WO2015111597A1

WO2015111597A1 - Method for preparing citrulline

Info

Publication number: WO2015111597A1
Application number: PCT/JP2015/051462
Authority: WO
Inventors: 圭介古市; 玲子渡部; 伊藤　裕之; 恵理山本
Original assignee: 株式会社明治
Priority date: 2014-01-22
Filing date: 2015-01-21
Publication date: 2015-07-30
Also published as: CN107172883A; JPWO2015111597A1; SG11201605881YA; JP6535285B2; HK1243461A1

Abstract

　Disclosed are a method for preparing citrulline that makes it possible to produce citrulline efficiently, and a method for producing a citrulline-containing composition containing citrulline at high concentration. Also disclosed are a method for culturing and a method for fermenting microorganisms having increased conversion efficiency from arginine to citrulline, and a culture method that increases the concentration of microorganisms having the ability to produce citrulline. Citrulline can be produced efficiently by inoculating medium with microorganisms having the ability to produce citrulline and culturing at a higher temperature than usual, and by adding microorganisms having the ability to produce citrulline to a raw material and fermenting at a higher temperature than usual. The conversion efficiency from arginine to citrulline can also be increased, or the concentration of microorganisms can be increased, by adding arginine to medium or raw material and culturing or fermenting microorganisms having the ability to produce citrulline, and by culturing by controlling the pH of the medium.

Description

Method for preparing citrulline

The present invention relates to a method for preparing citrulline, and more particularly to a method for preparing citrulline using microorganisms such as lactic acid bacteria. The present invention also relates to a method for producing a composition (eg, dairy product) containing citrulline at a high concentration. Furthermore, the present invention includes a method for preparing a culture solution containing a microorganism capable of producing citrulline with enhanced conversion efficiency from arginine to citrulline, and a microorganism capable of producing citrulline with an increased cell concentration. The present invention relates to a method for preparing a culture solution.

Citrulline is a functional amino acid, and in Japan, its use as a food was approved in 2007 after its use as a medicine. In addition, citrulline has been ingested overseas as a food product since before 2007, and has been sold as a supplement, for example, for functions of improving blood flow, preventing arteriosclerosis, and enhancing energy. Furthermore, it has been reported that citrulline has other functions such as coldness improvement, skin function improvement, fatigue reduction / recovery, muscle growth, and motor function improvement.

On the other hand, citrulline is extremely expensive as a food material, and the amount of intake necessary for exerting its function is relatively large (for example, several hundred mg). Therefore, when citrulline is to be added to foods or the like in an effective amount, the problem is that it is expensive.

Citrulline is currently produced mainly by fermentation. For example, Japanese Patent Application Laid-Open No. 63-068091 (Patent Document 1) describes the production of L-citrulline by culturing microorganisms belonging to the genus Corynebacterium and Brevibacterium and generating and accumulating L-citrulline in the culture solution. The law is disclosed. Japanese Patent Laid-Open No. 05-168486 (Patent Document 2) discloses that a lactic acid bacterium belonging to the genus Pediococcus is infected with a bacteriophage to act on L-arginine to produce L-citrulline. A method for producing L-citrulline is disclosed. Japanese Patent Application Laid-Open No. 08-089269 (Patent Document 3) discloses that L-ornithine-producing deficient cells dried with a water-soluble organic solvent are brought into contact with L-arginine to produce L-citrulline. -A method for producing citrulline is disclosed. This publication exemplifies bacteria belonging to the genera Bacillus, Pseudomonas, and Streptococcus. Japanese Patent Laid-Open No. 2010-088301 (Patent Document 4) discloses a method for producing L-citrulline by a fermentation method of Vibrio bacteria.

However, these conventional techniques still have room for improvement from the viewpoint of citrulline production efficiency and production cost, and it can be said that there is still a need for a production method of citrulline that is highly efficient and cost-effective. .

Here, as far as the present inventors know, it has not been reported to produce citrulline or ornithine from arginine using Lactobacillus lactis ( L. lactis ), but L. lactis Several reports have been made that arginine is metabolized (Non-patent Documents 1, 2, and 3). For example, Non-Patent Documents 1 and 2 describe that all of arginine was converted to ornithine by L. lactis . Further, Non-Patent Document 3 describes as a known fact that all of arginine is converted to ornithine when arginine is metabolized by L. lactis . Japanese Patent Application Laid-Open No. 2009-112205 (Patent Document 5) describes that an ornithine-containing composition is produced by producing L-ornithine in a fermentation process for producing cheese or the like.

Furthermore, in the study of gene expression related to the metabolism of arginine, in L. lactis , arginine deiminase (ADI), an enzyme that converts arginine to citrulline, and ornithine carbamyltransferase (OTC), an enzyme that converts citrulline to ornithine. It has been reported that the genes are encoded adjacently and that the expression of these two genes is controlled by the same promoter (Non-patent Document 4).

Furthermore, studies of the expression of genes related to the metabolism of arginine, L. As lactic acid bacteria other than lactis, even in Enterococcus faecalis (Enterococcus faecalis) and Lactobacillus plantarum (Lactobacillus planturum), ADI and OTC gene adjacent code It has been reported that the expression of these two genes is controlled by the same promoter (Non-patent Documents 5 and 6).

In these studies, real-time PCR is used to confirm that the expression of ADI and OTC genes is controlled simultaneously. In L. lactis , the activities of ADI and OTC were measured under various culture conditions (Non-patent Document 1), and it was reported that the activity of OTC was higher than that of ADI under any of the culture conditions. Has been.

That is, from these studies, arginine is converted to citrulline by ADI in microorganisms having the ability to metabolize arginine, but citrulline is immediately converted to ornithine by OTC, so that citrulline accumulates in the culture medium. It is suggested not to.

JP 63-068091 A JP 05-168486 A Japanese Patent Laid-Open No. 08-089269 JP 2010-088301 A JP 2009-112205 A

In order to efficiently convert most of arginine to citrulline using microorganisms such as lactic acid bacteria, it was considered effective to suppress the conversion of citrulline to ornithine. However, as far as the present inventors know, no method has been reported so far for efficiently converting most of arginine to citrulline.

Inventors of the present invention, by using a microorganism having citrulline-producing ability, cultivating citrulline efficiently by culturing a medium at a temperature higher than normal (optimum temperature for culturing microorganisms). The knowledge that it can be obtained. In addition, the present inventors ferment a raw material (for example, raw milk) by using a microorganism having citrulline-producing ability at a temperature higher than normal (optimum temperature for fermentation of the microorganism), thereby producing citrulline. The knowledge that it can manufacture the composition (For example, food-drinks, such as fermented milk products) contained in high concentration, was acquired.

Furthermore, the present inventors have obtained the knowledge that the ability of microorganisms to produce citrulline can be enhanced by adding arginine to a medium or raw material and culturing and fermenting it. The present inventors have obtained knowledge that the concentration (number) of microorganisms can be increased by culturing while controlling the pH of the medium (culture solution). The present invention is based on these findings.

Therefore, an object of the present invention is to provide a method for preparing citrulline that can efficiently produce citrulline. Another object of the present invention is to provide a method for producing a citrulline-containing composition containing citrulline at a high concentration.

Furthermore, an object of the present invention is to provide a method for culturing and fermenting microorganisms with improved conversion efficiency from arginine to citrulline. The object of the present invention is to provide a culture method in which the concentration of microorganisms capable of producing citrulline is increased.

That is, the present invention relates to the following aspects (1) to (18).
(1) A method for preparing citrulline, comprising inoculating a culture medium with a citrulline-producing ability into a medium and culturing at a temperature of 40 ° C. or higher and 70 ° C. or lower.
(2) The method for preparing citrulline according to (1), wherein the microorganism having citrulline producing ability is a lactic acid bacterium, a bifidobacteria or a propionic acid bacterium.
(3) The method for preparing citrulline according to (2), wherein the lactic acid bacteria is one or more selected from the group consisting of Lactococcus lactis, Lactobacillus fermentum, and Lactobacillus buchneri.
(4) The lactic acid bacterium is one or more selected from the group consisting of Lactococcus lactis spp. Lactis OLS3789, OLS3797, and OLS3818, according to (2) A method for preparing citrulline.

(5) A method for producing a citrulline-containing composition, wherein a microorganism having citrulline-producing ability is added (blended) to a raw material and fermented at a temperature of 40 ° C or higher and 70 ° C or lower.
(6) The method for producing a citrulline-containing composition according to (5), wherein the microorganism having citrulline-producing ability is a lactic acid bacterium, a bifidobacteria, or a propionic acid bacterium.
(7) The method for producing a citrulline-containing composition according to (6), wherein the lactic acid bacteria is one or more selected from the group consisting of Lactococcus lactis, Lactobacillus fermentum, and Lactobacillus buchnerii .
(8) The lactic acid bacterium is one or more selected from the group consisting of Lactococcus lactis spp. Lactis OLS3789, OLS3797, and OLS3818, according to (6) A method for producing a citrulline-containing composition.
(9) The method for producing a citrulline-containing composition according to any one of (5) to (8), wherein the raw material is raw material milk.
(10) The method for producing a citrulline-containing composition according to any one of (5) to (9), wherein the citrulline-containing composition is a food or drink.

