JP6535285B2 - Method of preparing citrulline - Google Patents

Description

  The present invention relates to a method of preparing citrulline, and more particularly to a method of preparing citrulline using a microorganism such as lactic acid bacteria. The present invention also relates to a method of producing a composition (eg, a dairy product) containing citrulline at a high concentration. Furthermore, the present invention includes a method for preparing a culture solution containing a microorganism having a ability to produce citrulline having an increased conversion efficiency from arginine to citrulline, and a microorganism having a ability to produce citrulline having an increased cell concentration. The present invention relates to a method of preparing a culture solution.

  Citrulline is a functional amino acid, and in Japan, it is approved for use as a food in 2007 after being approved for use as a pharmaceutical. In addition, citrulline has been ingested as a food abroad from before 2007, and has been sold as a supplement, for example, from the functions of blood flow improvement, arteriosclerosis prevention, and energy enhancement. In addition, citrulline has also been reported to have other functions such as cold improvement, skin function improvement, fatigue reduction / restoration, muscle growth, and motor function improvement.

  On the other hand, citrulline is extremely expensive as a food material, and furthermore, the intake required to exert its function is relatively large (for example, several hundred mg). Therefore, when it is intended to blend citrulline in a food or the like in an effective amount, the problem is that the cost is high.

  Citrulline is currently produced mainly by fermentation. For example, in Japanese Patent Application Laid-Open No. 63-068091 (Patent Document 1), a microorganism belonging to the genus Corynebacterium or Brevibacterium is cultured to produce L-citrulline in the culture solution, thereby producing L-citrulline. The law is disclosed. Further, in Japanese Patent Application Laid-Open No. 05-168486 (patent document 2), a lactic acid bacteria belonging to the genus Pediococcus is infected with a bacteriophage and lysed, and L-arginine is caused to act on L-arginine to produce L-citrulline. A method of producing L-citrulline is disclosed. In addition, in Japanese Patent Application Laid-Open No. 08-089269 (Patent Document 3), L-ornithine producing ability-deficient cells dried with a water-soluble organic solvent are brought into contact with L-arginine to produce L-citrulline. -A process for the preparation of citrulline is disclosed. This publication exemplifies bacteria belonging to Bacillus, Pseudomonas, Streptococcus. Moreover, the manufacturing method of L- citrulline by the fermentation method of Vibrio genus bacteria is disclosed by Unexamined-Japanese-Patent No. 2010-088301 (patent document 4).

  However, these conventional techniques still have room for improvement from the viewpoint of production efficiency and production cost of citrulline, and it can be said that there is still a desire for a production efficiency and cost-effective method for preparing citrulline. .

Here, as far as the present inventors know, production of citrulline and ornithine from arginine using Lactococcus lactis ( L. lactis ), which is a kind of lactic acid bacteria, has not been reported, but L. lactis There are several reports that arginine is metabolized (Non-Patent Documents 1, 2 and 3). For example, Non-Patent Documents 1 and 2 describe that L. lactis converted all of arginine to ornithine. In addition, Non-Patent Document 3 describes L. lactis as a known fact that when arginine is metabolized, all arginine is converted to ornithine. And in Unexamined-Japanese-Patent No. 2009-112205 (patent document 5), it is described in a fermentation process of manufacture of cheese etc. that L- ornithine is produced and an ornithine containing composition is manufactured.

Furthermore, in the study of the expression of genes related to the metabolism of arginine, in L. lactis , arginine deiminase (ADI), an enzyme that converts arginine to citrulline, and ornithine carbamyl transferase (OTC), an enzyme that converts citrulline to ornithine It has been reported that genes are encoded adjacent to each other and that the expression of these two genes is controlled by the same promoter (Non-patent Document 4).

Furthermore, studies of the expression of genes related to the metabolism of arginine, L. As lactic acid bacteria other than lactis, even in Enterococcus faecalis (Enterococcus faecalis) and Lactobacillus plantarum (Lactobacillus planturum), ADI and OTC gene adjacent code It has been reported that these two genes have their expression controlled by the same promoter (Non-patent Documents 5 and 6).

In these studies, real-time PCR has been used to confirm that ADI and OTC gene expression is regulated at the same time. And, in L. lactis , the activity of ADI and OTC is measured under various culture conditions (Non-patent document 1), and it is reported that the activity of OTC is higher than that of ADI under any of the culture conditions. It is done.

  That is, according to these studies, in microorganisms having arginine metabolism, ADI converts arginine to citrulline, but OTC converts citrulline immediately to ornithine, so citrulline is accumulated in the culture solution. It is suggested not to.

Japanese Patent Application Laid-Open No. 63-068091 Japanese Patent Application Laid-Open No. 05-168486 Japanese Patent Application Publication No. 08-089269 Unexamined-Japanese-Patent No. 2010-088301 JP, 2009-112205, A

Crow V. L., T. D. Thomas. 1982. Arginine metabolism in lactic streptococci. J. Bacteriol. 150: 1024-1032. Poolman B., A. J. M. Driessen, W. N. Konings. 1987. Regulation of arginine-ornithine exchange and arginine deiminase pathway in Streptococcus lactis. Bacteriol., 169: 5597-5604 Larsen R., G. Burist, O. P. Kuipers, J. Kok. 2004. ArgR and AhrC are required for regulation of arginine metabolism in Lactococcus lactis. J. Bacteriol. 186: 1147-1157 Budin-Verneuil A., E. Maguin, Y. Auffray, DS Ehrlich, V. Pichereau. 2006. Genetic structure and transcription analysis of the arginine deiminase (ADI) cluster in Lactococcus lactis MG1363. Can. J. Microbiol. 52: 617 -622 Barcelona B., A. Marina, V. Rubio. 2002. Gene structure, organization, expression, and potential regulatory mechanisms of arginine catabolism in Enterococcus faecalis. J. Bacteriol. 184: 6289-6300 Spano G., G. Chieppa, L. Beneduce, S. Massa, 2004. Expression analysis of putative arcA, arcB and arcC genes partially cloned from Lactobacillus plantarum isolated from wine. J. Appl. Microbiol. 96 185-193

  In order to convert most of arginine to citrulline efficiently using a microorganism such as lactic acid bacteria, it was considered effective to suppress the conversion of citrulline to ornithine. However, as far as the present inventors know, no method has been reported so far for efficiently converting most of arginine to citrulline.

  The present inventors efficiently use the microorganism having citrulline-producing ability to culture citrulline efficiently by culturing the culture medium at a temperature higher than the normal temperature (optimum temperature for culturing the microorganism). I learned that I can do it. In addition, the present inventors ferment citrulline by fermenting a raw material (for example, raw material milk etc.) at a temperature higher than usual (optimum temperature for fermentation of the microorganism) using a microorganism having a ability to produce citrulline. It has been found that compositions containing high concentrations (for example, food and drink such as fermented milk products) can be produced.

  Furthermore, the present inventors obtained the finding that the ability to produce citrulline of a microorganism can be enhanced by culturing and fermenting by adding arginine to a culture medium or a raw material. Then, the present inventors obtained the finding that the concentration (number) of microorganisms can be increased by culturing while controlling the pH of the culture medium (culture solution). The present invention is based on these findings.

  Therefore, an object of the present invention is to provide a method for preparing citrulline which can efficiently produce citrulline. Another object of the present invention is to provide a method for producing a citrulline-containing composition containing a high concentration of citrulline.

  Furthermore, the present invention aims to provide a culture method and a fermentation method of a microorganism in which the conversion efficiency from arginine to citrulline is enhanced. And this invention aims at provision of the culture | cultivation method which raised the density | concentration of the microorganisms which have citrulline production ability.

That is, the present invention relates to the following aspects (1) to (18).
(1) A method for preparing citrulline, which comprises inoculating a microorganism having the ability to produce citrulline into a culture medium and culturing it at a temperature of 40 ° C. or more and 70 ° C. or less.
(2) The method for preparing citrulline according to (1), wherein the microorganism having the ability to produce citrulline is a lactic acid bacterium, a bifidobacteria or a propionic acid bacterium.
(3) The method for preparing citrulline according to (2), wherein the lactic acid bacteria are one or more selected from the group consisting of Lactococcus lactis, Lactobacillus fermentum, and Lactobacillus buchneri.
(4) The method according to (2), wherein the lactic acid bacteria is one or more selected from the group consisting of Lactococcus lactis spp. Lactis OLS 3789 strain, OLS 3797 strain, and OLS 3818 strain. Method of preparing citrulline.

(5) A method for producing a citrulline-containing composition, which comprises adding (composing) a microorganism having the ability to produce citrulline to a raw material, and fermenting at a temperature of 40 ° C. or more and 70 ° C. or less.
(6) The method for producing a citrulline-containing composition according to (5), wherein the microorganism having the ability to produce citrulline is a lactic acid bacterium, a bifidobacteria or a propionic acid bacterium.
(7) The method for producing a citrulline-containing composition according to (6), wherein the lactic acid bacterium is one or more selected from the group consisting of Lactococcus lactis, Lactobacillus fermentum, and Lactobacillus buchneri .
(8) The method according to (6), wherein the lactic acid bacterium is one or more selected from the group consisting of Lactococcus lactis spp. Lactis OLS 3789 strain, OLS 3797 strain, and OLS 3818 strain. Method for producing a citrulline-containing composition.
(9) The manufacturing method of the citrulline containing composition in any one of (5)-(8) whose raw material is raw material milk.
(10) The method for producing a citrulline-containing composition according to any one of (5) to (9), wherein the citrulline-containing composition is a food or drink.

