration. Alternatively, continuous intravenous infusion sufficient to maintain concentrations in the blood in the ranges specified for in vivo therapies are contemplated.
• efficacy of a given treatment for a disease can be determined by the skilled clinician. However, a treatment is considered "effective treatment," as the term is used herein, if any one or all of the signs or symptoms of the disease to be treated is/are altered in a beneficial manner, other clinically accepted symptoms or markers of disease are improved, or even ameliorated, e.g., by at least 10% following treatment with a vector as described herein. Efficacy can also be measured by failure of an individual to worsen as assessed by stabilization of the disease, hospitalization or need for medical interventions (i.e., progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and/or described herein.
• Treatment includes any treatment of a disease in an individual or an animal (some non- limiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing progression of the disease; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of the disease or preventing secondary issues associated with the disease.
• the inventors describe herein an approach for identifying chromatin insulators in the human genome that combines genomic informatics and CTCF ChlP-seq to classify the CTCF sites of the human genome according to their CTCF occupancy.
• the inventors find that only a minority of the CTCF sites of the human genome are occupied by CTCF and that the occupancy frequency determines the probability that the site will function as a enhancer-blocking insulator. All sites with 98% to 100% CTCF occupancy that were functionally analyzed are robust enhancer-blocking insulators. The majority of these insulators exhibit enhancer-blocking activity that is superior to that of the cHS4 insulator.
• the inventors identified candidate insulator sequences based on genome-wide in vivo occupancy profiling of CTCF in K562 cells (FIG. 1). Although the majority of CTCF binding sites are distinguished by a conserved sequence motif (15), most instances of this sequence genome -wide are not bound by CTCF (FIG. 5). Using an informatics approach to scan the genome, the inventors identified 22,579,591 instances of CTCF motifs (P ⁇ 10 ⁇ 2 ). Only 205,227 (0.9%) of these overlapped ChlP-seq peaks for CTCF binding, indicating that most sequence elements matching the CTCF motif have a low probability of being bound in vivo.
• Table 2 Chromosomal hgl8 and hgl9 coordinates, CTCF sequences, and enhancer blocking activity of the CTCF elements used for functional studies.
• CTCF classes with 100% CTCF occupancy, designated as A, B and C, and three classes with 98.6 to 98.8% CTCF occupancy,
• D, E, F Tables 1 and 2.
• Five sequences from each class were selected for functional assays using two additional criteria: (i) The CTCF sites had to coincide with a DNase I Hypersensitive Site (DHS) in K562 cells and other cell types (FIG. 7); and (ii) The CTCF motif had to be occupied by CTCF in 16 of the cell types studied with ChlP-seq in the inventors' laboratory (FIG. 6).
• the sizes of the sequences corresponding to the DHSs overlapping with the CTCF sites ranged from 1 19 to 284 nucleotides, and were considered to correspond to the likely size of the insulator elements.
• the inventors selected several sequences from classes G, H, and J (Table 1) with a CTCF occupancy of 9.6%, 9.7% and 9.8% respectively.
• Candidates identified with the above approach were cloned into a plasmid reporter construct in which the drug-resistance neo gene is driven by a ⁇ -globin gene (HBG1) promoter regulated by the enhancer of DNase I hypersensitive site 2 of the ⁇ -globin locus (FIG. 2A and Table 3).
• HBG1 ⁇ -globin gene
• K562 cells transfected with this construct grow in the presence of G418.
• an insulator element brackets the ⁇ - neo expression cassette, it disrupts the interaction between the enhancer and the ⁇ promoter, resulting in decreased neo expression and decreased number of colonies in the G418 cultures.
• the rate of decrease in colony numbers corresponds to the efficiency with which the insulator element blocks the interaction between the enhancer and ⁇ promoter.
• the ⁇ - neo cassette was bracketed with the cHS4 insulator.