(11) A method for preparing a culture solution comprising a microorganism having a citrulline-producing ability and having enhanced conversion efficiency from arginine to citrulline at a culture temperature of 40 ° C. or higher and 70 ° C. or lower, the microorganism having citrulline-producing ability Is cultured in a medium supplemented with arginine.
(12) Add arginine to the medium before culturing and / or
The method for preparing a culture solution according to (11), wherein arginine is intermittently added during the culture, or arginine is continuously added during the culture.
(13) A method for preparing a culture solution containing a microorganism having citrulline-producing ability and having an increased concentration of the microorganism, wherein the microorganism having citrulline-producing ability is a medium having a pH in the range of 5 to 7. A preparation method, characterized by culturing and increasing the concentration of the microorganism.
(14) The method for preparing a culture solution according to (13), wherein the pH of the medium is adjusted by adding an alkali.

(15) Culture having a citrulline producing ability, including a microorganism having an increased conversion efficiency from arginine to citrulline at a culture temperature of 35 ° C. or higher and 70 ° C. or lower, and having an increased concentration of the microorganism (cell concentration) A method for preparing a liquid, characterized in that a microorganism having citrulline-producing ability is added to arginine and cultured in a medium having a pH in the range of 5 to 7, to increase the concentration of the microorganism. Method.
(16) Add arginine to the medium before culturing, and / or
The method for preparing a culture solution according to (15), wherein arginine is intermittently added during the culture, or arginine is continuously added during the culture.
(17) The ability to produce citrulline with improved conversion efficiency from arginine to citrulline, obtained by centrifugation and / or membrane separation of the culture solution obtained by the method according to any one of (11) to (16). A method for preparing a microorganism.
(18) A culture solution obtained by the method for preparing a culture solution according to any one of (11) to (16) or a microorganism obtained by the method for preparing a microorganism according to (17) is inoculated into a medium. The method for producing citrulline according to any one of (1) to (4), or the method for producing a citrulline-containing composition according to any one of (5) to (10), wherein the method is cultivated or fermented by adding to a raw material .

According to the method for preparing citrulline of the present invention, citrulline can be produced efficiently. Moreover, according to the method for producing a citrulline-containing composition of the present invention, a nutritional composition such as a dairy product containing citrulline at a high concentration can be obtained. Moreover, according to the microorganism culture method and fermentation method of the present invention, the conversion efficiency from arginine to citrulline can be increased. And according to the microorganism cultivation method of the present invention, the concentration of microorganisms can be increased. Furthermore, according to the method for preparing citrulline and the method for producing a citrulline-containing composition of the present invention, a microorganism having the ability to produce citrulline with improved conversion efficiency from arginine to citrulline and / or increased microorganism concentration and / or Alternatively, citrulline can be efficiently produced using the culture solution, and a nutritional composition such as a dairy product containing citrulline at a high concentration can be obtained.

It is a graph which shows the time-dependent change of the cell concentration of L. lactis OLS3797 strain | stump | stock when the pH of a culture medium (culture liquid) is controlled to 5.5 using sodium hydroxide, and L. lactis OLS3797 strain | stump | stock is cultured. . Controlling the pH of the medium (culture solution) and culturing the L. lactis OLS3797 strain (pH-controlled culture) 10, 11, and 12 hours after the start of culture, and the L. lactis OLS3797 strain It is a graph which shows the comparison of the conversion efficiency from arginine to citrulline in the culture solution when it culture | cultivates. Graph showing time-dependent change in pH, time-dependent change in cell concentration, time-dependent change in arginine concentration, citrulline concentration and ornithine concentration when arginine was added to MRS medium before culturing and L. lactis OLS3797 strain was cultured. is there. 10 hours after the start of culture, arginine was intermittently added to the MRS medium, and when L. lactis OLS3797 was cultured, the change in pH over time, the change in cell concentration over time, the arginine concentration, citrulline concentration, ornithine concentration over time It is a graph which shows a change. 4 hours after the start of the culture, arginine was continuously added to the MRS medium, and when the L. lactis OLS3797 strain was cultured, the pH change over time, the cell concentration change over time, the arginine concentration, citrulline concentration, ornithine concentration over time It is a graph which shows a change.

Method for Preparing Citrulline The method for preparing citrulline of the present invention is characterized in that a microorganism having citrulline-producing ability is inoculated into a medium and cultured at a temperature higher than usual (the optimum temperature for culturing microorganisms). The culture temperature is specifically 40 ° C. or higher and 48 ° C. or lower, preferably 42 ° C. or higher and 47 ° C. or lower, more preferably 44 ° C. or higher and 46 ° C. or lower. According to another aspect of the present invention, the culture temperature is 40 ° C. or higher and 70 ° C. or lower, a preferred upper limit is 68 ° C., a more preferred upper limit is 65 ° C., a preferred lower limit is 42 ° C., and a more preferred lower limit is 43. ° C.

As described above, the culture temperature in the present invention is higher than the normal culture temperature (for example, optimum temperature) of microorganisms having citrulline production ability. Citrulline can be efficiently produced by culturing microorganisms in such a temperature range. The reason for this can be considered as follows. However, the following explanation (theory) is merely an assumption, and the present invention is not limited by this theory. That is, as described in the prior art, for example, L. lactis having the ability to metabolize arginine is arginine deiminase (ADI), an enzyme that converts arginine to citrulline, and ornithine carbamyltransferase (ADI), an enzyme that converts citrulline to ornithine. OTC) gene, both of which are thought to be controlled by the same promoter. At this time, as in the present invention, when the culture temperature is high, ADI enhances the conversion of arginine to citrulline, or OTC suppresses the conversion of citrulline to ornithine, or It is considered that citrulline accumulates in the medium (culture medium) with both of these actions and phenomena. That is, as in the present invention, when the culture temperature is high, arginine is efficiently converted to citrulline, and therefore, it is considered that an efficient method for preparing citrulline can be realized.

The culture time of the present invention is not particularly limited as long as it is appropriately selected from the conditions under which a microorganism capable of producing citrulline can be cultured, but is preferably 2 to 48 hours, more preferably 3 to 36 hours, and still more preferably 4 to 4 hours. 24 hours.

The microorganism having citrulline producing ability of the present invention is not particularly limited as long as it produces citrulline, but is preferably 40 ° C. or higher and 48 ° C. or lower, more preferably 42 ° C. or higher and 47 ° C. or lower, and further preferably 44 ° C. or higher. It is preferable to culture at a temperature of 46 ° C. or less to efficiently produce citrulline. According to another aspect of the present invention, the temperature is 40 ° C. or more and 70 ° C. or less, a preferred upper limit is 68 ° C., a more preferred upper limit is 65 ° C., a preferred lower limit is 42 ° C., and a more preferred lower limit is 43 ° C. It is. The microorganism having citrulline producing ability in the present invention is preferably a lactic acid bacterium, bifidobacteria or propionic acid bacterium having citrulline producing ability, more preferably a lactic acid bacterium or bifidobacteria having citrulline producing ability, and more preferably. Is a lactic acid bacterium having citrulline-producing ability.

The lactic acid bacteria having citrulline-producing ability of the present invention are preferably Lactococcus lactis, Lactobacillus fermentum, Lactobacillus buchnerii, Enterococcus faecalis, Oenococcus oeni, Pediococcus pentosaceus, Lactobacillus amylovorus, lacto One or more selected from the group consisting of Bacillus brevis and Lactobacillus reuteri, more preferably selected from the group consisting of Lactococcus lactis, Lactobacillus fermentum, and Lactobacillus buchneri Or more, more preferably Lactococcus lactis.

The Lactococcus lactis having the ability to produce citrulline of the present invention is preferably one or more selected from the group consisting of Lactococcus lactis subspecies lactis and Lactococcus lactis subspecies cremolith, more preferably Is Lactococcus lactis subsp . Lactis, more preferably one or two selected from the group consisting of Lactococcus lactis spp. Lactis OLS3789, OLS3797, and OLS3818 More than a seed. These strains are deposited with the depository as described later.

Lactococcus lactis spp. Lactis OLS3789 having the ability to produce citrulline according to the present invention is Lactococcus lactis spp. Lactis OLS3789 as described above, and received from the National Institute of Microbiology, Japan Patent Evaluation Organization: NITE BP-1387 (Indication of identification: Lactococcus lactis spp. Lactis OLS3789, deposit date: July 18, 2012), Lactococcus lactis spp. Lactis OLS3797, independent administrative agency Product Evaluation Technology Organization, Patent Microorganism Depositary Center No. NITE BP-1388 (indication of identification: Lactococcus lactis spp. Lactis OLS3797, date of deposit: July 18, 2012), Lactococcus lactis spp. Lactis OLS3818, an independent administrative agency receiving the product evaluation technology mechanism, Patent microorganisms Depositary number: NITE BP-1389 (of identification:. Lactococcus lactis spp lactis OLS3818, date of deposit: July 18, 2012) that it has been deposited in A.