(11) A method of preparing a culture solution comprising a microorganism having citrulline-producing ability and having an enhanced conversion efficiency from arginine to citrulline at a culture temperature of 40 ° C. to 70 ° C., which is a microorganism having citrulline-producing ability Is cultured in a medium to which arginine is added.
(12) Add arginine to the medium prior to culture, and / or
(11) The method of preparing a culture solution according to (11), wherein arginine is intermittently added in the middle of the culture, or arginine is continuously added in the middle of the culture.
(13) A method for preparing a culture solution comprising a microorganism having a ability to produce citrulline, wherein the concentration of the microorganism is increased, wherein the microorganism having the ability to produce citrulline is a medium having a pH in the range of 5 to 7. A preparation method comprising culturing and raising the concentration of the microorganism.
(14) The method for preparing a culture solution according to (13), wherein the pH of the medium is adjusted by the addition of an alkali.

(15) A culture comprising a microorganism having a ability to produce citrulline and having an increased conversion efficiency from arginine to citrulline at a culture temperature of 35 ° C. or more and 70 ° C. or less, and a culture in which the concentration (cell concentration) of the microorganism is increased. A method for preparing a liquid, which comprises adding an arginine to a microorganism having citrulline-producing ability and culturing it in a medium having a pH of 5 or more and 7 or less to increase the concentration of the microorganism. Method.
(16) Add arginine to the medium prior to culture, and / or
(15) The method of preparing a culture solution according to (15), wherein arginine is intermittently added in the middle of the culture, or arginine is continuously added in the middle of the culture.
(17) Citrulline producing ability with enhanced conversion efficiency from arginine to citrulline obtained by centrifugation and / or membrane separation of the culture fluid obtained by the method according to any of (11) to (16) A method of preparing a microorganism having the
(18) A culture solution obtained by the method of preparing a culture solution according to any one of (11) to (16) or a microorganism obtained by the method of preparing a microorganism according to (17) is inoculated into a medium The method for preparing citrulline according to any one of (1) to (4), or the method for producing a citrulline-containing composition according to any one of (5) to (10) .

  According to the method for preparing citrulline of the present invention, citrulline can be produced efficiently. Moreover, according to the method for producing a citrulline-containing composition of the present invention, a nutritional composition such as a dairy product containing a high concentration of citrulline can be obtained. Moreover, according to the culture method and fermentation method of the microorganism of the present invention, the conversion efficiency from arginine to citrulline can be enhanced. And according to the culture | cultivation method of the microorganisms of this invention, the density | concentration of microorganisms can be raised. Furthermore, according to the method for preparing citrulline according to the present invention or the method for producing a citrulline-containing composition, a microorganism having the ability to produce citrulline and / or having an increased conversion efficiency from arginine to citrulline and / or an increased concentration of microorganisms Alternatively, citrulline can be efficiently produced using the culture solution, and a nutritional composition such as a dairy product containing citrulline at a high concentration can be obtained.

It is a graph which shows a time-dependent change of the bacterial cell concentration of L. lactis OLS3797 strain when culture medium (culture solution) is controlled to 5.5 using sodium hydroxide, and L. lactis OLS 3797 strain is cultured. . Control the pH of the culture medium (culture medium), and culture the L. lactis OLS3797 strain (pH-controlled culture), and let the culture solution 10, 11 and 12 hours after the start of culture, and leave the L. lactis OLS 3797 strain It is a graph which shows the comparison of the conversion efficiency from arginine to citrulline in the culture solution at the time of culture | cultivation. The graph showing the time-dependent change of pH, the time-dependent change of bacterial cell concentration, the time-dependent change of arginine concentration, the citrulline concentration, the ornithine concentration when arginine is added to MRS medium before the culture and L. lactis OLS3797 strain is cultured. is there. 10 hours after the start of culture, arginine is intermittently added to the MRS medium, and the time course of pH when culturing L. lactis OLS 3797 strain, the time course of bacterial cell concentration, arginine concentration, citrulline concentration, ornithine concentration time It is a graph which shows change. Arginine is continuously added to MRS medium 4 hours after the start of culture, and the time course of pH when L. lactis OLS 3797 strain is cultured, the time course of bacterial cell concentration, the time course of arginine concentration, citrulline concentration, ornithine concentration It is a graph which shows change.

Method for preparing citrulline The method for preparing citrulline according to the present invention is characterized in that a microorganism having citrulline-producing ability is inoculated into a medium and cultured at a temperature higher than normal (optimum temperature for culturing the microorganism). The culture temperature is specifically 40 ° C. or more and 48 ° C. or less, preferably 42 ° C. or more and 47 ° C. or less, more preferably 44 ° C. or more and 46 ° C. or less. Further, according to another aspect of the present invention, the culture temperature is 40 ° C. or more and 70 ° C. or less, a preferable upper limit is 68 ° C., a more preferable upper limit is 65 ° C., a preferable lower limit is 42 ° C., and a more preferable lower limit is 43 ° C.

As described above, the culture temperature in the present invention is a temperature higher than the normal culture temperature (for example, the optimum temperature) of the microorganism having the ability to produce citrulline. Citrulline can be efficiently produced by culturing the microorganism in such a temperature range. The reason for this can be considered as follows, but the following explanation (theory) is only an assumption, and the present invention is not limited by this theory. That is, as described in the prior art, for example, L. lactis having arginine metabolic ability comprises arginine deiminase (ADI), which is an enzyme that converts arginine to citrulline, and ornithine carbamyl transferase (which is an enzyme that converts citrulline to ornithine). It has the gene of OTC), and both of them are considered to be regulated in expression by the same promoter. At this time, as in the present invention, when the culture temperature is high, ADI enhances the conversion of arginine to citrulline, or OTC suppresses the conversion of citrulline to ornithine, or It is thought that citrulline is accumulated in the medium (culture medium) along with both of these actions and phenomena. That is, as in the present invention, when the culture temperature is high, arginine is efficiently converted to citrulline, and it is considered that an efficient preparation method of citrulline can be realized.

  The culture time of the present invention is not particularly limited as long as it can appropriately culture a microorganism having a ability to produce citrulline, and is preferably 2 to 48 hours, more preferably 3 to 36 hours, still more preferably 4 to 4 hours. It is 24 hours.

  The microorganism having the ability to produce citrulline according to the present invention is not particularly limited as long as it produces citrulline, but is preferably 40 ° C. or more and 48 ° C. or less, more preferably 42 ° C. or more and 47 ° C. or less, still more preferably 44 ° C. or more Preferably, the culture is carried out at a temperature of 46 ° C. or less to efficiently produce citrulline. Further, according to another aspect of the present invention, the temperature is 40 ° C. or more and 70 ° C. or less, the upper limit is preferably 68 ° C., more preferably 65 ° C., and the lower limit is preferably 42 ° C., more preferably 43 ° C. It is. And, the microorganism having the ability to produce citrulline in the present invention is preferably a lactic acid bacterium having the ability to produce citrulline, bifidobacteria or propionic acid bacteria, more preferably a lactic acid bacterium having the ability to produce citrulline or bifidobacteria, more preferably Is a lactic acid bacterium capable of producing citrulline.

  The lactic acid bacteria having the ability to produce citrulline according to the present invention are preferably, but are not limited to, Lactococcus lactis, Lactobacillus fermentum, Lactobacillus buchneri, Enterococcus faecalis, Oenococcus oeni, Pediococcus pentosaceus, Lactobacillus amylovoras, Lactobacillus. It is one or more selected from the group consisting of Bacillus brevis and Lactobacillus reuteri, and more preferably selected from the group consisting of Lactococcus lactis, Lactobacillus fermentum and Lactobacillus buchneri Or more preferably Lactococcus lactis.

Lactococcus lactis having the ability to produce citrulline according to the present invention is preferably one or more selected from the group consisting of Lactococcus lactis subsp. Lactis and Lactococcus lactis subsp. Cremoris, more preferably Is L. lactis subsp . Lactis, more preferably one or two selected from the group consisting of Lactococcus lactis spp. Lactis OLS 3789, OLS 3797, and OLS 3818 . It is more than a species. These strains are deposited at the depository as described later.

Lactococcus lactis subsp . Lactis having the ability to produce citrulline according to the present invention is Lactococcus lactis spp. Lactis OLS 3789 as described above, and it is an independent administrative corporation product evaluation technology mechanism receipt number: NITE BP-1387 (Indication of identification: Lactococcus lactis spp. Lactis OLS 3789, deposit date: July 18, 2012) What is deposited, Lactococcus lactis spp. Lactis OLS 3797 which is an independent administrative corporation product evaluation technology mechanism Patent Microorganisms Deposit Center The receipt number: NITE BP-1388 (Indication of identification: Lactococcus lactis spp. Lactis OLS 3797, deposit date: July 18, 2012), Lactococcus lactis spp. Lactis OLS 3818, which is an independent administrative corporation receipt to product evaluation technology mechanism, Patent microorganisms Depositary number: NITE BP-1389 (of identification:. Lactococcus lactis spp lactis OLS3818, date of deposit: July 18, 2012) that it has been deposited in A.

