WO2015119447A1 - 단백질 융합 디스플레이 기술을 이용한 물질 간 상호작용 고속분석 방법 - Google Patents

단백질 융합 디스플레이 기술을 이용한 물질 간 상호작용 고속분석 방법 Download PDF

Info

Publication number
WO2015119447A1
WO2015119447A1 PCT/KR2015/001226 KR2015001226W WO2015119447A1 WO 2015119447 A1 WO2015119447 A1 WO 2015119447A1 KR 2015001226 W KR2015001226 W KR 2015001226W WO 2015119447 A1 WO2015119447 A1 WO 2015119447A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cell
cells
binding protein
fluorescent protein
Prior art date
Application number
PCT/KR2015/001226
Other languages
English (en)
French (fr)
Inventor
이승구
김유정
감종식
김하성
이대희
정흥채
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to EP15746712.7A priority Critical patent/EP3103900B1/en
Priority to CN201580018385.7A priority patent/CN106164344B/zh
Priority to JP2016550222A priority patent/JP6526029B2/ja
Publication of WO2015119447A1 publication Critical patent/WO2015119447A1/ko
Priority to US15/229,102 priority patent/US10908163B2/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00—Methods of screening libraries
    • C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/02—Libraries contained in or displayed by microorganisms, e.g. bacteria or animal cells; Libraries contained in or displayed by vectors, e.g. plasmids; Libraries containing only microorganisms or vectors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label