Here, Lactococcus lactis spp. Lactis OLS3789 has the following scientific properties (morphological, characteristics on the medium, physiological properties, etc.).
(A) Morphological properties Colony properties on medium (Lactobacilli MRS Agar, DIFCO): circular, white, smooth, flat (b) Physiological properties Bacterial morphology: cocci, Gram staining: positive, lactic acid fermentation format: Homolactic fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism The 16s rDNA sequence is as follows. (OLS3789)
GCTGGCGGGCGTGCCTAATACATGCAAGTTGAGCGCTGAAGGTTGGTACTTGTACCGACTGGATGAGCAGCGAACGGGTGAGTAACGCGTGGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAAAAACTTTAAACACAAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGATGATCCCGCGTTGTATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGATGATACATAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAGCTCATCAAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 1)

Lactococcus lactis spp. Lactis OLS3797 has the following scientific properties (morphological, characteristics on the medium, physiological properties, etc.).
(A) Morphological properties Colony properties on medium (Lactobacilli MRS Agar, DIFCO): circular, white, smooth, flat (b) Physiological properties Bacterial morphology: cocci, Gram staining: positive, lactic acid fermentation format: Homolactic fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism The 16s rDNA sequence is as follows. (OLS3797)
GAAGCTGGCGGCGTGCCTAATACATGCAAGTTGAGCGCTGAAGGTTGGTACTTGTACCGACTGGATGAGCAGCGAACGGGTGAGTAACGCGTGGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAAAAACTTTAAACACAAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGATGATCCCGCGTTGTATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGATGATACATAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAGCTCATCAAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 2)

Furthermore, Lactococcus lactis spp. Lactis OLS3818 has the following scientific properties (morphological, characteristics on the medium, physiological properties, etc.).
(A) Morphological properties Colony properties on medium (Lactobacilli MRS Agar, DIFCO): circular, white, smooth, flat (b) Physiological properties Bacterial morphology: cocci, Gram staining: positive, lactic acid fermentation format: Homolactic fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism The 16s rDNA sequence is as follows. (OLS3818)
GCGAAGCTGGCGGCGTGCCTAATACATGCAAGTTGAGCGCTGAAGGTTGGTACTTGTACCGACTGGATGAGCAGCGAACGGGTGAGTAACGCGTGGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAAAAACTTTAAACACAAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGATGATCCCGCGTTGTATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGATGATACATAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAGCTCATCAAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 3)

The medium of the present invention may be appropriately selected from those capable of culturing microorganisms capable of producing citrulline, and is not particularly limited. Examples thereof include skim milk, skim concentrated milk, reduced skim milk, and their protein degradation products, whey. , Whey concentrate, reduced whey, and their protein degradation products, raw milk, whole fat milk (sterilized milk), whole fat concentrated milk, reduced whole fat milk, etc., preferably skim milk, reduced skim milk , And these protein degradation products, whey, reduced whey, and these protein degradation products.

In the method for preparing citrulline of the present invention, citrulline is produced in the medium. At this time, the medium containing citrulline may be used as it is as a raw material or material for food or drink, preferably as a raw material or material for dairy products, or citrulline is separated (isolated or the like) from this medium. Alternatively, citrulline having a desired purity may be prepared and used after processing by treatment such as or concentration. At this time, functional foods, nutritional foods, etc. are mentioned as food and drink, and dairy products include, for example, milk drinks, fermented milk (more preferably yogurt), lactic acid bacteria drinks, cheese, ice cream and the like. .

Method for producing citrulline-containing composition In the method for producing a citrulline-containing composition of the present invention, a microorganism having citrulline-producing ability is added (mixed) to a raw material and fermented at a temperature higher than usual (the optimum temperature for fermentation of microorganisms). It is characterized by doing. The fermentation temperature is specifically 40 ° C. or higher and 48 ° C. or lower, preferably 42 ° C. or higher and 47 ° C. or lower, more preferably 44 ° C. or higher and 46 ° C. or lower. Moreover, according to another aspect of the present invention, the fermentation temperature is 40 ° C. or higher and 70 ° C. or lower, a preferred upper limit is 68 ° C., a more preferred upper limit is 65 ° C., a preferred lower limit is 42 ° C., and a more preferred lower limit is 43. ° C.

As described above, the fermentation temperature in the present invention is higher than the normal fermentation temperature (for example, optimum temperature) of microorganisms having citrulline production ability. Citrulline can be efficiently produced by culturing microorganisms in such a temperature range. About this reason, it is thought similarly to the reason already demonstrated in the preparation method of the citrulline of this invention.

Further, in the method for preparing citrulline of the present invention, the citrulline may be used as it is as a citrulline-containing composition without isolating citrulline from the citrulline-containing medium, or a desired operation (for example, centrifugation, You may utilize the culture medium processed by membrane separation etc. as a citrulline containing composition.

The fermentation time of the present invention may be appropriately selected from the conditions under which a microorganism having citrulline producing ability can be fermented, and is not particularly limited, but is preferably 2 to 24 hours, more preferably 3 to 16 hours, still more preferably 4 to 4 hours. 12 hours.

The raw material of the present invention may be appropriately selected from those that can be fermented by microorganisms capable of producing citrulline, and is not particularly limited. For example, skim milk, skim concentrated milk, reduced skim milk, and their protein degradation products, whey , Whey concentrate, reduced whey, and their protein degradation products, raw milk, whole fat milk (sterilized milk), whole fat concentrated milk, reduced whole fat milk, etc., preferably skim milk, reduced skim milk , And these protein degradation products, whey, reduced whey, and these protein degradation products.

According to a preferred embodiment of the present invention, when raw milk is used as a raw material, a milk raw material or a dairy product can be obtained as a citrulline-containing composition. A function derived from citrulline is added to the obtained milk raw material or dairy product (citrulline-containing composition), and its nutritional value is enhanced. Furthermore, in the dairy material or dairy product of the present invention, citrulline is not added (mixed) from the outside, but the citrulline content can be increased in the production process. The manufacturing cost of the final product can be kept low.

According to another preferred embodiment of the present invention, fermented milk (more preferably yogurt) is obtained as a citrulline-containing composition by using fermented milk mix (more preferably yogurt mix) as a raw material. A function derived from citrulline is added to the obtained fermented milk (more preferably yogurt), and its nutritional value is enhanced. Furthermore, in the fermented milk (more preferably yogurt) of the present invention, citrulline content can be increased in the production process instead of adding (blending) citrulline from the outside. Can reduce the manufacturing cost of the final product based on yogurt).

In the method for producing a citrulline-containing composition of the present invention, citrulline is produced in the raw material. At this time, the raw material containing citrulline may be used as it is as a raw material or raw material for food or drink, preferably as a raw material or raw material for dairy products, or citrulline is separated (isolated, etc.) from this raw material. Alternatively, citrulline having a desired purity may be prepared and used after processing by treatment such as or concentration. At this time, functional foods, nutritional foods, etc. are mentioned as food and drink, and dairy products include, for example, milk drinks, fermented milk (more preferably yogurt), lactic acid bacteria drinks, cheese, ice cream and the like. .

Citrulline-containing food and drink, as described above, a medium containing citrulline obtained by the method for preparing citrulline of the present invention, or a raw material containing citrulline obtained by the method for producing a citrulline-containing composition according to the present invention, or a processed product thereof, By selecting and using any suitable medium and raw material for food and drink, each can be used as the food and drink itself or the raw material or material of the food or drink. Therefore, according to the present invention, there is provided a citrulline-containing food or drink using the citrulline-containing medium of the present invention, or a raw material containing citrulline, or a processed product thereof as the food or drink itself or the raw material or material of the food or drink. be able to.

In addition, citrulline or a citrulline-containing composition obtained by the above-described method for preparing citrulline or a method for producing a citrulline-containing composition of the present invention, or a processed product thereof, a food or drink (preferably a dairy product, more preferably, Added to (fermented milk), the function derived from citrulline can be added to the food or drink. Therefore, according to this invention, the citrulline or citrulline containing composition of this invention, or these processed goods can be added to food-drinks, and a citrulline containing food-drinks can be provided.

According to the method for preparing citrulline or the method for producing a citrulline-containing composition of the present invention, the citrulline or citrulline-containing composition, or a processed product thereof can be efficiently kept at low preparation costs (processing costs), production costs, etc. Can be provided. Therefore, by using the citrulline or citrulline-containing composition of the present invention, it is possible to increase the citrulline content in the production process of citrulline-containing foods and drinks while increasing the commercial value by adding functions derived from citrulline. For the reason of being able to do so, the manufacturing cost etc. can be suppressed low and it can provide efficiently.

The citrulline-containing food or drink of the present invention is not particularly limited as long as it allows the inclusion of citrulline, and examples thereof include milk drinks, fermented milk (more preferably yogurt), lactic acid bacteria drinks, cheese, ice cream and the like. Dairy products.

Preparation method of culture solution containing microorganisms capable of producing citrulline with increased conversion efficiency from arginine to citrulline Preparation of culture solution containing microorganisms capable of producing citrulline with improved conversion efficiency from arginine to citrulline of the present invention The method is characterized in that the microorganism is cultured in a medium to which arginine is added at a culture temperature higher than usual (the optimum temperature for fermentation of the microorganism). The culture temperature is specifically 40 ° C. or higher and 48 ° C. or lower, preferably 42 ° C. or higher and 47 ° C. or lower, more preferably 44 ° C. or higher and 46 ° C. or lower. According to another aspect of the present invention, the culture temperature is 40 ° C. or higher and 70 ° C. or lower, a preferred upper limit is 68 ° C., a more preferred upper limit is 65 ° C., a preferred lower limit is 42 ° C., and a more preferred lower limit is 43. ° C.