Here, Lactococcus lactis spp. Lactis OLS 3789 has the following scientific properties (morphology, characteristics on culture medium, physiological properties, etc.).
(A) Morphological properties Colony properties on culture medium (Lactobacilli MRS Agar, DIFCO): circular, white, smooth, squamous (b) physiological properties Bacterial form: cocci, gram stain: positive, lactate fermentation form: Homo lactic acid fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism
The 16sr DNA sequence is as follows: (OLS 3789)
GCTGGCGGGCGTGCCTAATACATGCAAGTTGAGCGCTGAAGGTTGGTACTTGTACCGACTGGATGAGCAGCGAACGGGTGAGTAACGCGTGGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAAAAACTTTAAACACAAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGATGATCCCGCGTTGTATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGATGATACATAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAGCTCATCAAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 1)

In addition, Lactococcus lactis spp. Lactis OLS3797 has the following scientific properties (morphological, media characteristics, physiological properties, etc.).
(A) Morphological properties Colony properties on culture medium (Lactobacilli MRS Agar, DIFCO): circular, white, smooth, squamous (b) physiological properties Bacterial form: cocci, gram stain: positive, lactate fermentation form: Homo lactic acid fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism
The 16sr DNA sequence is as follows: (OLS 3797)
GAAGCTGGCGGCGTGCCTAATACATGCAAGTTGAGCGCTGAAGGTTGGTACTTGTACCGACTGGATGAGCAGCGAACGGGTGAGTAACGCGTGGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAAAAACTTTAAACACAAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGATGATCCCGCGTTGTATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGATGATACATAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAGCTCATCAAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 2)

Furthermore, Lactococcus lactis spp. Lactis OLS3818 has the following scientific properties (morphology, characteristics on culture medium, physiological properties, etc.).
(A) Morphological properties Colony properties on culture medium (Lactobacilli MRS Agar, DIFCO): circular, white, smooth, squamous (b) physiological properties Bacterial form: cocci, gram stain: positive, lactate fermentation form: Homo lactic acid fermentation, aerobic growth: +

(C) Other properties that characterize the microorganism
The 16sr DNA sequence is as follows: (OLS 3818)
GCGAAGCTGGCGGCGTGCCTAATACATGCAAGTTGAGCGCTGAAGGTTGGTACTTGTACCGACTGGATGAGCAGCGAACGGGTGAGTAACGCGTGGGGAATCTGCCTTTGAGCGGGGGACAACATTTGGAAACGAATGCTAATACCGCATAAAAACTTTAAACACAAGTTTTAAGTTTGAAAGATGCAATTGCATCACTCAAAGATGATCCCGCGTTGTATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGATGATACATAGCCGACCTGAGAGGGTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAGCTCATCAAGTGACGGTAACTACCCAGAAAGGGACGGCTAACTACGT (SEQ ID NO: 3)

  The medium of the present invention is not particularly limited as long as it can be appropriately selected from those capable of cultivating a microorganism having a ability to produce citrulline, and for example, skimmed milk, skimmed concentrated milk, reduced skimmed milk, and their protein degradation products, whey Whey concentrate, reduced whey, and protein decomposition products thereof, raw milk, whole fat milk (sterilized milk), whole fat concentrated milk, reduced whole fat milk, etc., preferably skimmed milk, reduced skimmed milk And their proteolysis products, whey, reduced whey, and their proteolysis products.

  In the method of preparing citrulline of the present invention, citrulline is produced in a culture medium. At this time, the medium containing citrulline may be used as it is as a raw material or material of a food or drink, preferably as a raw material or material of dairy products, or citrulline may be separated from this medium (isolation etc.) After processing by processing such as or concentration, citrulline of desired purity may be prepared and used. At this time, food and drink include functional foods and nutritional foods, and dairy products include, for example, milk drinks, fermented milk (more preferably yogurt), lactic acid bacteria drinks, cheese, ice cream and the like. .

Method for producing a citrulline-containing composition The method for producing a citrulline-containing composition according to the present invention adds (formulates) a microorganism having a ability to produce citrulline to a raw material and ferments at a temperature higher than usual (optimum temperature for fermentation of microorganisms). It is characterized by Specifically, the fermentation temperature is 40 ° C. or more and 48 ° C. or less, preferably 42 ° C. or more and 47 ° C. or less, and more preferably 44 ° C. or more and 46 ° C. or less. Further, according to another aspect of the present invention, the fermentation temperature is 40 ° C. or more and 70 ° C. or less, a preferable upper limit is 68 ° C., a more preferable upper limit is 65 ° C., a preferable lower limit is 42 ° C., and a more preferable lower limit is 43 ° C.

  As described above, the fermentation temperature in the present invention is a temperature higher than the normal fermentation temperature (for example, optimum temperature) of the microorganism having the ability to produce citrulline. Citrulline can be efficiently produced by culturing the microorganism in such a temperature range. The reason is considered to be the same as the reason already described in the method for preparing citrulline of the present invention.

  In addition, in the method for preparing citrulline according to the present invention, the culture medium may be used as it is as a citrulline-containing composition without isolating citrulline from the culture medium containing citrulline, or a desired operation (eg, centrifugation, The medium treated by membrane separation or the like may be used as a citrulline-containing composition.

  The fermentation time of the present invention is not particularly limited as long as it can be appropriately selected from the conditions under which microorganisms having citrulline producing ability can be fermented, but preferably 2 to 24 hours, more preferably 3 to 16 hours, further preferably 4 to 4 hours. 12 hours.

  The raw material of the present invention is not particularly limited as long as a microorganism capable of producing citrulline can be fermented, and is not particularly limited. For example, skimmed milk, skimmed concentrated milk, reduced skimmed milk, and these protein degradation products, whey Whey concentrate, reduced whey, and protein decomposition products thereof, raw milk, whole fat milk (sterilized milk), whole fat concentrated milk, reduced whole fat milk, etc., preferably skimmed milk, reduced skimmed milk And their proteolysis products, whey, reduced whey, and their proteolysis products.

  According to a preferred embodiment of the present invention, if raw material milk is used as the raw material, a milk raw material, a dairy product or the like can be obtained as a citrulline-containing composition. A function derived from citrulline is added to the obtained milk raw material or dairy product or the like (citrulline-containing composition), and its nutritional value is enhanced. Furthermore, in the milk raw material or the dairy product etc. of the present invention, the citrulline content can be increased in the production process without adding (composing) citrulline from the outside, and therefore based on the milk raw material or the dairy product etc. The production cost of the final product can be kept low.

  According to another preferred embodiment of the present invention, fermented milk (more preferably yoghurt) can be obtained as a citrulline-containing composition by using fermented milk mix (more preferably yoghurt mix) as a raw material. A function derived from citrulline is added to the obtained fermented milk (more preferably, yogurt), and its nutritional value is enhanced. Furthermore, in the fermented milk of the present invention (more preferably, yoghurt), the citrulline content can be increased in the production process thereof without adding (composing) citrulline from the outside, so the fermented milk (more preferably Can reduce the production cost etc. of the final product based on yogurt).

  In the method for producing a citrulline-containing composition of the present invention, citrulline is produced in a raw material. At this time, the raw material containing citrulline may be used as it is as a raw material or a raw material of food and drink, preferably as a raw material or a raw material of dairy product, or citrulline may be separated from this raw material (isolation etc.) After processing by processing such as or concentration, citrulline of desired purity may be prepared and used. At this time, food and drink include functional foods and nutritional foods, and dairy products include, for example, milk drinks, fermented milk (more preferably yogurt), lactic acid bacteria drinks, cheese, ice cream and the like. .

Citrulline-Containing Food / Beverage Product As described above, the medium containing citrulline obtained by the method of preparing citrulline according to the present invention, or the raw material containing citrulline obtained by the method of producing a citrulline-containing composition according to the present invention By selecting and using any suitable medium for the food and drink as the culture medium and the raw material, each can be used as the food or drink itself or as a raw material or material for the food and drink. Therefore, according to the present invention, there is provided a citrulline-containing food or drink using the culture medium containing citrulline of the present invention, or a material containing citrulline, or a processed product thereof as the material or material of food or drink itself or food or drink. be able to.

  The citrulline or citrulline-containing composition obtained by the method for preparing citrulline according to the present invention or the method for producing a citrulline according to the present invention, or a processed product thereof can be used as a food or drink (preferably a dairy product, more preferably The fermented milk can be added (blended) to add the function derived from citrulline to the food and drink. Therefore, according to the present invention, the citrulline or citrulline-containing composition of the present invention, or a processed product thereof can be added to food and drink to provide a citrulline-containing food and drink.

  According to the method for preparing citrulline or the method for producing a citrulline-containing composition of the present invention, the citrulline or citrulline-containing composition, or a processed product thereof can be efficiently obtained by suppressing the preparation cost (processing cost) and the production cost. Can be provided. Therefore, using the citrulline or citrulline-containing composition of the present invention to increase the citrulline content of the citrulline-containing food / drink product in the production process while enhancing the commercial value by adding a function derived from citrulline, etc. For reasons such as being able to do so, the manufacturing cost etc. can be suppressed low and provided efficiently.

  The citrulline-containing food / drink product of the present invention is not particularly limited as long as it contains citrulline, and examples thereof include milk drinks, fermented milk (more preferably yogurt), lactic acid bacteria drinks, cheese, ice cream, etc. Dairy products are mentioned.

Method of preparing culture solution containing microorganism having ability to produce citrulline having increased conversion efficiency from arginine to citrulline Preparation of culture solution containing microorganism having ability to produce citrulline having increased conversion efficiency from arginine to citrulline according to the present invention The method is characterized in that the microorganism is cultured in a medium to which arginine is added at a culture temperature higher than normal (optimum temperature for fermentation of the microorganism). The culture temperature is specifically 40 ° C. or more and 48 ° C. or less, preferably 42 ° C. or more and 47 ° C. or less, more preferably 44 ° C. or more and 46 ° C. or less. Further, according to another aspect of the present invention, the culture temperature is 40 ° C. or more and 70 ° C. or less, a preferable upper limit is 68 ° C., a more preferable upper limit is 65 ° C., a preferable lower limit is 42 ° C., and a more preferable lower limit is 43 ° C.