Definitions

  • the present invention expresses an active protein particle containing a binding protein, that is, a fusion protein that forms insoluble aggregates (inclusion bodies) while exhibiting inherent interaction and activity of the binding protein, thereby binding the binding protein to an intracellular inclusion body surface.
  • a binding protein that is, a fusion protein that forms insoluble aggregates (inclusion bodies) while exhibiting inherent interaction and activity of the binding protein, thereby binding the binding protein to an intracellular inclusion body surface.
  • the interaction between the binding protein and the external target material by using the interaction trapper cells (ITcells) displayed on the screen and an optimal permeation step that does not affect the activity and genetic information of the binding protein displayed on the cells. It relates to a method for analyzing the interaction between the binding protein and the target material comprising measuring the action, and to the library screening method further comprising the step of recovering to the individual cell unit.
  • the present invention is characterized in that the foreign target material can be introduced into the cell while preserving the activity and genetic information of the binding protein displayed on the surface of the inclusion body in the cell, the structure comprising a polynucleotide encoding the fusion protein Or to a cell and cell library in which the fusion protein is expressed so that the binding protein is displayed in the inclusion body.
  • cell-free systems include ribosomal display and in vitro compartmentalization.
  • IVC ribosomal display and in vitro compartmentalization.
  • phage display phage display and bacterial / yeast display methods are known as conventional library screening methods as surface expression systems.
  • ribosome display is a method in which a mRNA-ribosome-peptide forms a triple complex to dissociate mRNA of a peptide bound to a target from a complex and amplify it through RT-PCR. It has the advantage that the library size is up to 10 13 because it is not necessary, but only about 27% is present as a complex and has limitations such as the limitation of the protein size displayed on the mRNA-ribosome, the stability and the technical sensitivity of the ribosome complex ( Hanes, J and Pluckthun, A., 1997. In vitro selection and evolution of functional proteins by using ribosome display.Proc. Natl. Acad. Sci. 94: 4937-42).
  • IVC In vitro compartmentalization
  • aqueous emulsion that is dispersed in oil rather than inside the cell, where the compartmentalized genes are transcribed and translated into an enamel to form a protein library.
  • More than 10 9 droplets can be made in a volume of 1 milliliter (mL), which acts as a stable and independent microreactor to various external environments (temperature, pH, salt concentration).
  • mL milliliter
  • the emulsion is destroyed by using an organic solvent, and the activity of the protein may be decreased by the organic solvent used, and thus the recovered proteins may not show activity in cells (Dan S. Tawfik). and Andrew D. Griffiths., 1998. Man-made cell-like compartments for molecular evolution.Nat. Biotechnol. 16; 652-56).
  • Phage display the most commonly used method in current library screening, is a method of screening by binding affinity to a fixed target target, which is displayed by fusing the library proteins to the phage end pIII protein and using them. Clones can be easily screened. However, since 1 to 5 binding proteins are displayed on the pIII protein of phage and the target is fixed to the bead and the bottom of the plate, several bindings occur simultaneously on the target, which is different from the actual affinity between the individual protein and the target (avidity effect). ) May occur. In addition, the nature of this method requires an elution step, there is a limitation that the displayed protein is difficult to elute from the stationary phase if the displayed protein has a high binding strength with the target.
  • the panning method used for library screening in phage display has a low signal-to-noise ratio and requires at least 3 to 5 panning steps to obtain a protein having a binding affinity with a target (George P.). Smith and Valery A. Petrenko., 1997. Phage Display.Chem. Rev. 97: 391-410).
  • Cell surface display developed to overcome the limitations of phage display, is a method of stably expressing proteins on the surface of microorganisms by using membrane proteins of microorganisms such as bacteria and yeast as surface anchoring motifs.
  • Targeted fusion of fluorescence probes allows for high throughput screening (1x10 9 cells / h) for phage display and non-specific noise ratio (1x10 9 cells / h) for use in flow cytometry (FACS) screening. It has the advantage of low background).
  • FACS flow cytometry
  • a surface expression system must successfully protrude the protein library out of the cell wall, while proteins that successfully cross the cell membrane must be stably attached to the cell surface and free of three-dimensional structural changes of the proteins fused to the cell surface ( Keep the protein active).
  • screening can be screened for targets with various binding affinities (mM ⁇ nM) by increasing the sensitivity of the screening.
  • mM ⁇ nM binding affinities
  • a plurality of binding proteins are immobilized on one carrier to amplify a detection signal when combined with a target, and the interaction analysis with the target uses a detection method using fluorescence to reduce the signal-to-noise ratio.
  • a detection method using fluorescence As an analytical method having such characteristics, a method of detecting interactions between materials through nano-high complexes using ferritin, a protein having self-assembly properties (Sangkyu Lee et al., 2011.
  • Intracellular protein inclusion bodies generally refer to inert aggregates, but recently it has been reported that some inclusion bodies are active particles that retain much of the protein's inherent biochemical properties (Antonio Villaverd). et al., 2005. Aggregation as bacterial inclusion bodies does not imply inactivation of enzymes and fluorescent proteins.Microbial Cell Factories 4; 1-6).
  • the active protein particles as an immobilization carrier, the enzyme and the fluorescent protein were immobilized to measure the activity. As a result, the activity was maintained by 30-100% compared to the activity of the enzyme and the fluorescent protein not immobilized.
  • studies are actively underway to use active protein particles in the enzyme industry.
  • the present inventors confirmed that the family II CBD (cellulose-binding domain) derived from Cellulomonas fimi forms self-aggregation in Escherichia coli ( E. coli ) to form inclusion bodies (IB).
  • a method of observing interactions between biological materials in cells using a phenomenon in which co-expressed proteins co-expressed not only in bacterial cells but also in eukaryotic cells is integrated into the inclusion body particles has been developed (Korea Patent Publication No. 10-2013 -0023057).
  • the above method can only observe the interactions between intracellular biomolecules that are simultaneously expressed in the cell, and the signal-to-noise ratio is low, which makes it difficult to effectively separate and recover the binding material bound to the target material in individual cell units.
  • the target material is limited to materials that can be synthesized in cells such as proteins or peptides, nucleic acids, and the fluorescent signal has a restriction that only fluorescent proteins should be used. That is, not only can not use a variety of target materials that can be put from the outside, but also a fluorescent signal can not use a variety of fluorescent chemicals.
  • the present inventors permeate the cell wall so as not to affect the activity and genetic information of the binding protein displayed on the inclusion body, and introduces an external target into the cell to bind the binding protein displayed on the protein inclusion body present in the cell.
  • the signal-to-noise ratio has been improved to more than 450 times, confirming that the interaction between substances can be directly observed at the single cell level.
  • the binding proteins interacting with the target material can be selectively recovered by searching for high speed intermolecular interactions at the single cell level.
  • the present invention was completed by confirming that a high-affinity binder ( ⁇ nM level) could be discovered.
  • One object of the present invention is to provide a cell library comprising a construct comprising a polynucleotide encoding a fusion protein consisting of a binding protein and an intracellular particle protein; Expressing a fusion protein in the cell library to form Interaction Trapper cells (ITcells) in which the binding protein is displayed in the inclusion body; Introducing a target material to which fluorescence is fused into the cell through permeation treatment (membrane disintegration) to the cell according to the step; And measuring the fluorescence intensity of the fluorescent material fused to the target material by measuring the interaction of the binding protein with the target material, and recovering each cell unit.
  • ITcells Interaction Trapper cells
  • Another object of the present invention is to provide a cell comprising a construct comprising a polynucleotide encoding a fusion protein consisting of a binding protein and an active inclusion body protein; Expressing a fusion protein in said cells to form Interaction Trapper cells (ITcells) in which the binding protein is displayed in the inclusion body; Introducing a target material to which fluorescence is fused into the cell through permeation treatment (membrane disintegration) to the cell according to the step; And it provides a method for analyzing the interaction between the binding protein and the target material comprising measuring the interaction of the binding protein and the target material by the fluorescence intensity of the fluorescent material fused to the target material introduced from the outside.
  • ITcells Interaction Trapper cells
  • Another object of the present invention is to provide a cell library comprising a construct comprising a polynucleotide encoding a fusion protein consisting of a binding protein and an active inclusion body protein.
  • the signal-to-noise ratio is 450 times higher than that of conventional screening methods by sensitively labeling target substances interacting due to overexpression of binding proteins, and thus, the screening efficiency is high and single cell units. Easily separated, fluorescence microscopy and flow cytometry can be used to provide high-throughput screening (HTS) for ultra-fast screening and separation of interacting proteins in large libraries.
  • HTS high-throughput screening
  • foreign substances which are difficult to express in cells, can be easily and quickly analyzed for interactions between biological materials through introduction into cells after extracellular expression.
  • the present invention can be used in various fields such as antibody / artificial antibody development, preparation of new interacting proteins, analysis and optimization of interaction between target protein and pharmaceutical candidate.
  • FIG. 1 is a representative diagram of the present invention is a protein fusion display schematic diagram capable of high-speed interaction between substances and the results of analyzing the interaction between substances using the same.
  • FIG. 2 is a methodology overall schematic of the protein fusion display technology.
  • FIG. 3 shows the intercalation cells (Interaction Trapper cells; ITcells) displaying the binding protein VLR and the fluorescent protein mRFP using CBD protein forming an active inclusion body in Escherichia coli, and the inclusion body cells in the cell through ultrasonic grinding. Only the separation was observed through a fluorescence microscope.
  • Interaction Trapper cells ITcells
  • Figure 5 shows that the activity and expression of the binding protein displayed on the active inclusion body is maintained by the cell freezing process of the cell permeation process developed in the present invention, but the degree of cell permeation is not sufficient to introduce an external target material. Flow cytometry results confirmed by the introduction of the target material.
  • (A, B) is the type and pH of the acid solution
  • (C) is a result of comparing the analysis of the permeation efficacy between EDTA and acidic solution chelating agent having an extracellular membrane permeability.
  • FIG. 7 is a result of confirming the interaction with the binding protein by introducing the external target material into the cell through the optimized permeation in Figure 6,
  • (A) is the interaction of the binding protein and the target material displayed on the active inclusion body
  • (B) shows the degree of incorporation of the target material according to the incubation time with the target material after cell permeation treatment to the capture cell by using the fluorescence intensity of the target material through interaction with the binding protein. The result is confirmed.
  • RT-PCR polymerase chain reaction quantitative test
  • Figure 11a is a result of confirming the protein fusion display through the cell permeation treatment developed in the present invention using the model protein and the model target material, the binding protein and the target material by intracellular introduction of the external target material according to the cell penetration Flow cytometry and fluorescence imaging results confirming the interaction.
  • Figure 11b is a result of confirming the protein fusion display through the cell permeation treatment developed in the present invention by using the model protein and the model target material, the genetic information of the binding protein in the interaction capture cell is maintained in spite of the cell permeation process
  • the results were analyzed by polymerase chain reaction quantitative assay (RT-PCR) and agarose gel electrophoresis.
  • Figure 11c is a result of confirming the protein fusion display through the cell permeation treatment developed in the present invention using a model protein and a model target material, the change of the active inclusion body cells before and after the cell permeation treatment was confirmed by flow cytometry and electron microscope The result is.
  • FIG. 13 shows the interaction between proteins according to the presence or absence of affinity with the binding protein by introducing a target material into cells through the optimized cell permeation treatment developed in the present invention, using a fluorescence image (A) and a flow cytometer (B). The result is.
  • (C) is a result of analyzing the interaction according to the difference of affinity of the binding protein with the target material by introducing the target material into the cell through the optimized cell permeation treatment by flow cytometry.
  • the binding protein interacts with the target material through a flow cytometer after creating a library-like environment by mixing the inclusion protein (PPI +) with the interaction between the binding protein and the target material and the inclusion body cell (PPI-) without the interaction.
  • PPI + inclusion protein
  • PPI- inclusion body cell
  • 15A shows a screening process for finding protein conjugates for various types of targets as a result of screening using an actual library through protein fusion display.
  • Figure 15b shows the overall structure showing the amino acid residues for the construction of a random library of repebody used as a model binding protein as a result of screening using the actual library through the protein fusion display.
  • FIG. 15C shows a result of screening using a real library through protein fusion display. As a result, interactions with targets of protein conjugates selected through library screening using respective targets are confirmed by flow cytometry.
  • FIG. 16 shows the binding affinity of H2, an sfGFP conjugate, obtained as a result of actual library screening by isothermal titration calorimetry (ITC).
  • the present invention provides a cell library comprising (a) a structure comprising a polynucleotide encoding a fusion protein consisting of a binding protein and an intracellular particle protein step; (b) expressing a fusion protein in the cell library to form Interaction Trapper cells (ITcells) in which the binding protein is displayed in the inclusion body; (c) introducing the target material to which the fluorescence is fused into the cell through permeation treatment (membrane disintegration) to the cell according to step (b); And (d) measuring the interaction between the binding protein and the target material by fluorescence intensity of the fluorescent material fused to the target material, and recovering the cells in individual cell units.
  • Icells Interaction Trapper cells
  • the permeation step of step (c) does not affect the activity and genetic information of the binding protein displayed on the inclusion body inside the cell, and as long as the target material can be introduced into the cell through the permeated membrane, it is generally used in the art.
  • the method of use can be used without limitation.
  • it may include the step of freezing the cells, thawing and treating with an acid solution, for example, (i) freezing the cells at -80 to -10 °C; (ii) thawing the frozen cells at room temperature to 37 ° C .; And (iii) treating with an acidic solution.
  • the acidic solution is not limited to the type and pH, for example may be pH 4 to pH 6.
  • the activity and genetic information of the binding protein displayed on the inclusion body inside the cell is not affected, and the target material is introduced into the cell through the permeated membrane so that the external target material is introduced into the cell so that the binding protein and the target material are introduced. It may be an optimized cell permeation treatment that enables the interaction of the liver.
  • the permeation process comprises centrifuging the cells of step (b) in which the binding protein is expressed to form a pellet, and freezing at -20 ° C; Thawing at 37 ° C. and acidic solution, preferably with 0.1M citric acid (pH.4).
  • the library screening method of the present invention may further comprise obtaining a fusion protein present in the cells recovered in individual cell units or isolating and amplifying a gene encoding the fusion protein. Recovering the protein or isolating and amplifying the gene may be achieved through a method widely used in the art.
  • the method of the present invention includes a binding protein as a method that can replace a ribosome display, a phage display, a cell surface display, and the like, which are commonly used as a conventional library screening method.
  • the active protein particles ie, CBD protein tags, are formed as inclusion bodies in cells and used as Interaction Trapper cells (ITcells), which penetrate the cells, and the binding proteins with external targets displayed on the inclusion bodies.
  • ITcells Interaction Trapper cells
  • the present invention overexpresses intracellular binding proteins and displays them at high density in the inclusion body ( ⁇ 3 x 10 5 proteins / cell, cf) yeast surface expression system 3 x 10 4 proteins / cell.
  • the signal-to-noise ratio is much higher than that of the conventional screening methods, resulting in high screening efficiency and various binding affinity.
  • even a small amount of the target material has the advantage that it is possible to confirm the interaction even with a low expression rate of the target material due to the high signal intensity, and because it is an E. coli-based system, the experiment is easy and the method is simple. It is a high-speed mass screening system that enables analysis and library screening of cells with interactions between materials and binding proteins through flow cytometry.
  • the present inventors confirmed that the family II CBD (cellulose-binding domain) derived from Cellulomonas fimi self-aggregates in Escherichia coli ( E. coli ) to form inclusion bodies, and eukaryotic as well as bacterial cells.
  • a method of observing interactions between biological materials in a cell using a phenomenon in which co-expressed proteins are co-integrated into the inclusion body particles has been developed (Korean Patent Publication No. 10-2013-0023057).
  • the present inventors display binding proteins (antibodies, artifacts, interacting proteins, ligand binding proteins, pharmaceutical target proteins, etc.) having inherent activity by using the CBD protein that can be captured and interact with the active inclusion body in the patent.
  • Interaction Trapper cells Icells
  • Tcells Interaction Trapper cells
  • a protein library screening system was developed that can rapidly recover intermolecular interactions at the single cell level to selectively recover binding proteins that interact with targets (FIG. 1).
  • the cell permeation treatment method membrane disintegration developed in the present invention as a feature of the present invention, while maintaining the activity and expression of the binding protein displayed on the active inclusion body in the cell stably loses most of the genetic information of the binding protein And stably maintained in the cell.
  • cell permeation is a method of enhancing or completely removing the permeability of the cell wall / membrane to the cell wall or cell membrane by using physical and chemical methods to secrete molecules in vivo to the outside of the cell. It is a method that completely destroys cells or maintains cell morphology using toluene and secretes not only intracellular proteins but also genetic information outside the cells (Hansruedi Felix., 1982. Permeabilized cells. Analytical Biochemistry 120; 211 ⁇ ). 34).
  • the binding protein and genetic information displayed on the active inclusion body are not lost to the extracellular cells, and the cell morphology remains stable. This is a characteristic method of the present invention.
  • the presence of the active inclusion body affects the intracellular presence of the genetic information of the binding protein, which is consistent with the previous report that the ribosomal RNA, RNA polymerase, etc. are found in the inclusion body (Ursula Rinas and James E. Bailey., 1992. Protein compositional analysis of inclusion bodies produced in recombinant Escherichia coil.Applied Microbiology and Biotechnology 37; 609-14).
  • the present inventors overexpressed the binding protein in the cell to display the inclusion body in a highly integrated manner, thereby overcoming the limitations of the existing surface expression system (the size and number of displayable proteins, cell surface secretion problems), and high integration in the inclusion body.
  • the binding protein displayed on the screen is sensitive to the target material interacting with each other, resulting in a signal intensity of several hundred to tens of thousands or more higher than that of the fluorescent signal obtained by expression of the cell surface. It is much higher than the above, it has the advantage that it is easy to analyze the interaction between biological materials (Fig. 18).
  • the present invention is characterized in that since the binding protein is displayed on the active inclusion body, the genetic information of the binding protein is almost lost, as well as maintaining the intrinsic activity of the binding protein even after the optimized cell permeation treatment developed in the present invention. .
  • fusion protein refers to a protein produced by fusion of two or more proteins, and in particular, the present invention includes binding proteins and CBD proteins.
  • the fusion protein of the present invention can be produced through a genetic recombination method, it is possible to confirm the expression of the binding protein, preferably by transforming the structure into a host cell.
  • the fusion protein may further comprise a fluorescent protein.
  • the construct of the invention is a recombinant vector operably linked to a polynucleotide encoding a component of the fusion protein of the invention.
  • "Operably linked” refers to that expression control sequences are linked to regulate the transcription and translation of the polynucleotide sequence encoding the components of the fusion protein, wherein the polynucleotide sequence is expressed under the control of the expression control sequence (including the promoter) Maintaining an accurate frame of translation such that the components of the fusion protein encoded by the polynucleotide sequence are produced.
  • binding protein refers to a protein that can interact with a target material. Binding proteins may include, but are not limited to, proteins that need to be mass-produced for commercial use, but are selected from antibodies, artifacts, interacting proteins, ligand binding proteins, pharmaceutical target proteins, etc. It may mean a protein to be interacted with. In addition, the binding protein is not limited thereto, but may be a part of a polypeptide or a domain which is responsible for a binding function, as well as a native protein that may interact with a target material.
  • the polynucleotide encoding the binding protein may be derived from a library including genes encoding various proteins. This can be obtained from the whole genome of an organism such as whole genomic DNA and cDNA libraries. In addition, the polynucleotide encoding the binding protein and target can be obtained from a subset of the entire genome, such as a subtracted library or a sized library.
  • the binding protein is In, an artificial antibody protein in which the N-terminus of the Internaline B (InB) protein, the modified repeat module of the Variable Lymphocyte Receptor (VLR) protein, and the C-terminus of the VLR protein are fused together. -VLR5-c or In-VLR5c-D3E8 (Korean Patent No. 10-1255682).
  • active inclusion body protein refers to a protein having a characteristic that can be displayed while maintaining the intrinsic activity of the binding protein expressed in the inclusion body, for example, CBD (cellulose-binding domain) protein, PhaC Protein (polyhydroxybutyrate synthase from Cupriavidus necator ; Bjorn Steinmann, Andreas Christmann, Tim Heiseler, Janine Fritz, Harald Kolmar., 2010. In Vivo Enzyme Immobilization by Inclusion Body Display.Appl.Environ.Microbiol. 76; 5563? 69), FMDV foot-and-mouth disease virus VP1 capsid protein (Antonio Villaverd et al., 2005. Aggregation as bacterial inclusion bodies does not imply inactivation of enzymes and fluorescent proteins.Microbial Cell Factories 4; 1-6).
  • the term "cellulose-binding domain protein” refers to a cellulose-binding domain protein as a family II protein derived from Cellulomonas fimi .
  • the CBD protein forms an inclusion body in E. coli , forms intracellular particles that do not affect the intrinsic activity and properties of the proteins fused thereto, and the CBD protein It is not limited to, and may include proteins capable of forming all active inclusion bodies.
  • D3E8 as a binding protein, D3E8, one of the variants of InB-VLR (Republic of Korea Patent No. 10-1255682), which is a Leucine-rich-repeat (LRR) protein, was used.
  • LRR Leucine-rich-repeat
  • a protein having a binding affinity of 6 and 2 nM a protein in which a binding protein was fused was designed as follows.
  • PInVLR5c-mRFP-CBD plasmid vector was generated by genetic recombination to produce a fusion protein consisting of only binding protein InVLR5c, binding protein mRFP, and family II CBD protein without binding affinity with IL-6.
  • the plasmid vector was generated by pD3E8-mRFP-CBD by gene recombination to produce a fusion protein consisting of InVLR5c-D3E8, a binding protein with affinity, mRFP, a fluorescent protein, and family II CBD protein.
  • the plasmid vectors were used as elements for transforming host cell E. coli to produce a fusion protein (Example 2).
  • the term "cell” refers to a functional and structural basic unit of all living things.
  • the cells may be cells of animals, plants, yeasts and bacteria, but are not limited to bacterial cells such as E. coli , Streptomyces, Salmonella typhimurium; Yeast cells; Fungal cells such as Pchia pastoris; Insect cells such as Drozophila and Spodoptera Sf9 cells; Animal cells such as CHO, COS, NSO, 293, bow melanoma cells; Or plant cells.
  • bacterial cells more preferably E. coli .
  • the cell of the present invention is preferably a bacterial cell in which an active inclusion body is formed by overexpression of CBD protein and can be used as an interaction capture cell.
  • the term "Interaction Trapper cells (ITcells)” means that the plasmid capable of expressing the binding protein and the CBD protein is overexpressed and the CBD protein forms an inclusion body and is expressed in the inclusion body. Refers to cells in which the bound protein maintains its intrinsic activity and is displayed in high density. When an external target material is introduced into the interaction capture cell, a cell capable of interacting with the binding protein displayed on the inclusion body is preferable.
  • the term "target material” refers to a material that can interact with the binding protein.
  • the target material may be, but is not limited to, a natural protein that can interact with the binding protein, as well as a domain, a part of a polypeptide that functions, and a compound that does not exist in vivo.
  • it may be a candidate material useful for biotechnology, medicine, pharmacy, or the like, a substance causing an in vivo action, and in particular, may be a protein, a nucleic acid or a compound, and may be, for example, IL-6.
  • the target material is characterized in that it is introduced from the outside without simultaneously expressing the binding protein in the cell. That is, the inclusion body is used as an interaction capture cell capable of displaying the binding protein, and the target material is introduced from the outside.
  • the term "introduced into a cell” refers to the movement of a substance outside the cell into the cell using physical or chemical methods.
  • the substance is a target substance and includes increasing the permeability of the cell membrane or cell wall to move the target substance into the cell.
  • There are various physical and chemical methods for temporarily increasing the permeability of cell walls or cell membranes (HANSRUEDI FELIX., 1982. Permeabilized Cells.Anal. Biochem. 120; 211-34), for example sonication, osmotic pressure treatment. , Heat treatment, freezing treatment, thawing treatment, acidic solution treatment, or a combination thereof.
  • coli cells are frozen at -20 ° C, thawed at 37 ° C, and acidic solution treatment is used to increase the permeability of cell walls or cell membranes, thereby displaying the activity of the binding proteins displayed in the intracellular inclusion bodies. And introducing foreign targets into the cells through the permeated membrane while maintaining genetic information (Example 5).
  • fluorescent material means a material that can react or spontaneously fluoresce in a specific energy, and in the present invention may be used to include a fluorescent protein, a fluorescent compound.
  • fluorescent protein refers to a polypeptide capable of spontaneously fluorescing or reacting with a specific energy, but is not limited thereto.
  • red fluorescent protein DsRed
  • Blue Fluorescent Protein BFP
  • Enhanced Blue Fluorescent Protein EBFP
  • CFP Cyan Fluorescent Protein
  • CGFP Cyan Green Fluorescent Protein
  • ECFP Enhanced Cyan Fluorescent Protein
  • YFP Yellow Fluorescent Protein
  • EYFP Enhanced Yellow Fluorescent Protein
  • AzG AzG
  • HcR HcRed, Heteractis crispa red fluorescent protein
  • BFP Blue Fluorescent Protein
  • the fluorescent compound may mean a fluorophore capable of modifying the target material, but is not limited to the fluorescent protein and Xanthene derivatives fluorescein, rhodamine, Oregon green, eosin, Texas red, and cyanine derivatives cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, and merocyanine, Naphthalene derivatives (dansyl and prodan derivatives), Coumarin derivatives, oxadiazole derivatives pyridyloxazole, nitrobenzoxadiazole and benzoxadiazole, pyrene derivative cascade blue, oxazine derivatives Nile red, Nile blue, cresyl violet , Acridine derivatives proflavin, acridine orange, acridine yellow, Arylmethine derivatives auramine, crystal violet, malachite green, Tetrapyrrole derivatives may be selected from the group consisting of porphin,
  • the fluorescent protein constituting the binding protein and the fusion protein and the fluorescent material for modifying the target material may be fluorescence of different wavelengths, specifically, the wavelength of the fluorescence signal emitted from each other is different from the fluorescence signal detector Each signal may be detected separately.
  • the binding protein may or may not include a fluorescent protein, but the target material should include the fluorescent protein or fluorescent material.
  • the plasmids pInVLR5c-mRFP-CBD and pD3E8-mRFP-CBD encoding the binding protein include RFP as a fluorescent protein, and GFP as a fluorescent substance for the target protein IL-6. .
  • fluorescent signal means the wavelength of energy resulting from a fluorescent protein or fluorescent material, which can be expressed as a value by a fluorescent signal detector.
  • the measurement of the intracellular fluorescence signal is performed by fluorescence microscopy or flow cytometry.
  • GFP and RFP fluorescence was detected by FL1 (530/30 nm) and FL2 (585/42 nm) PMT with flow cytometry FACS Calibur (BD Biosciences, CA), respectively.
  • GFP was optimized by cell permeation optimized for inclusion body cells (PPI +) expressing pD3E8-mRFP-CBD with binding affinity to IL6, and inclusion cells (PPI-) expressing pInVLR5c-mRFP-CBD without affinity. After introducing the bound IL6 protein into the cells, the binding affinity difference for IL6 was confirmed by GFP fluorescence (FIG. 11).
  • the existing method depends on whether the bait protein interacts with the binding material.
  • the method of the present invention analyzes the interaction between proteins using the difference in the density and dispersion of the fluorescent signal fused to the binding material on the intracellular inclusion body, the method of the present invention through the optimized cell permeation of the target material from the outside By measuring the intensity of the fluorescent signal of the target material introduced into the binding protein through interaction with the binding protein, while the conventional method shows a slight difference of about twice the signal-to-noise ratio, the present invention has a signal-to-noise ratio of more than 450 times The difference shows clear results (FIG. 13).
  • D3E8 and InVLR5c as a binding protein
  • CBD protein of family II derived from cellulose monamis Pim as an active inclusion body
  • target material used IL-6 but the present invention is not limited thereto, but the binding protein It is apparent to those skilled in the art that the present invention can be applied to any kind of binding protein, target material, and active inclusion body for the purpose of analyzing the interaction between the target material and the target material.
  • the method of the present invention may further include (e) recovering the cells in individual cell units based on the measured fluorescence intensity after step (d), wherein the fusion present in the cells recovered in the individual cell units Obtaining a protein or isolating and amplifying the gene encoding the fusion protein may be further included. Obtaining the protein or isolating and amplifying the gene may be achieved through methods widely used in the art.
  • the term "recovery” refers to measuring the fluorescent signal of the fluorescent material fused to the target material from the cell library containing the binding protein to screen only cells identified for interaction of the binding protein with the target material using a flow cytometer.
  • the flow cytometer may mean a device capable of measuring the cell size, the composition inside the cell, the intensity of fluorescence, preferably a single cell according to the cell size, the composition inside the cell, the intensity of fluorescence desired by the experimenter It may be a device that can be recovered by separating.
  • the term “isolation” refers to the separation of polynucleotides encoding the binding protein from the cell when the cell from which the binding protein and the target material have been identified is recovered from the cell library containing the binding protein.
  • the separation may mean separation of DNA from cells.
  • the above DNA separation may be any method known in the art, so long as it does not violate the purpose of separating the polynucleotide encoding the binding protein.
  • amplification refers to amplifying a large amount of polynucleotides encoding the binding proteins separated above using a general polynucleotide amplification method known in the art.
  • the method of amplification can be selected according to the use of the amplified polynucleotide, and such a selection can be easily selected by those skilled in the art.
  • the binding affinity of the GFP fused to the target material according to the interaction between the binding protein displayed on the inclusion body and the target material is determined whether or not binding affinity is obtained through a high-speed mass flow cytometer. Investigate whether the difference can be analyzed, and the LRR protein D3E8 (PPI +), which has a binding affinity of about 2 nM, and F11 (PPI +), which is 117 nM, and InVLR5c (PPI-), which have no affinity, are included in the inclusion body.
  • IL-6 was analyzed using a flow cytometer (FACSaria) for samples inducing cell permeation and protein interaction. 10,000 E. coli cells with high binding affinity were recovered. Plasmids were purified from the recovered cells and transformed back into DH5 ⁇ E. coli cells, and PCR amplification was performed on the formed colonies to determine whether the cells recovered through the phenotype (D3E8-mRFP-CBD protein) were recovered. It was confirmed (Fig. 14).
  • Protein library screening step including fractionation can be used in a variety of protein engineering including the step.
  • the present invention provides a method comprising the steps of: (a) providing a cell comprising a construct comprising a polynucleotide encoding a fusion protein consisting of a binding protein and an active inclusion body protein; (b) expressing a fusion protein in said cells to form Interaction Trapper cells (ITcells) in which the binding protein is displayed in the inclusion body; (c) introducing the target material to which the fluorescence is fused into the cell through permeation treatment (membrane disintegration) to the cell according to step (b); And (d) measuring the interaction between the binding protein and the target material by the fluorescence intensity of the fluorescent material fused to the target material introduced from the outside, the method for analyzing the interaction between the binding protein and the target material. .
  • the permeation step of step (c) does not affect the activity and genetic information of the binding protein displayed on the inclusion body inside the cell, and as long as the target material can be introduced into the cell through the permeated membrane, it is generally used in the art.
  • the method of use can be used without limitation.
  • it may include the step of freezing the cells, thawing and treating with an acid solution, for example, (i) freezing the cells at -80 to -10 °C; (ii) thawing the frozen cells at room temperature to 37 ° C .; And (iii) treating with an acidic solution.
  • the acidic solution is not limited to the type and pH, for example may be pH 4 to pH 6.
  • the permeation process comprises centrifuging the cells of step (b) in which the binding protein is expressed to form a pellet, and freezing at -20 ° C; Thawing at 37 ° C. and acidic solution, preferably with 0.1M citric acid (pH.4).
  • microorganism' of the present invention refers to all kinds of cells expressing a fusion protein composed of the binding protein of the present invention and an active inclusion body protein and displayed on the intracellular inclusion body, and may be eukaryotic cells or prokaryotic cells, This is not restrictive. For example, it may be E. coli.
  • Existing permeation technology is a technology for the purpose of permeation process itself to obtain protein and genetic information by leaking the intracellular protein and genetic information to the outside of the cell, the purpose is to completely leak the intracellular protein and genetic information through permeation,
  • the present inventors endeavored to establish a permeation treatment method that enables the target material to be introduced into the cell smoothly without affecting the activity and genetic information of the binding protein displayed on the intracellularly active inclusion body. The method was established.
  • the activity and genetic information of the binding protein displayed on the active inclusion body inside the microorganism are stably maintained in the cell, and an external target material can be introduced into the cell. Has a new effect to keep.
  • the permeation process comprises the steps of centrifuging microorganisms (E. coli) to form pellets and freezing at -20 ° C; Thawing at 37 ° C. and acidic solution, preferably with 0.1M citric acid (pH.4).
  • E. coli centrifuging microorganisms
  • acidic solution preferably with 0.1M citric acid (pH.4).
  • the invention provides a cell comprising a construct comprising a polynucleotide encoding a fusion protein consisting of a binding protein and an active inclusion body protein.
  • binding protein active inclusion body protein, fusion protein and cells are as described above.
  • a polynucleotide encoding LRR protein as a binding protein, CBD protein as an active inclusion body protein, and IL-6 protein as a target material, and a protein in which a binding protein and a CBD protein are fused were formed by transduction into E. coli cells.
  • the present invention provides a cell library comprising a construct comprising a polynucleotide encoding a fusion protein consisting of a binding protein and an active inclusion body protein.
  • the library may be a DNA library or a cell library transformed thereto.
  • binding protein active inclusion body protein, fusion protein and cells are as described above.
  • a "cell library” is a library consisting of cells comprising a plasmid encoded by a binding protein that interacts with a target material.
  • the binding protein is stably displayed in an inclusion body and the target is expressed through cell permeation.
  • It may be a library characterized in that the substance consists of cells that can be introduced into the cells.
  • the cell library may be, but is not limited to, a library consisting of E. coli cells.
  • the target substance IL-6 has an affinity of about 2 nM, an LRR protein of D3E8 (PPI +), and an 117 nM of F11 (PPI +), an affinity LRR protein of InVLR5c (PPI-).
  • the cells in which) are displayed in the inclusion body were used in a similar library, which was mixed and manipulated in a ratio of 1: 10: 10000, respectively.
  • a random library was constructed on the repebody (LRR protein), a model binding protein, for screening using a protein fusion display system, and used as a real library.
  • the present invention provides an interaction capture cell and cell library in which a fusion protein consisting of a binding protein and an active inclusion body protein is expressed and the binding protein is displayed on the inclusion body.
  • binding protein active inclusion protein, fusion protein, cell and cell library are as described above.
  • Example 1 Obtain genes and enzymes
  • the cellulose-binding domain (CBD) gene of family II was derived from the exoglucanase gene of the cellulomonas fimi KCTC 9143 strain of the Korean Collection of Type Cultures (KCTC). Cloned.
  • the improved GFP (modified green fluorescent protein) gene was obtained from the commercial plasmid vector pEGFP (Clontech, CA), and the plasmid vector pRFP carrying the monomeric red fluorescent protein 1 (mRFP1) gene was provided by the Korea Advanced Institute of Science and Technology in Daejeon, Korea. received.
  • VLR Variable Lymphocyte Receptor
  • InB-VLR Repebody
  • InB Internaline B
  • InB Internaline B
  • InB modified repeat module of the VLR protein
  • C-terminus of the VLR protein are fused together.
  • In-VLR5-c Korean Patent Publication No. 10-2010-0086055
  • In-VLR5c-D3E8 with binding affinity with IL-6
  • In-VLR5c-F11 117 nM
  • hIL-6 human interlukin-6 was a vector in which the hIL-6 gene was cloned. All of these genes were provided by the Korea Advanced Institute of Science and Technology in Daejeon, Korea. All enzymes used in the present invention were purchased from NEB (New England Biolabs).
  • All primers of the present invention were synthesized in Bioneer, Daejeon, Korea.
  • the primers are shown in Table 1 below.
  • restriction sites such as restriction enzymes NdeI and KpnI are shown in bold.
  • All genes used in the present invention, including the In-VLR and GFP genes, were amplified with the respective primers shown in Table 1, then fused using overlap extension PCR, and the NdeI and Hind III of the pET21a vector. Restriction sites were inserted and recombined using E. coli DH5 ⁇ cells.
  • Plasmid vectors prepared by the method were named pInVLR5c-mRFP-CBD, pD3E8-mRFP-CBD, pF11-mRFP-CBD, pGFP-IL6, respectively.
  • pInVLR5c-mRFP-CBD plasmid was inserted into NdeI and HindIII restriction enzyme-treated pET21a vector of NdeI and HindIII , and recombined using E. coli DH5 ⁇ cells.
  • the plasmid vector prepared by the above method was named pInVLR5c-mRFP.
  • In-VLR5c-D3E8 and In-VLR5c-F11 genes as Primer 1 (SEQ ID NO: 1) and Primer 2 (SEQ ID NO: 2)
  • the In-VLR5c gene was identified as Primer 1 (SEQ ID NO: 1) and Primer 7 (SEQ ID NO: 7).
  • the mRFP1 gene was amplified from the vector cloned with the mRFP1 gene using primers 3 (SEQ ID NO: 3) and primer 4 (SEQ ID NO: 4), and the GFP genes were primer 8 (SEQ ID NO: 8) and primer 9 (SEQ ID NO: 9). Amplify from pEGFP gene.
  • the CBD gene is amplified from CBD using Primer 5 (SEQ ID NO: 5) and Primer 6 (SEQ ID NO: 6) (see J Microbiol Biotechnol.
  • hIL-6 gene is a primer 10 (SEQ ID NO: 10) and Primer 11 (SEQ ID NO: 11) were used to amplify the vector from which the hIL-6 gene was cloned.
  • PInVLR5c-mRFP-CBD, pD3E8-mRFP-CBD, pF11-mRFP-CBD, and pInVLR5c-mRFP plasmids prepared in Example 2 were transformed with E. coli DH5 ⁇ , containing ampicillin (50 ⁇ g / ml) Inoculated in LB medium (1% bacto-trypton, 0.5% yeast extract, 1% NaCl) shaking culture for 24 hours at 37 °C.
  • the cultured cell suspension was centrifuged at 4,470 ⁇ g for 5 minutes using a centrifuge (universal 320R, Hettich), and the plasmid was separated by a QIAprep ® spin miniprep kit using pellets from which the supernatant was removed. It was confirmed by electrophoresis using a% agarose gel.
  • pGFP-IL6 plasmid prepared in Example 2 was transformed with E. coli DH5 ⁇ , LB medium containing ampicillin (50 ⁇ g / ml) (1% bacto-trypton, 0.5% yeast extract, 1% NaCl) Inoculated to shaker culture for 24 hours at 37 °C.
  • the cultured cell suspension was centrifuged at a speed of 4,470 ⁇ g for 5 minutes using a centrifuge (universal 320R, Hettich), and the plasmid was separated using a pellet obtained by removing the supernatant using a QIAprep ® spin miniprep kit. The size and sequence were confirmed by electrophoresis and sequencing using a 1% agarose gel.
  • PD3E8-mRFP-CBD, pInVLR5c-mRFP-CBD and pInVLR5c-mRFP plasmids prepared in Example 2 were transformed with E. coli BL21 (DE3) and LB medium containing ampicillin (50 ⁇ g / ml) (1 % bacto-trypton, 0.5% yeast extract, 1% NaCl) was incubated at 37 °C shaking culture.
  • ampicillin 50 ⁇ g / ml
  • IPTG isopropyl-1-thio- ⁇ -D-galactopyranoside, 200 ⁇ M
  • ZEISS Fluorescence microscopy
  • pGFP-IL6 plasmid was transformed with E. coli OrigamiB (DE3) and inoculated in LB medium (1% bacto-trypton, 0.5% yeast extract, 1% NaCl) containing ampicillin (50 ⁇ g / ml) 37 Shake culture was carried out at °C.
  • LB medium 1% bacto-trypton, 0.5% yeast extract, 1% NaCl
  • ampicillin 50 ⁇ g / ml
  • the optimized cell permeation treatment developed in the present invention was performed.
  • the E. coli cell culture was centrifuged at 2,480 ⁇ g for 5 minutes and the pellet was frozen at -20 ° C.
  • Frozen E. coli cells were resuspended in PBS buffer (pH 7.4) and thawed at 37 ° C., centrifuged at 2,480 ⁇ g for 5 minutes and the supernatant removed.
  • the supernatant was removed by centrifugation and resuspended in PBS buffer (pH 7.4).
  • Example 7 protein structure based Binding protein Library building
  • the method for constructing a library of repebody which is an LRR protein used as a model binding protein, was applied in the same manner as that used in Korean Patent No. 10-1356075.
  • Repebody was used to select six amino acid residues 91, 93, 94, 115, 117, and 118 located in the concave region of two consecutive mutation modules (LRRV module 1 and 2). Then, the selected amino acid was substituted with NNK degenerate codon to synthesize a mutagenic primer for constructing a library.
  • the primers were used to perform overlap polymerase chain reaction (Overlap PCR) on two modules to obtain a library DNA, and by replacing and inserting a library gene at the position of InVLR5c gene of the recombinant vector pInVLR5c-mRFP-CBD, mRFP A library plasmid bound to the -CBD gene was obtained.
  • the secured library was introduced into E. coli DH5 ⁇ by electroporation to obtain a transformant, thereby constructing a library having a diversity of 1 ⁇ 10 7 level.
  • Example 8 in an active enclosure Displayed Expression Library Construction and Expression
  • the library colonies prepared in Example 7 were collected using storage buffer (2xTY media, 50% glycerol, 20% glucose), and centrifuged at 4,470 xg for 5 minutes using pellets from which the supernatant was removed.
  • QIAprep ® spin miniprep The plasmid was separated by kit. 1 ⁇ g of the isolated library plasmid was transformed into Escherichia coli BL21 (DE3) by electrochemistry to construct an expression library having a diversity of 1 ⁇ 10 7 level.
  • the expression library colonies were collected in storage buffer, inoculated in LB medium (1% bacto-trypton, 0.5% yeast extract, 1% NaCl) containing ampicillin (50 ⁇ g / ml) by taking OD 600 0.05 cells.
  • Example 4 GFP- purified and isolated in Example 4 in suspension of interaction capture cells (ITcells) expressing pD3E8-mRFP-CBD (PPI +) or pInVLR5c-mRFP-CBD (PPI-) via cell permeation treatment in Example 5
  • 10 ⁇ M of IL6 protein was added to each and an external target material was introduced into the cell through agitation reaction for 30 minutes to induce the interaction between proteins. After 30 minutes, washed with PBST, PBS buffer (pH 7.4), the interaction between the binding protein and the target material was analyzed by fluorescence microscopy (A of Figure 13) or flow cytometry (B of Figure 13).
  • Example 8 After the cell permeation treatment in the method of Example 5 to the frozen pellet (pellet) in Example 8, a variety of targets (mGFP-IL6, sfGFP. Fluorescein, dextran-FITC) to which the GFP is fused, respectively, the binding protein library After inducing interaction with the displayed inclusion body cells, the interacting cells were recovered by flow cytometry. Interacting cell recovery was performed with FACSaria TM III (BD Biosciences, Calif.) And assay gates were set based on SSC and FSC parameters.
  • targets mGFP-IL6, sfGFP. Fluorescein, dextran-FITC
  • Example 11 electron microscopy analysis ( SEM , TEM )
  • E. coli cells treated in Example 5 were pre-fixed in 2.5% paraformaldehyde-glutaraldehyde (4 ° C., phosphate buffer, pH 7.2) fixed solution for 2 hours and phosphate buffer (0.1 M, pH). 7.2), then washed three times for 10 minutes, and then post-fixed in 1% OsO 4 (25 ° C., 0.1 M phosphate buffer, pH 7.2) for 2 hours.
  • the fixed material was washed several times with the same buffer, dehydrated in increasing order of ethanol concentration, replaced with isoamyl acetate, dried with a critical point dryer, and then a SC502 sputter coater. After plating to a thickness of 20nm using the), it was observed at 10kV with a FEI Quanta 250 FEG (FEI, USA) scanning electron microscope (SEM) installed in the Korea Research Institute of Bioscience and Biotechnology.
  • the site cut out for transmission electron microscopic observation was fixed in 2.5% paraformaldehyde-glutaraldehyde (4 ° C, phosphate buffer, pH 7.2) fixed solution for 2 hours, and 10 minutes each with phosphate buffer (0.1M, pH 7.2). After washing three times, it was post-fixed in 1% OsO 4 (25 ° C., 0.1 M phosphate buffer, pH 7.2) for 2 hours. The fixed material was washed several times with the same buffer, and then dehydrated in increasing order of ethanol concentration. Substituted with propylene oxide, embedded with Epon-812, and polymerized in an oven at 60 ° C. for 36 hours.
  • the embedded tissue was fabricated by ultra-thin slicer (ultramicrotome, ULTRACUT E, Leica), and double-stained with uranyl acetate and lead citrate to transmit electron microscope, TEM, CM 20, Philips) at 100 kV.
  • the binding protein VLR InVLR5c
  • the fluorescent protein mRFP are fused to the CBD tag and overexpressed in E. coli.
  • Cells were formed, and only the inclusion bodies were separated by ultrasonic pulverization and confirmed by fluorescence microscopy.
  • the fluorescence of mRFP, a fluorescent protein was observed at the inclusion body position, indicating that the binding proteins, VLR and mRFP, were displayed on the CBD inclusion body, and mRFP fluorescence was also observed in the inclusion body separated by ultrasonic crushing. And it was confirmed that the display stably (Fig. 3).
  • Example 13 cell permeability Intracellular External influence
  • the intracellular changes according to the presence or absence of inclusion bodies after freezing and thawing during the cell permeation treatment in Example 5 were analyzed using a flow cytometer and a fluorescence image (FIG. 4).
  • FOG. 4 fluorescence image
  • an external target into the cell is not introduced into the cell only by the freezing and thawing process (FIG. 5), but the flow cytometry may be introduced into the frozen and thawed infiltrating cells through an acid solution or EDTA, which is a chelating agent. It was confirmed (FIG. 6). As a result of FIG. 6, it was confirmed that the most effective method of introducing an external target material into the cell was 0.1M citric acid (pH 4), thereby completing the optimized permeation treatment process of the present invention.
  • the external target material was moved into the cell, and the interaction with the binding protein displayed on the inclusion body was observed by fluorescence image (FIG. 7A), and the target material was short-lived (1 minute).
  • the flow cytometry results of moving to the inside and interacting with the binding protein confirmed that the permeated cell membrane was easily movable to the target material.
  • VLR-mRFP-CBD cell in which the binding protein is displayed on the active inclusion body and a cell without inclusion body (VLR-mRFP) is used.
  • the optimized cell permeation process was developed to separate pellets and supernatants, respectively, and to determine the presence or absence of a plasmid containing the genetic information of the binding protein in the two cells according to the permeation process (Quantitative PCR; Q). -PCR).
  • Q quantitative PCR
  • -PCR PCR
  • 11A shows that external target material can be introduced into the cell only after the two-step permeation process developed in the present invention, and the introduced target material aggregates into the inclusion body through interaction with the binding protein displayed on the intracellular inclusion body. This data shows that it is (co-localized).
  • the cells developed in the present invention in cells (repebody-mRFP-CBD cells) in which the binding protein is displayed on the active inclusion body. After each separation into a pellet and a supernatant through a permeation treatment, the aggregate is resuspended in the same amount of PBS buffer (pH 7.4) as the supernatant. Using the aggregate suspension and the supernatant, the presence or absence of the plasmid containing the genetic information of the binding protein was confirmed by real-time polymerase chain reaction quantitative PCR (Q-PCR). In addition, cells before permeation and intracellular plasmids after permeation were separated and confirmed by electrophoresis. As a result, it was confirmed that the genetic information of the binding protein displayed on the active inclusion body was maintained stably in the cell despite the cell permeation treatment.
  • Q-PCR real-time polymerase chain reaction quantitative PCR
  • the binding protein displayed on the intracellular active inclusion body and its genetic information are maintained through the optimized permeation treatment of the present invention, it is possible to separate and separate the cells into individual cells by using the interaction between the binding protein and the target material. It is a result showing that the protein library screening system including the step of recovering the genetic information in the unit.
  • 11C is a result of confirming the cell morphology before and after the cell permeation treatment through flow cytometry and electron microscopy, and it was confirmed that the cell morphology was stably maintained even after the cell permeation treatment.
  • the cell permeation treatment method developed in the present invention increases the permeability of the cell wall and membrane without destroying the cells, stably introduces an external target material into the cell, and simultaneously binds the protein and its genetic information displayed on the active inclusion body. It is supported by the present invention, which is clearly different from other existing cell permeation treatment methods that are stably maintained in the interior.
  • Example 15 Protein-to-protein interaction analysis using protein fusion display technology
  • Proteins were used as model binding proteins and displayed in inclusion bodies, respectively.
  • pD3E8-mRFP-CBD or pInVLR5c-mRFP-CBD plasmids were transformed into E. coli to express fusion proteins, and the target cell GFP-IL6 protein was introduced into cells through the optimized cell permeation treatment of Example 5. The cells were then observed through fluorescence microscopy and flow cytometry.
  • the fluorescence of the target material is determined not only by fluorescence microscopy but also by flow cytometry on inclusion body cells of individual cell units according to the affinity and interaction between the binding protein displayed on the inclusion body and the target material through the method of the present invention. It is supported by the strength that separation and recovery is possible.
  • the present invention distinguishes the presence or absence of interaction depending on the intensity of fluorescence fused to the target material introduced from the outside, the signal-to-noise ratio difference is very clear.
  • PCR amplification reaction was performed using a mixture of primers 12 (SEQ ID NO: 12), primer 13 (SEQ ID NO: 13), and primer 14 (SEQ ID NO: 14) shown in Table 1, and recovered the cells with the interaction through the size of the amplified gene. It was confirmed.
  • a real library was prepared using the repebody used as a model binding protein, and screening was performed to find protein binders for various types of targets using the repebody (FIGS. 15A to 15C).
  • various types of targets mGFP-IL6, sfGFP, fluorescein, dextran-FITC
  • FACS fluorescein, dextran-FITC
  • the plasmid bound to the mRFP-CBD gene was secured by PCR of only the repebody gene of the recovered cells and replacing and inserting the library gene at the InVLR5c gene position of pInVLR5c-mRFP-CBD.
  • This plasmid was introduced into Escherichia coli BL21 (DE3) by electroporation to obtain transformants, and then randomly selected colonies were identified to confirm the repebody gene sequence obtained through sequencing.
  • Several kinds of protein binders that bind to each target could be easily obtained with up to two repeated screenings, especially in the case of library screening targeting sfGFP, only binding protein cells with the target and desired binding capacity were selected on FACS analysis. Recovery was possible.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 결합단백질을 포함하고 있는 활성형 단백질입자, 즉 불용성 응집체(봉입체; inclusion bodies)를 형성하면서도 결합단백질 고유의 상호작용 및 활성을 나타내도록 하는 융합 단백질을 발현시켜 결합단백질이 세포내 봉입체 표면에 디스플레이 된 상호작용 포획 세포(ITcells; Interaction Trapper cells)를 이용하고 상기 세포를 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않는 최적의 투과처리 단계를 통해 결합단백질과 외부 표적물질의 상호작용을 측정하는 단계를 포함하는 결합단백질과 표적물질 간 상호작용을 분석하는 방법 및 이에 개별 세포 단위로 회수하는 단계를 추가로 포함하는 라이브러리 스크리닝 방법에 관한 것이다. 또한, 본 발명은 세포내 봉입체 표면에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보를 보존하면서도 외부 표적물질을 세포 내로 도입시킬 수 있는 것을 특징으로 하며, 상기 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하거나, 융합 단백질이 발현되어 결합단백질이 봉입체에 디스플레이 된 세포 및 세포 라이브러리에 관한 것이다. 본 발명의 방법을 이용하면, 결합단백질의 과발현으로 인해 상호작용하는 표적물질을 민감하게 표지함으로써 신호 대 잡음비가 450배 수준으로 기존의 스크리닝 방법들에 비해 월등히 높아 스크리닝 효율이 높으며, 단일세포 단위로 용이하게 분리할 수 있어 형광 현미경 및 유세포분석기를 이용하여 대량의 라이브러리에서 상호작용 단백질을 초고속으로 탐색 및 분리할 수 있는 고속 탐색 기술(high-throughput screening; HTS)을 제공할 수 있다. 또한, 세포 내에서 발현이 어려운 외래 물질도 세포 외 발현 후 세포내 도입을 통해 생체 물질 간의 상호작용을 손쉽게 고속으로 분석할 수 있다. 본 발명은 항체/인공 항체개발, 새로운 상호작용 단백질의 제조, 표적단백질과 의약후보물질의 상호작용 분석 및 최적화 등 다양한 분야에 이용될 수 있다.