According to a preferred embodiment of the present invention, the microorganism having the ability to produce citrulline of the present invention is cultured at a temperature of 40 ° C. to 48 ° C., preferably 42 ° C. to 47 ° C., more preferably 44 ° C. to 46 ° C. A method for improving citrulline production ability of the microorganism is provided. According to another aspect of the present invention, the culturing is performed at 40 ° C. or higher and 70 ° C. or lower, a preferable upper limit temperature of the culture is 68 ° C., a more preferable upper limit is 65 ° C., and a preferable lower limit temperature is 42 ° C., more preferable. The lower limit is 43 ° C. At this time, the microorganism having the citrulline producing ability of the present invention was obtained by appropriately treating the culture or composition obtained by the method for preparing citrulline of the present invention or the method for producing a citrulline-containing composition, A microorganism having enhanced conversion efficiency from arginine to citrulline can be used.

As described above, the medium of a preferred embodiment of the present invention is a medium to which arginine is added. Citrulline can be efficiently produced by culturing microorganisms with such a medium composition (formulation). The reason for this can be considered as follows. However, the following explanation (theory) is merely an assumption, and the present invention is not limited by this theory. That is, as described in the prior art, for example, in Non-Patent Documents 1 and 2 above, regarding the metabolic activity of arginine in L. lactis, when arginine is added to the medium, the amount of transcription of genes encoding ADI and OCT is increased. It is reported to increase. According to this finding, the addition of arginine to the medium is expected to increase the transcription amount of the gene encoding ADI. When the culture temperature is 40 ° C. or higher and 70 ° C., and in some cases 48 ° C. or lower, the culture temperature is high. In addition, it is considered that this phenomenon is maintained. In addition, when arginine is added to the medium, the transcription amount of the gene encoding ADI increases, or even when the culture temperature is high, such as 40 ° C. or higher and 70 ° C. or lower, and in some cases 48 ° C. or lower, It is difficult to predict immediately that this phenomenon is maintained or that the transcription amount of the gene encoding OCT is suppressed. Therefore, it is not appropriate to judge that the present invention is obvious from Non-Patent Documents 1 and 2.

According to a preferred aspect of the present invention, when culturing a microorganism having citrulline-producing ability, arginine is added to the medium before culturing and / or arginine is intermittently added to the medium during the culture. Alternatively, arginine is continuously added to the medium during the culture. Thereby, the citrulline producing ability of the microorganisms having citrulline producing ability can be enhanced. In this case, it is preferable that the microorganism having citrulline-producing ability has a long time for contacting with a sufficient concentration of arginine. Therefore, when culturing a microorganism capable of producing citrulline, it is preferable to add (formulate) arginine to the medium before culturing, and add arginine to the medium before culturing, and intermittently or More preferably, arginine is continuously added (added) to the medium, and more preferably, arginine is continuously added to the medium during the culture.

The addition amount of arginine of the present invention is not particularly limited as long as it is appropriately selected from citrulline or a composition containing citrulline, or conditions under which these processed products can be prepared and manufactured. To 5% by mass, more preferably 0.7 to 4% by mass, and still more preferably 1 to 3% by mass.

The method for adding arginine of the present invention is not particularly limited as long as arginine can be added (mixed) aseptically to the medium, and after adding arginine to the medium, the medium is subjected to heat sterilization or filter sterilization. Alternatively, an arginine aqueous solution may be separately prepared, and the arginine aqueous solution may be added to the medium after heat sterilization or filter sterilization.

According to a preferred embodiment of the present invention, when culturing a microorganism having citrulline producing ability, a medium having a pH in the range of 5 or more and 7 or less is used, and preferably in a range of pH of 5 or more and 6.5 or less. A certain medium is used, more preferably a medium having a pH in the range of 5 or more and 6 or less, and further preferably a medium having a pH in the range of 5.5 or more and 6 or less. Thereby, the density | concentration (microbe density | concentration) of the microorganisms which have a citrulline production ability can be raised, and a citrulline production ability can be raised. At this time, it is preferable to adjust the pH of the medium by adding an alkali, and it is more preferable to use arginine or an alkali metal hydroxide as the alkali.

In one embodiment of the present invention, “cultured in a medium having a pH in the range of 5 to 7” preferably means that the pH of the medium is in the range of 5 to 7 from the beginning to the end of the culture. However, this does not necessarily mean that the pH of the medium is always in the range of 5 or more and 7 or less from the beginning to the end of the culture. That is, in the state where the pH of the medium is in the range of 5 or more and 7 or less, the culture may be performed for a sufficient time to increase the conversion efficiency from arginine to citrulline, specifically 1 to 60 hours, preferably 2 to The culture may be performed for 48 hours, more preferably 3 to 36 hours, and still more preferably 4 to 24 hours.

The method for adding an alkali of the present invention is not particularly limited as long as it is appropriately selected from conditions under which the pH of the medium can be controlled or managed within a predetermined range. For example, it is preferable to control or manage the pH of the medium intermittently or continuously within a predetermined range while observing the pH of the medium intermittently or continuously using a pH meter and a computer. It is more preferable to continuously control and manage the pH of the medium within a predetermined range while observing continuously.

According to a preferred embodiment of the present invention, before culturing a microorganism having citrulline-producing ability, the microorganism may be activated and cultured. The culture conditions for the activation culture may be appropriately selected according to the type of microorganism having citrulline production ability, and are not particularly limited.

According to one aspect of the present invention, the microorganism cells are subjected to a treatment such as centrifugation or membrane separation from a culture solution containing microorganisms capable of producing citrulline with increased conversion efficiency from arginine to citrulline. Then, the cells may be used in the method for preparing citrulline or the method for producing a citrulline-containing composition of the present invention.

Method for producing a composition containing a microorganism capable of producing citrulline with enhanced conversion efficiency from arginine to citrulline Production of a composition comprising a microorganism capable of producing citrulline with enhanced efficiency of conversion of arginine into citrulline according to the present invention The method is characterized in that the microorganism is fermented with a raw material to which arginine is added at a culture temperature higher than usual (the optimum temperature for fermentation of the microorganism). The culture temperature is specifically 40 ° C. or higher and 48 ° C. or lower, preferably 42 ° C. or higher and 47 ° C. or lower, more preferably 44 ° C. or higher and 46 ° C. or lower. According to another aspect of the present invention, the culture temperature is 40 ° C. or higher and 70 ° C. or lower, a preferred upper limit is 68 ° C., a more preferred upper limit is 65 ° C., a preferred lower limit is 42 ° C., and a more preferred lower limit is 43. ° C.

According to a preferred embodiment of the present invention, the microorganism having citrulline producing ability of the present invention is fermented at a temperature of 40 ° C. or higher and 48 ° C. or lower, preferably 42 ° C. or higher and 47 ° C. or lower, more preferably 44 ° C. or higher and 46 ° C. or lower. A method for improving citrulline production ability of the microorganism is provided. Moreover, according to another aspect of the present invention, the fermentation temperature is 40 ° C. or higher and 70 ° C. or lower, a preferred upper limit is 68 ° C., a more preferred upper limit is 65 ° C., a preferred lower limit is 42 ° C., and a more preferred lower limit is 43. ° C. At this time, the microorganism having the citrulline production ability of the present invention is provided with arginine obtained by appropriately treating the culture or composition obtained by the method for preparing citrulline of the present invention or the method for producing a citrulline-containing composition. It is possible to use microorganisms that have improved the conversion efficiency from citrus to citrulline.

As described above, the raw material according to a preferred embodiment of the present invention is a raw material to which arginine is added. Citrulline can be efficiently produced by fermenting microorganisms with the composition (formulation) of such raw materials. The reason for this is considered to be the same as the reason explained in the method for preparing a culture solution containing a microorganism having the ability to produce citrulline with improved conversion efficiency from arginine to citrulline of the present invention.

In the method for preparing a culture solution containing a microorganism capable of producing citrulline with improved conversion efficiency from arginine to citrulline according to the present invention, the medium is directly used as a citrulline-containing composition without isolating citrulline from the citrulline-containing medium. The medium treated by a desired operation (for example, centrifugation, membrane separation, etc.) may be used as the citrulline-containing composition.

The addition amount of arginine of the present invention is not particularly limited as long as it is appropriately selected from citrulline or a composition containing citrulline, or conditions under which these processed products can be prepared and manufactured, but is preferably 0.5 to the raw material. To 5% by mass, more preferably 0.7 to 4% by mass, and still more preferably 1 to 3% by mass.

The method for adding arginine of the present invention is not particularly limited as long as arginine can be aseptically added (blended) to the medium, and after adding arginine to the raw material, the raw material is subjected to heat sterilization or filter sterilization. Alternatively, an arginine aqueous solution may be separately prepared, and the arginine aqueous solution may be added to the raw material after heat sterilization or filter sterilization.