• the inventors used a silencer assay in which the element under study is placed outside the enhancer-promoter cassette. Silencers are expected to suppress promoter activity or inhibit the formation of the enhancer/promoter complex thus resulting in decreased neo expression and decreased colony numbers (FIG. 3A). Silencer assays were performed using 19 elements with enhancer-blocking activities equal to or higher than cHS4 (FIG. 3B and Table 4). The positive silencer control in these assays decreased colony formation 23 -fold, while in no cases were colony numbers statistically different from the negative control, indicating that none of the 19 elements carried silencer activity.
• Table 4 Testing insulator elements for silencer activity.
• the fragments used to assess the insulator activity of the high- and low-occupancy class CTCF sites also include several other transcription factor recognition sequences in DNase I footprints in K562 cells, notably including E box, S l, and nuclear hormone receptor sequences (FIG. 1 1).
• the inventors did not observe a direct correlation between any specific transcription factor recognition sequence or pattern of sequences and either a specific CTCF occupancy rank or insulator activity level.
• the inventors did note a direct correlation between CTCF occupancy and overlap with binding of Rad21 (FIG. 12A), a subunit of cohesin that is thought to play an important role in insulator function (28). Overlap with cohesin was also correlated with increased CTCF binding and accessibility to DNase I (FIG.
• CTCF multivalent nature of CTCF permits regulation of binding site function by differential recruitment of zinc fingers to a combination of core and upstream sequences (29, 30). It was found that the high-occupancy CTCF classes preferentially lack the extended recognition sequence, potentially freeing zinc fingers 8- 1 1 for interaction with other proteins or DNA sequence (FIG. 13). Based on published chromatin interaction analysis data, the inventors noted a slight depletion of Pol II interactions crossing the high-occupancy CTCF sites (31), and a small correlation between the high-occupancy CTCF sites and both interactions with other CTCF sites and associations with topologically associated domains (TADs) (19) (FIG. 14). These latter findings are consistent with models for enhancer-blocking insulators, but do not point to a specific chromatin context that can help identify highly efficient chromatin insulators better than the CTCF occupancy class.
• the new insulators do not affect viral vector stability
• each insulator into the double-copy region of a third-generation lentiviral vector expressing GFP from a constitutive Pgk promoter and measured viral titers and GFP expression (FIG. 3C). Only two of the 26 insulators tested significantly affected the vector titers either in the forward or in the reverse orientation (FIG. 3D, Table 5). None of the elements affected adversely vector GFP expression (FIG. 16 and Table 6). In addition, chromatin immunoprecipitation studies demonstrated the ability of a high-occupancy class insulator to efficiently bind CTCF in this lentiviral vector context in K562 cells (FIG. 16).
• Table 5 Effects of insulator elements on lentiviral vector titers.
• Titers based on % of GFP(+) cells transduced with titrated vector are based on % of GFP(+) cells transduced with titrated vector.
• Table 6 Effects of the novel insulator elements on lentiviral vector expression.
• the inventors used insulator Al to test possible effects on vector-mediated genotoxicity in a tumor transplant genotoxicity assay (24).
• a cell line transduced with gamma retroviral vectors produces tumors after transplantation in mice and allows quantitation of genotoxic effects by measuring rates of tumor free survival.
• Insulator Al was inserted in the proximal portion of the 3' LTR, from which it is copied into the 5' LTR during reverse transcription and vector integration.
• the resulting topology (FIG. 4A) is expected to decrease genotoxicity by placing the insulator at both ends of the vector pro-virus, thereby preventing the 5' LTR fully and the 3 ' LTR partially from interacting with the surrounding genomic region.