  According to a preferred embodiment of the present invention, the microorganism having the ability to produce citrulline according to the present invention is cultured at a temperature of 40 ° C. to 48 ° C., preferably 42 ° C. to 47 ° C., more preferably 44 ° C. to 46 ° C. There is provided a method of improving the ability of the microorganism to produce citrulline. According to another aspect of the present invention, the culture is performed at 40 ° C. or more and 70 ° C. or less, the upper limit temperature of preferable culture is 68 ° C., more preferably 65 ° C., and the lower limit temperature is 42 ° C., more preferably The lower limit is 43 ° C. At this time, the microorganism having the ability to produce citrulline of the present invention is obtained by appropriately treating the culture or composition obtained by the method of preparing citrulline of the present invention or the method of producing a citrulline-containing composition of the present invention A microorganism having an increased conversion efficiency from arginine to citrulline can be used.

  As described above, the medium of a preferred embodiment of the present invention is a medium to which arginine is added. Citrulline can be efficiently produced by culturing the microorganism with such a composition (formulation) of the culture medium. The reason for this can be considered as follows, but the following explanation (theory) is only an assumption, and the present invention is not limited by this theory. That is, as described in the prior art, for example, in the non-patent documents 1 and 2 described above, regarding arginine metabolic activity of L. lactis, when arginine is added to the medium, the transcription amount of the gene encoding ADI and OCT is increased. It has been reported to increase. According to this finding, the addition of arginine to the medium is expected to increase the amount of transcription of the gene encoding ADI, and the culture temperature is high at 40 ° C. to 70 ° C., in some cases 48 ° C. or less. It is also conceivable that this phenomenon is maintained. In addition, addition of arginine to the culture medium increases the transcription amount of the gene encoding ADI, and also in the case of a high culture temperature of 40 ° C. or more and 70 ° C. or less, and in some cases 48 ° C. or less. It is not immediately predictable that this phenomenon is maintained or that the transcription level of the gene encoding OCT is suppressed. Therefore, it is not appropriate to judge that the present invention is obvious from Non-Patent Documents 1 and 2.

  According to a preferred aspect of the present invention, when culturing a microorganism capable of producing citrulline, arginine is added to the medium before culture and / or arginine is intermittently added to the medium during the culture. Alternatively, arginine is continuously added to the medium during the culture. Thereby, the ability to produce citrulline of the microorganism having the ability to produce citrulline can be enhanced. At this time, it is preferable that the microorganism having the ability to produce citrulline has a long time of contacting with a sufficient concentration of arginine. Therefore, when culturing a microorganism having a ability to produce citrulline, it is preferable to add (formulate) arginine to the medium before culture, and add arginine to the medium before culture and intermittently or during the culture It is more preferable to add (add) arginine to the medium continuously, and it is further preferable to add arginine to the medium continuously during the culture.

  The addition amount of arginine of the present invention is not particularly limited as long as it is appropriately selected from citrulline or a citrulline-containing composition, or conditions under which these processed products can be prepared or manufactured, and is preferably 0.5 to the culture medium. The content is 5 to 5% by mass, more preferably 0.7 to 4% by mass, and still more preferably 1 to 3% by mass.

  The method of adding arginine according to the present invention is not particularly limited as long as arginine can be aseptically added (blended) to the medium, and there is no particular limitation, however, after adding arginine to the medium, the medium is sterilized by heating or filtration sterilization. Alternatively, an arginine aqueous solution may be separately prepared, and the arginine aqueous solution may be added to the medium after heat sterilization or filter sterilization.

  According to a preferred embodiment of the present invention, when culturing a microorganism having a ability to produce citrulline, a medium having a pH of 5 or more and 7 or less is used, preferably a pH of 5 or more and 6.5 or less. A certain culture medium is used, more preferably, a culture medium having a pH of 5 or more and 6 or less is used, and still more preferably, a culture medium having a pH of 5.5 or more and 6 or less. Thereby, the concentration (bacterial cell concentration) of the microorganism having the ability to produce citrulline can be increased, and the ability to produce citrulline can be increased. At this time, it is preferable to adjust the pH of the culture medium by adding an alkali, and it is more preferable to use arginine or an alkali metal hydroxide as the alkali.

  In one aspect of the present invention, “incubation with a medium having a pH in the range of 5 to 7” preferably means that the pH of the medium is in the range of 5 to 7 from the beginning to the end of the culture. However, this does not necessarily mean that the pH of the culture medium is always in the range of 5 or more and 7 or less from the beginning to the end of the culture. That is, in a state where the pH of the medium is in the range of 5 to 7, the culture may be performed for a sufficient time to increase the conversion efficiency from arginine to citrulline, specifically 1 to 60 hours, preferably 2 to Culturing may be performed for 48 hours, more preferably 3 to 36 hours, still more preferably 4 to 24 hours.

  The method of adding an alkali of the present invention is not particularly limited as long as it is appropriately selected from the conditions capable of controlling or managing the pH of the culture medium within a predetermined range. For example, it is preferable to control or control the pH of the medium intermittently or continuously within a predetermined range while observing the pH of the medium intermittently or continuously using a pH meter and a computer etc. It is more preferable to continuously control and manage the pH of the culture medium within a predetermined range while continuously observing.

  According to a preferred embodiment of the present invention, the microorganism may be activated and cultured before culturing the microorganism having the ability to produce citrulline. The culture conditions of the activation culture may be appropriately selected according to the type of the microorganism having the ability to produce citrulline, and is not particularly limited.

  According to one aspect of the present invention, cells of a microorganism having a ability to produce citrulline having increased conversion efficiency from arginine to citrulline are subjected to treatment such as centrifugation or membrane separation. Then, the cells may be used in the method for preparing citrulline according to the present invention or the method for producing a citrulline-containing composition.

Process for producing a composition containing a microorganism having citrulline-producing ability with increased conversion efficiency from arginine to citrulline A composition containing a microorganism having a citrulline-producing ability with increased conversion efficiency from arginine to citrulline according to the present invention The method is characterized in that the microorganism is fermented with a raw material to which arginine is added, at a culture temperature higher than normal (optimum temperature for fermentation of the microorganism). The culture temperature is specifically 40 ° C. or more and 48 ° C. or less, preferably 42 ° C. or more and 47 ° C. or less, more preferably 44 ° C. or more and 46 ° C. or less. Further, according to another aspect of the present invention, the culture temperature is 40 ° C. or more and 70 ° C. or less, a preferable upper limit is 68 ° C., a more preferable upper limit is 65 ° C., a preferable lower limit is 42 ° C., and a more preferable lower limit is 43 ° C.

  According to a preferred embodiment of the present invention, the microorganism having the ability to produce citrulline according to the present invention is fermented at a temperature of 40 ° C. to 48 ° C., preferably 42 ° C. to 47 ° C., more preferably 44 ° C. to 46 ° C. There is provided a method of improving the ability of the microorganism to produce citrulline. Further, according to another aspect of the present invention, the fermentation temperature is 40 ° C. or more and 70 ° C. or less, a preferable upper limit is 68 ° C., a more preferable upper limit is 65 ° C., a preferable lower limit is 42 ° C., and a more preferable lower limit is 43 ° C. At this time, the microorganism having the ability to produce citrulline according to the present invention can be obtained by appropriately treating the culture or composition obtained by the method for preparing citrulline according to the present invention or the method for producing a citrulline-containing composition, It is possible to use a microorganism having an increased conversion efficiency to citrulline.

  As described above, the raw material of a preferred embodiment of the present invention is a raw material to which arginine is added. Citrulline can be efficiently produced by fermenting the microorganism with the composition (formulation) of such raw materials. The reason for this is considered to be the same as the reason described in the method for preparing a culture solution containing a microorganism having a ability to produce citrulline, which improves the conversion efficiency from arginine to citrulline according to the present invention.

  In the method for preparing a culture solution containing a microorganism having a ability to produce citrulline having increased conversion efficiency from arginine to citrulline according to the present invention, the culture medium is used as a citrulline-containing composition as it is without isolating citrulline from the culture medium containing citrulline. A medium treated with a desired operation (eg, centrifugation, membrane separation, etc.) may be used as a citrulline-containing composition.

  The addition amount of arginine of the present invention is not particularly limited as long as it is appropriately selected from citrulline or a citrulline-containing composition, or conditions under which these processed products can be prepared or manufactured. The content is 5 to 5% by mass, more preferably 0.7 to 4% by mass, and still more preferably 1 to 3% by mass.

  The method for adding arginine according to the present invention is not particularly limited as long as arginine can be aseptically added (blended) to the medium, and there is no particular limitation. Alternatively, an arginine aqueous solution may be separately prepared, and the arginine aqueous solution may be heat-sterilized or filter-sterilized, and then added to the raw material.

  According to a preferred aspect of the present invention, when culturing a microorganism capable of producing citrulline, arginine is added to the medium before culture and / or arginine is intermittently added to the medium during the culture. Alternatively, arginine is continuously added to the medium during the culture. Thereby, the ability to produce citrulline of the microorganism having the ability to produce citrulline can be enhanced. At this time, it is preferable that the microorganism having the ability to produce citrulline has a long time of contact with arginine at a sufficient concentration. Therefore, it is preferable to add (blend) arginine to the medium or the raw material before culture, and add arginine to the medium before culture, and intermittently (for example, collectively at a predetermined amount) during the culture or More preferably, arginine is added (added) to the medium continuously (for example, gradually in small amounts), and it is further preferable to add arginine to the medium continuously during the culture, among others. Thereby, when culture | cultivating the microorganisms which have citrulline production ability, the conversion efficiency from arginine to citrulline can be raised.