Description

단백질 융합 디스플레이 기술을 이용한 물질 간 상호작용 고속분석 방법
본 발명은 결합단백질을 포함하고 있는 활성형 단백질입자, 즉 불용성 응집체(봉입체; inclusion bodies)를 형성하면서도 결합단백질 고유의 상호작용 및 활성을 나타내도록 하는 융합 단백질을 발현시켜 결합단백질이 세포 내 봉입체 표면에 디스플레이 된 상호작용 포획 세포(ITcells; Interaction Trapper cells)를 이용하고 상기 세포를 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않는 최적의 투과처리 단계를 통해 결합단백질과 외부 표적물질의 상호작용을 측정하는 단계를 포함하는 결합단백질과 표적물질 간 상호작용을 분석하는 방법 및 이에 개별 세포 단위로 회수하는 단계를 추가로 포함하는 라이브러리 스크리닝 방법에 관한 것이다. 또한, 본 발명은 세포 내 봉입체 표면에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보를 보존하면서도 외부 표적물질을 세포 내로 도입시킬 수 있는 것을 특징으로 하며, 상기 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하거나, 융합 단백질이 발현되어 결합단백질이 봉입체에 디스플레이 된 세포 및 세포 라이브러리에 관한 것이다.
생명체가 수행하는 모든 과정들은 세포내 단백질들을 매개로 한 상호작용 네트워크 복합체(interactome)를 통해 이루어지고, 이러한 상호작용 조절에 문제가 발생하면 네트워크 전체에 영향을 미치게 되며, 이는 곧 질병 발생의 원인이 된다. 따라서 상호작용에 관련된 단백질들을 이해하고 이를 조절하는 것은 네트워크 복합체를 이해하는 기반이 되며, 나아가 질병 치료연구 및 치료제 개발에 있어서도 매우 중요하다.
따라서 이미 그 기능 및 특성이 알려져 있는 세포내 단백질들을 타깃으로 하여 이에 대한 상호작용 파트너인 단백질 라이브러리를 제작하고, 라이브러리에서 타깃과 상호작용하는 단백질만 선별하여 그 특성을 확인함으로써 생체 내 단백질 간 상호작용을 이해하는 다양한 스크리닝 방법들이 연구되어 왔다 (Hening Lin and VirginiaW. Cornish., 2002. Screening and Selection Methods for Large-Scale Analysis of Protein Function. Angew. Chem. Int. Ed 41;4402~25).
현재 라이브러리를 스크리닝 하는 다수의 방법들은 크게 무세포 시스템(cell-free system)과 세포 표면 발현 시스템 (surface display)로 나눌 수 있으며, 대표적 무세포 시스템으로는 라이보좀 디스플레이와 시험관 내 구획화(in vitro compartmentalization; IVC) 방법이, 표면 발현 시스템으로는 파아지 디스플레이, 박테리아/효모 디스플레이 방법이 통상적인 라이브러리 스크리닝 방법으로 알려져 있다.
먼저 라이보좀 디스플레이는 mRNA-라이보좀-펩타이드가 3중 복합체를 형성하여 타깃과 결합한 펩타이드의 mRNA를 복합체로부터 해리시켜 RT-PCR을 통해 증폭시키는 방법으로, 모든 과정이 생체 외에서 진행되기 때문에 형질전환이 필요 없어 라이브러리 사이즈가 최대 1013개로 크다는 장점을 가지고 있으나, 약 27%만이 복합체로 존재하며 mRNA-라이보좀에 디스플레이 되는 단백질 크기의 한계성, 라이보좀 복합체의 안정성 및 기술적 민감성 등의 한계를 지니고 있다 (Hanes, J and Pluckthun, A., 1997. In vitro selection and evolution of functional proteins by using ribosome display. Proc. Natl. Acad. Sci. 94: 4937~42).
시험관내 구획화(IVC)는 세포 내부가 아닌 오일 속에 분산되어 있는 수용액 에멀전으로 유전자를 구획화하는 방법으로, 구획된 유전자는 에멜전 내에서 전사, 번역되어 단백질 라이브러리를 형성한다. 1 밀리리터(mL)의 부피 안에 109개 이상의 액적을 만들 수 있으며, 이러한 액적은 다양한 외부환경(온도, pH, 염의 농도)에 안정하고 독립적인 미세반응기(microreactor)의 역할을 한다. 하지만 단백질 회수 시 에멀전을 유기 용매를 이용하여 파괴하게 되는데 이 때 사용하는 유기 용매에 의해 단백질의 활성이 감소될 수 있으며, 이렇게 회수된 단백질들이 세포 내에서는 활성을 나타내지 않을 수 있다(Dan S. Tawfik and Andrew D. Griffiths., 1998. Man-made cell-like compartments for molecular evolution. Nat. Biotechnol. 16; 652-56).
현재 라이브러리 스크리닝에서 가장 통상적으로 사용되는 방법인 파아지 디스플레이는 파지 끝부분 pIII 단백질에 라이브러리 단백질들이 융합되어 디스플레이되고 이를 이용하여 고정된 표적 타깃에 대한 결합 친화도에 의해 스크리닝 하는 방법으로, 라이브러리에서 많은 수의 클론들을 쉽게 스크리닝 가능하다는 장점을 가지고 있다. 하지만 파아지의 pIII 단백질에 1~5개의 결합단백질들이 디스플레이 되어 있고 타깃을 비드, 플레이트 바닥에 고정하여 사용하므로 타깃에 여러 개의 결합이 동시에 발생하여 개별 단백질과 타깃과의 실제 친화력과 다른 문제점(avidity effect)이 발생할 수 있다. 또한 이 방법의 특성상 용리(elution)단계를 필요로 하는데 디스플레이 된 단백질이 타깃과 높은 결합력을 가질 경우 디스플레이 된 단백질이 고정상으로부터 용리되기 어려운 등의 한계점이 있다. 또한 파아지 디스플레이에서 라이브러리 스크리닝 시 사용되는 panning방법은 신호 대 잡음비가 낮아 타깃과 결합 친화도를 가지는 단백질을 얻기 위해서는 최소 3~5 번의 panning 과정을 거쳐야하며, false positive가 높다는 한계점도 있다(George P. Smith and Valery A. Petrenko., 1997. Phage Display. Chem. Rev. 97: 391~410).
파아지 디스플레이의 한계점을 극복하기 위해 개발된 세포 표면 디스플레이는 박테리아, 효모와 같은 미생물의 세포막 단백질을 표면 발현 모체(surface anchoring motif)로 사용하여 단백질을 미생물 표면에 안정적으로 발현시키는 방법으로, 형광 탐침(fluorescence probe)이 융합된 타깃을 이용하여 라이브러리 스크리닝 시 유세포분석기(FACS)를 사용하기에 고속대량스크리닝(high throughput screening)이 가능하며(1x109 cells/h) 파아지 디스플레이의 panning 방법보다 비특이적 잡음비(nonspecific background)가 낮다는 장점을 가지고 있다. 하지만 이러한 표면 발현 시스템은 단백질 라이브러리를 세포벽 밖으로 성공적으로 돌출시켜야 하는 동시에 성공적으로 세포 내막을 통과한 단백질들은 세포 표면에 안정하게 부착되어야하며, 세포 표면에 융합된 단백질들의 3차원 구조 변화가 없어야 한다(단백질의 활성 유지). 이를 위해서는 세포 표면까지 도착하기 위해 세포 내막을 통과할 수 있도록 도와주는 매우 효율적인 시그널 서열이 단백질에 융합되어 있어야 하며, 세포 외부로 단백질들이 성공적으로 돌출되어야 하기에 표면에 디스플레이 될 수 있는 단백질의 크기 제한 및 표면에 디스플레이되는 단백질의 갯수 제한 등의 한계점이 있다 (Eric T. Boder and K. Dane Wittrup., 1997. Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotech. 15;553~57).
따라서 기존의 스크리닝 시스템들의 지니는 한계점을 극복하기 위해서는 스크리닝의 민감도를 높여 다양한 결합 친화도(mM ~ nM)를 가지는 타깃에 대해서도 스크리닝이 가능하며, 신호 대 잡음비가 높아 세포내 수많은 단백질들 중에 원하는 단백질과 특이적 결합을 가지는 결합 단백질을 라이브러리에서 손쉽게 스크리닝 할 수 있는 효과적이고 효율적인 스크리닝 시스템의 개발이 필요하다.
상기와 같은 문제점을 해결하기 위한 방법으로 여러 개의 결합단백질들을 하나의 담체에 고정화시켜 타깃과 결합 시 탐지 시그널을 증폭시키고, 타깃과의 상호작용 분석은 형광을 이용한 탐지방법을 사용하여 신호 대 잡음비를 높이는 방법이 있으며, 이러한 특징을 가지는 분석 방법들로는 자가조립 성질을 지니는 단백질인 페리틴(ferritin)을 이용하여 나노고단위복합체를 통한 물질 간의 상호작용 검출 방법(Sangkyu Lee et al., 2011. Small-Molecule-Based Nanoassemblies as Inducible Nanoprobes for Monitoring Dynamic Molecular Interactions Inside Live Cells. Angew Chem Int Ed Engl 50;8709~13), 나노 입자를 고정화 담체(immobilized matrix)로 이용하여 생물학적 분자들과의 상호작용 및 촉매작용에 이용하는 방법(Wenwan Zhong., 2009. Nanomaterials in fluorescence-based biosensing. 394;47~59)이 개발되어 있다.
한편 최근에는 세포 내 단백질의 불용성 침전물인 단백질 봉입체(inclusion bodies; IBs)에 세포 내 단백질을 고정하여 생체 촉매로 이용하려는 연구들이 보고되고 있다 (Jozef Nahalka, Bernd Nidetzky., 2007. Fusion to a pull-down domain: a novel approach of producing trigonopsis variabilis D-amino acid oxidase as insoluble enzyme aggregates. Biotechnology and Bioengineering. 97;454~61).
일반적으로 세포내 단백질 봉입체(inclusion bodies; IBs)는 불활성 응집체를 의미하나, 최근 일부 봉입체가 단백질 고유의 생화학적 특성을 상당부분 유지하는 활성형 단백질 입자(active particles)임이 보고된 바 있다(Antonio Villaverd et al., 2005. Aggregation as bacterial inclusion bodies does not imply inactivation of enzymes and fluorescent proteins. Microbial Cell Factories 4;1~6). 상기 활성형 단백질 입자들을 고정화 담체로 사용하여 효소 및 형광 단백질을 고정화시켜 그 활성을 측정한 결과, 고정화 시키지 않은 효소 및 형광 단백질의 활성과 비교하여도 30~100%정도까지 활성을 유지하며 고정화 된 효소의 안정성 증가 및 재사용 등의 유용성이 보고됨에 따라 활성형 단백질 입자들을 효소 산업에 이용하려는 연구들이 활발히 진행되고 있다.
본 발명자들은 셀룰로모나스 피미(Cellulomonas fimi) 유래의 패밀리 II CBD(cellulose-binding domain)가 대장균(Escherichia coli, E. coli) 내에서 자가 응집을 하여 봉입체(inclusion bodies, IB)를 형성하는 것을 확인하고, 박테리아 세포뿐만 아니라 진핵 세포 내에서 동시 발현된 단백질들이 상기 봉입체 입자로 동시 집적되는 현상을 이용하여 세포에서 생체 물질 간 상호작용을 관찰하는 방법을 개발한 바 있다(대한민국 공개특허 제10-2013-0023057호). 그러나, 상기의 방법은 세포 내에서 동시에 발현하는 세포내 생체 분자들 간의 상호작용만을 관찰할 수 있으며, 신호 대 잡음비가 낮아 표적물질과 결합된 결합물질을 효과적으로 개별 세포단위로 분획, 회수하기에는 힘들다는 한계점이 있다. 또한 표적물질은 단백질 또는 펩타이드, 핵산 등 세포 내에서 합성될 수 있는 물질로 제한되고, 형광신호는 형광단백질만을 사용해야 하는 제한이 있다. 즉 외부에서 넣어줄 수 있는 다양한 형태의 표적물질을 사용할 수 없을 뿐 아니라 형광신호도 다양한 형광화학물질을 사용할 수 없는 단점이 있다.
본 발명자들은 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않도록 세포벽을 투과 처리하고 외부 표적물질을 세포 내로 도입하여 세포 내에 존재하는 단백질 봉입체에 디스플레이된 결합단백질과 결합하게 함으로써 생체 분자와 외부 물질 간에 일어나는 상호작용을 직접적으로 관찰할 수 있는 시스템을 개발한 결과, 신호 대 잡음 비가 450배 이상 수준으로 개선되어 단일 세포 수준에서 물질 간의 상호작용을 직접적으로 관찰 가능한 것을 확인하였다. 또한 실제 라이브러리를 제작하여 스크리닝 수행 결과 단일 세포 수준에서 분자 간 상호작용을 고속으로 탐색하여 표적물질과 상호작용하는 결합단백질을 선택적으로 회수 가능함을 확인하였으며, 최대 2번의 반복 스크리닝만에 고친화도 결합체(high-affinity binder; ~nM 수준)를 발굴할 수 있음을 확인함으로서 본 발명을 완성하였다.
본 발명의 하나의 목적은 결합단백질과 활성형 봉입체(intracellular particle) 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는, 세포 라이브러리를 제공하는 단계; 상기 세포 라이브러리에서 융합 단백질을 발현시켜 결합단백질이 봉입체에 디스플레이된 상호작용 포획 세포(Interaction Trapper cells; ITcells)를 형성시키는 단계; 형광이 융합되어 있는 표적물질을 상기 단계에 따른 세포에 투과처리(membrane disintegration)를 통해 세포 내로 도입하는 단계; 및 결합단백질과 표적물질의 상호작용을 표적물질에 융합된 형광 물질의 형광 강도로 측정하여 개별세포 단위로 회수하는 단계를 포함하는, 라이브러리 스크리닝 방법을 제공하는 것이다.
본 발명의 다른 하나의 목적은 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는, 세포를 제공하는 단계; 상기 세포에서 융합 단백질을 발현시켜 결합단백질이 봉입체에 디스플레이된 상호작용 포획 세포(Interaction Trapper cells; ITcells)를 형성시키는 단계; 형광이 융합되어 있는 표적물질을 상기 단계에 따른 세포에 투과처리(membrane disintegration)를 통해 세포 내로 도입하는 단계; 및 결합단백질과 표적물질의 상호작용을 외부에서 도입된 표적물질에 융합된 형광 물질의 형광 강도로 측정하는 단계를 포함하는, 결합단백질과 표적물질 간 상호작용을 분석하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는 세포를 제공하는 것이다.
본 발명의 또 다른 목적은 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는 세포 라이브러리를 제공하는 것이다.
본 발명의 또 다른 목적은 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질이 발현되고, 결합단백질이 봉입체에 디스플레이 된 상호작용 포획 세포 및 세포 라이브러리를 제공하는 것이다.
본 발명의 방법을 이용하면, 결합단백질의 과발현으로 인해 상호작용하는 표적물질을 민감하게 표지함으로써 신호 대 잡음비가 450배 수준으로 기존의 스크리닝 방법들에 비해 월등히 높아 스크리닝 효율이 높으며, 단일세포 단위로 용이하게 분리할 수 있어 형광 현미경 및 유세포분석기를 이용하여 대량의 라이브러리에서 상호작용 단백질을 초고속으로 탐색 및 분리할 수 있는 고속 탐색 기술(high-throughput screening; HTS)을 제공할 수 있다. 또한, 세포 내에서 발현이 어려운 외래 물질도 세포 외 발현 후 세포 내 도입을 통해 생체 물질 간의 상호작용을 손쉽게 고속으로 분석할 수 있다. 본 발명은 항체/인공 항체개발, 새로운 상호작용 단백질의 제조, 표적단백질과 의약후보물질의 상호작용 분석 및 최적화 등 다양한 분야에 이용될 수 있다.
도 1은 본 발명의 대표도로서 물질 간 상호작용 고속분석이 가능한 단백질 융합 디스플레이 도식도 및 이를 이용하여 물질 간 상호작용을 분석한 결과이다.
도 2는 단백질 융합 디스플레이 기술의 방법적인 전체적 모식도이다.
도 3은 대장균 내에서 활성형 봉입체를 형성하는 CBD 단백질을 이용 결합단백질인 VLR과 형광단백질인 mRFP가 디스플레이 되어 있는 봉입체 세포(Interaction Trapper cells; ITcells)와, 봉입체 세포를 초음파분쇄를 통해 세포에서 봉입체만 분리한 것을 형광 현미경을 통해 관찰한 결과이다.
도 4는 본 발명에서 개발한 두 단계의 세포 투과처리(membrane disintegration) 과정 중 세포 동결/해동 과정이 세포 투과에 미치는 영향을 확인하기 위해, 결합단백질의 활성형 봉입체 디스플레이 유무에 따른 차이로 분석한 결과이다.
도 5는 본 발명에서 개발한 세포 투과처리 과정 중 세포 동결 과정에 의해 활성형 봉입체에 디스플레이되어 있는 결합단백질의 활성 및 발현은 유지되나, 외부 표적물질이 도입되기에는 세포 투과 정도가 충분하지 않음을 표적물질의 도입을 통해 확인한 유세포 분석 결과이다.
도 6은 본 발명에서 개발한 세포 투과처리 과정 중 세포 동결 과정을 거친 봉입체 세포에 산성용액 처리를 통해 외부 표적물질의 도입을 확인한 유세포 분석 결과로서, (A, B)는 산성용액의 종류 및 pH에 따른 외부 표적물질의 도입을 확인한 결과이며 (C)는 세포 외막 투과 효능을 가진 킬레이트제인 EDTA와 산성용액들 간의 투과 효능을 비교 분석한 결과이다.
도 7은 도 6에서 최적화된 투과를 통해 외부 표적물질을 세포 내로 도입하여 결합단백질과의 상호 작용을 확인한 결과로서, (A)는 활성형 봉입체에 디스플레이되어 있는 결합단백질과 표적물질과의 상호작용을 확인한 형광이미지 결과이며 (B)는 상호작용 포획 세포에 세포 투과 처리 후 표적물질과의 배양 시간에 따른 표적물질의 세포내 도입정도를 결합단백질과의 상호작용을 통한 표적물질의 형광강도를 이용해 확인한 결과이다.
도 8은 최적화된 세포 투과 방법을 통해 결합단백질과 표적물질간의 상호작용이 활성형 봉입체에 의해 고유의 활성을 유지하고 있는 결합단백질과의 특이적 결합임을 확인한 유세포 분석 결과이다.
도 9는 활성형 봉입체 세포의 투과화로 인한 세포 내외부의 변화를 관찰한 결과로, (A)는 세포 투과 처리 단계에 따른 세포내 단백질의 변화를 단백질 분석 시스템인 ExperionTM Pro260(Bio-rad)로 분석한 결과이며, (B)는 세포 투과 처리 전후의 활성형 봉입체 세포의 변화를 전자현미경을 통해 확인한 결과이다.
도 10은 본 발명에서 개발한 세포 투과 처리 과정에도 불구하고 활성형 봉입체로 인해 세포내 결합단백질의 유전정보가 대부분 유지됨을 중합효소연쇄반응 정량검사(RT-PCR)로 확인한 결과이다.
도 11a는 본 발명에서 개발한 세포 투과처리를 통한 단백질 융합 디스플레이를 모델단백질과 모델 표적물질을 이용하여 확인한 결과로서, 세포 투과에 따른 외부 표적물질의 세포내 도입에 의한 결합단백질과 표적물질과의 상호작용을 확인한 유세포 분석 및 형광이미지 결과이다.
도 11b는 본 발명에서 개발한 세포 투과처리를 통한 단백질 융합 디스플레이를 모델단백질과 모델 표적물질을 이용하여 확인한 결과로서, 세포 투과 처리 과정에도 불구하고 상호작용 포획세포 내 결합단백질의 유전정보가 대부분 유지됨을 중합효소연쇄반응 정량검사(RT-PCR) 및 아가로오스 젤 전기영동으로 분석한 결과이다.
도 11c는 본 발명에서 개발한 세포 투과처리를 통한 단백질 융합 디스플레이를 모델단백질과 모델 표적물질을 이용하여 확인한 결과로서, 세포 투과 처리 전후의 활성형 봉입체 세포의 변화를 유세포 분석기와 전자현미경을 통해 확인한 결과이다.
도 12는 단백질 융합 디스플레이 기술을 통해 획득한 dextran-FITC 결합체인 C20을 이용하여 여러 종류의 분자량을 가진 dextran-FTIC 처리를 통해 본 발명에서 개발한 세포 투과처리에 의한 세포 투과 정도를 분석한 결과이다.
도 13은 본 발명에서 개발한 최적화된 세포 투과 처리를 통해 표적물질을 세포 내로 도입하여 결합단백질과의 친화도 유무에 따른 단백질 간 상호작용을 형광 이미지(A) 및 유세포 분석기(B)로 분석한 결과이다. (C)는 최적화된 세포 투과 처리를 통해 표적물질을 세포 내로 도입하여 결합단백질의 표적물질과의 친화도 차이에 따른 상호작용을 유세포 분석기로 분석한 결과이다.
도 14는 단백질 융합 디스플레이를 이용하여 라이브러리 스크리닝이 가능함을 확인한 결과이다. 결합단백질과 표적물질간의 상호작용이 존재하는 봉입체 세포(PPI+)와 상호작용이 존재하지 않는 봉입체 세포(PPI-)를 혼합하여 라이브러리 유사 환경을 조성한 후 유세포 분석기를 통해 표적물질과 상호작용 하는 결합단백질이 발현된 세포를 표적물질에 융합되어 있는 GFP 형광을 통해 분석 후, GFP형광이 높은 E. coli 세포(PPI+) 10,000개를 회수하여 이를 PCR 증폭을 통해 스크리닝 효율을 분석한 결과이다.
도 15a는 단백질 융합 디스플레이를 통해 실제 라이브러리를 이용하여 스크리닝을 수행한 결과로 여러 종류의 타깃에 대해 단백질 결합체를 찾는 스크리닝 과정을 나타낸 결과이다.
도 15b는 단백질 융합 디스플레이를 통해 실제 라이브러리를 이용하여 스크리닝을 수행한 결과로 모델결합단백질로 사용된 repebody의 무작위적 라이브러리 구축을 위한 아미노산 잔기를 표시한 전체 구조를 나타낸 것이다.
도 15c는 단백질 융합 디스플레이를 통해 실제 라이브러리를 이용하여 스크리닝을 수행한 결과로 각각의 타깃을 이용하여 라이브러리 스크리닝을 통해 각각 선별된 단백질 결합체들의 타깃과의 상호작용을 유세포 분석기를 통해 확인한 결과이다.
도 16은 실제 라이브러리 스크리닝 결과 획득한 sfGFP 결합체인 H2의 결합 친화성을 등온적정열량계(isothermal titration calorimetry; ITC)로 측정한 것이다.
