WO2015072776A1 - 재설계 유전자 회로를 이용한 ε카프로락탐의 감지 및 정량 방법 - Google Patents

재설계 유전자 회로를 이용한 ε카프로락탐의 감지 및 정량 방법 Download PDF

Info

Publication number
WO2015072776A1
WO2015072776A1 PCT/KR2014/010951 KR2014010951W WO2015072776A1 WO 2015072776 A1 WO2015072776 A1 WO 2015072776A1 KR 2014010951 W KR2014010951 W KR 2014010951W WO 2015072776 A1 WO2015072776 A1 WO 2015072776A1
Authority
WO
WIPO (PCT)
Prior art keywords
caprolactam
gene
expression
detecting
redesigned
Prior art date
Application number
PCT/KR2014/010951
Other languages
English (en)
French (fr)
Inventor
이승구
염수진
김하성
이대희
권길광
나유진
정흥채
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2015072776A1 publication Critical patent/WO2015072776A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • the present invention relates to a method for detecting and quantifying ⁇ -caprolactam using a redesigned gene circuit, and more particularly, to the method of ⁇ -caprolactam using a gene circuit capable of detecting ⁇ -caprolactam utilized as a precursor of nylon 6. It relates to a detection and quantification method.
  • ⁇ -caprolactam is a precursor for synthetic polymer nylon 6, synthetic leather and polyurethane linkers and is a monomer that is in the spotlight in the global market for $ 2,700 to 3,300.
  • (epsilon) -caprolactam is a lactam type organic compound of 6-aminohexanoic acid ( ⁇ -aminohexanoic acid, 6-amino capronic acid), and nylon-6 is produced by ring-opening polymerization reaction of ⁇ -caprolactam monomer.
  • the starting compound for producing ⁇ -caprolactam is benzene, benzene is converted to cyclohexane or phenol, and the cyclohexane or phenol is subjected to cyclohexanone to cyclohexanone oxime), which intermediate is heated under sulfuric acid.
  • This chemical reaction is known as the Beckman rearrangement.
  • the starting compound benzene is produced through the purification of petroleum compounds.
  • the process of producing ⁇ -caprolactam through a chemical reaction is increasing the need for bioprocessing technology research due to problems such as the use of benzene toxic substances, the generation of environmental pollution by-products and the use of strong oxidizing agents.
  • the present inventors have made intensive efforts to develop a method for detecting and quantifying ⁇ -caprolactam.
  • the nitR gene encoding the NitR protein which is a protein for detecting ⁇ -caprolactam
  • the NitR protein coupled with ⁇ -caprolactam By using a promoter of the nitR gene ( nitA ), which is induced by expression, a redesigned gene circuit for detecting ⁇ -caprolactam is produced, and when using a microorganism including the redesigned gene circuit, ⁇ -caprolactam is used. It has been confirmed that the present invention can be efficiently detected and quantified, and the present invention has been completed.
  • Another object of the present invention is to provide a recombinant microorganism for detecting ⁇ -caprolactam including a redesigned genetic circuit for detecting ⁇ -caprolactam.
  • Another object of the present invention to provide a method for detecting and quantifying ⁇ -caprolactam using the recombinant microorganism for detecting ⁇ -caprolactam.
  • the present invention (1) at least one selected from the group consisting of (i) nitR gene encoding a NitR protein that recognizes ⁇ -caprolactam; (ii) a gene encoding a fluorescent protein and an antibiotic resistance gene An ⁇ comprising a reporter gene, (iii) a promoter that regulates the expression of the nitR gene, and (iv) a nitA promoter that binds to the NitR (protein) that recognizes the ⁇ -caprolactam to induce expression of a downstream reporter gene
  • a redesigned genetic circuit for caprolactam detection Provides a redesigned genetic circuit for caprolactam detection.
  • the present invention also provides a recombinant microorganism for detecting ⁇ -caprolactam containing the redesigned gene circuit for detecting ⁇ -caprolactam.