  According to a preferred embodiment of the present invention, the microorganism may be activated and cultured before fermentation using a microorganism having citrulline-producing ability. The culture conditions of the activation culture may be appropriately selected according to the type of the microorganism having the ability to produce citrulline, and is not particularly limited.

  According to one aspect of the present invention, cells of the microorganism having a ability to produce citrullin having enhanced conversion efficiency from arginine to citrulline are subjected to centrifugation, membrane separation, etc. The cells may be used in the method for preparing citrulline according to the invention or the method for producing a citrulline-containing composition.

A method of preparing a culture solution containing a microorganism having citrulline-producing ability and having increased concentration of microorganism (cell concentration) A culture solution containing a microorganism having citrulline-producing ability and having increased concentration (cell concentration) of the microorganism of the present invention The method of preparing is characterized in that the microorganism is cultured in a medium having a pH of 5 or more and 7 or less at a culture temperature of normal (optimum temperature for fermentation of the microorganism), PH is 5 at a culture temperature of 48 ° C. or less, preferably 38 ° C. or more and 48 ° C. or less, more preferably 40 ° C. or more and 48 ° C. or less, still more preferably 42 ° C. or more and 47 ° C. or less, particularly preferably 44 ° C. or more and 46 ° C. or less More than 7 or less, preferably pH is 5 or more and 6.5 or less, more preferably pH is 5 or more and 6 or less, more preferably pH is 5.5 or more and 6 or less, Characterized by culturing in a medium supplemented with arginine. That is, here, the microorganism may be cultured at a temperature (for example, optimum temperature) suitable for culturing a microorganism having the ability to produce citrulline. According to another aspect of the present invention, the microorganism is cultured at a culture temperature of 35 ° C. or more and 70 ° C. or less (where the lower limit is preferably 38 ° C., more preferably 40 ° C., still more preferably 42 ° C., particularly preferably 44). C., and the upper limit is preferably 68.degree. C., more preferably 65.degree. C.), the pH is in the range of 5 to 7, preferably the pH is 5 to 6.5, and more preferably the pH is 5 or more. It is characterized in that it is cultured in a medium to which arginine is added, which has a pH of 6 or less, more preferably a pH of 5.5 or more and 6 or less.

  According to a preferred embodiment of the present invention, the microorganism having the ability to produce citrulline according to the present invention is 35 ° C. to 48 ° C., preferably 38 ° C. to 48 ° C., more preferably 40 ° C. to 48 ° C., further preferably The method for improving the concentration (cell concentration) of the microorganism, which is cultured at a temperature of 42 ° C. or more and 47 ° C. or less, particularly preferably 44 ° C. or more and 46 ° C. or less, is provided. According to another aspect of the present invention, the microorganism is cultured at a culture temperature of 35 ° C. or more and 70 ° C. or less (where the lower limit is preferably 38 ° C., more preferably 40 ° C., still more preferably 42 ° C., particularly preferably 44). C., and the upper limit is preferably 68.degree. C., more preferably 65.degree. C.), the method for improving the concentration of the microorganism (cell concentration) is provided. At this time, the microorganism having the ability to produce citrulline according to the present invention can be obtained by appropriately treating the culture or composition obtained by the method for preparing citrulline according to the present invention or the method for producing a citrulline-containing composition, It is possible to use a microorganism having an increased conversion efficiency to citrulline.

  According to a preferred embodiment of the present invention, when culturing a microorganism having a ability to produce citrulline, a medium having a pH of 5 or more and 7 or less is used, preferably a pH of 5 or more and 6.5 or less. The concentration of the above-mentioned microorganism is preferably used using a certain culture medium, more preferably using a culture medium having a pH of 5 or more and 6 or less, and still more preferably using a culture medium having a pH of 5.5 or more and 6 or less. A method of improving body concentration is provided. Thereby, the concentration (bacterial cell concentration) of the microorganism having the ability to produce citrulline can be increased, and the ability to produce citrulline can be increased. At this time, it is preferable to adjust the pH of the culture medium by adding an alkali, and it is more preferable to use arginine or an alkali metal hydroxide as the alkali.

  The addition amount of arginine of the present invention is not particularly limited as long as it is appropriately selected from citrulline or a citrulline-containing composition, or conditions under which these processed products can be prepared or manufactured, and is preferably 0.5 to the culture medium. The content is 5 to 5% by mass, more preferably 0.7 to 4% by mass, and still more preferably 1 to 3% by mass.

  In one aspect of the present invention, “incubation with a medium having a pH in the range of 5 to 7” preferably means that the pH of the medium is in the range of 5 to 7 from the beginning to the end of the culture. However, this does not necessarily mean that the pH of the culture medium is always in the range of 5 or more and 7 or less from the beginning to the end of the culture. That is, in a state where the pH of the culture medium is in the range of 5 to 7, the culture may be carried out for a sufficient time to increase the cell concentration, specifically 1 to 60 hours, preferably 2 to 48 hours, The culture may be carried out preferably for 3 to 36 hours, more preferably 4 to 24 hours.

  The method of adding the alkali is not particularly limited as long as it is appropriately selected from the conditions capable of controlling or managing the pH of the culture medium within a predetermined range. For example, it is preferable to control or control the pH of the culture medium within a predetermined range while observing the pH of the culture medium intermittently or continuously using a pH meter and a computer etc., and the pH of the culture medium is continuously monitored. It is more preferable to control or manage the pH of the culture medium within a predetermined range.

  According to a preferred embodiment of the present invention, the microorganism may be activated and cultured before culturing the microorganism having the ability to produce citrulline. The culture conditions of the activation culture may be appropriately selected according to the type of the microorganism having the ability to produce citrulline, and is not particularly limited.

  According to one aspect of the present invention, a culture solution containing a microorganism having a citrulline-producing ability and having increased cell concentration is subjected to treatment such as centrifugation or membrane separation of the microorganism of the microorganism, and then the present invention is carried out. The cells may be used in the method for preparing citrulline according to the invention or the method for producing a citrulline-containing composition.

  In one embodiment of the present invention, when arginine is used as an alkali, the arginine is added to the medium by the method of preparing citrulline of the present invention, the method of preparing a culture solution containing a microorganism having the ability to produce citrulline of the present invention, etc. In common with Therefore, when arginine is excessively added to the culture medium by the preparation method described above, the pH of the culture medium may change to the alkaline side, and the pH of the culture medium may be largely deviated from the range of 5 or more and 7 or less. . Thus, when arginine is excessively added to the culture medium, the ability to produce citrulline can be somewhat enhanced, so it is acceptable if the purpose is only to enhance the ability to produce citrulline, but the cell concentration is sufficiently increased. It can not be done. Therefore, in such a case, although the amount of citrulline production (relative amount of citrulline) per microorganism (bacterial body) having citrulline-producing ability can be increased, the production of citrulline per culture solution (medium) containing the microorganism Care must be taken as the amount (absolute amount of citrulline) may not be increased sufficiently.

Method of preparing a culture solution containing a microorganism having a ability to produce citrulline, wherein the conversion efficiency from arginine to citrulline is enhanced and the concentration of microorganisms (cell concentration) is increased , the conversion efficiency from arginine to citrulline of the present invention is enhanced, The method for preparing a culture solution containing a microorganism having a ability to produce citrulline, which has an increased concentration of microorganisms (cell concentration), has a pH of 5 at a culture temperature higher than the usual (optimum temperature for fermentation of microorganisms). Culturing is carried out in a culture medium in the range of 7 to 7, and the culture temperature is 40.degree. C. to 48.degree. C., preferably 42.degree. C. to 47.degree. C., more preferably 44.degree. C. to 46.degree. PH 5 or more and 7 or less, preferably pH 5 or more and 6.5 or less, more preferably pH 5 or more and 6 or less, more preferably pH In the range of .5 to 6, characterized by culturing in a medium supplemented with arginine. Further, according to another aspect of the present invention, the preparation method according to the present invention is characterized in that the temperature range from 40 ° C. to 70 ° C. (wherein the preferable upper limit is 68 ° C., more preferable upper limit is 65 ° C.) The lower limit is preferably 42 ° C., more preferably 43 ° C.), the pH is in the range of 5 to 7, preferably the pH is 5 to 6.5, and more preferably the pH is 5 to 6 More preferably, the culture is performed in a medium to which arginine is added, which has a pH of 5.5 or more and 6 or less.

  That is, the conditions for preparing a culture solution containing a microorganism having a ability to produce citrulline having enhanced conversion efficiency from arginine to citrulline according to the present invention, and the ability to produce citrulline having an increased concentration (cell concentration) of the microorganism of the present invention. The culture solution containing the microorganism having the ability to produce citrulline, in which the conversion efficiency from arginine to citrulline is enhanced and the concentration of the microorganism (cell concentration) is increased, is used in combination with the preparation conditions of the culture solution containing the microorganism having It will be possible.

  In one embodiment of the present invention, the method of adding arginine to the medium (culture solution) and the method of adjusting (controlling) the pH of the medium (culture solution) increase the conversion efficiency from arginine to citrulline, and the concentration of microorganisms The above method can be applied as long as the (cell concentration) can be increased.