도 17은 CBD 활성형 단백질 봉입체를 전자현미경을 통해 확인한 결과이다
도 18은 본 발명의 라이브러리 스크리닝 시스템과 기존의 라이브러리 스크리닝 시스템을 비교한 결과이다.
상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 (a) 결합단백질과 활성형 봉입체(intracellular particle) 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는, 세포 라이브러리를 제공하는 단계; (b) 상기 세포 라이브러리에서 융합 단백질을 발현시켜 결합단백질이 봉입체에 디스플레이된 상호작용 포획 세포(Interaction Trapper cells; ITcells)를 형성시키는 단계; (c) 형광이 융합되어 있는 표적물질을 (b) 단계에 따른 세포에 투과처리(membrane disintegration)를 통해 세포 내로 도입하는 단계; 및 (d) 결합단백질과 표적물질의 상호작용을 표적물질에 융합된 형광 물질의 형광 강도로 측정하여 개별세포 단위로 회수하는 단계를 포함하는, 표적물질에 특이적인 라이브러리 스크리닝 방법을 제공한다.
상기 (c) 단계의 투과처리 단계는 세포 내부의 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않으며 투과된 막을 통해 표적물질은 세포 내로 도입 가능하게 하는 한, 당업계에서 통상적으로 이용하는 방법을 제한없이 이용할 수 있다. 특히 세포를 동결하는 단계, 해동하는 단계 및 산성용액으로 처리하는 단계를 포함할 수 있으며, 예를 들어, (i) 세포를 -80 내지 -10 ℃에서 동결하는 단계; (ii) 상기 동결한 세포를 상온 내지 37 ℃에서 해동하는 단계; 및 (iii) 산성용액으로 처리하는 단계를 포함하는 것일 수 있다. 상기 산성용액은 종류와 pH에 제한되지 않으며, 예를 들어 pH 4 내지 pH 6일 수 있다. 이를 통해, 상기 세포 내부의 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않으며 투과된 막을 통해 표적물질은 세포 내로 도입 가능하게 하여 외부 표적물질이 세포 내로 도입되어 결합단백질과 표적물질 간의 상호작용을 가능하게 하는 최적화된 세포 투과처리일 수 있다.
본 발명의 일 실시예에 의하면 투과처리는 결합단백질이 발현된 상기 (b) 단계의 세포를 원심분리하여 응집체(pellet)를 형성하고, -20℃에서 동결하는 단계; 37℃에서 해동하는 단계 및 산성용액으로, 바람직하게는 0.1M 시트르산(pH.4)으로 처리하는 단계를 통해 이루어졌다.
본 발명의 라이브러리 스크리닝 방법에는 개별 세포 단위로 회수한 세포에 존재하는 융합 단백질을 수득하거나 융합 단백질을 코딩하는 유전자를 분리하고 증폭하는 단계를 추가로 포함할 수 있다. 상기 단백질을 회수하거나 유전자를 분리하고 증폭하는 단계는 당업계에서 널리 사용되는 방법을 통해 이루어질 수 있다.
본 발명의 상기 방법은 기존의 라이브러리 스크리닝 방법으로 통상적으로 사용되는 라이보좀 디스플레이(ribosome display), 파아지 디스플레이(phage display), 세포표면 디스플레이(cell surface display) 등을 대체 가능한 방법으로, 결합단백질을 포함하고 있는 활성형 단백질 입자, 즉 CBD 단백질 태그를 세포 내에서 봉입체로 형성시켜 상호작용 포획세포(Interaction Trapper cells; ITcells)로 이용하며, 세포를 투과하여 외부 표적물질이 봉입체에 디스플레이 되어 있는 결합단백질과 상호작용 가능하도록 함으로써, 결합단백질과 함께 활성형 봉입체에 응집(co-localization)하는 현상을 직접적으로 관찰함을 통해 간편하게 상호작용을 검출할 수 있는 상호작용 분석 방법이다. 특히, 본 발명은 세포내 결합단백질을 과발현(overexpression)시켜 봉입체에 고집적(high density)으로 디스플레이하여(≒ 3 x 105 개 단백질/cell, cf) 효모 표면 발현 시스템 3 x 104 개 단백질/cell) 결합단백질에 상호작용하는 표적물질을 민감하게 표지하게 됨으로서 신호 대 잡음비가 기존의 스크리닝 방법들에 비해 월등히 높아 스크리닝 효율이 높으며, 다양한 결합 친화도에 적용 가능하다는 장점을 지니고 있다. 또한, 미량의 표적물질만으로도 높은 신호강도로 인해 발현률이 낮은 표적물질에도 상호작용 확인이 가능하다는 장점을 가지고 있으며 대장균 기반 시스템이기에 실험이 용이하고 방법이 간단한, 표적물질에 융합되어 있는 형광을 이용해 표적물질과 결합단백질 간에 상호작용이 일어난 세포를 유세포 분석기를 통한 분석 및 라이브러리 스크리닝이 가능한 고속 대량 스크리닝 시스템이다.
본 발명자들은 셀룰로모나스 피미(Cellulomonas fimi) 유래의 패밀리 II CBD(cellulose-binding domain)가 대장균(Escherichia coli; E. coli) 내에서 자가 응집 하여 봉입체를 형성하는 것을 확인하였고, 박테리아 세포뿐만 아니라 진핵 세포 내에서 동시 발현된 단백질들이 상기 봉입체 입자로 동시 집적되는 현상을 이용하여 세포내 생체 물질 간 상호작용을 관찰하는 방법을 개발한 바 있다(대한민국 공개특허 제10-2013-0023057호).
이에 본 발명자들은 상기 특허에서 활성형 봉입체로 상호작용 포획이 가능한CBD 단백질을 이용하여 고유의 활성을 지닌 결합단백질(항체, 유사항체, 상호작용단백질, 리간드결합단백질, 의약 표적단백질 등)이 디스플레이 되어 있는 봉입체 세포(Interaction Trapper cells; ITcells)를 형성시켰다. 상기 세포에 본 발명에서 개발한 최적화된 세포 투과 처리를 통해 형광이 결합된 표적물질(단백질, 핵산 또는 저분자 물질)을 외부에서 세포 내부로 도입시켜 봉입체에 디스플레이된 결합단백질과 상호작용을 직접적으로 관찰할 수 있으며, 단일 세포 수준에서 분자 간 상호작용을 고속으로 탐색하여 표적물질과 상호작용하는 결합단백질을 선택적으로 회수 가능한 단백질 라이브러리 스크리닝 시스템을 개발하였다(도 1).
특히 본 발명의 특징으로 본 발명에서 개발한 세포 투과처리방법(membrane disintegration)으로, 활성형 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 발현을 세포 내에 안정적으로 유지시키는 동시에 결합단백질의 유전정보도 대부분 소실되지 않고 세포 내에 안정적으로 유지시키는 것을 특징으로 한다.
일반적으로 세포 투과란 세포벽 또는 세포막에 물리적, 화학적 방법을 이용하여 세포벽/막의 투과성을 높이거나 또는 완벽하게 제거하여 세포내 생체 내 분자들을 세포 외부로 분비시키는 방법으로, 삼투압, 초음파 분쇄기 등을 이용하여 세포를 완벽하게 파괴하는 방법이거나 또는 톨루엔 등을 이용하여 세포 형태는 유지하나 세포내 단백질 뿐 아니라 유전정보도 세포 외부로 분비시키는 방법이다 (Hansruedi Felix., 1982. Permeabilized cells. Analytical Biochemistry 120; 211~34).
본 발명에서 개발한 최적화된 세포 투과방법은 세포 내외 단백질들은 자유롭게 이동 가능한 정도의 투과처리에도 불구하고 활성형 봉입체에 디스플레이 되어 있는 결합단백질 및 유전정보는 세포 외로 소실되지 않으며, 세포 형태는 안정적으로 유지하는 본 발명의 특징적인 방법이다.
또한 본 발명의 실시예에 의하면 활성형 봉입체 유무에 의해 결합단백질의 유전정보의 세포내 유무에 영향을 미치는 것으로 확인하였으며, 이는 봉입체 내에 ribosomal RNA, RNA polymerase 등이 발견된다는 이전 보고와 일치하는 결과이다 (Ursula Rinas and James E. Bailey., 1992. Protein compositional analysis of inclusion bodies produced in recombinant Escherichia coil. Applied Microbiology and Biotechnology 37; 609~14).
즉, 본 발명자들은 세포 내에서 결합단백질을 과발현시켜 봉입체에 고집적으로 디스플레이시킴으로써 기존의 표면 발현 시스템이 가지는 한계점(디스플레이 할 수 있는 단백질의 크기 및 개수, 세포 표면 분비 문제)을 극복하였으며, 봉입체에 고집적으로 디스플레이 되어 있는 결합단백질은 상호작용하는 표적물질을 민감하게 표지하게 됨으로써 기존 세포표면 발현에 의하여 얻어지는 형광신호에 비하여 수백 내지 수만배 이상 높은 수준의 신호강도를 나타내게 되어 신호 대 잡음비가 기존의 스크리닝 방법들에 비해 월등히 높아 생체 물질 간의 상호작용을 손쉽게 분석할 수 있다는 장점을 가진다(도 18).
또한 본 발명은 결합단백질이 활성형 봉입체에 디스플레이 되어 있음으로 인해 본 발명에서 개발한 최적화된 세포투과 처리 후에도 결합단백질의 고유의 활성 유지 뿐 아니라 결합단백질의 유전정보가 거의 소실되지 않는다는 것을 특징으로 한다.
본 발명에서 용어, "융합 단백질"이란 두 개 이상의 단백질 융합으로 생성된 단백질로서, 특히, 본 발명에서는 결합단백질 및 CBD 단백질을 포함한다. 또한, 본 발명의 융합 단백질은 유전자 재조합 방법을 통해 생산할 수 있으며, 바람직하게는 구조물을 숙주세포에 형질전환시키는 방법으로 결합단백질의 발현을 확인할 수 있다. 또한, 상기 융합 단백질은 형광 단백질을 추가로 포함하는 것일 수 있다.
본 발명의 구조물은 본 발명의 융합 단백질의 구성 요소를 코딩하는 폴리뉴클레오티드가 작동 가능하게 연결된 재조합 벡터이다. 상기 "작동 가능하게 연결된"은 발현 조절 서열이 융합 단백질의 구성 요소를 코딩하는 폴리뉴클레오티드 서열의 전사 및 해독을 조절하도록 연결된 것을 말하며, 발현 조절 서열(프로모터 포함)의 조절하에 폴리뉴클레오티드 서열이 발현되어 폴리뉴클레오티드 서열에 의해 코딩되는 융합 단백질의 구성 요소가 생성되도록 정확한 해독 프레임을 유지시키는 것을 포함한다.
본 발명에서 용어, "결합단백질"이란 표적물질과 상호작용할 수 있는 단백질을 말한다. 결합단백질은 상업적 용도로 대량 생산될 필요가 있는 단백질을 포함할 수 있으며 이에 제한되지는 않으나, 항체, 유사항체, 상호작용단백질, 리간드결합단백질, 의약 표적단백질 등에서 선택되는 결합단백질로 표적물질과의 상호작용 대상이 되는 단백질을 의미할 수 있다. 또한, 상기 결합단백질은 이에 제한되지는 않으나, 표적물질과 상호 작용할 수 있는 천연형 단백질뿐만 아니라, 결합기능을 담당하는 도메인, 폴리펩티드의 일부일 수 있다.
바람직하게는 상기 결합단백질을 코딩하는 폴리뉴클레오티드는 다양한 단백질을 코딩하는 유전자를 포함하는 라이브러리로부터 유래된 것일 수 있다. 이는 전체 게놈성 DNA 및 cDNA 라이브러리와 같은 생물체 전체 게놈에서부터 얻을 수 있다. 또한, 상기 결합단백질 및 표적물질을 코딩하는 폴리뉴클레오티드는 공제 라이브러리(subtracted library) 또는 맞춤 라이브러리(sized library)와 같은 전체 게놈의 서브셋에서부터 얻을 수 있다. 예를 들어, 결합단백질은 인터날린 B(internaline B, InB) 단백질의 N-말단, VLR(Variable Lymphocyte Receptor) 단백질의 변형된 반복모듈 및 VLR 단백질의 C-말단이 융합된, 인공 항체 단백질인 In-VLR5-c 또는 In-VLR5c-D3E8일 수 있다(대한민국 등록특허 제10-1255682호).
본 발명에서 용어, "활성형 봉입체 단백질"이란 봉입체에 발현된 결합단백질의 고유의 활성을 유지하면서 디스플레이 시킬 수 있는 특징을 가진 단백질을 의미하며, 예를 들어 CBD(cellulose-binding domain) 단백질, PhaC 단백질(polyhydroxybutyrate synthase from Cupriavidus necator; Bjorn Steinmann, Andreas Christmann, Tim Heiseler, Janine Fritz, Harald Kolmar., 2010. In Vivo Enzyme Immobilization by Inclusion Body Display. Appl. Environ. Microbiol. 76;5563?69), FMDV(foot-and-mouth disease virus) VP1 capsid 단백질 (Antonio Villaverd et al., 2005. Aggregation as bacterial inclusion bodies does not imply inactivation of enzymes and fluorescent proteins. Microbial Cell Factories 4;1-6) 등이 이에 해당한다.
본 발명에서 용어, "CBD(cellulose-binding domain) 단백질"이란 셀룰로모나스 피미(Cellulomonas fimi) 유래의 패밀리 II 단백질로 셀룰로오스 결합 도메인 단백질을 말한다. 본 발명의 일 실시예에 의하면, CBD 단백질은 E. coli에서 봉입체를 형성하고, 이에 융합되어 있는 단백질들의 고유의 활성 및 특성에는 영향을 주지 않는 활성형 입자(intracellular particle)을 형성하며, CBD 단백질에 한정되지 않고 모든 활성형 봉입체를 형성할 수 있는 단백질들을 포함하는 것일 수 있다.
본 발명의 일 실시예에 의하면, 결합단백질로서는 LRR(Leucine-rich-repeat) 단백질인 InB-VLR(대한민국 등록특허 제10-1255682호)의 변이체 중 하나인 D3E8을 이용하였으며 이는 표적물질인 IL-6와 2 nM의 결합 친화도를 지니는 단백질로서 다음과 같이 결합단백질이 융합된 단백질을 설계하였다. IL-6와 결합 친화도가 없는 결합단백질인 InVLR5c, 형광 단백질인 mRFP, 및 패밀리 Ⅱ CBD 단백질만으로 구성된 융합 단백질을 생산하기 위해 유전자 재조합 방법으로 pInVLR5c-mRFP-CBD 플라스미드 벡터를 생성하였으며, IL-6와 친화도가 있는 결합단백질인 InVLR5c-D3E8, 형광 단백질인 mRFP, 및 패밀리 Ⅱ CBD 단백질만으로 구성된 융합 단백질을 생산하기 위해 유전자 재조합 방법으로 pD3E8-mRFP-CBD로 플라스미드 벡터를 생성하였다. 상기 플라스미드 벡터들은 숙주세포 대장균에 형질전환시켜 융합 단백질을 생산하는 요소로 이용되었다(실시예 2).
본 발명에서 용어, "세포"란 모든 생물의 기능적, 구조적 기본 단위를 말한다. 상기 세포는 동물, 식물, 효모 및 박테리아의 세포일 수 있으며, 이에 제한되지는 않으나 E. coli, 스트렙토미세스, 살모넬라 티피뮤리움 등의 박테리아 세포; 효모 세포; 피치아 파스토리스 등의 균류 세포; 드로조필라, 스포도프테라 Sf9 세포 등의 곤충 세포; CHO, COS, NSO, 293, 보우 멜라노마 세포 등의 동물 세포; 또는 식물 세포가 될 수 있다. 바람직하게는 박테리아 세포, 더 바람직하게는 대장균(E. coli)일 수 있다. 본 발명의 세포는 CBD단백질의 과발현에 의해 활성형 봉입체가 형성되고 이를 상호작용 포획 세포로 사용할 수 있는 박테리아 세포가 바람직하다.
본 발명에서 용어, "상호작용 포획 세포(Interaction Trapper cells; ITcells)"란 결합단백질과 CBD 단백질을 발현할 수 있는 플라스미드가 형질전환 된 세포를 과발현시켜 CBD 단백질이 봉입체를 형성하고, 이 봉입체에 발현된 결합단백질이 고유의 활성을 유지하며 고집적으로 디스플레이 되어 있는 세포를 말한다. 상기 상호작용 포획 세포 내에 외부 표적물질이 도입되었을 때, 봉입체에 디스플레이 되어 있는 결합단백질과 상호작용을 할 수 있는 세포가 바람직하다.
본 발명에서 용어, "표적물질"이란 결합단백질과 상호작용할 수 있는 물질을 말한다. 또한 상기 표적물질은 이에 제한되지는 않으나, 결합단백질과 상호 작용할 수 있는 천연형 단백질뿐만 아니라, 기능을 담당하는 도메인, 폴리펩티드의 일부일 수 있으며, 생체 내에 존재하지 않는 화합물일 수 있다. 특히, 생명공학, 의학, 약학 등에 유용한 후보물질이나, 생체 내 작용을 일으키는 물질 등일 수 있으며, 특히, 단백질, 핵산 또는 화합물일 수 있으며, 예를 들어, IL-6일 수 있다. 본 발명의 목적상, 상기 표적물질은 세포 내에서 결합단백질과 동시에 발현시키지 않고 외부에서 도입시키는 것을 특징으로 한다. 즉, 상기 봉입체가 결합단백질을 디스플레이할 수 있는 상호작용 포획 세포로 이용되고, 표적물질이 외부에서 도입된다.
본 발명에서 용어, "세포 내로 도입"이란 세포 외부의 물질을 물리적 또는 화학적 방법을 이용하여 세포 내로 이동시키는 것을 말한다. 외부 물질을 세포 내로 이동시키는 과정에 있어, 상기 물질은 표적 물질이며, 상기 표적 물질을 세포 내로 이동시키기 위해 세포막 또는 세포벽의 투과성을 증대시키는 과정을 포함한다. 세포벽 또는 세포막의 투과성을 일시적으로 증대시키는 방법으로는 다양한 물리적, 화학적 방법들이 존재하며(HANSRUEDI FELIX., 1982. Permeabilized Cells. Anal. Biochem. 120;211-34), 예를 들어 초음파 처리, 삼투압처리, 열처리, 동결처리, 해동처리, 산성 용액 처리, 또는 이들의 조합 등이 있다. 본 발명의 일 실시예에 의하면, 대장균세포를 -20℃에서 동결 처리 후, 37℃에서 해동하고, 산성 용액 처리를 통해 세포벽 또는 세포막의 투과성을 증대시켜 세포 내 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 유전 정보를 유지하면서 투과된 막을 통해 외부 표적물질을 세포 내로 도입하였다(실시예 5).
본 발명에서 용어, "형광 물질"이란 특정 에너지에 반응하거나 자발적으로 형광을 낼 수 있는 물질을 의미하며, 본 발명에 있어서는 형광 단백질, 형광 화합물을 포함한 의미로 사용될 수 있다. 본 발명에서 "형광 단백질"이란 특정 에너지에 반응하거나 자발적으로 형광을 낼 수 있는 폴리펩티드를 의미하며, 이에 제한되지는 않으나 GFP(Green Fluorescent Protein), EGFP(Enhanced Green Fluorescent Protein), mGFP(modified green fluorescent protein), RFP(Red Fluorescent Protein), mRFP(Monomeric Red Fluorescent Protein), ERFP(Enhanced Red Fluorescent Protein), DsRed(Discosoma sp. red fluorescent protein), BFP(Blue Fluorescent Protein), EBFP(Enhanced Blue Fluorescent Protein), CFP(Cyan Fluorescent Protein), CGFP(Cyan Green Fluorescent Protein), ECFP(Enhanced Cyan Fluorescent Protein), YFP(Yellow Fluorescent Protein), EYFP(Enhanced Yellow Fluorescent Protein), AzG(Azami Green), HcR(HcRed, Heteractis crispa red fluorescent protein) 및 BFP(Blue Fluorescent Protein)로 이루어진 군으로부터 선택되는 것일 수 있다. 또한, 형광 화합물은 표적 물질을 수식할 수 있는 형광단을 의미할 수 있으며, 이에 제한되지는 않으나 상기 형광 단백질 및 Xanthene 유도체인 fluorescein, rhodamine, Oregon green, eosin, Texas red, 및 Cyanine 유도체인 cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, 및 merocyanine, Naphthalene 유도체(dansyl 및 prodan 유도체), Coumarin 유도체, oxadiazole 유도체인 pyridyloxazole, nitrobenzoxadiazole 및 benzoxadiazole, Pyrene 유도체인 cascade blue, Oxazine 유도체인 Nile red, Nile blue, cresyl violet, oxazine 170, Acridine 유도체인 proflavin, acridine orange, acridine yellow, Arylmethine 유도체인 auramine, crystal violet, malachite green, Tetrapyrrole 유도체인 porphin, phtalocyanine, bilirubin으로 이루어진 군으로부터 선택되는 것일 수 있다.
본 발명에서, 결합단백질과 융합 단백질을 이루는 형광 단백질과 표적물질을 수식하는 형광 물질은 서로 다른 파장의 형광인 것일 수 있으며, 구체적으로는 각각에서 방출되는 형광 신호의 파장이 서로 달라 형광 신호 검출기가 각각의 신호를 구분하여 검출할 수 있는 것일 수 있다.
본 발명에서, 결합단백질에는 형광 단백질이 포함되거나, 포함되지 않은 것일 수 있으나, 표적물질에는 상기 형광단백질 또는 형광물질이 포함되어 있어야 한다.
본 발명의 일 실시예에 의하면, 결합단백질을 코딩하는 플라스미드 pInVLR5c-mRFP-CBD 및 pD3E8-mRFP-CBD는 형광 단백질로서 RFP를 포함하고 있으며, 표적 단백질 IL-6의 경우 GFP를 형광 물질로 포함하였다.
본 발명에서 용어, "형광 신호"란 형광 단백질 또는 형광 물질로부터 야기되는 에너지의 파장을 의미하며, 이는 형광 신호 검출기에 의해 값으로 표현될 수 있다.