According to a preferred aspect of the present invention, when culturing a microorganism having citrulline-producing ability, arginine is added to the medium before culturing and / or arginine is intermittently added to the medium during the culture. Alternatively, arginine is continuously added to the medium during the culture. Thereby, the citrulline producing ability of the microorganisms having citrulline producing ability can be enhanced. At this time, it is preferable for the microorganism having citrulline producing ability to have a long time for contacting with a sufficient concentration of arginine. Therefore, it is preferable to add (formulate) arginine to the medium or raw material before culturing, and add arginine to the medium before culturing and intermittently (for example, a predetermined amount in a lump) during the culturing or It is more preferable to add (add) arginine to the medium continuously (for example, gradually little by little), and it is more preferable to add arginine to the medium continuously during the culture. Thereby, when cultivating a microorganism having citrulline-producing ability, the conversion efficiency from arginine to citrulline can be increased.

According to a preferred embodiment of the present invention, the microorganism may be activated and cultured before fermentation using a microorganism having citrulline-producing ability. The culture conditions for the activation culture may be appropriately selected according to the type of microorganism having citrulline production ability, and are not particularly limited.

According to one aspect of the present invention, the composition of a microorganism containing citrulline-producing ability with enhanced conversion efficiency from arginine to citrulline is centrifuged, membrane-separated, etc. You may use the microbial cell for the preparation method of the citrulline of invention, or the manufacturing method of a citrulline containing composition.

Method for preparing culture solution containing microorganisms having citrulline production ability with increased microorganism concentration (bacterial cell concentration) Culture solution containing microorganisms having citrulline production ability with increased microorganism concentration (bacterial cell concentration) of the present invention The preparation method is characterized in that the microorganism is cultured in a medium having a pH in the range of 5 or more and 7 or less at a normal culture temperature (optimum temperature for fermentation of the microorganism). At a culture temperature of 48 ° C. or lower, preferably 38 ° C. or higher and 48 ° C. or lower, more preferably 40 ° C. or higher and 48 ° C. or lower, more preferably 42 ° C. or higher and 47 ° C. or lower, particularly preferably 44 ° C. or higher and 46 ° C. or lower. In the range of 7 or less, preferably in the range of 5 to 6.5, more preferably in the range of 5 to 6 and even more preferably in the range of 5.5 to 6. Characterized by culturing in a medium supplemented with arginine. That is, here, the microorganism may be cultured at a temperature suitable for culturing a microorganism capable of producing citrulline (for example, an optimum temperature). According to another aspect of the present invention, the microorganism is cultured at a culture temperature of 35 ° C. or higher and 70 ° C. or lower (here, the lower limit is preferably 38 ° C., more preferably 40 ° C., still more preferably 42 ° C., particularly preferably 44 ° C.). And the upper limit is preferably 68 ° C., more preferably 65 ° C.), the pH is in the range of 5 to 7, preferably the pH is in the range of 5 to 6.5, more preferably the pH is 5 or more. It is characterized by culturing in a medium to which arginine is added, which is in the range of 6 or less, more preferably in the range of pH 5.5 or more and 6 or less.

According to a preferred embodiment of the present invention, the microorganism having citrulline producing ability of the present invention is 35 ° C. or higher and 48 ° C. or lower, preferably 38 ° C. or higher and 48 ° C. or lower, more preferably 40 ° C. or higher and 48 ° C. or lower, and still more preferably. There is provided a method for improving the concentration of the microorganism (bacterial cell concentration), which is cultured at a temperature of 42 ° C. or higher and 47 ° C. or lower, particularly preferably 44 ° C. or higher and 46 ° C. or lower. According to another aspect of the present invention, the microorganism is cultured at a culture temperature of 35 ° C. or higher and 70 ° C. or lower (here, the lower limit is preferably 38 ° C., more preferably 40 ° C., still more preferably 42 ° C., particularly preferably 44 ° C.). And the upper limit is preferably 68 ° C., more preferably 65 ° C.), and a method for improving the concentration of the microorganism (cell concentration) is provided. At this time, the microorganism having the citrulline production ability of the present invention is provided with arginine obtained by appropriately treating the culture or composition obtained by the method for preparing citrulline of the present invention or the method for producing a citrulline-containing composition. It is possible to use microorganisms that have improved the conversion efficiency from citrus to citrulline.

According to a preferred embodiment of the present invention, when culturing a microorganism having citrulline producing ability, a medium having a pH in the range of 5 or more and 7 or less is used, and preferably in a range of pH of 5 or more and 6.5 or less. A concentration of the microorganism (bacteria) using a certain medium, more preferably using a medium having a pH in the range of 5 to 6, more preferably using a medium having a pH in the range of 5.5 to 6 A method for improving body concentration is provided. Thereby, the density | concentration (microbe density | concentration) of the microorganisms which have a citrulline production ability can be raised, and a citrulline production ability can be raised. At this time, it is preferable to adjust the pH of the medium by adding an alkali, and it is more preferable to use arginine or an alkali metal hydroxide as the alkali.

In one embodiment of the present invention, “cultured in a medium having a pH in the range of 5 to 7” preferably means that the pH of the medium is in the range of 5 to 7 from the beginning to the end of the culture. However, this does not necessarily mean that the pH of the medium is always in the range of 5 or more and 7 or less from the beginning to the end of the culture. That is, in the state where the pH of the medium is in the range of 5 or more and 7 or less, it may be cultured for a sufficient time to increase the bacterial cell concentration, specifically 1 to 60 hours, preferably 2 to 48 hours. The culture is preferably performed for 3 to 36 hours, more preferably 4 to 24 hours.

The method for adding alkali is not particularly limited as long as it is appropriately selected from the conditions under which the pH of the medium can be controlled or managed within a predetermined range. For example, it is preferable to control or manage the pH of the medium within a predetermined range while observing the pH of the medium intermittently or continuously using a pH meter and a computer or the like. However, it is more preferable to control or manage the pH of the medium within a predetermined range.

According to one aspect of the present invention, the microorganism body is subjected to a treatment such as centrifugation or membrane separation from a culture solution containing a microorganism having a citrulline-producing ability and having an increased cell concentration, and then the present invention. You may use the microbial cell for the preparation method of the citrulline of invention, or the manufacturing method of a citrulline containing composition.

In one embodiment of the present invention, when arginine is used as an alkali, the arginine is added to the medium by the method for preparing citrulline of the present invention, the method for preparing a culture solution containing a microorganism having the ability to produce citrulline of the present invention, or the like. And in common. Therefore, when arginine is excessively added to the medium by the above preparation method or the like, the pH of the medium may change to the alkali side, and the pH of the medium may greatly deviate from the range of 5 to 7. . When arginine is added excessively to the medium in this way, citrulline production ability can be increased somewhat, so it is acceptable only for the purpose of enhancing citrulline production ability, but the cell concentration is sufficiently increased. It may not be possible. Therefore, in such a case, although the citrulline production amount (relative amount of citrulline) per microorganism (cells) capable of producing citrulline can be increased, the production of citrulline per culture solution (medium) containing the microorganisms Note that the amount (absolute amount of citrulline) may not be sufficiently increased.

Method for preparing a culture solution containing microorganisms having citrulline-producing ability with increased conversion efficiency from arginine to citrulline and increased microorganism concentration (bacterial cell concentration) Increased conversion efficiency from arginine to citrulline of the present invention, and A method for preparing a culture solution containing a microorganism having a citrulline-producing ability and having an increased microorganism concentration (cell concentration) has a pH of 5 at a culture temperature higher than normal (optimum temperature for fermentation of microorganisms). The microorganism is cultured in a medium in the range of 7 or less, and the microorganism is cultured at a culture temperature of 40 to 48 ° C., preferably 42 to 47 ° C., more preferably 44 to 46 ° C. The pH is in the range of 5 to 7, preferably the pH is in the range of 5 to 6.5, more preferably the pH is in the range of 5 to 6, more preferably the pH is In the range of .5 to 6, characterized by culturing in a medium supplemented with arginine. Moreover, according to another aspect of the present invention, the preparation method according to the present invention is a method in which the microorganism is in a temperature range of 40 ° C. or higher and 70 ° C. or lower (here, the preferable upper limit is 68 ° C., the more preferable upper limit is 65 ° C., The preferred lower limit is 42 ° C., and the more preferred lower limit is 43 ° C.), the pH is in the range of 5 to 7, preferably the pH is in the range of 5 to 6.5, more preferably the pH is in the range of 5 to 6. More preferably, the culture is performed in a medium supplemented with arginine having a pH in the range of 5.5 to 6.

That is, the preparation conditions of the culture solution containing the microorganisms having citrulline-producing ability with improved conversion efficiency from arginine to citrulline of the present invention, and the citrulline-producing ability with increased microorganism concentration of the present invention (cell concentration) Preparation of a culture solution containing microorganisms capable of producing citrulline with increased conversion efficiency from arginine to citrulline and increased microorganism concentration (bacterial cell concentration) by combining the preparation conditions of the culture solution containing microorganisms It will be possible.

In one embodiment of the present invention, the method for adding arginine to a medium (culture solution) and the method for adjusting (controlling) the pH of the medium (culture solution) increase the conversion efficiency from arginine to citrulline and increase the concentration of microorganisms. As long as the (bacterial cell concentration) can be increased, the above method can be applied.