  According to a preferred aspect of the present invention, when culturing a microorganism capable of producing citrulline, arginine is added to the medium before culture and / or arginine is intermittently added to the medium during the culture. Alternatively, arginine is continuously added to the medium during the culture. Thereby, the ability to produce citrulline of the microorganism having the ability to produce citrulline can be enhanced. At this time, it is preferable for the microorganism having the ability to produce citrulline that the pH of the medium is about neutral at the start of the culture. Therefore, it is preferable not to add (formulate) arginine to the medium before culture, and intermittently (eg, collectively with a predetermined amount) or continue in the middle of the culture without adding arginine to the medium before culture. More preferably, arginine is added to the medium (for example, gradually in small amounts), and it is more preferable to add arginine to the medium continuously during the culture. Thereby, when culturing or fermenting a microorganism having the ability to produce citrulline, the conversion efficiency from arginine to citrulline can be increased, and the concentration (cell concentration) of the microorganism can be increased.

  The addition amount of arginine of the present invention is not particularly limited as long as it is appropriately selected from citrulline or a citrulline-containing composition, or conditions under which these processed products can be prepared or manufactured, and is preferably 0.5 to the culture medium. The content is 5 to 5% by mass, more preferably 0.7 to 4% by mass, and still more preferably 1 to 3% by mass.

  Hereinafter, the present invention will be described in more detail by way of examples. However, the present invention is not limited to these examples.

  In the examples of the present invention, the bacterial cell concentration was measured by the method of measuring the number of lactic acid bacteria described in "Ministry Ordinance on Milk and Dairy Ingredient Specifications, etc. (milk ordinance ordinance) (Japan)". However, the culture temperature of the BCP medium was 30 ° C. The arginine concentration, citrulline concentration and ornithine concentration were measured by HPLC.

Example 1 : Metabolic ability of arginine of Lactic acid bacteria and Bifidobacterium The metabolizing ability of arginine was examined about the lactic acid bacteria and Bifidobacterium described in Table 1 below. First, MRS medium or GAM medium was sterilized at 121 ° C. for 15 minutes. Thereafter, the arginine aqueous solution was filter-sterilized and then added to these media to adjust the arginine concentration to 27 mM. An activated culture solution of the lactic acid bacteria and the bifidobacteria MRS culture medium shown in Table 1 below was inoculated at 1% by weight into the conditioned medium. In Lactococcus, the culture temperature is 30 ° C. and the culture time is 16 hours, aerobic culture is performed in a stationary state, and in the other cells, the culture temperature is 37 ° C. and the culture time is 16 hours. Air culture.

The results were as shown in Table 1 below. In Lactobacillus fermentum JCM1173T, Lactobacillus buchneri NCIMB 8007T, Lactococcus lactis ssp. Lactis JCM5805T, and IFO12007, the metabolic ability of arginine was confirmed.

Example 2: Lactococcus lactis ssp.lactis and Lactococcus lactis ssp.diacetylactis result of metabolic capacity Example 1 of arginine, in Lactococcus lactis ssp.lactis, both 2 strain of 2 strains, metabolic capacity of arginine was confirmed . However, in these two strains, most of the citrulline was converted to ornithine after converting all of arginine to citrulline.

Accordingly, next, described in Table 2 below, and 29 strains of Lactococcus lactis ssp.lactis, the Lactococcus lactis ssp. 1 strain of Lactococcus lactis ssp.diacetylactis a related species of the lactis, citrulline to ornithine conversion We searched for strains that did not. NO. 1 to NO. 29 in Table 2 are Lactococcus lactis ssp. Lactis , and NO. 30 is Lactococcus lactis ssp . Diacetylactis .

  First, the MRS medium was sterilized at 121 ° C. for 15 minutes. Thereafter, the arginine aqueous solution was filter-sterilized and then added to these media to adjust the arginine concentration to 27 mM. The adjusted culture medium was inoculated with 1% by weight of an activated culture broth of MRS medium of the strain of Table 2 below. These strains were aerobically cultured in a stationary state at a culture temperature of 30 ° C. and a culture time of 16 hours.

The results were as shown in Table 2 below. In all 29 strains of Lactococcus lactis ssp. Lactis , the metabolic ability of arginine was confirmed. However, most of arginine was converted to ornithine, and the production ratio of citrulline to ornithine ("Cit / Orn") was as low as 0.02 to 0.13. In addition, the metabolic ability of arginine was not confirmed in one strain of Lactococcus lactis ssp .

Example 3 Effect of culture temperature (37 ° C., 40 ° C.) on arginine metabolism of Lactococcus lactis ssp. Lactis Bacterial cells were cultured in the same manner as in Example 2 except that the culture temperature was 37 ° C. or 40 ° C. And examined the metabolic ability of arginine. The results were as shown in Table 3 below. Here, strains with relatively high Cit / Orn were searched, and 6 strains were selected.

Example 4 : Verification of the metabolic ability of Lactococcus lactis ssp. Lactis arginine in reduced skimmed milk (1)
From the results of Example 3, strains with relatively high Cit / Orn were searched for, and 5 strains were selected and used. That is, the metabolic ability of arginine was examined for the five strains listed in Table 4 below. At this time, reduced skimmed milk (concentration of skimmed milk powder: 10% by weight) (hereinafter referred to as "1% Arg + 10% reduced skimmed milk") to which arginine was added at 1% by weight was used as a medium.

  Twenty mL of the activated culture solution of MRS medium of 5 strains described in Table 4 below was centrifuged (8000 rpm, 10 minutes) to recover the cells of these 5 strains. Thereafter, 40 mL of “1% Arg + 10% reduced skimmed milk” was sterilized at 95 ° C. for 3 minutes to inoculate the cells of five strains recovered as described above. In addition, when adding arginine to reduced skimmed milk, first, an aqueous solution of arginine was prepared, pH was adjusted with hydrochloric acid, and then mixed with reduced skimmed milk. These five strains were aerobically cultured in a stationary state, with culture temperatures of 40 ° C. and 43 ° C., and culture times of 4 hours and 8 hours.

  The results were as shown in Table 4 below. Here, a strain with relatively high Cit / Orn was searched, and a culture temperature and culture time with relatively high Cit / Orn were searched. In these strains, as a whole, the higher the culture temperature and the longer the culture time, the higher the tendency for Cit / Orn to be.

Example 5 : Verification of the metabolic ability of Lactococcus lactis ssp. Lactis arginine in reduced skimmed milk (2)
Bacterial cells were cultured in the same manner as in Example 4 except that the culture temperature was changed to 44.5 ° C., 46 ° C., and 50 ° C. to 70 ° C. in 5 degrees increments, and the metabolic ability of arginine was examined. The results are as shown in Table 5 below. From the results of Example 4, strains having relatively high Cit / Orn were searched for, and 3 strains were selected and used.

Example 6 : Preparation of yogurt containing citrulline using Lactococcus lactis ssp. Lactis OLS 3797 strain or OLS 3818 strain
Lactococcus lactis ssp. Lactis OLS3797 strain or OLS3818 strain was used to produce fermented milk (yogurt) containing citrulline. That is, the raw material milk (yogurt base) described in Table 6 below was prepared and sterilized at 95 ° C. for 3 minutes. Then, 2% by weight of a mixed starter of Lactobacillus bulgaricus and Streptococcus thermophilus as a yogurt starter is added to this raw material milk, and Lactococcus lactis ssp. Lactis OLS3797 strain or OLS3818 strain is added and fermented at 45 ° C. for yogurt Manufactured. Here, the culture solution of MRS medium was centrifuged (8000 rpm, 10 minutes) as Lactococcus lactis ssp. Lactis OLS3797 strain and OLS 3818 strain, and only the bacterial cells were recovered and used. At this time, the amount of MRS medium used was the same as the amount of raw material milk used described in Table 6 below.

When Lactococcus lactis ssp. Lactis OLS3797 strain was used, the acidity reached 0.80% in 5 hours and 30 minutes. In addition, when Lactococcus lactis ssp. Lactis OLS3818 strain was used, the acidity reached 0.83% in 4 hours and 30 minutes. When these two strains were used, it was confirmed that the fermentation proceeded smoothly. Moreover, the flavor and physical properties of these fermented milks (yogurt) were not much different from those of conventional products and conventional products.

The concentrations of arginine, citrulline and ornithine in these fermented milks (yogurt) were measured. The results are as shown in Table 7 below. It was confirmed that the majority of arginine was metabolized and most was converted to citrulline. That is, it was revealed that fermented milk (yogurt) containing citrulline at high concentration can be produced using Lactococcus lactis ssp. Lactis OLS3797 strain or OLS3818 strain.

Example 7 : Examination of preparation method of culture solution of strain ( Lactococcus lactis ssp. Lactis OLS3797 strain) having high conversion efficiency from arginine to citrulline (1)
A method for preparing a culture solution with high conversion efficiency (activity) from arginine to citrulline was examined. In the above example, the culture broth was prepared by static culture of L. lactis in MRS medium. As a result, when L. lactis was subjected to static culture, it was observed that the growth of L. lactis was stopped and the cell concentration did not increase with the decrease of pH of the culture solution. Therefore, alkali is added to the culture solution to suppress a drop in the pH of the culture solution, and while culturing the L. lactis while culturing the culture in a MRS culture medium (pH-controlled culture), the bacterial cell concentration can be increased. We examined the influence of In other words, the possibility of increasing the conversion efficiency from arginine to citrulline per unit volume in the culture solution of L. lactis was examined by pH-controlled culture of L. lactis in MRS medium. The MRS medium was sterilized at 121 ° C. for 15 minutes.