상기 세포내 형광 신호의 측정은 형광 현미경 또는 유세포 분석기로 수행하는 것인 방법이다. 본 발명의 일 실시예에 의하면, 유세포 분석기 FACS Calibur(BD Biosciences, CA)로 GFP 및 RFP 형광을 각각 FL1(530/30 nm) 및 FL2(585/42 nm) PMT로 검출하여 분석하였으며, 표적물질인 IL6와 결합 친화도를 가지는 pD3E8-mRFP-CBD가 발현된 봉입체 세포(PPI+)와 친화도가 없는 pInVLR5c-mRFP-CBD가 발현되어 있는 봉입체 세포(PPI-)에 최적화된 세포 투과를 통해 GFP가 결합되어 있는 IL6 단백질을 세포 내로 도입시킨 후, IL6에 대한 결합 친화도 차이를 GFP 형광을 통해 확인하였다(도 11). 미끼단백질과 결합물질을 세포 내에서 동시에 발현시키는 기존의 방법(대한민국 공개특허 제10-2013-0023057호)에 따른 결과와 비교해 보면, 기존의 방법이 미끼단백질과 결합물질과의 상호작용 유무에 따라 세포 내 봉입체 상으로 결합물질에 융합되어 있는 형광 신호의 밀집 및 분산의 차이를 이용하여 단백질 간의 상호작용을 분석하는 방법인데 반해, 본 발명의 방법은 최적화된 세포 투과를 통해 외부에서 표적물질이 세포 내로 도입되어 결합단백질과 상호작용을 통해 결합한 표적물질의 형광신호의 강도를 측정하는 것으로, 기존의 방법이 신호 대 잡음비가 2배 정도의 미미한 차이를 보이는 반면 본 발명은 신호 대 잡음비가 450배 이상 차이나는 명확한 결과를 나타낸다 (도 13).
본 발명의 실시예에서는 결합단백질로서 D3E8 및 InVLR5c, 활성형 봉입체로서 셀룰로모나스 피미 유래의 패밀리 Ⅱ의 CBD단백질, 그리고 표적물질은 IL-6를 이용하였으나, 본 발명은 이에 제한되지 않고, 결합단백질과 표적물질 간 상호작용을 분석하려는 목적을 위해서라면 어떠한 종류의 결합단백질, 표적물질, 및 활성형 봉입체에 대해서도 적용할 수 있음은 당업자에게 자명하다.
본 발명의 방법은 상기 (d) 단계 이후 (e) 상기 측정된 형광 강도를 기준으로 개별 세포 단위로 세포를 회수하는 단계를 추가로 포함할 수 있으며, 개별 세포 단위로 회수된 세포에 존재하는 융합 단백질을 수득하거나 융합 단백질을 코딩하는 유전자를 분리하고 증폭하는 단계를 추가로 포함할 수 있다. 상기 단백질을 수득하거나 유전자를 분리하고 증폭하는 단계는 당업계에서 널리 사용되는 방법을 통해 이루어질 수 있다.
본 발명에서 용어, "회수"란 결합단백질을 포함하는 세포 라이브러리로부터 표적물질에 융합된 형광 물질의 형광 신호를 측정하여 결합단백질과 표적물질의 상호작용이 확인된 세포만을 유세포 분석기를 이용하여 선별하는 것을 의미한다. 상기 유세포 분석기는 세포크기, 세포내부의 조성, 형광의 강도를 측정할 수 있는 장치를 의미할 수 있으며, 바람직하게는 실험자가 원하는 상기의 세포크기, 세포내부의 조성, 형광의 강도에 따라 단일 세포를 분리하여 회수할 수 있는 장치일 수 있다.
본 발명에서 용어, "분리"란 결합단백질을 포함하는 세포 라이브러리로부터 결합단백질과 표적물질의 상호작용이 확인된 세포를 회수하였을 때, 결합단백질을 코딩하는 폴리뉴클레오티드를 세포로부터 분리해 내는 것을 의미한다. 상기 분리는 세포로부터 DNA를 분리하는 것을 의미할 수 있다. 상기의 DNA 분리는 결합단백질을 코딩하는 폴리뉴클레오티드를 분리하려는 목적에 위배되지 않는 한, 당업계에 알려진 어떠한 방법도 가능하다.
본 발명에서 용어, "증폭"이란 상기에서 분리된 결합단백질을 코딩하는 폴리뉴클레오티드를 당업계에 알려진 일반적인 폴리뉴클레오티드 증폭 방법을 이용하여 대량으로 증폭하는 것을 의미한다. 증폭의 방법은 증폭된 폴리뉴클레오티드의 용도에 따라 선택될 수 있으며, 이러한 선택은 당업자에게 용이하게 선택이 가능하다.
본 발명의 일 실시예에 의하면, 봉입체에 디스플레이되어 있는 결합단백질과 표적물질과의 상호작용에 따라 표적물질에 융합되어 있는 GFP의 형광 강도 차이를 이용하여 고속 대량 유세포분석기를 통해 결합 친화도 유무에 따른 차이를 분석 가능한지 조사하고, IL-6와 결합 친화도가 약 2 nM인 LRR 단백질인 D3E8(PPI+), 117nM인 F11(PPI+)과 친화도가 없는 LRR 단백질인 InVLR5c(PPI-)가 봉입체에 디스플레이되어 있는 세포(ITcells)를 각각 1:10:10000의 비율로 혼합하여 라이브러리 유사환경을 조작한 후, 세포 투과 처리 및 단백질 상호작용을 유도한 샘플을 유세포 분석기(FACSaria)를 이용하여 IL-6와 결합 친화력이 높은 E. coli 세포 10,000개를 회수하였다. 회수한 세포들에서 플라스미드를 순수 분리하여 DH5α E. coli 세포에 다시 형질전환 하였으며, 형성된 콜로니들을 대상으로 PCR 증폭 반응을 수행하여 표현형(D3E8-mRFP-CBD 단백질)을 통해 회수한 세포의 유전자 회수 여부를 확인하였다(도 14).
본 발명의 방법은 세포 내에서 과발현시키고 봉입체로 집속시킨 결합단백질을 이용하므로 기존의 세포표면 발현에 의하여 얻어지는 형광신호에 비하여 수백~수만 배 이상 높은 수준의 신호강도가 나타내며, 이를 기반으로 개별 세포단위로 분획하는 단계를 포함하는 단백질 라이브러리 스크리닝 단계를 포함하는 다양한 단백질공학에 이용할 수 있다.
또 하나의 양태로서, 본 발명은 (a) 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는, 세포를 제공하는 단계; (b) 상기 세포에서 융합 단백질을 발현시켜 결합단백질이 봉입체에 디스플레이된 상호작용 포획 세포(Interaction Trapper cells; ITcells)를 형성시키는 단계; (c) 형광이 융합되어 있는 표적물질을 (b) 단계에 따른 세포에 투과처리(membrane disintegration)를 통해 세포 내로 도입하는 단계; 및 (d) 결합단백질과 표적물질의 상호작용을 외부에서 도입된 표적물질에 융합된 형광 물질의 형광 강도로 측정하는 단계를 포함하는, 결합단백질과 표적물질 간 상호작용을 분석하는 방법을 제공한다.
상기 (c) 단계의 투과처리 단계는 세포 내부의 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않으며 투과된 막을 통해 표적물질은 세포 내로 도입 가능하게 하는 한, 당업계에서 통상적으로 이용하는 방법을 제한없이 이용할 수 있다. 특히 세포를 동결하는 단계, 해동하는 단계 및 산성용액으로 처리하는 단계를 포함할 수 있으며, 예를 들어, (i) 세포를 -80 내지 -10 ℃에서 동결하는 단계; (ii) 상기 동결한 세포를 상온 내지 37 ℃에서 해동하는 단계; 및 (iii) 산성용액으로 처리하는 단계를 포함하는 것일 수 있다. 상기 산성용액은 종류와 pH에 제한되지 않으며, 예를 들어 pH 4 내지 pH 6일 수 있다. 이를 통해, 상기 결합 단백질과 그 유전정보가 세포 내에서 안정적으로 유지되며, 외부 표적물질이 세포 내로 도입되어 결합단백질과 표적물질 간의 상호작용을 가능하게 하는 최적화된 세포 투과처리일 수 있다.
본 발명의 일 실시예에 의하면 투과처리는 결합단백질이 발현된 상기 (b) 단계의 세포를 원심분리하여 응집체(pellet)를 형성하고, -20℃에서 동결하는 단계; 37℃에서 해동하는 단계 및 산성용액으로, 바람직하게는 0.1M 시트르산(pH.4)으로 처리하는 단계를 통해 이루어졌다.
본 발명의 용어 '미생물'은 본 발명의 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 발현하여 세포 내 봉입체에 디스플레이시킬 수 있는 모든 종류의 세포를 의미하며, 진핵 세포 또는 원핵 세포일 수 있으나, 이에 제한되지 않는다. 예들 들어, 대장균(E.coli)일 수 있다.
기존 투과처리 기술은 세포내 단백질 및 유전정보를 세포 외로 유출시켜 단백질 및 유전정보를 얻기 위한 투과처리 자체를 목적으로 한 기술로서 투과를 통해 세포내 단백질 및 유전정보를 완벽하게 유출시키는 것이 목적이나, 본 발명자들은 세포내 활성형 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않으면서, 표적물질은 세포 내로 원활하게 도입 가능하게 하는 투과처리 방법을 수립하고자 노력한 결과 본 발명의 투과처리 방법을 수립하였다.
이에 본 발명의 미생물 세포투과 처리 방법은 미생물 내부의 활성형 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 그 유전정보가 세포 내에서 안정적으로 유지되고, 외부 표적물질이 세포 내로 도입될 수 있으며 세포 형태는 유지하는 새로운 효과를 지닌다.
본 발명의 일 실시예에 의하면 투과처리는 미생물(대장균)을 원심분리하여 응집체(pellet)를 형성하고, -20℃에서 동결하는 단계; 37℃에서 해동하는 단계 및 산성용액으로, 바람직하게는 0.1M 시트르산(pH.4)으로 처리하는 단계를 통해 이루어졌다. 이를 통하여 외부 표적물질이 세포 내로 자유롭게 도입 가능한 투과 처리된 상호작용 포획세포를 형성하였으며 이를 이용할 경우 단백질 간의 상호작용을 높은 민감도로 측정 가능한 것을 확인하였으며, 이를 통해 유전정보 또한 수득할 수 있음을 확인하였다.
또 하나의 양태로서, 본 발명은 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는 세포를 제공한다.
상기 결합단백질, 활성형 봉입체 단백질, 융합 단백질 및 세포에 대해서는 상기에서 설명한 바와 같다.
본 발명의 일 실시예에 의하면 LRR 단백질을 결합 단백질로, 활성형 봉입체 단백질로서 CBD 단백질을 그리고 표적물질로 IL-6 단백질을 이용하였으며, 결합단백질과 CBD 단백질이 융합된 단백질을 코딩하는 폴리뉴클레오티드를 대장균 세포에 형질도입을 통해 상호작용 포획 세포를 형성하였다.
또 하나의 양태로서, 본 발명은 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는 세포 라이브러리를 제공한다. 상기 라이브러리는 DNA 라이브러리 또는 이를 형질전환한 세포 라이브러리일 수 있다.
상기 결합단백질, 활성형 봉입체 단백질, 융합 단백질 및 세포에 대해서는 상기에서 설명한 바와 같다.
본 발명에서 "세포 라이브러리"란 표적물질과 상호작용하는 결합단백질이 코딩되어 있는 플라스미드를 포함하는 세포들로 이루어진 라이브러리로서, 바람직하게는 결합단백질이 안정적으로 봉입체에 디스플레이되어 있고 세포 투과화를 통해 표적물질이 세포 내로 도입될 수 있는 세포로 이루지는 것을 특징으로 하는 라이브러리일 수 있다. 상기 세포 라이브러리는 이에 제한되지는 않으나, 바람직하게는 E. coli 세포로 이루어진 라이브러리일 수 있다.
본 발명의 일 실시예에 의하면, 표적물질인 IL-6와 친화도가 약 2 nM인 LRR 단백질인 D3E8(PPI+), 117 nM인 F11(PPI+)과 친화도가 없는 LRR 단백질인 InVLR5c(PPI-)가 봉입체에 디스플레이되어 있는 세포를 각각 1:10:10000의 비율로 혼합 조작된 유사 라이브러리를 이용하였다. 또한 본 발명의 일 실시예에 의하면, 단백질 융합 디스플레이 시스템을 이용한 스크리닝을 위해 모델 결합단백질인 repebody(LRR단백질)에 무작위적 라이브러리를 구축하여 실제 라이브러리로 이용하였다.
또 하나의 양태로서, 본 발명은 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질이 발현되고, 결합단백질이 봉입체에 디스플레이 된 상호작용 포획 세포 및 세포 라이브러리를 제공한다.
상기 결합단백질, 활성형 봉입체 단백질, 융합 단백질, 세포 및 세포 라이브러리에 대해서는 상기에서 설명한 바와 같다.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
실시예 1: 유전자 및 효소 확보
패밀리 Ⅱ의 CBD(cellulose-binding domain) 유전자는 한국생명공학연구원 생물자원센터(Korean Collection of Type Cultures, KCTC)의 셀룰로모나스 피미 (Cellulomonas fimi) KCTC 9143 균주의 엑소글루카네이즈(exoglucanase) 유전자로부터 클로닝하였다. 개선된 GFP(modified green fluorescent protein) 유전자는 상용 플라스미드 벡터인 pEGFP(Clontech, CA)로부터 얻었으며, mRFP1(monomeric red fluorescent protein 1) 유전자를 갖고 있는 플라스미드 벡터 pRFP는 한국 대전에 위치한 한국과학기술원으로부터 제공받았다. VLR(Variable Lymphocyte Receptor) 단백질은 인터날린 B(internaline B, InB) 단백질의 N-말단, VLR 단백질의 변형된 반복모듈 및 VLR 단백질의 C-말단이 융합된, 인공 항체 단백질인 Repebody(InB-VLR) 패밀리 중에서 IL-6와 결합 친화도가 없는 In-VLR5-c(대한민국 공개특허 제10-2010-0086055호) 및 IL-6와 결합 친화도가 있는 In-VLR5c-D3E8(KD= 2 nM), In-VLR5c-F11(KD=117 nM)이 이용되었으며, hIL-6(human interlukin-6)는 hIL-6 유전자가 클로닝되어있는 벡터이다. 상기의 유전자는 모두 한국 대전에 위치한 한국과학기술원으로부터 제공받았다. 본 발명에서 사용된 모든 효소는 NEB(New England Biolabs)로부터 구입하였다.
실시예 2: 재조합 벡터 제작
본 발명의 모든 프라이머는 한국 대전의 바이오니아에서 합성하였다. 상기의 프라이머는 하기 표 1에 나타냈다. 표 1에서 제한효소 NdeI 및 KpnI 등의 제한부위는 볼드체로 표시하였다. In-VLR, GFP 유전자를 비롯하여 본 발명에 사용된 모든 유전자는 표 1에 나타낸 각각의 프라이머로 증폭시킨 후, 오버랩 연장 PCR(overlap extension PCR)을 이용하여 융합하고, pET21a 벡터의 NdeI 및 Hind Ⅲ의 제한부위로 삽입하였으며, E. coli DH5α 세포를 이용하여 재조합하였다. 상기 방법에 의해 제조된 플라스미드 벡터들은 각각 pInVLR5c-mRFP-CBD, pD3E8-mRFP-CBD, pF11-mRFP-CBD, pGFP-IL6로 명명하였다. 또한 pInVLR5c-mRFP-CBD 플라스미드를 NdeI 및 HindIII의 제한효소 처리를 통해 InVLR5c-mRFP 유전자를 NdeI 및 HindIII의 제한효소 처리된 pET21a 벡터에 삽입하였으며, E. coli DH5α 세포를 이용하여 재조합하였다. 상기 방법에 의해 제조된 플라스미드 벡터를 pInVLR5c-mRFP로 명명하였다.
표 1
프라이머 이름 서열 (5'→3') 서열번호
nde Ⅰ histag VLR F GGAATTCCATATGGGCAGCAGCCACCACCACCACCACCACAGCAGCGGCGGATCCGAAACCATTACCGTGAGCACCCC 1
gs linker D3E8 R GGACCCAGAGCCGCTACCGGTACCGGTCGGGCAAATAATGCTACGC 2
gs linker mRFP F GGTAGCGGCTCTGGGTCCATGGCCTCCTCCGAGGACG 3
pt linker mRFP R TCGGAGGGAATTCACCGGAACCGCGTGGCACCAGACCGGCGCCGGTGGAGTGGC 4
pt linker cex F TTCCGGTGAATTCCCTCCGACGCCGACCCCGACTAGTGGTCCGGCCGGGTG 5
Hind Ⅲ CBD R CCCCCCAAGCTTTTAGCCGACCGTGCAGGGCG 6
gs linker InVLR5c R GGACCCAGAGCCGCTACCGGTACCAACTTCCAGGGTCGGACAGATAATG 7
nde Ⅰ histag mGFP F GGAATTCCATATGGGCAGCAGCCACCACCACCACCACCACAGCAGCGGCGGATCCGTGAGCAAGGGCGAGGAGCTG 8
gs linker mGFP R GGACCCAGAGCCGCTACCCTTGTACAGCTCGTCCATGCCGA 9
gs linker IL6 F GGTAGCGGCTCTGGGTCCGAATTCGCCCCAGTACCCCCAGGAGAAG 10
Hind Ⅲ IL6 R CCCCCCAAGCTTTTACATTTGCCGAAGAGCCCTCAGG 11
D3E8 specific F GCAGCTGTGGGCGAATCAAC 12
InVLR5c specific F GACGTATCTGATTCTGACCGGT 13
mRFP R GAAGCGCATGAACTCCTTGATG 14
In-VLR5c-D3E8, In-VLR5c-F11 유전자를 프라이머 1(서열번호 1) 및 프라이머 2(서열번호 2) 를 이용, In-VLR5c 유전자를 프라이머 1(서열번호 1) 및 프라이머 7(서열번호 7)을 이용하여 In-VLR5c-D3E8, In-VLR5c-F11, In-VLR5c 유전자가 클로닝되어 있는 벡터로부터 증폭시킨다. mRFP1 유전자는 프라이머 3(서열번호 3) 및 프라이머 4(서열번호 4)를 사용하여 mRFP1 유전자가 클로닝 되어 있는 벡터로부터 증폭시키고, GFP 유전자는 프라이머 8(서열번호 8) 및 프라이머 9(서열번호 9)를 사용하여 pEGFP 유전자로부터 증폭시킨다. CBD 유전자는 프라이머 5(서열번호 5) 및 프라이머 6(서열번호 6)을 사용하여 CBD로부터 증폭시키며(J Microbiol Biotechnol. 2008 Mar;18(3):443-8 참조), hIL-6 유전자는 프라이머 10(서열번호 10) 및 프라이머 11(서열번호 11)를 이용하여 hIL-6 유전자가 클로닝 되어 있는 벡터로부터 증폭시켰다.
실시예 3: 플라스미드 분리
실시예 2에서 제조한 pInVLR5c-mRFP-CBD, pD3E8-mRFP-CBD, pF11-mRFP-CBD, 그리고 pInVLR5c-mRFP 플라스미드를 E. coli DH5α로 형질전환하고, 앰피실린(50 ㎍/㎖)을 포함하는 LB 배지(1% bacto-trypton, 0.5% yeast extract, 1% NaCl)에 접종하여 37 ℃에서 24시간 동안 진탕 배양하였다. 배양한 세포 현탁액을 원심분리기(universal 320R, Hettich)를 이용하여 4,470×g 속도로 5분 원심분리 후, 상등액은 제거한 펠릿을 이용하여 QIAprep® spin miniprep kit로 플라스미드를 분리하였으며, 분리한 플라스미드는 1 % 아가로즈 겔을 이용하여 전기영동을 통해 확인하였다.
또한 실시예 2에서 제조한 pGFP-IL6 플라스미드를 E. coli DH5α로 형질전환하고, 앰피실린(50 ㎍/㎖)을 포함하는 LB 배지(1% bacto-trypton, 0.5% yeast extract, 1% NaCl)에 접종하여 37℃에서 24시간 동안 진탕 배양하였다. 배양한 세포 현탁액을 원심분리기(universal 320R, Hettich)를 이용하여 4,470×g 속도로 5분 원심분리 후, 상등액을 제거한 펠릿을 이용하여 QIAprep® spin miniprep kit로 이용하여 플라스미드를 분리하였으며, 분리한 플라스미드는 1 % 아가로즈 겔을 이용하여 전기영동 및 시퀀싱을 통해 사이즈 및 염기서열을 확인하였다.
실시예 4: 단백질 발현 및 정제
실시예 2에서 제조한 pD3E8-mRFP-CBD, pInVLR5c-mRFP-CBD 그리고 pInVLR5c-mRFP 플라스미드를 E. coli BL21(DE3)로 형질전환하고, 앰피실린(50 ㎍/㎖)을 포함하는 LB 배지(1% bacto-trypton, 0.5% yeast extract, 1% NaCl)에 접종하여 37℃에서 진탕 배양하였다. 600 nm에서 OD 값이 0.5일 때, CBD 봉입체를 유도하기 위하여, IPTG(isopropyl-1-thio-β-D-galactopyranoside, 200 μM)를 첨가하고, 세포를 30℃에서 5시간 동안 배양하였으며, 배양된 세포가 단백질 및 단백질 봉입체를 형성하였는지를 형광 현미경(ZEISS)으로 확인하였다(도 3).
pGFP-IL6 플라스미드를 E. coli OrigamiB(DE3)로 형질전환하고, 앰피실린(50 ㎍/㎖)을 포함하는 LB 배지(1% bacto-trypton, 0.5% yeast extract, 1% NaCl)에 접종하여 37℃에서 진탕 배양하였다. 600 nm에서 OD 값이 0.5일 때, hIL-6 단백질을 발현하기 위하여, IPTG(isopropyl-1-thio-β-D-galactopyranoside, 200 μM)를 첨가하고, 세포를 30℃에서 5시간 동안 배양하였으며, 배양된 세포가 GFP-hIL6 단백질이 발현하였는지 형광 현미경으로 확인하였다. 융합 단백질이 발현된 세포 배양액을 얼음 상에서 초음파 분쇄하여 세포막을 파쇄한 후, 용해된 균주들을 다시 20,000×g에서 20분간 원심 분리하여 침전물을 제거하였고, 상층액만을 0.2 μm filter로 여과하여 이후의 정제과정에 사용하였다. 단백질의 정제는 GFP-hIL6의 N-말단에 발현된 6×His-tag을 이용하여 FPLC (fast-performance liquid chromatography)에 연결된 친화성 크로마토그래피 컬럼 HiTrapTM Q HP(GE Healthcare, Uppsala, Sweden)를 이용하여 정제 후, PBS 완충액(pH 7.4)으로 탈염하고 원심여과기(centrifugal filteration; Sartorius stedim)를 이용하여 단백질을 40 mg/ml의 농도로 농축하여 -20℃에서 보관하면서 하기의 실시예에서 사용하였다. 정제된 GFP-hIL6 단백질은 SDS-PAGE 분석으로 확인하였다.
실시예 5: 단백질 상호작용 포획 세포의 투과 처리
실시예 4에서 배양한 pD3E8-mRFP-CBD 또는 pInVLR5c-mRFP-CBD 세포에 외부 표적물질인 GFP-IL6 단백질의 세포내 도입을 위해, 본 발명에서 개발한 최적화된 세포 투과 처리를 수행하였다. E. coli 세포 배양액을 2,480×g에서 5분간 원심분리한 뒤 응집체(pellet)를 -20℃에서 동결하였다. 동결된 E. coli 세포를 PBS 완충액(pH 7.4)으로 재현탁한 후 37℃에서 해동하였으며, 2,480×g에서 5분간 원심분리하고 상등액을 제거하였다. 0.1M 시트르산(pH 4)로 E. coli 세포에 처리한 뒤, 원심분리하여 상등액을 제거하고, PBS 완충액(pH 7.4)으로 재현탁하였다.
실시예 6: 봉입체 디스플레이 유무에 따른 투과 세포에서의 유전자 분석
실시예 4에서 배양한 pInVLR5c-mRFP-CBD 세포에 실시예 5의 방법으로 세포 투과 처리를 한 뒤, 원심분리기(universal 320R, Hettich)를 이용하여 4,470×g 속도로 5분 원심분리하여 세포 상등액과 응집체(pellet)로 나눈 뒤, 응집체는 세포 상등액과 동일량의 PBS 완충액(pH 7.4)으로 재현탁한다. 세포 상등액과 응집체 재현탁액을 각각 iQTM SYBR® Green supermix(Bio-rad)와 1:1 비율로 섞고 프라이머 13(서열번호 13)과 프라이머 14(서열번호 14)를 10 pmol씩 첨가하여 중합효소연쇄반응 정량검사기인 CFX96(Bio-rad)를 이용하여 DNA 양을 분석하였다.