According to a preferred aspect of the present invention, when culturing a microorganism having citrulline-producing ability, arginine is added to the medium before culturing and / or arginine is intermittently added to the medium during the culture. Alternatively, arginine is continuously added to the medium during the culture. Thereby, the citrulline producing ability of the microorganisms having citrulline producing ability can be enhanced. At this time, it is preferable for the microorganism having citrulline producing ability that the pH of the medium is neutral at the start of the culture. Therefore, it is preferable not to add (formulate) arginine to the medium before culturing, and intermittently (for example, a predetermined amount in a lump) or during the culturing without adding arginine to the medium before culturing. It is more preferable to add (add) arginine to the medium (for example, gradually in small amounts), and it is more preferable to add arginine to the medium continuously during the culture. Thereby, when culturing or fermenting a microorganism having citrulline-producing ability, the conversion efficiency from arginine to citrulline can be increased, and the concentration of the microorganism (cell density) can be increased.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not limited to these examples.

In the examples of the present invention, the bacterial cell concentration was measured by the method for measuring the number of lactic acid bacteria described in "Ministerial Ordinance on Milk and Dairy Product Component Standards (Ministerial Ordinance on Milk) (Japan)". However, the culture temperature of the BCP medium was 30 ° C. Arginine concentration, citrulline concentration and ornithine concentration were measured by HPLC method.

Example 1 : Arginine metabolic capacity of lactic acid bacteria and bifidobacteria Arginine metabolic capacity was examined for lactic acid bacteria and bifidobacteria described in Table 1 below. First, the MRS medium or GAM medium was sterilized at 121 ° C. for 15 minutes. Thereafter, the aqueous arginine solution was sterilized by filtration and then added to these media to adjust the arginine concentration to 27 mM. These prepared media were inoculated with 1% by weight of an activating culture solution of lactic acid bacteria and bifidobacteria MRS medium shown in Table 1 below. In Lactococcus, the culture temperature is 30 ° C. and the culture time is 16 hours, and the aerobic culture is performed in a stationary state. In other cells, the culture temperature is 37 ° C. and the culture time is 16 hours, and the culture is preferably performed in a stationary state. Air-cultured.

The results were as shown in Table 1 below. In Lactobacillus fermentum JCM1173T, Lactobacillus buchneri NCIMB8007T, Lactococcus lactis ssp. Lactis JCM5805T, and IFO12007, the ability to metabolize arginine was confirmed.

Example 2: Lactococcus lactis ssp.lactis and Lactococcus lactis ssp.diacetylactis result of metabolic capacity Example 1 of arginine, in Lactococcus lactis ssp.lactis, both 2 strain of 2 strains, metabolic capacity of arginine was confirmed . However, in these two strains, after all of arginine was converted to citrulline, most of the citrulline was converted to ornithine.

Accordingly, next, described in Table 2 below, and 29 strains of Lactococcus lactis ssp.lactis, the Lactococcus lactis ssp. 1 strain of Lactococcus lactis ssp.diacetylactis a related species of the lactis, citrulline to ornithine conversion We searched for strains that did not. In Table 2, NO.1 to NO.29 are Lactococcus lactis ssp.lactis , and NO.30 is Lactococcus lactis ssp.diacetylactis .

First, the MRS medium was sterilized at 121 ° C. for 15 minutes. Thereafter, the aqueous arginine solution was sterilized by filtration and then added to these media to adjust the arginine concentration to 27 mM. These prepared media were inoculated with 1% by weight of an activated culture solution of MRS medium of the strains shown in Table 2 below. These strains were aerobically cultured in a stationary state at a culture temperature of 30 ° C. and a culture time of 16 hours.

The results were as shown in Table 2 below. In all 29 strains of Lactococcus lactis ssp. Lactis, the ability to metabolize arginine was confirmed. However, most of the arginine was converted to ornithine, and the production ratio of citrulline to ornithine (“Cit / Orn”) was as low as 0.02 to 0.13. Moreover, in one strain of Lactococcus lactis ssp. Diacetylactis, the ability to metabolize arginine was not confirmed.

Example 3 : Effect of culture temperature (37 ° C, 40 ° C) on the metabolism of arginine in Lactococcus lactis ssp. Lactis The cells were cultured in the same manner as in Example 2 except that the culture temperature was 37 ° C or 40 ° C. Then, the metabolic capacity of arginine was examined. The results were as shown in Table 3 below. Here, strains having relatively high Cit / Orn were searched and 6 strains were selected.

Example 4 : Verification of arginine metabolic capacity of Lactococcus lactis ssp. Lactis in reduced skim milk (1)
From the results of Example 3, strains having relatively high Cit / Orn were searched, and 5 strains were selected and used. That is, the metabolic ability of arginine was examined for 5 strains described in Table 4 below. At this time, reduced skim milk (concentration of skim milk powder: 10% by weight) to which arginine was added at 1% by weight (hereinafter referred to as “1% Arg + 10% reduced skim milk”) was used as a medium.

20 mL of the activated culture solution of MRS medium of 5 strains described in Table 4 below was centrifuged (8000 rpm, 10 minutes), and the cells of these 5 strains were recovered. Thereafter, 40 mL of “1% Arg + 10% reduced skim milk” was sterilized at 95 ° C. for 3 minutes, and the cells of the 5 strains collected as described above were inoculated. In addition, when adding arginine to reduced skim milk, first, an aqueous solution of arginine was prepared, pH was adjusted with hydrochloric acid, and then mixed with reduced skim milk. In these 5 strains, the culture temperature was 40 ° C. and 43 ° C., and the culture time was 4 hours and 8 hours.

This result was as shown in Table 4 below. Here, strains with relatively high Cit / Orn were searched, and culture temperatures and culture times with relatively high Cit / Orn were searched. In these strains as a whole, it was confirmed that the higher the culture temperature and the longer the culture time, the higher the Cit / Orn.

Example 5 : Verification of the ability of Lactococcus lactis ssp. Lactis to metabolize arginine in reduced skim milk (2)
Bacterial cells were cultured in the same manner as in Example 4 except that the culture temperature was 44.5 ° C., 46 ° C., and further from 50 ° C. to 70 ° C. in increments of 5 degrees, and the metabolic capacity of arginine was examined. The results were as shown in Table 5 below. In addition, from the result of Example 4, a strain having a relatively high Cit / Orn was searched, and three strains were selected and used.

Example 6: Use the Lactococcus lactis ssp.lactis OLS3797 strain or manufacture of yogurt containing citrulline using OLS3818 strain Lactococcus lactis ssp.lactis OLS3797 strain or OLS3818 strain to produce a fermented milk containing citrulline (yogurt). That is, raw material milk (yogurt base) described in Table 6 below was prepared and sterilized at 95 ° C. for 3 minutes. Then, as a yogurt starter, 2% by weight of a mixed starter of Lactobacillus bulgaricus and Streptococcus thermophilus is added to this raw milk, and Lactococcus lactis ssp. Lactis OLS3797 strain or OLS3818 strain is added, fermented at 45 ° C, and yogurt Manufactured. Here, as the Lactococcus lactis ssp. Lactis OLS3797 strain and OLS3818 strain, the culture solution of the MRS medium was centrifuged (8000 rpm, 10 minutes), and only the cells were collected and used. At this time, the amount of MRS medium used was the same weight as the amount of raw milk described in Table 6 below.

When Lactococcus lactis ssp. Lactis OLS3797 strain was used, the acidity reached 0.80% in 5 hours and 30 minutes. In addition, when Lactococcus lactis ssp. Lactis OLS3818 was used, the acidity reached 0.83% in 4 hours and 30 minutes. When these two strains were used, it was confirmed that the fermentation proceeded smoothly. Moreover, the flavor and physical properties of these fermented milk (yogurt) were not significantly different from those of normal products and conventional products.

The concentrations of arginine, citrulline and ornithine in these fermented milk (yogurt) were measured. The results were as shown in Table 7 below. It was confirmed that most of arginine was metabolized and most of it was converted to citrulline. That is, it was revealed that fermented milk (yogurt) containing citrulline at a high concentration can be produced using Lactococcus lactis ssp. Lactis OLS3797 strain or OLS3818 strain.

Example 7 : Examination of preparation method of culture solution of strain having high conversion efficiency from arginine to citrulline ( Lactococcus lactis ssp. Lactis OLS3797) (1)
A method for preparing a culture solution having high conversion efficiency (activity) from arginine to citrulline was examined. In the above examples, L. lactis was statically cultured in MRS medium to prepare a culture solution. As a result, it was observed that when L. lactis was statically cultured, the growth of L. lactis stopped and the bacterial cell concentration did not increase as the pH of the culture solution decreased. Therefore, by adding alkali to the culture solution, suppressing the decrease in the pH of the culture solution, and controlling the pH, L. lactis is stirred and cultured in the MRS medium (pH-controlled culture) to achieve the cell concentration. The effect of was examined. That is, the possibility of increasing the conversion efficiency from arginine to citrulline per unit volume in the culture solution of L. lactis by controlling the pH of L. lactis in MRS medium was examined. The MRS medium was sterilized at 121 ° C. for 15 minutes.