An aqueous solution of sodium hydroxide (NaOH: 10% by weight) is added to the culture solution, and L. lactis strain OLS3797 is cultured with stirring (pH-controlled culture) while controlling the pH of the culture solution to 5.5. It measured over time. Specifically, the MRS medium activated culture solution (culture temperature: 30 ° C., culture time: 16 hours) of L. lactis OLS 3797 strain is inoculated at 1% by weight into the MRS medium and stirred culture (culture temperature: 30 ° C. , Stirring speed: 200 rpm). The time-dependent change of the cell concentration was as shown in FIG.

  At 10, 11, and 12 hours after the start of culture, the culture broth of pH-controlled culture was collected, and these cultures were stored under cooling in ice water. Then, this culture solution is inoculated at 5% by weight into "1% Arg + 10% reduced skimmed milk" and subjected to stationary culture (culture temperature: 44.5 ° C., culture time: 8 hours) to convert arginine to citrulline. The conversion efficiency was examined. At this time, 5% by weight of the above culture broth was inoculated at 5% by weight into the MRS medium as a comparison control, and stationary culture (culture temperature: 30 ° C., culture time: 16 hours) was conducted to examine the conversion efficiency from arginine to citrulline. . The results were as shown in FIG. 2 and Table 8 below.

As described above, it is confirmed that the conversion efficiency from arginine to citrulline per unit volume in the culture solution of L. lactis is enhanced in the case of pH-controlled culture in MRS medium as compared to static culture in MRS medium. It was done. On the other hand, the difference in conversion efficiency from arginine to citrulline per unit time / unit cell in the culture solution of L. lactis in the case of pH-controlled culture in MRS medium compared to static culture in MRS medium It was not. That is, compared to static culture, in pH-controlled culture, it was judged that the cell concentration increased, but the conversion efficiency from arginine per unit cell to citrulline did not change. In addition, the conversion efficiency from arginine to citrulline per unit time / unit cell is the concentration of citrulline 4 hours and 8 hours after the start of culture, the initial viable cell count and culture time (4 hours and 8 hours) Calculated as the number divided by.

Furthermore, the number of bacteria after 4 hours and after 8 hours from the start of culture in “1% Arg + 10% reduced skimmed milk” was examined for the case of using the culture solution 12 hours after the start of culture of pH controlled culture. As a result, the number of these bacteria is 1 × 10 ⁶ cfu / mL and 1 × 10 ⁴ cfu / mL (cfu: colony forming unit), respectively, and the number of bacteria decreases with the passage of time from the start of culture. The Therefore, during measurement of the conversion efficiency from arginine to citrulline, it was possible that ADI was unlikely to be produced, and it could be inferred that conversion from arginine to citrulline was made by ADI that the cells themselves possessed. At this time, there is a possibility that the activity of ADI is somewhat reduced with the passage of time from the start of culture, but there was no big difference in the conversion efficiency 4 hours and 8 hours after the start of culture.

Example 8 : Examination of preparation method of culture solution of strain ( Lactococcus lactis ssp. Lactis strain 3797) having high conversion efficiency from arginine to citrulline (2)
In Example 7, when L. lactis was pH-controlled and cultured, the cell concentration (number of cells) increased, but the conversion efficiency from arginine to citrulline per unit time / unit cell did not change. Therefore, before starting culture of L. lactis , adding arginine to the MRS medium and performing stationary culture may increase the conversion efficiency of arginine to citrulline per unit volume in the culture solution of L. lactis . Was examined. That is, L. lactis OLS3797 strain was statically cultured in a normal MRS medium and an MRS medium containing 0.5% by weight of arginine, and using the culture solution, “1% Arg + 10% reduced skimmed milk” The conversion efficiency of arginine to citrulline in Here, the MRS medium was sterilized at 121 ° C. for 15 minutes.

Specifically, activation culture of L. lactis 3797 strain (culture temperature 30 ° C., incubation time 16 hours), stationary culture was inoculated at 1% by weight in MRS medium (incubation temperature: 30 ° C., incubation time: 16 hours). Then, 20 mL of this culture solution is centrifuged (8000 rpm, 10 minutes), and only the cells are recovered, and then 40 mL of "1% Arg + 10% reduced skimmed milk" is inoculated and stirred culture (culture temperature) : 44.5 ° C., culture time: 4 hours), and the conversion efficiency from arginine to citrulline was examined. The results are as shown in Table 9 below.

  On the other hand, 1% by weight of the above-mentioned activated culture broth was inoculated at 1% by weight into an MRS medium containing 0.5% by weight of arginine, and stationary culture (culture temperature: 30 ° C., culture time: 16 hours) was performed. Then, 20 mL of this culture solution is centrifuged (8000 rpm, 10 minutes), and only the cells are recovered, and then 40 mL of "1% Arg + 10% reduced skimmed milk" is inoculated and stirred culture (culture temperature) : 44.5 ° C., culture time: 4 hours), and the conversion efficiency from arginine to citrulline was examined. The results are as shown in Table 9 below.

As described above, compared with stationary culture in a normal (conventional) MRS medium, per unit cell in a culture solution of L. lactis per unit cell, in the case of stationary culture in an MRS medium containing arginine, as compared to when stationary culture is performed It has been confirmed that the conversion efficiency from arginine to citrulline is more than doubled.

Example 9 : Examination of preparation method of culture solution of strain ( Lactococcus lactis ssp. Lactis OLS3797 strain) having high conversion efficiency from arginine to citrulline (3)
In Example 8, addition of arginine to the medium increased the conversion efficiency of L. lactis from arginine to citrulline. Therefore, before starting culture of L. lactis , adding arginine to the MRS medium and then performing pH-controlled culture can increase the conversion efficiency of arginine to citrulline per unit volume in the culture solution of L. lactis I examined the sex. That is, L. lactis OLS3797 strain is pH-controlled culture in MRS medium containing arginine at 0.5% by weight, and the culture solution is used to convert arginine to citrulline in "1% Arg + 10% reduced skimmed milk". The conversion efficiency of was measured. Here, the MRS medium was sterilized at 121 ° C. for 15 minutes. Thereafter, the arginine aqueous solution was filter-sterilized and then added to the medium to adjust the arginine concentration to 0.5% by weight.

An aqueous solution of sodium hydroxide (NaOH: 10% by weight) is added to the culture solution, and the L. lactis strain OLS3797 is cultured with agitation (pH-controlled culture) while controlling the pH of the culture solution to 5.5. Was measured over time. Specifically, 1% by weight of an activated culture broth (culture temperature: 30 ° C., culture time: 16 hours) of L. lactis OLS 3797 strain MRS medium was inoculated at 1% by weight into MRS medium containing 0.5% by weight of arginine. Then, NaOH was added, and culture was carried out with stirring (culture temperature: 30 ° C., stirring speed: 200 rpm) while controlling the pH of the culture solution to 5.5. The temporal changes in the cell concentration, pH, arginine concentration, citrulline concentration, and ornithine concentration were as shown in FIG.

As described above, when arginine was added to the medium before starting the culture of L. lactis, the pH of the medium at the start of the culture rose to 8.3. And, it is thought that the growth of the strain is delayed by the increase of pH of the culture medium at the start of the culture (early stage of the culture). However, at the late stage (second half) of the culture, lactic acid bacteria (bacterial cells) grew smoothly, consumption of arginine started 10 hours after the start of the culture, and arginine concentration became 0 after 13 hours. In this culture, the cell concentration reached the highest reached 2.7 × 10 ⁹ cfu / mL, and the cell concentration was reduced to half (one-half) or less compared to Example 7.

  The culture fluid was collected at 8, 9, 10, 11, 12, 13 hours after the start of the culture, and the culture fluid was kept cold in ice water. Then, this culture solution is inoculated at 5% by weight into "1% Arg + 10% reduced skimmed milk" and subjected to stationary culture (culture temperature: 44.5 ° C., culture time: 8 hours) to convert arginine to citrulline. The conversion efficiency was examined. The results are as shown in Table 10 below.

以上のとおり、培養開始から１１時間以降にアルギニンの消費が急激に増加した。これらのアルギニンの消費が速い培養液を使用すると、アルギニンからシトルリンへの変換効率が高まることが確認された。

As described above, consumption of arginine increased rapidly after 11 hours from the start of culture. It has been confirmed that the use of a culture broth which consumes arginine rapidly increases the conversion efficiency from arginine to citrulline.

Example 10 : Examination of preparation method of culture solution of strain ( Lactococcus lactis ssp. Lactis OLS3797 strain) having high conversion efficiency from arginine to citrulline (4)
In Example 9, when arginine is added to the medium before culture of lactic acid bacteria (bacterial cells) is started, the conversion efficiency from arginine to citrulline is greatly enhanced, but the maximum is reached compared to the case where arginine is not added. The cell concentration of Here, when the pH of the culture medium at the start of the culture was high, it was thought that the concentration of cells reaching the highest was likely to be reduced. Therefore, during culture of L. lactis , arginine is collectively (intermittently) added to the medium (culture solution) and pH-controlled culture is carried out per unit volume in the culture solution of L. lactis. The possibility of increasing the conversion efficiency from arginine to citrulline was investigated. Here, the MRS medium was sterilized at 121 ° C. for 15 minutes.

An aqueous solution of sodium hydroxide (NaOH: 10% by weight) is added to the culture solution, and L. lactis strain OLS3797 is cultured with stirring (pH-controlled culture) while controlling the pH of the culture solution to 5.5. Etc were measured over time. At this time, after 10 hours from the start of culture, an arginine aqueous solution (arginine: 10% by weight) was filter-sterilized and then added to this medium (culture solution) to adjust the arginine concentration to 0.5% by weight. . Specifically, after activating the MRS culture medium of L. lactis OLS 3797 strain (culture temperature: 30 ° C., culture time: 16 hours) at 1% by weight in MRS medium, NaOH is added and culture is performed. While stirring culture (culture temperature: 30 ° C., stirring speed: 200 rpm) while controlling the pH of the solution to 5.5, after 10 hours from the start of culture, the arginine aqueous solution is filter-sterilized and then added to this medium, The arginine concentration was adjusted to be 0.5% by weight. The changes over time in the bacterial cell concentration, pH, arginine concentration, citrulline concentration, and ornithine concentration were as shown in FIG.