실시예 7: 단백질 구조 기반의 결합단백질 라이브러리 구축
모델 결합단백질로 사용된 LRR단백질인 repebody의 라이브러리 구축 방법은 대한민국 등록특허 제10-1356075호에 사용된 방법을 동일하게 적용하였다. Repebody를 이용하여 연속적인 두 개의 변이 모듈(LRRV module 1 과 2)의 오목한 지역에 위치하는 여섯 아미노산 잔기 91, 93, 94, 115, 117, 그리고 118번을 선택하였다. 그런 뒤, 상기 선택한 아미노산을 NNK 동의코돈(Degenerate codon)으로 치환하여 라이브러리 구축을 위한 돌연변이 유발 프라이머(Mutagenic primer)를 합성하였다. 이어, 상기 프라이머들을 이용하여 두 모듈에 대한 겹침 중합효소 연쇄 반응(Overlap PCR) 을 수행하여 라이브러리 DNA를 수득하고 상기 재조합한 벡터 pInVLR5c-mRFP-CBD의 InVLR5c 유전자 위치에 라이브러리 유전자를 치환, 삽입함으로써 mRFP-CBD 유전자와 결합한 라이브러리 플라스미드를 확보하였다. 확보된 라이브러리는 전기청공법(electroporation)으로 대장균 DH5α에 도입하여 형질전환체를 수득함으로써, 1 x 107 수준의 다양성을 갖는 라이브러리를 구축하였다.
실시예 8: 활성형 봉입체에 디스플레이 된 발현 라이브러리 제작 및 발현
실시예 7에서 제조한 라이브러리 콜로니들을 storage buffer(2xTY media, 50% glycerol, 20% glucose)를 이용하여 수거한 뒤, 4,470 x g 속도로 5분 원심분리 하여 상등액을 제거한 펠릿을 이용하여 QIAprep® spin miniprep kit로 플라스미드를 분리하였다. 분리한 라이브러리 플라스미드 1 μg을 전기청공법으로 대장균 BL21(DE3)에 형질전환함으로써 1x107 수준의 다양성을 갖는 발현 라이브러리를 구축하였다. 발현 라이브러리 콜로니들은 storage buffer로 수거한 뒤, OD600 0.05의 세포를 취하여 앰피실린(50 ㎍/㎖)을 포함하는 LB 배지(1% bacto-trypton, 0.5% yeast extract, 1% NaCl)에 접종하여 37℃에서 진탕 배양하였다. 600 nm에서 OD 값이 0.5일 때, CBD 봉입체를 유도하기 위하여, 200 μM IPTG를 첨가하고, 세포를 30℃에서 3시간 동안 배양하였으며, 배양된 세포는 원심분리하여 상층액을 제거한 후 응집체(pellet)를 -20℃에 동결하였다.
실시예 9: 유세포분석기를 통한 단백질 간 상호작용 분석
실시예 5에서 세포 투과 처리를 통한 pD3E8-mRFP-CBD(PPI+) 또는 pInVLR5c-mRFP-CBD(PPI-)가 발현되어있는 상호작용 포획 세포(ITcells) 현탁액에 실시예 4에서 정제 및 분리한 GFP-IL6 단백질 10 μM을 각각에 첨가하고 30분 동안 교반 반응을 통해 외부 표적물질을 세포 내부로 도입하여 단백질 간 상호작용을 유도하였다. 30분 후 PBST, PBS 완충액(pH 7.4)으로 세척한 후, 결합단백질과 표적물질 간의 상호작용을 형광현미경(도 13의 A) 또는 유세포분석기로 분석하였다(도 13의 B).
유세포 분석은 FACS Calibur(BD Biosciences, CA)로 수행하였으며, 분석 게이트는 SSC 및 FSC 파라미터를 바탕으로 세팅하였다. GFP 및 RFP 형광을 각각 FL1(530/30 nm) 및 FL2(585/42 nm) PMT로 검출하였고, 컨펜세이션은(FL1-FL2: FL2-FL1=16％:16％)로 설정하였으며, 10,000 번의 이벤트를 각 시료에서 카운팅하였다. 데이터는 BD CellQuest Pro(version 4.0.2, 145 BD Biosciences) 소프트웨어를 이용하여 수집하였으며, Flowjo 소프트웨어(version 10)를 이용하여 분석하였다.
실시예 10: 단백질 융합 디스플레이를 이용한 라이브러리 스크리닝
실시예 8에서 동결된 응집체(pellet)에 실시예 5의 방법으로 세포 투과처리 후, GFP가 융합 되어 있는 여러 종류의 타깃(mGFP-IL6, sfGFP. Fluorescein, dextran-FITC)을 각각 결합단백질 라이브러리가 디스플레이 되어 있는 봉입체 세포와 상호작용을 유도한 뒤, 유세포 분석기를 통해 상호작용 세포를 회수하였다. 상호작용 세포 회수는 FACSariaTM III(BD Biosciences, CA)로 수행하였으며, 분석 게이트는 SSC 및 FSC 파라미터를 바탕으로 세팅하였다. GFP 및 RFP 형광을 각각 FL1(530/30 nm) 및 FL2(585/42 nm) PMT로 검출하였고, 컨펜세이션은(PE-FITC: FITC-PE=28.62:4.29)로 설정하였으며, 10,000 번의 이벤트를 각 시료에서 카운팅하였다. 데이터는 BD FACS Diva (version 7.0 BD Biosciences) 소프트웨어를 이용하여 수집하였으며, Flowjo 소프트웨어(version 10)를 이용하여 분석하였다.
실시예 11: 전자 현미경 분석 ( SEM , TEM )
실시예 5의 처리를 거친 E. coli 세포를 2.5% 파라포름알데히드-글루타르알데히드(paraformaldehyde-glutaraldehyde; 4℃, 인산 완충액, pH 7.2) 고정액에서 2시간 전고정하고, 인산 완충액(0.1M, pH 7.2)으로 10분씩 3회 세척한 후, 1% OsO4(25℃, 0.1M 인산 완충액, pH 7.2)에서 2시간 동안 후고정하였다. 고정이 끝난 재료는 동일 완충액으로 수 회 세척한 후, 에탄올 농도 상승순으로 탈수시켜 이소아밀 아세테이트(isoamyl acetate)로 치환하고 초임계점 건조기(critical point dryer)로 건조시킨 후, SC502 스퍼터 코터(sputter coater)를 이용하여 20nm 두께로 도금한 후, 한국생명공학연구원 내에 설치되어있는 FEI Quanta 250 FEG(FEI, USA) 주사전자현미경(scanning electron microscope, SEM)으로 10kV에서 관찰하였다.
투과전자현미경적 관찰을 위하여 절취한 부위를 2.5% 파라포름알데히드-글루타르알데히드(4℃, 인산 완충액, pH 7.2) 고정액에서 2시간 전고정하고, 인산 완충액(0.1M, pH 7.2)으로 10분씩 3회 세척한 후, 1% OsO4(25℃, 0.1M 인산 완충액, pH 7.2)에서 2시간 동안 후고정하였다. 고정이 끝난 재료는 동일 완충액으로 수 회 세척한 후, 에탄올 농도 상승순으로 탈수하였으며, 프로필렌 옥시드(propylene oxide)로 치환하여 Epon-812로 포매한 다음, 60℃ 오븐에서 36시간 중합반응시켰다. 포매된 조직은 초박막절편기(ultramicrotome, ULTRACUT E, Leica)으로 초박절편을 제작하여 우라닐 아세테이트(uranyl acetate)와 리드 시트레이트(lead citrate)로 이중염색하여 투과전자현미경(transmission electron microscope, TEM, CM 20, Philips)으로 100kV에서 관찰하였다.
실시예 12: 결합단백질의 봉입체 디스플레이
CBD 봉입체가 디스플레이 되어 있는 결합단백질의 활성 및 발현을 안정적으로 유지시켜주는 활성형 봉입체임을 확인하기 위해, 결합단백질인 VLR(InVLR5c)과 형광단백질인 mRFP를 CBD태그에 융합하여 대장균 내에서 과발현시켜 봉입체 세포를 형성하였으며, 초음파분쇄를 통해 봉입체만 분리하여 형광 현미경으로 확인하였다. 형광단백질인 mRFP의 형광이 봉입체 위치에 관찰됨을 통해 결합단백질인 VLR과 mRFP가 CBD봉입체에 디스플레이 되었음을 확인하였으며, 초음파분쇄로 분리된 봉입체에도 mRFP 형광이 관찰됨을 통해 CBD봉입체가 결합단백질의 활성을 유지시키며 안정적으로 디스플레이 함을 확인하였다(도 3).
실시예 13: 세포 투과가 세포내 외부에 미치는 영향
본 발명에서 개발한 세포투과방법(membrane disintegration)이 세포에 미치는 영향을 확인하기 위해 결합단백질 및 RFP단백질이 봉입체에 디스플레이 되어 있는 세포(VLR-mRFP-CBD)와 봉입체에 디스플레이 되어 있지 않는 세포(VLR-mRFP)를 이용하여 실험을 수행하였다. 결합단백질이 활성형 봉입체에 디스플레이 되어 있는 세포(VLR-mRFP-CBD)와 봉입체가 없는 세포(VLR-mRFP)를 이용하여 본 발명에서 개발한 두 단계의 세포투과 처리(동결/해동 및 산성용액처리)를 수행한 뒤, 투과 단계에 따른 두 세포의 차이점을 유세포 분석기와 형광현미경을 이용하여 관찰하였다.
실시예 5에서의 세포 투과 처리 과정 중 동결 및 해동 처리 과정 후 봉입체 유무에 따른 세포내 변화를 유세포 분석기와 형광이미지를 이용하여 분석하였다(도 4). 그 결과 결합단백질이 활성형 봉입체에 디스플레이 되어 있는 경우에는 동결 및 해동 처리 과정 후에도 세포내 안정적으로 발현을 유지하는 반면, 봉입체에 디스플레이 되어 있지 않는 결합단백질은 대부분 세포 내에서 소실됨을 확인하였다. 이는 동결/해동 처리 과정이 세포벽을 투과처리 시켜 세포내 분자(intracellular molecules)들을 세포 외부로 유실시키나, 봉입체에 결합되어 있는 결합단백질은 봉입체에 안정적으로 디스플레이 되어 있기 때문에 세포 외부로 소실되지 않고 세포내 존재함을 나타내는 결과이다.
또한 외부 표적물질의 세포내 도입은 동결 및 해동 처리 과정만으로는 세포 내로 도입되지는 않으나(도 5), 동결 및 해동 처리 된 봉입체 세포에 산성용액 또는 킬레이트제인 EDTA 처리를 통해 도입이 가능함을 유세포 분석기로 확인하였다(도 6). 도 6의 결과 외부 표적물질의 세포내 도입 효능이 가장 효과적인 방법은 0.1M 시트르산 (pH 4)임을 확인하였으며, 이로써 본 발명의 최적화된 투과 처리 과정을 완성하였다.
상기 최적화된 투과 처리 과정을 통해 외부 표적물질이 세포 내로 이동하여 봉입체에 디스플레이 되어 있는 결합단백질과의 상호작용을 형광이미지로 관찰하였으며(도 7의 A), 표적물질이 단시간 내에(1 분) 세포 내부로 이동하여 결합단백질과 상호작용하는 유세포 분석 결과를 통해(도 7의 B), 투과 처리된 세포막이 표적물질이 쉽게 이동 가능한 상태임을 확인하였다.
도 8은 이러한 상기 최적화된 투과 처리 과정을 통해 세포 내부로 도입된 외
부 표적물질과 봉입체에 디스플레이 되어 있는 결합단백질과의 상호작용이 비특이적 상호작용이 아닌 결합단백질의 고유의 활성을 유지하는 상태에서 표적물질과의 친화도에 의해 상호작용하는 특이적 상호작용임을 확인한 결과이다.
결합단백질의 활성형 봉입체 디스플레이 유무에 의한 결합단백질의 유전정보
유지를 확인하기 위해, 결합단백질이 활성형 봉입체에 디스플레이 되어 있는 세포(VLR-mRFP-CBD cell)와 봉입체가 없는 세포(VLR-mRFP)를 이용하여 본 발명에서
개발한 최적화된 세포투과 처리를 통해 응집체(pellet)와 상등액으로 각각 분리 후, 투과 과정에 따른 두 세포 내의 결합 단백질의 유전정보를 지니고 있는 플라스미드 유무를 실시간 중합효소연쇄반응 정량검사(Quantitative PCR; Q-PCR)로 확인하였다. 그 결과 활성형 봉입체에 디스플레이 된 결합단백질의 유전정보는 세포 투과 처리에도 불구하고 세포 내에 대부분 안정적으로 유지되는 반면, 봉입체에 디스플레이 되어 있지 않는 결합단백질의 유전정보는 대부분 세포 외부로 유실됨을 확인하였다(도 10).
실시예 14: 단백질 융합 디스플레이 시스템의 증명
상기 발명한 최적화된 세포 투과 처리를 이용하여 단백질 융합 디스플레이 기술 증명을 위해 모델 결합단백질과 모델 표적물질을 이용하여 실험을 수행하였다. 도 11의 A는 본 발명에서 개발한 두 단계의 투과 처리 과정 후에야 외부 표적물질이 세포 내부로 도입 가능하며, 도입된 표적물질이 세포내 봉입체에 디스플레이 되어 있는 결합단백질과 상호작용을 통해 봉입체로 응집(co-localization)됨을 보여주는 데이터이다.
도 11의 B는 상기 세포투과처리 과정 후 세포내 유전정보 유지 여부를 확인하기 위한 실험으로, 결합단백질이 활성형 봉입체에 디스플레이 되어 있는 세포(repebody-mRFP-CBD cell)에 본 발명에서 개발한 세포투과 처리를 통해 응집체(pellet)와 상등액으로 각각 분리 후, 응집체는 상등액과 동일량의 PBS 완충액(pH 7.4)로 재현탁한다. 응집체 현탁액과 상등액을 이용하여 결합 단백질의 유전정보를 지니고 있는 플라스미드 유무를 실시간 중합효소연쇄반응 정량검사(Quantitative PCR; Q-PCR)로 확인하였다. 또한 투과처리 전 세포와 투과처리 후 세포내 플라스미드를 분리하여 전기영동을 통해 확인하였다. 그 결과 활성형 봉입체에 디스플레이 된 결합단백질의 유전정보는 세포 투과 처리에도 불구하고 세포 내에 대부분 안정적으로 유지됨을 확인하였다.
이는 본 발명의 최적화된 투과 처리를 통해 세포내 활성형 봉입체에 디스플레이 되어 있는 결합단백질과 그 유전정보가 유지되는 특징으로 인해 결합단백질과 표적물질간의 상호작용을 이용하여 개별 세포단위로 분획, 개별 세포 단위에서의 유전정보를 회수 가능하게 하는 단계를 포함하는 단백질 라이브러리 스크리닝이 가능한 시스템임을 보여주는 결과이다.
도 11의 C는 상기 세포투과 처리 전,후의 세포 형태를 유세포 분석기와 전자현미경을 통해 확인한 결과로서, 세포 투과 처리 후에도 세포 형태를 안정적으로 유지하는 것을 확인하였다.
즉, 본 발명에서 개발한 세포 투과 처리 방법은 세포를 파괴하지 않고 세포벽 및 막의 투과화를 높여 외부 표적물질을 세포 내로 안정적으로 도입시키며 동시에 활성형 봉입체에 디스플레이 되어 있는 결합단백질 및 그 유전정보는 세포 내에 안정적으로 유지시키는 기존의 다른 세포 투과 처리 방법과는 명백히 다른 본 발명 고유의 방법임을 뒷받침한다.
도 12는 상기 최적화된 세포 투과처리로 인해 도입 가능한 표적물질의 크기를 확인한 실험으로, 단백질 융합 디스플레이 시스템을 이용한 스크리닝을 통해 획득한 dextran-FITC 결합단백질인 C20(PPI+)과 결합하지 않는 결합단백질(negative control)이 봉입체에 디스플레이 되어 있는 상호작용 포획세포를 실험에 사용하였다. 각각의 세포(PPI+, PPI-)에 투과처리 후 여러 크기를 가지는 dextran-FITC(분자량 3,000~5,000, 70,000, 250,000)를 세포 내로 인가시켜 상호작용을 유도하였다. 그 결과 분자량 250,000 dextran-FITC도 세포 내로 인가되어 세포내 봉입체에 디스플레이 되어 있는 결합단백질과 상호작용함을 확인하였으며, 이는 본 발명의 투과처리 방법을 사용하면 고분자물질(macromolecules)도 쉽게 세포 내로 도입 가능하며 이를 타깃으로 상호작용을 유도하여 라이브러리 스크리닝을 통해 단백질 결합체를 획득 가능함을 보여주는 결과이다.
실시예 15: 단백질 융합 디스플레이 기술을 이용한 단백질 간 상호작용 분석
상기 실시예를 통해 최적화된 세포 투과를 이용하여 단백질 융합 디스플레이를 통한 단백질 간 상호작용을 확인하기 위해, 표적물질인 IL-6와 친화도를 가지는 D3E8(Kd=2 nM)과 친화도가 없는 InVLR5c 단백질을 모델 결합단백질로 사용하여 봉입체에 각각 디스플레이하였다. pD3E8-mRFP-CBD 또는 pInVLR5c-mRFP-CBD 플라스미드를 각각 E. coli에 형질전환하여 융합단백질을 발현시켰으며, 실시예 5의 최적화된 세포 투과 처리를 통하여 표적물질인 GFP-IL6 단백질을 세포 내로 도입한 뒤, 형광 현미경 및 유세포 분석기를 통해 세포를 관찰하였다.
그 결과, IL6와 결합 친화도를 가지는 pD3E8-mRFP-CBD가 발현된 봉입체 세포(PPI+)에서는 GFP-IL6형광이 세포내 봉입체에 결합단백질과 함께 디스플레이 되어 있는 RFP 형광과 동일한 위치(co-localization)에서 관찰되는 반면, 친화도가 없는 LRR 단백질이 발현되어 있는 세포인 pInVLR5c-mRFP-CBD(PPI-)에서는 세포내 봉입체에 디스플레이 되어 있는 결합단백질의 RFP 형광만 관찰되며, GFP형광은 전혀 관찰되지 않았다(도 13의 A). 즉, 결합단백질과 상호작용을 통해 결합한 표적물질의 형광 강도를 통해 단백질 간 상호작용 여부를 분명하게 확인할 수 있었다. 요컨대, 이와 같은 결과는 활성형 봉입체가 이에 디스플레이되어 있는 단백질들의 적절한 접힘(folding) 및 천연 형태의 형성을 방해하지 않으며, 디스플레이된 단백질들을 활성형 형태로 고정화하는 역할을 담당한다는 것을 뒷받침하는 것이다. 즉, 본 발명의 방법이 결합단백질의 실제 구조 및 고유의 활성에는 영향을 미치지 않은 상태에서 단백질 간의 상호작용을 분석할 수 있다는 것을 증명하는 것이다.
또한 유세포 분석 결과, 표적물질(IL-6)과 상호작용이 존재하는 결합단백질인 D3E8이 디스플레이 되어 있는 봉입체 세포(PPI+)는 세포 투과를 통해 세포 내로 도입된 표적물질 IL-6 단백질과 상호작용을 통해 GFP형광이 크게 증가되었으며(적색 실선), IL-6와 친화도가 없는 결합단백질인 InVLR5c(회색 실선)과 비교 시(PPI-), 단백질 간 상호작용의 존재 여부에 따른 형광 차이(신호 대 잡음비)가 450배 수준으로 명확하게 차이가 나는 것을 확인함으로써 (PPI-:PPI+=1×101:5.5×103), 단백질 간 상호작용 여부를 명료하게 판별할 수 있음을 확인하였다(도 13B). 또한 결합단백질의 친화도에 따른 단백질 간 상호작용을 분석한 결과 결합단백질의 친화도가 증가함에 따라 표적물질에 융합되어 있는 형광의 강도도 함께 증가함을 통해 본 발명이 정량적 분석이 가능한 단백질 간 상호작용 분석 방법임을 확인하였다(도 13C).
상기와 같은 결과는, 본 발명의 방법을 통해 봉입체에 디스플레이되어 있는 결합단백질과 표적물질간의 친화도 및 상호작용에 따라 개별 세포단위의 봉입체 세포를 형광 현미경뿐만 아니라, 유세포 분석기를 통해서도 표적물질의 형광 강도를 통해 분리 및 회수하는 것이 가능하다는 것을 뒷받침하는 것이다. 더불어, 본 발명이 외부에서 도입된 표적물질에 융합된 형광의 강도에 따라 상호작용 유무를 구별하기 때문에 신호 대 잡음비 차이가 매우 명료한 장점이 있다.
실시예 16: 단백질 융합 디스플레이 기술을 이용한 라이브러리 스크리닝
본 발명에서 개발한 단백질 융합 디스플레이 기술을 이용하여 라이브러리 스크리닝이 가능함을 확인하였다. 표적물질인 IL-6와 친화도가 존재하는 결합단백질인 D3E8(Kd= 2 nM), F11(Kd= 117 nM)과 친화도가 없는 LRR 단백질인 InVLR5c(PPI-)가 디스플레이 되어 있는 봉입체 세포를 각각 1:10:10000의 비율로 혼합하여 라이브러리 유사환경을 조작한 후, 실시예 5의 방법으로 최적화된 세포 투과화 처리 및 단백질 상호작용을 유도한 샘플을 유세포 분석기(FACSaria)를 이용하여 IL-6와 결합 친화력이 높은 E. coli 세포 10,000개를 회수하였다. 회수한 세포들에서 플라스미드를 순수 분리하여 DH5α E. coli 세포에 다시 형질전환 하였으며, 형성된 콜로니들을 대상으로 PCR 증폭반응을 수행하여 표현형(D3E8(F11)-mRFP-CBD 단백질)을 통해 회수한 세포의 유전자 회수 여부를 확인하였다. PCR 증폭반응은 표1의 프라이머 12(서열번호 12), 프라이머 13(서열번호 13) 및 프라이머 14(서열번호14)를 섞어 사용하였으며, 증폭된 유전자의 크기를 통해 상호작용이 존재하는 세포의 회수 여부를 확인하였다.
그 결과, 한번의 스크리닝으로 초기 혼합비율(1/1000)을 감안하였을 때 약 30,000배의 스크리닝 효율을 나타내는 것으로 확인하였다(도 14). 이와 같은 결과는 활성형 봉입체를 상호작용 포획 세포로 이용하여 결합단백질을 디스플레이한 상호작용 포획 세포 라이브러리에서 단백질 간 상호작용을 통해 상호작용이 존재하는 봉입체 세포만을 초고속 분석장비인 유세포 분석기(FACS)를 이용하여 선택적으로 분류할 수 있으며, 선택적으로 분류된 세포에서 상호작용 단백질 코딩 유전자를 효과적으로 회수 가능한 라이브러리 스크리닝 시스템이라는 사실을 뒷받침한다.
상기 결과를 바탕으로 모델 결합단백질로 사용된 repebody를 이용하여 실제 라이브러리를 제작하고, 이를 이용하여 여러 종류의 타깃에 대한 단백질 결합체(binder)를 찾는 스크리닝 작업을 수행하였다(도 15a 내지 도 15c). 실시예 8에서 제작한 발현 라이브러리에 세포투과 처리 후, GFP가 결합되어 있는 여러 종류의 타깃들(mGFP-IL6, sfGFP, fluorescein, dextran-FITC)을 상호작용 포획 세포 라이브러리에 처리하여 상호작용을 유도한 후, FACS에서 GFP 시그널이 증가된 부분(상호작용 존재)의 세포를 회수하였다 (도 15a). 회수한 세포의 repebody 유전자 부분만 PCR하여 pInVLR5c-mRFP-CBD의 InVLR5c 유전자 위치에 라이브러리 유전자를 치환, 삽입함으로써 mRFP-CBD 유전자와 결합한 플라스미드를 확보하였다. 이 플라스미드를 전기청공법으로 대장균 BL21(DE3) 에 도입하여 형질전환체를 수득한 후, 무작위적으로 각각의 콜로니들을 선별하여 시퀀싱을 통해 획득한 repebody 유전자 서열을 확인하였다. 최대 2번의 반복 스크리닝만으로 각각의 타깃에 결합하는 여러 종류의 단백질 결합체(binder)를 쉽게 획득할 수 있었으며, 특히 sfGFP를 타깃으로 한 라이브러리 스크리닝 경우 FACS 분석 상에서 타깃과 원하는 결합력을 갖는 결합단백질 세포들만 선별적으로 회수하는 것이 가능하였다. 이와 같은 결과를 통해 단백질 융합 디스플레이 기술을 이용하면 단백질 간 상호작용에 의한 단백질 결합체를 빠르고 쉽게 획득할 수 있는 라이브러리 스크리닝 시스템이라는 사실을 증명하였다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (22)