Aqueous sodium hydroxide (NaOH: 10% by weight) was added to the culture solution, and the L. lactis OLS3797 strain was stirred and cultured (pH controlled culture) while controlling the pH of the culture solution to 5.5. Measured over time. Specifically, the MRS medium activation culture solution (culture temperature: 30 ° C., culture time: 16 hours) of L. lactis OLS3797 strain was inoculated at 1% by weight into the MRS medium and stirred culture (culture temperature: 30 ° C.). , Stirring speed: 200 rpm). The change with time of the bacterial cell concentration was as shown in FIG.

Culture media for pH-controlled culture at 10, 11, and 12 hours after the start of culture were collected, and these culture media were stored in ice water by cooling. Then, this culture broth is inoculated at 5% by weight into “1% Arg + 10% reduced skim milk” and statically cultured (culture temperature: 44.5 ° C., culture time: 8 hours), from arginine to citrulline. The conversion efficiency was examined. At this time, as a comparative control, the above culture broth was inoculated into MRS medium at 5% by weight and subjected to static culture (culture temperature: 30 ° C., culture time: 16 hours), and the conversion efficiency from arginine to citrulline was examined. . The results were as shown in FIG. 2 and Table 8 below.

As described above, it is confirmed that the conversion efficiency from arginine to citrulline per unit volume in the culture solution of L. lactis is higher in the case of pH controlled culture in MRS medium than in the case of stationary culture in MRS medium. It was done. On the other hand, compared to the case of static culture in MRS medium, the difference in conversion efficiency from arginine to citrulline per unit time / unit cell in the culture solution of L. lactis in the case of pH controlled culture in MRS medium. There wasn't. That is, compared with static culture, it was determined that the pH control culture increased the cell concentration, but the conversion efficiency from arginine to citrulline per unit cell did not change. The conversion efficiency from arginine to citrulline per unit time / unit cell is the concentration of citrulline 4 hours and 8 hours after the start of culture, the number of viable bacteria and the culture time (4 hours and 8 hours). Calculated as the value divided by.

Furthermore, the number of bacteria at 4 hours and 8 hours after the start of the culture in “1% Arg + 10% reduced skim milk” was examined in the case of using the culture solution 12 hours after the start of the pH controlled culture. As a result, these numbers are 1 × 10 ⁶ cfu / mL and 1 × 10 ⁴ cfu / mL (cfu: colony forming unit), respectively. It was. Therefore, during the measurement of the conversion efficiency from arginine to citrulline, the possibility that ADI was produced was low, and it was estimated that ADI possessed by the cells themselves was converted from arginine to citrulline. At this time, there is a possibility that the activity of ADI is somewhat decreased with the passage of time from the start of the culture, but there was no great difference in the conversion efficiency after 4 hours and 8 hours from the start of the culture.

Example 8 : Examination of preparation method of culture solution of strain having high conversion efficiency from arginine to citrulline ( Lactococcus lactis ssp. Lactis 3797 strain) (2)
In Example 7, when L. lactis was cultured under pH control, the cell concentration (number of cells) increased, but the conversion efficiency from arginine to citrulline per unit time / unit cell did not change. Therefore, before starting the culture of L. lactis, by stationary culture was added to arginine to MRS medium, possibly the conversion efficiency is increased from arginine per unit volume in the culture of L. lactis to citrulline Was examined. That is, the L. lactis OLS3797 strain was statically cultured in a normal MRS medium and an MRS medium containing 0.5% by weight of arginine, and “1% Arg + 10% reduced skim milk” was used. The conversion efficiency from arginine to citrulline was measured. Here, the MRS medium was sterilized at 121 ° C. for 15 minutes.

Specifically, an activated culture solution of L. lactis 3797 strain (culture temperature 30 ° C., culture time 16 hours) is inoculated into 1% by weight of MRS medium and left to stand (culture temperature: 30 ° C., culture time: 16 hours). Then, 20 mL of this culture solution is centrifuged (8000 rpm, 10 minutes), and only the cells are collected, then inoculated into 40 mL of “1% Arg + 10% reduced skim milk” and stirred culture (culture temperature) : 44.5 ° C., culture time: 4 hours), and the conversion efficiency from arginine to citrulline was examined. The results were as shown in Table 9 below.

On the other hand, the activated culture solution was inoculated at 1% by weight into MRS medium containing 0.5% by weight of arginine and allowed to stand (culture temperature: 30 ° C., culture time: 16 hours). Then, 20 mL of this culture solution is centrifuged (8000 rpm, 10 minutes), and only the cells are collected, then inoculated into 40 mL of “1% Arg + 10% reduced skim milk” and stirred culture (culture temperature) : 44.5 ° C., culture time: 4 hours), and the conversion efficiency from arginine to citrulline was examined. The results were as shown in Table 9 below.

As described above, in the case of static culture in an MRS medium containing arginine, compared to the case of static culture in a normal (conventional) MRS medium, the unit time per unit cell in the culture solution of L. lactis It was confirmed that the conversion efficiency from arginine to citrulline increased more than twice.

Example 9 : Examination of preparation method of culture solution of strain having high conversion efficiency from arginine to citrulline ( Lactococcus lactis ssp. Lactis OLS3797) (3)
In Example 8, when arginine was added to the medium, the conversion efficiency of L. lactis from arginine to citrulline increased. Therefore, by adding arginine to the MRS medium before starting the cultivation of L. lactis and then carrying out pH-controlled cultivation, the conversion efficiency of arginine to citrulline per unit volume in the culture solution of L. lactis can be increased. The sex was examined. That is, L. lactis OLS3797 strain was subjected to pH control culture in MRS medium containing 0.5% by weight of arginine, and the culture solution was used to convert arginine to citrulline in “1% Arg + 10% reduced skim milk”. The conversion efficiency of was measured. Here, the MRS medium was sterilized at 121 ° C. for 15 minutes. Thereafter, the aqueous arginine solution was sterilized by filtration and then added to this medium to adjust the arginine concentration to 0.5% by weight.

Sodium hydroxide aqueous solution (NaOH: 10% by weight) was added to the culture solution, and the L. lactis OLS3797 strain was stirred and cultured (pH controlled culture) while controlling the pH of the culture solution to 5.5. Was measured over time. Specifically, the MRS medium activation culture solution (culture temperature: 30 ° C., culture time: 16 hours) of L. lactis OLS3797 strain was inoculated at 1% by weight into MRS medium containing 0.5% by weight of arginine. After that, NaOH was added, and stirring culture (culture temperature: 30 ° C., stirring speed: 200 rpm) was performed while controlling the pH of the culture solution to 5.5. The changes over time in the bacterial cell concentration, pH, arginine concentration, citrulline concentration, and ornithine concentration were as shown in FIG.

As described above, when arginine was added to the medium before starting the cultivation of L. lactis, the pH of the medium at the start of the cultivation increased to 8.3. And, it seems that the growth of the strain was delayed by the increase in pH of the medium at the start of the culture (initial stage of the culture). However, in the later stage (second half) of culture, lactic acid bacteria (bacteria) grew smoothly, and consumption of arginine started 10 hours after the start of culture, and the arginine concentration became 0 after 13 hours. In this culture, the highest cell concentration reached 2.7 × 10 ⁹ cfu / mL, and compared to Example 7, the cell concentration was reduced to half (1/2) or less.

The culture broths after 8, 9, 10, 11, 12, and 13 hours from the start of the culture were collected, and these culture broths were cooled and stored in ice water. Then, this culture broth is inoculated at 5% by weight into “1% Arg + 10% reduced skim milk” and statically cultured (culture temperature: 44.5 ° C., culture time: 8 hours), from arginine to citrulline. The conversion efficiency was examined. The results were as shown in Table 10 below.

As described above, consumption of arginine increased rapidly after 11 hours from the start of culture. It was confirmed that the conversion efficiency from arginine to citrulline is increased by using a culture medium that consumes these arginines quickly.

Example 10 : Examination of a method for preparing a culture solution of a strain having a high conversion efficiency from arginine to citrulline ( Lactococcus lactis ssp. Lactis OLS3797 strain) (4)
In Example 9, when arginine was added to the medium before starting the culture of lactic acid bacteria (bacteria), the conversion efficiency from arginine to citrulline was greatly increased, but reached the highest level compared to the case where arginine was not added. The bacterial cell concentration decreased. Here, it was considered that when the pH of the culture medium at the start of the culture was high, the highest cell concentration was likely to decrease. Therefore, in the middle of culturing the L. lactis, collectively arginine to the culture medium (culture solution) (intermittently) was added, by pH control culture, per unit volume in the culture fluid of L. lactis The possibility of increasing the conversion efficiency of arginine to citrulline was investigated. Here, the MRS medium was sterilized at 121 ° C. for 15 minutes.

An aqueous sodium hydroxide solution (NaOH: 10% by weight) was added to the culture solution, and the L. lactis OLS3797 strain was stirred and cultured (pH controlled culture) while controlling the pH of the culture solution to 5.5. Etc. were measured over time. At this time, 10 hours after the start of the culture, an arginine aqueous solution (arginine: 10% by weight) was sterilized by filtration and then added to this medium (culture solution) to adjust the arginine concentration to 0.5% by weight. . Specifically, the MRS medium activation culture solution of L. lactis OLS3797 strain (culture temperature: 30 ° C., culture time: 16 hours) was inoculated into the MRS medium at 1% by weight, NaOH was added, and the culture was performed. Stirring culture (culture temperature: 30 ° C., stirring speed: 200 rpm) while controlling the pH of the solution to 5.5, and 10 hours after the start of the culture, the aqueous arginine solution is sterilized by filtration, and then added to this medium. The arginine concentration was adjusted to 0.5% by weight. Changes in the bacterial cell concentration, pH, arginine concentration, citrulline concentration and ornithine concentration over time were as shown in FIG.