  The culture solution was collected at 8, 10, 12, 13 hours after the start of the culture, and this culture solution was kept cold in ice water. Then, this culture solution is inoculated at 5% by weight into "1% Arg + 10% reduced skimmed milk" and subjected to stationary culture (culture temperature: 44.5 ° C, culture time: 4.5 hours), and arginine to citrulline The conversion efficiency was investigated. The results are as shown in Table 11 below.

以上のとおり、最高到達の菌体濃度が7.1×10 ⁹ cfu/mLとなり、実施例７と比較して、菌体濃度が同程度となった。一方、実施例９と比較して、アルギニンからシトルリンへの変換効率は低下した。

As described above, the cell concentration reached the highest reached 7.1 × 10 ⁹ cfu / mL, and the cell concentration was comparable to that of Example 7. On the other hand, compared to Example 9, the conversion efficiency from arginine to citrulline was reduced.

Example 11 : Examination of preparation method of culture solution of strain ( Lactococcus lactis ssp. Lactis OLS3797 strain) having high conversion efficiency from arginine to citrulline (5)
In Example 10, arginine is collectively (intermittently) added to a culture medium (culture solution) while culturing lactic acid bacteria (bacterial cells), and pH-controlled culture is carried out, pH control usually (conventional) Although the concentration of cells reaching the highest level is comparable as compared to the case of culture, arginine to citrulline is compared to the case where arginine is added to the culture medium before starting the culture of lactic acid bacteria (cells). Conversion efficiency of Therefore, during culture of L. lactis , pH-controlled culture is carried out while adding (continuously) little by little (continuously) arginine to the medium (culture solution), per unit volume in the culture solution of L. lactis The possibility of increasing the conversion efficiency from arginine to citrulline was investigated. Here, the MRS medium was sterilized at 121 ° C. for 15 minutes.

An arginine aqueous solution (arginine: 10% by weight) is added to the culture solution, and L. lactis strain OLS3797 is cultured with stirring (pH-controlled culture) while controlling the pH of the culture solution to 5.5, It measured over time. At this time, after 4 hours from the start of culture, an arginine aqueous solution (arginine: 10% by weight) was filter-sterilized and then added to the medium (culture medium) to adjust the pH of the medium to 5.5. Specifically, after an MRS culture medium (incubation temperature: 30 ° C., culture time: 16 hours) of L. lactis OLS 3797 strain MRS medium was inoculated at 1% by weight in MRS medium, arginine was added and culture was carried out. While stirring culture (culture temperature: 30 ° C., stirring speed: 200 rpm) while controlling the pH of the solution to 5.5, 4 hours after the start of culture, the arginine aqueous solution is filter-sterilized and then added to this medium, The pH of the medium was adjusted to 5.5. The changes over time in the bacterial cell concentration, pH, arginine concentration, citrulline concentration and ornithine concentration were as shown in FIG.

  The culture solution was collected 8, 10, 12, 13 hours after the start of the culture, and this culture solution was kept cold in ice water. Then, this culture solution is inoculated at 5% by weight into "1% Arg + 10% reduced skimmed milk" and subjected to stationary culture (culture temperature: 44.5 ° C, culture time: 4.5 hours), and arginine to citrulline The conversion efficiency was investigated. The results are as shown in Table 12 below. Here, in the table, "Culture" is the culture solution as it is, and inoculated at 5% by weight into "1% Arg + 10% reduced skimmed milk". In addition, "Supernatant" is obtained by inoculating 5% by weight of the supernatant obtained by centrifuging the culture solution into "1% Arg + 10% reduced skimmed milk". Furthermore, in "Cell", the culture solution is centrifuged and the supernatant is removed, and the collected cells are cryopreserved at -80 ° C and then thawed to "1% Arg + 10% reduced skimmed milk". It was inoculated at 5% by weight.

  Here, addition of arginine (neutralizing agent, substrate) to the medium (culture medium) was started 4 hours after the start of culture, and continued until the end of culture. At this time, arginine was immediately converted to ornithine for a while after starting addition of arginine to the medium, but in the second half of the culture, some of arginine was not converted to ornithine but was accumulated as it was .

As described above, the cell concentration reached the highest reached 6.5 × 10 ⁹ cfu / mL, and the cell concentration was comparable as compared with Example 7 and Example 10. And, compared to Example 9, the conversion efficiency from arginine to citrulline was comparable. That is, here, the cell concentration increased and the conversion efficiency from arginine to citrulline increased.

  In addition, the conversion efficiency from arginine to citrulline was almost the same when only the cells were recovered and stored frozen as compared with the case where the culture solution of the cells was used as it was. And 4 to 8 hours after the culture start, all of arginine was metabolized and most of arginine was converted into citrulline.

  The concentration (inoculation amount) added to the culture medium (culture solution) is 1 to 20 minutes when only the bacterial cells are recovered and used as compared to the case where the culture fluid of the bacterial cells is used as it is. It decreases to about 1/50. Here, since the concentration added to the medium is 5% by weight, the concentration added to the medium can be estimated to be 0.25 to 0.1% by weight when only cells are recovered and used. That is, when the culture solution is prepared by pH-controlled culture while adding arginine continuously (for example, until the end of culture) in the middle of culture (as a neutralizing agent), only the cells are recovered and used Then, dairy products containing high concentrations of citrulline can be efficiently produced.

Claims (16)

Inoculating the culture medium with a microorganism capable of producing citrulline and culturing it at a temperature of 40 ° C. or more and 60 ° C. or less;
Microorganism having the citrulline-producing ability, characterized in that it is a Lactococcus Lacty scan, process for the preparation of citrulline.   The method for preparing citrulline according to claim 1, wherein the microorganism having the ability to produce citrulline is such that citrulline production is superior to ornithine production at a culture temperature of 40 ° C or higher.   The microorganism having the ability to produce citrulline is one or more selected from the group consisting of Lactococcus lactis spp. Lactis OLS 3789 strain, OLS 3797 strain, and OLS 3818 strain. Or 2. The method for preparing citrulline as described in 2. Adding a microorganism having the ability to produce citrulline to a raw material, and fermenting at a temperature of 40 ° C. or more and 60 ° C. or less,
Method for producing a microorganism having the citrulline-producing ability, characterized in that it is a Lactococcus Lacty scan, citrulline-containing composition.   The method for producing a citrulline-containing composition according to claim 4, wherein the citrulline-producing microorganism is such that citrulline production is superior to ornithine production at a culture temperature of 40 ° C or higher.   The microorganism having the ability to produce citrulline is one or more selected from the group consisting of Lactococcus lactis spp. Lactis OLS 3789 strain, OLS 3797 strain, and OLS 3818 strain. Or 5. The method for producing a citrulline-containing composition according to 5.   The manufacturing method of the citrulline containing composition as described in any one of Claims 4-6 whose raw material is raw material milk.   The method for producing a citrulline-containing composition according to any one of claims 4 to 7, wherein the citrulline-containing composition is a food or drink. A method for preparing a culture solution comprising a microorganism having citrulline-producing ability and having an enhanced conversion efficiency from arginine to citrulline at a culture temperature of 40 ° C. or more and 60 ° C. or less, which is a microorganism having citrulline-producing ability Culturing in a medium supplemented with
Microorganism having the citrulline-producing ability, characterized in that it is a Lactococcus Lacty scan, preparation method.   The preparation method according to claim 9, wherein the citrulline-producing microorganism is such that citrulline production is superior to ornithine production at a culture temperature of 40 ° C or higher. Add arginine to the medium prior to culture and / or
The method for preparing a culture solution according to claim 9, wherein arginine is intermittently added in the middle of the culture, or arginine is continuously added in the middle of the culture. What is claimed is: 1. A method of preparing a culture broth comprising a microorganism having a ability to produce citrulline and having an enhanced conversion efficiency from arginine to citrulline at a culture temperature of 35 ° C. to 60 ° C., and having an increased concentration of the microorganism. Increasing the concentration of the microorganism having a citrulline-producing ability by adding arginine and culturing it in a medium having a pH of 5 or more and 7 or less;
Microorganism having the citrulline-producing ability, characterized in that it is a Lactococcus Lacty scan, preparation method. The preparation method according to claim 12 , wherein the citrulline-producing microorganism is such that citrulline production is superior to ornithine production at a culture temperature of 40 ° C or higher. Add arginine to the medium prior to culture and / or
The method for preparing a culture solution according to claim 12 or 13 , wherein arginine is intermittently added in the middle of the culture, or arginine is continuously added in the middle of the culture. A microorganism having a citrulline-producing ability with enhanced conversion efficiency from arginine to citrulline, which is obtained by centrifugation and / or membrane separation of a culture solution obtained by the method according to any one of claims 9 to 14. How to prepare. A culture solution obtained by the method of preparing a culture solution according to any one of claims 9 to 14 or a microorganism obtained by the method of preparing a microorganism according to claim 15 is inoculated into a culture medium and cultured. The manufacturing method of the citrulline as described in any one of Claims 1-3, or the manufacturing method of the citrulline containing composition as described in any one of Claims 4-8 which adds and ferments to a raw material.

Images