  1. (a) 결합단백질과 활성형 봉입체(intracellular particle) 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는, 세포 라이브러리를 제공하는 단계;
    (b) 상기 세포 라이브러리에서 융합 단백질을 발현시켜 결합단백질이 봉입체에 디스플레이된 상호작용 포획 세포(Interaction Trapper cells; ITcells)를 형성시키는 단계;
    (c) 형광이 융합되어 있는 표적물질을 (b) 단계에 따른 세포에 투과처리(membrane disintegration)를 통해 세포 내로 도입하는 단계; 및
    (d) 결합단백질과 표적물질의 상호작용을 표적물질에 융합된 형광 물질의 형광 강도로 측정하여 개별세포 단위로 회수하는 단계를 포함하는, 표적물질에 특이적인 라이브러리 스크리닝 방법.
  2. 제1항에 있어서, 상기 투과처리하는 단계는,
    (i) 세포를 -80 내지 -10 ℃에서 동결하는 단계;
    (ii) 상기 동결한 세포를 상온 내지 37 ℃에서 해동하는 단계; 및
    (iii) 산성용액으로 처리하는 단계를 포함하는 것인 방법.
  3. 제1항에 있어서, 상기 투과처리는 세포 내부의 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않으며 투과된 막을 통해 표적물질은 세포 내로 도입 가능하게 하는 것을 특징으로 하는 방법.
  4. 제1항에 있어서, 상기 표적물질은 단백질, 핵산 또는 화합물인 것인 방법.
  5. 제1항에 있어서, 상기 융합 단백질은 형광 단백질을 추가로 포함하는 것인 방법.
  6. 제5항에 있어서, 상기 형광 단백질과 표적물질을 구성하는 형광 물질은 서로 다른 파장의 형광인 것을 특징으로 하는 방법.
  7. 제1항에 있어서, 상기 활성형 봉입체 단백질은 CBD(cellulose-binding domain) 단백질인 것인 방법.
  8. 제5항에 있어서, 상기 형광 단백질은 GFP(Green Fluorescent Protein), EGFP(Enhanced Green Fluorescent Protein), mGFP(modified green fluorescent protein), RFP(Red Fluorescent Protein), mRFP(Monomeric Red Fluorescent Protein), ERFP(Enhanced Red Fluorescent Protein), DsRed(Discosoma sp. red fluorescent protein), BFP(Blue Fluorescent Protein), EBFP(Enhanced Blue Fluorescent Protein), CFP(Cyan Fluorescent Protein), CGFP(Cyan Green Fluorescent Protein), ECFP(Enhanced Cyan Fluorescent Protein), YFP(Yellow Fluorescent Protein), EYFP(Enhanced Yellow Fluorescent Protein), AzG(Azami Green), HcR(HcRed, Heteractis crispa red fluorescent protein) 및 BFP(Blue Fluorescent Protein)로 이루어지는 군에서 선택되는 것인 방법.
  9. 제1항에 있어서, 상기 세포 내 형광 신호의 측정은 형광 현미경 또는 유세포 분석기로 수행하는 것인 방법.
  10. 제1항에 있어서, (e) 개별 세포 단위로 회수한 세포에 존재하는 융합 단백질을 코딩하는 유전자를 분리하고 증폭하는 단계를 추가로 포함하는 방법.
  11. (a) 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는, 세포를 제공하는 단계;
    (b) 상기 세포에서 융합 단백질을 발현시켜 결합단백질이 봉입체에 디스플레이된 상호작용 포획 세포(Interaction Trapper cells; ITcells)를 형성시키는 단계;
    (c) 형광이 융합되어 있는 표적물질을 (b) 단계에 따른 세포에 투과처리(membrane disintegration)를 통해 세포 내로 도입하는 단계; 및
    (d) 결합단백질과 표적물질의 상호작용을 외부에서 도입된 표적물질에 융합된 형광 물질의 형광 강도로 측정하는 단계를 포함하는, 결합단백질과 표적물질 간 상호작용을 분석하는 방법.
  12. 제11항에 있어서, 상기 투과처리하는 단계는,
    (i) 세포를 -80 내지 -10 ℃에서 동결하는 단계;
    (ii) 상기 동결한 세포를 상온 내지 37 ℃에서 해동하는 단계; 및
    (iii) 산성용액으로 처리하는 단계를 포함하는 것인 방법.
  13. 제12항에 있어서, 상기 투과처리는 세포 내부의 봉입체에 디스플레이 되어 있는 결합단백질의 활성 및 유전정보에는 영향을 주지 않으며 투과된 막을 통해 표적물질은 세포 내로 도입 가능하게 하는 것을 특징으로 하는 방법.
  14. 제11항에 있어서, 상기 표적물질은 단백질, 핵산 또는 화합물인 것인 방법.
  15. 제11항에 있어서, 상기 융합 단백질은 형광 단백질을 추가로 포함하는 것인 방법.
  16. 제15항에 있어서, 상기 형광 단백질과 표적물질을 구성하는 형광 물질은 서로 다른 파장의 형광인 것을 특징으로 하는 방법.
  17. 제15항에 있어서, 상기 형광 단백질은 GFP(Green Fluorescent Protein), EGFP(Enhanced Green Fluorescent Protein), mGFP(modified green fluorescent protein), RFP(Red Fluorescent Protein), mRFP(Monomeric Red Fluorescent Protein), ERFP(Enhanced Red Fluorescent Protein), DsRed(Discosoma sp. red fluorescent protein), BFP(Blue Fluorescent Protein), EBFP(Enhanced Blue Fluorescent Protein), CFP(Cyan Fluorescent Protein), CGFP(Cyan Green Fluorescent Protein), ECFP(Enhanced Cyan Fluorescent Protein), YFP(Yellow Fluorescent Protein), EYFP(Enhanced Yellow Fluorescent Protein), AzG(Azami Green), HcR(HcRed, Heteractis crispa red fluorescent protein) 및 BFP(Blue Fluorescent Protein)로 이루어지는 군에서 선택되는 것인 방법.
  18. 제11항에 있어서, 상기 세포 내 형광 신호의 측정은 형광 현미경 또는 유세포 분석기로 수행하는 것인 방법.
  19. 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는 세포.
  20. 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 구조물을 포함하는 세포 라이브러리.
  21. 제20항에 있어서, 상기 라이브러리는 DNA 라이브러리 또는 이를 형질전환한 세포 라이브러리인 것인 라이브러리.
  22. 결합단백질과 활성형 봉입체 단백질로 구성된 융합 단백질이 발현되고, 결합단백질이 봉입체에 디스플레이 된 상호작용 포획 세포 및 세포 라이브러리.
PCT/KR2015/001226 2014-02-07 2015-02-06 단백질 융합 디스플레이 기술을 이용한 물질 간 상호작용 고속분석 방법 WO2015119447A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP15746712.7A EP3103900B1 (en) 2014-02-07 2015-02-06 High-throughput analysis method of interaction between materials, using protein fusion display technique
CN201580018385.7A CN106164344B (zh) 2014-02-07 2015-02-06 使用流式细胞仪测定蛋白纳米颗粒分子间相互作用的方法
JP2016550222A JP6526029B2 (ja) 2014-02-07 2015-02-06 タンパク質融合ディスプレイ技術を用いた物質間相互作用高速分析方法
US15/229,102 US10908163B2 (en) 2014-02-07 2016-08-04 Analysis method of molecular interactions on protein nanoparticles using flow cytometry