The culture solution after 8, 10, 12, 13 hours from the start of the culture was collected, and this culture solution was stored in ice water by cooling. Then, this culture broth is inoculated at 5% by weight into “1% Arg + 10% reduced skim milk” and statically cultured (culture temperature: 44.5 ° C., culture time: 4.5 hours), from arginine to citrulline. The conversion efficiency to was investigated. The results were as shown in Table 11 below.

As described above, the highest cell concentration reached 7.1 × 10 ⁹ cfu / mL, and compared with Example 7, the cell concentration was comparable. On the other hand, compared with Example 9, the conversion efficiency from arginine to citrulline decreased.

Example 11 : Examination of a method for preparing a culture solution of a strain having a high conversion efficiency from arginine to citrulline ( Lactococcus lactis ssp. Lactis OLS3797 strain) (5)
In Example 10, during the cultivation of lactic acid bacteria (cells), arginine was added to the medium (culture solution) all at once (intermittently), and when pH-controlled culture was performed, normal (conventional) pH control was performed. Compared to the case of culturing, the highest cell concentration reached the same level, but before starting the cultivation of lactic acid bacteria (bacteria), arginine is added to citrulline compared to the case where arginine is added to the medium. The conversion efficiency decreased. Therefore, while culturing L. lactis , arginine was added to the medium (culture medium) in small amounts (continuously), and pH-controlled culture was performed, so that per unit volume in the culture medium of L. lactis. The possibility of increasing the conversion efficiency of arginine to citrulline was investigated. Here, the MRS medium was sterilized at 121 ° C. for 15 minutes.

An aqueous arginine solution (arginine: 10% by weight) was added to the culture solution, and the L. lactis OLS3797 strain was stirred and cultured (pH controlled culture) while controlling the pH of the culture solution to 5.5. Measured over time. At this time, 4 hours after the start of the culture, an aqueous arginine solution (arginine: 10% by weight) was sterilized by filtration and then added to this medium (culture solution) to adjust the pH of the medium to 5.5. Specifically, the MRS medium activation culture solution of L. lactis OLS3797 strain (culture temperature: 30 ° C., culture time: 16 hours) was inoculated into the MRS medium at 1% by weight, arginine was added, and the culture was performed. Stirring culture (culture temperature: 30 ° C., stirring speed: 200 rpm) while controlling the pH of the solution to 5.5, and 4 hours after the start of the culture, the arginine aqueous solution was sterilized by filtration and then added to this medium. The pH of the medium was adjusted to 5.5. Changes in the bacterial cell concentration, pH, arginine concentration, citrulline concentration and ornithine concentration over time were as shown in FIG.

The culture solution after 8, 10, 12, 13 hours from the start of the culture was collected, and this culture solution was stored in ice water by cooling. Then, this culture solution is inoculated into “1% に Arg + 10% reduced skim milk” at 5% by weight, and statically cultured (culture temperature: 44.5 ° C., culture time: 4.5 hours), from arginine to citrulline. The conversion efficiency to was investigated. The results were as shown in Table 12 below. Here, in the table, “Culture” is an inoculation of “1% Arg + 10% reduced skim milk” with 5% by weight of the culture solution. “Supernatant” is obtained by inoculating a supernatant obtained by centrifuging a culture solution into “1% に Arg + 10% reduced skim milk” at 5% by weight. In addition, “Cell” was prepared by centrifuging the culture broth, removing the supernatant, freezing the collected cells at −80 ° C., and then thawing them into “1% Arg + 10% reduced skim milk” Inoculated at 5% by weight.

Here, 4 hours after the start of the culture, the addition of arginine (neutralizing agent, substrate) to the medium (culture solution) was started and continued until the end of the culture. At this time, arginine was immediately converted to ornithine for a while after starting the addition of arginine to the medium, but in the latter half of the culture, some of the arginine was not converted to ornithine and was accumulated as it was. .

As described above, the highest cell concentration reached 6.5 × 10 ⁹ cfu / mL, and compared with Example 7 and Example 10, the cell concentration was comparable. And compared with Example 9, the conversion efficiency from arginine to citrulline became comparable. That is, here, the bacterial cell concentration increased and the conversion efficiency from arginine to citrulline increased.

In addition, compared to the case where the culture solution of the bacterial cells was used as it was, the conversion efficiency from arginine to citrulline was also comparable when only the bacterial cells were collected and stored frozen. Then, 4 to 8 hours after the start of the culture, all of the arginine was metabolized and most of the arginine was converted to citrulline.

Then, compared to the case where the culture solution of the bacterial cells is used as it is, when only the bacterial cells are collected and used, the concentration (inoculation amount) added to the medium (culture solution) is from 1/20 Decrease to about 1/50. Here, since the concentration added to the medium is 5% by weight, when only the cells are collected and used, the concentration added to the medium can be estimated to be 0.25 to 0.1% by weight. That is, when arginine is added (as a neutralizing agent) continuously during culture (for example, until the end of the culture) and a culture solution is prepared by pH-controlled culture, only the cells are collected and used. Then, a dairy product containing citrulline at a high concentration can be efficiently produced.

Claims

A method for preparing citrulline, which comprises inoculating a medium with a citrulline-producing microorganism and culturing at a temperature of 40 ° C. or higher and 70 ° C. or lower.
The method for preparing citrulline according to claim 1, wherein the microorganism having citrulline-producing ability is a lactic acid bacterium, a bifidobacteria or a propionic acid bacterium.
The method for preparing citrulline according to claim 2, wherein the lactic acid bacteria is one or more selected from the group consisting of Lactococcus lactis, Lactobacillus fermentum, and Lactobacillus buchneri.
The preparation of citrulline according to claim 2, wherein the lactic acid bacterium is one or more selected from the group consisting of Lactococcus 亜 lactis spp. Lactis OLS3789, OLS3797, and OLS3818. Method.
A method for producing a citrulline-containing composition, wherein a microorganism having citrulline-producing ability is added to a raw material and fermented at a temperature of 40 ° C to 70 ° C.
The method for producing a citrulline-containing composition according to claim 5, wherein the microorganism having citrulline-producing ability is a lactic acid bacterium, a bifidobacteria or a propionic acid bacterium.
The method for producing a citrulline-containing composition according to claim 6, wherein the lactic acid bacteria are one or more selected from the group consisting of Lactococcus lactis, Lactobacillus fermentum, and Lactobacillus buchneri.
The citrulline-containing composition according to claim 6, wherein the lactic acid bacterium is one or more selected from the group consisting of Lactococcus 亜 lactis spp. Lactis 37 OLS3789, OLS3797, and OLS3818. Manufacturing method.
The method for producing a citrulline-containing composition according to any one of claims 5 to 8, wherein the raw material is raw material milk.
The method for producing a citrulline-containing composition according to any one of claims 5 to 9, wherein the citrulline-containing composition is a food or drink.
A method for preparing a culture solution containing a microorganism having a citrulline producing ability and having an enhanced conversion efficiency from arginine to citrulline at a culture temperature of 40 ° C. or higher and 70 ° C. or lower, wherein the microorganism having citrulline producing ability is obtained by A method of preparation, comprising culturing in a medium to which is added.
Add arginine to the medium before culturing and / or
The method for preparing a culture solution according to claim 11, wherein arginine is intermittently added during the culture, or arginine is continuously added during the culture.
A method for preparing a culture solution containing a microorganism having citrulline producing ability and having an increased concentration of the microorganism, wherein the microorganism having citrulline producing ability is cultured in a medium having a pH in the range of 5 to 7. A preparation method characterized by increasing the concentration of the microorganism.
The method for preparing a culture solution according to claim 13, wherein the pH of the medium is adjusted by adding an alkali.
A method for preparing a culture solution having a citrulline-producing ability, comprising a microorganism having an enhanced conversion efficiency from arginine to citrulline at a culture temperature of 35 ° C. or higher and 70 ° C. or lower, and having an increased concentration of the microorganism, A method for preparing a microorganism comprising citrulline-producing ability, wherein arginine is added and the microorganism is cultured in a medium having a pH in the range of 5 to 7, thereby increasing the concentration of the microorganism.
Add arginine to the medium before culturing and / or
The method for preparing a culture solution according to claim 15, wherein arginine is intermittently added during the culture, or arginine is continuously added during the culture.
A microorganism having the ability to produce citrulline with improved conversion efficiency from arginine to citrulline, obtained by centrifuging and / or membrane-separating the culture solution obtained by the method according to any one of claims 11 to 16 Preparation method.
A culture solution obtained by the method for preparing a culture solution according to any one of claims 11 to 16 or a microorganism obtained by the method for preparing a microorganism according to claim 17 is inoculated into a medium and cultured. The method for producing citrulline according to any one of claims 1 to 4, or the method for producing a citrulline-containing composition according to any one of claims 5 to 10, wherein the citrulline preparation method according to any one of claims 1 to 4 is added to the raw material for fermentation.