• Vectors flanked with the Al insulator or control fragments were used to transduce the growth factor-dependent cell line 32D, and 10 independent sub-clones for each vector were transplanted into syngeneic C3H/HeJ mice. All 10 mice transplanted with mock-transduced cells remained free of tumors, while nearly all mice transplanted with 32D cells transduced with vectors containing no inserts or a 790 bp neutral spacer developed tumors within a median of 16 weeks (FIG. 4B). Flanking this vector with the cHS4 insulator delayed the onset of tumor formation by several weeks, and reduced the frequency of animals that developed tumors to 6 of 10.
• flanking the vector with insulator Al reduced the overall rate of tumor formation 15.7 -fold, from nearly 47 tumors per 10 5 provirus to under 3 tumors per 10 5 provirus (FIG. 4C).
• the cHS4 insulator reduced the overall rate of tumor formation 2.8-fold (to about 17 tumors per 10 5 provirus), while the neutral spacer had no statistically discernable effect on the rate of tumor formation.
• gammaretroviral vectors (1,2,32-36). Insights on the mechanisms of genotoxicity were obtained from the extensive analyses of genomic integration patterns in the lymphoid and other hematopoietic cells of SCID-X1 and ADA patients (37-41). It is now clear that the first step in the oncogenic process is the activation of proto-oncogenes and other cellular growth genes by the strong enhancer/promoters of the vectors (37-41). This first step provides the growth advantage to the affected cells leading to clonal expansion. Prevention of this first step is necessary for decreasing the risk of genotoxicity and this can be accomplished by the use of chromatin insulators (6,7).
• Placement of a chromatin insulator in the LTR of self-inactivating gammaretroviral or lentiviral vectors will bracket the regulatory elements of the vector thus decreasing the probability of activation of nearby genes.
• the inventors have shown here that all the insulators the inventors identified can block the interactions between enhancers and promoters.
• the significant reduction of tumors when a gammaretroviral vector was insulated by insulator Al (FIG. 4) indicates that these insulators will decrease the risks of genotoxicity in the clinical setting.
• CTCF- based insulators should be active and provide protection in most stages of hematopoiesis.
• CTCF transcriptional factor
• CTGGTTCTACTCATTACAT TCCAATCGTGGCATATCCTCTAAACTTTCTTTT 75991564 75991883 CCCTTCATAAATCCTCTTT CTTTTTTTTCCCCCTCACAGTTTTCCTGAACAG GTTGACTATTAATTGTGTC TGCTTGATGTGGACACCAGGTGGCGCTGGACAT CAGAT T T GGAGAGGCAGT T GTCTAGGGAACCGGGCTCTGTGCCAGCGCAGGA GGCAGGCTGGCTCTCCTAT TCCAGGGATGCTCATCCAGGAAGGAAAGGTTGC AT GC T GGACACAC TAACCT TGAAGAATTCTTCTGTCTCTCTCGTCATTTAGA AAGGAAGG
• a 5' element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila. Cell. 74, 505-514 (1993).
• Newburger, D.E. & Bulyk, M.L. UniPROBE an online database of protein binding microarray data on protein-DNA interactions. Nucleic Acids Res. 37, D77-82 (2009).

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Microbiology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Plant Pathology (AREA)
• Analytical Chemistry (AREA)
• Animal Behavior & Ethology (AREA)
• Medicinal Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• Virology (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Immunology (AREA)
• Epidemiology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (6)

Applications Claiming Priority (4)

Related Child Applications (2)

Publications (1)

Family

ID=54072444

Family Applications (1)

Country Status (5)

Cited By (8)

Families Citing this family (7)

Citations (10)

Family Cites Families (6)

• 2015
  • 2015-03-13 US US15/126,115 patent/US10590433B2/en active Active
  • 2015-03-13 JP JP2016575630A patent/JP6737714B2/ja active Active
  • 2015-03-13 AU AU2015229227A patent/AU2015229227B2/en active Active
  • 2015-03-13 EP EP15760641.9A patent/EP3117004A4/en active Pending
  • 2015-03-13 WO PCT/US2015/020369 patent/WO2015138852A1/en not_active Ceased
• 2020
  • 2020-01-31 US US16/778,996 patent/US11788101B2/en active Active
• 2023
  • 2023-09-07 US US18/462,870 patent/US20240182924A1/en active Pending

Patent Citations (10)

Non-Patent Citations (76)

Also Published As

Similar Documents

Legal Events