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0014334 2014-02-07
KR20140014334 2014-02-07

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/229,102 Continuation-In-Part US10908163B2 (en) 2014-02-07 2016-08-04 Analysis method of molecular interactions on protein nanoparticles using flow cytometry

Publications (1)

Publication Number Publication Date
WO2015119447A1 true WO2015119447A1 (ko) 2015-08-13

Family

ID=53778195

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/001226 WO2015119447A1 (ko) 2014-02-07 2015-02-06 단백질 융합 디스플레이 기술을 이용한 물질 간 상호작용 고속분석 방법

Country Status (6)

Country Link
US (1) US10908163B2 (ko)
EP (1) EP3103900B1 (ko)
JP (1) JP6526029B2 (ko)
KR (1) KR101733609B1 (ko)
CN (1) CN106164344B (ko)
WO (1) WO2015119447A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190101808A (ko) 2018-02-23 2019-09-02 주식회사 페라메드 하이 스루풋 스크리닝 방법

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060257887A1 (en) * 2004-12-04 2006-11-16 Waldo Geoffrey S Protein -protein interaction detection system using fluorescent protein microdomains
US20080153111A1 (en) * 2005-03-15 2008-06-26 President And Fellows Of Harvard College Method and composition for detecting protein-protein and protein-nucleic acid interactions
US20090105089A1 (en) * 2006-04-19 2009-04-23 Millegen Method for detecting intracytoplasmic protein/protein interactions
KR20100086055A (ko) 2007-12-17 2010-07-29 알까뗄 루슨트 집합된 클라이언트 패킷들의 이송
KR20130023057A (ko) 2011-08-26 2013-03-07 한국생명공학연구원 생체 내 단백질 간 상호작용의 분석 방법
KR101255682B1 (ko) 2010-09-02 2013-04-18 한국생명공학연구원 신규한 ｍｄ-2 결합 폴리펩타이드 및 이의 용도
KR101356075B1 (ko) 2012-02-27 2014-02-12 한국과학기술원 인터루킨-6와 결합할 수 있는 신규한 폴리펩타이드

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1062564C (zh) * 1996-12-20 2001-02-28 周红 猪血中提纯杀菌性/通透性增加蛋白的方法
JP2003294736A (ja) 2002-04-01 2003-10-15 Japan Science & Technology Corp 蛍光蛋白質融合プローブを用いたスクリーニング方法
AU2004257228B8 (en) * 2003-07-09 2009-01-08 Life Technologies Corporation Method for assaying protein-protein interaction
US9164090B2 (en) 2007-08-17 2015-10-20 Korea Advanced Institute Of Science And Technology Methods for detecting molecular interactions
CN101230362B (zh) * 2008-02-27 2012-07-04 东南大学 一种改变细胞膜通透性有效生产1,3-丙二醇的方法
KR101356787B1 (ko) 2011-07-22 2014-02-06 한국과학기술원 나노클러스터 형성을 이용한 단백질간 상호작용 분석 방법 및 키트
US8877446B2 (en) * 2011-08-26 2014-11-04 Korea Research Institute Of Bioscience And Biotechnology Method for detecting protein-protein interactions in cells
US9708381B2 (en) * 2011-09-30 2017-07-18 Korea Advanced Institute Of Science And Technology Method for forming a reversible protein nanocluster using light in a cell

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060257887A1 (en) * 2004-12-04 2006-11-16 Waldo Geoffrey S Protein -protein interaction detection system using fluorescent protein microdomains
US20080153111A1 (en) * 2005-03-15 2008-06-26 President And Fellows Of Harvard College Method and composition for detecting protein-protein and protein-nucleic acid interactions
US20090105089A1 (en) * 2006-04-19 2009-04-23 Millegen Method for detecting intracytoplasmic protein/protein interactions
KR20100086055A (ko) 2007-12-17 2010-07-29 알까뗄 루슨트 집합된 클라이언트 패킷들의 이송
KR101255682B1 (ko) 2010-09-02 2013-04-18 한국생명공학연구원 신규한 ｍｄ-2 결합 폴리펩타이드 및 이의 용도
KR20130023057A (ko) 2011-08-26 2013-03-07 한국생명공학연구원 생체 내 단백질 간 상호작용의 분석 방법
KR101356075B1 (ko) 2012-02-27 2014-02-12 한국과학기술원 인터루킨-6와 결합할 수 있는 신규한 폴리펩타이드

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
ANTONIO VILLAVERD ET AL.: "Aggregation as bacterial inclusion bodies does not imply inactivation of enzymes and fluorescent proteins", MICROBIAL CELL FACTORIES, vol. 4, 2005, pages 1 - 6
BJORN STEINMANN; ANDREAS CHRISTMANN; TIM HEISELER; JANINE FRITZ; HARALD KOLMAR.: "In Vivo Enzyme Immobilization by Inclusion Body Display", APPL. ENVIRON. MICROBIOL., vol. 76, 2010, pages 5563 - 69, XP055054515, DOI: doi:10.1128/AEM.00612-10
DAN S. TAWFIK; ANDREW D. GRIFFITHS.: "Man-made cell-like compartments for molecular evolution", NAT. BIOTECHNOL., vol. 16, 1998, pages 652 - 56
ERIC T. BODER; K. DANE WITTRUP: "Yeast surface display for screening combinatorial polypeptide libraries", NAT. BIOTECH., vol. 15, 1997, pages 553 - 57
GEORGE P. SMITH; VALERY A. PETRENKO: "Phage Display", CHEM. REV., vol. 97, 1997, pages 391 - 410
HANES, J; PLUCKTHUN, A.: "In vitro selection and evolution of functional proteins by using ribosome display", PROC. NATL. ACAD. SCI., vol. 94, 1997, pages 4937 - 42, XP002079690
HANSRUEDI FELIX.: "Permeabilized Cells", ANAL. BIOCHEM., vol. 120, 1982, pages 211 - 34
HANSRUEDI FELIX.: "Permeabilized cells", ANALYTICAL BIOCHEMISTRY, vol. 120, 1982, pages 211 - 34
HENING LIN; VIRGINIA W. CORNISH.: "Screening and Selection Methods for Large-Scale Analysis of Protein Function", ANGEW. CHEM. INT. ED, vol. 41, 2002, pages 4402 - 25
HUANG, Z. ET AL.: "Active inclusion bodies of acid phosphatase PhoC: aggregation induced by GFP fusion and activities modulated by linker flexibility", MICROBIAL CELL FACTORIES, vol. 12, no. 1, 14 March 2013 (2013-03-14), pages 25, XP021141764 *
J MICROBIOL BIOTECHNOL., vol. 18, no. 3, March 2008 (2008-03-01), pages 443 - 8
JOZEF NAHALKA; BERND NIDETZKY: "Fusion to a pull-down domain: a novel approach of producing trigonopsis variabilis D-amino acid oxidase as insoluble enzyme aggregates", BIOTECHNOLOGY AND BIOENGINEERING, vol. 97, 2007, pages 454 - 61
SANGKYU LEE ET AL.: "Small-Molecule-Based Nanoassemblies as Inducible Nanoprobes for Monitoring Dynamic Molecular Interactions Inside Live Cells", ANGEW CHEM INT ED ENGL, vol. 50, 2011, pages 8709 - 13, XP055069128, DOI: doi:10.1002/anie.201101467
URSULA RINAS; JAMES E. BAILEY.: "Protein compositional analysis of inclusion bodies produced in recombinant Escherichia coli", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 37, 1992, pages 609 - 14
WENWAN ZHONG., NANOMATERIALS IN FLUORESCENCE-BASED BIOSENSING., vol. 394, 2009, pages 47 - 59

Also Published As

Publication number Publication date
US20170192009A1 (en) 2017-07-06
JP6526029B2 (ja) 2019-06-05
CN106164344B (zh) 2018-12-18
EP3103900B1 (en) 2020-09-09
US10908163B2 (en) 2021-02-02
JP2017512055A (ja) 2017-05-18
KR20150093619A (ko) 2015-08-18
EP3103900A4 (en) 2017-10-04
EP3103900A1 (en) 2016-12-14
KR101733609B1 (ko) 2017-05-08
CN106164344A (zh) 2016-11-23

Similar Documents

Publication Publication Date Title
US11078479B2 (en) Polypeptide display libraries and methods of making and using thereof
US6846627B2 (en) Screening for novel compounds which regulate biological interactions
AU2003291677A1 (en) Methods for producing polypeptide-tagged collections and capture systems containing the tagged polypeptides
WO2004053151A1 (en) Evolved clostridial toxins with altered protease specificity
Ren et al. Selection and screening strategies in directed evolution to improve protein stability
US20130136694A1 (en) Method for identifying cancer drug candidates in drosophila
JP6013470B2 (ja) タンパク質ディスプレイの方法
Cedeño et al. Protein delivery into plant cells: toward in vivo structural biology
US10472408B2 (en) Fusion proteins comprising partial tetraspanin sequences and a system thereof for presenting peptides on the cell surface
WO2015119447A1 (ko) 단백질 융합 디스플레이 기술을 이용한 물질 간 상호작용 고속분석 방법
EP2516702B1 (en) Protein display
KR101963502B1 (ko) 살아있는 세포 기반 바이오센서 및 이를 이용한 외부자극물질 또는 생체신호물질 센싱 방법
Smith et al. Characterization of a novel method for the production of single‐span membrane proteins in Escherichia coli
Gebura Nanobodies as new tools for studying large cargo transport and lamina organization
Hendriks et al. A Novel Method for the Identification of SUMO Acceptor Lysines in a Site-Specific Manner

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15746712

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2016550222

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2015746712

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015746712

Country of ref document: EP