  • the present invention also comprises the steps of: (a) contacting the ⁇ -caprolactam-detecting recombinant microorganisms with ⁇ -caprolactam-containing possible samples; And (b) detecting the presence of ⁇ -caprolactam by analyzing the activity of the reporter protein inducing expression by detecting ⁇ -caprolactam.
  • the present invention also comprises the steps of: (a) contacting a sample containing ⁇ -caprolactam for detecting a recombinant microorganism and ⁇ -caprolactam; And (b) analyzing the activity of the reporter protein induced by expression of the ⁇ -caprolactam present in the sample, thereby quantifying the ⁇ -caprolactam present in the sample. to provide.
  • FIG. 1 is a schematic diagram showing a biocaprolactam detection gene circuit (CL-GESS).
  • FIG. 2 is a schematic diagram showing the construction of a genetic circuit of CL-GESS.
  • Figure 3 is the result measured by the fluorescent plate reader to verify the sensitivity of the various substrates of CL-GESS.
  • Figure 4 is a result of measuring the samples cultured in a liquid medium with a fluorescent flow cytometer (FACS) in order to verify the performance of the CL-GESS and the quantification of various substrates.
  • FACS fluorescent flow cytometer
  • FIG. 5 (A): As a result of measuring the culture medium using eGFP and sfGFP for ⁇ -caprolactam as a fluorescent reporter in CL-GESS, (B): sfGFP quantification of ⁇ -caprolactam when using a fluorescent reporter It is a curve graph.
  • FIG. 6 is a schematic diagram showing the construction of a gene circuit having a repeating sequence of sfGFP as a fluorescent reporter and a NitR protein that recognizes a compound, in order to increase sensitivity to ⁇ -caprolactam of CL-GESS.
  • Figure 7 shows the sensitivity to ⁇ -caprolactam using a NitR protein that recognizes a compound of CL-GESS and a gene having a repeat sequence of sfGFP as a fluorescent reporter.
  • A M9 medium
  • B LB medium
  • each symbol is CL-GESS ( ⁇ ), CL-GESS-Double NitR ( ⁇ ), CL-GESS-Double sfGFP ( ⁇ ).
  • C-GESS biocaprolactam detection gene circuit
  • FIG. 9 shows the results of system validation and quantitative signal analysis for ⁇ -caprolactam of biocaprolactam detection gene circuits with nitA promoters of various lengths (Black bar: wild-type CLGESS circuit, white bar: CLGESS100, Dark gray bar: CLGESS200, Gray bar: CLGESS300).
  • T7-CLGESS-PL biocaprolactam detection gene circuit
  • FIG 11 shows the results of the biocaprolactam detection gene circuit (T7-CLGESS-PL) system verification and quantitative signal analysis for ⁇ -caprolactam incorporating the T7 promoter expression system.
  • FIG. 12 shows screening of caprolactam producing strains in a metakenome library in a solid medium using a biocaprolactam detection gene circuit system (CLGESS), followed by incubation of selected positive strains and aminocapronic acid in a liquid medium for 24 hours. Shows the results of signal analysis for ⁇ -caprolactam.
  • CLGESS biocaprolactam detection gene circuit system
  • the present invention (i) nitR gene encoding a NitR protein that recognizes ⁇ -caprolactam; (ii) one or more reporter genes selected from the group consisting of genes encoding fluorescent proteins and antibiotic resistance genes; (iii) a promoter that regulates expression of the nitR gene; And (iv) a redesigned gene circuit for detecting ⁇ -caprolactam, comprising a nitA promoter that binds NitR (protein) that recognizes the ⁇ -caprolactam to induce expression of a reporter gene downstream.
  • the present invention detects a variety of compounds using a redesigned genetic circuit, and eventually applies a technology (GESS: Green fluorescence linked enzyme screening system) (Korean Patent No. 1,222,056) to easily detect a variety of compound synthase activities with high sensitivity. It is applied to the detection and quantification of ⁇ -caprolactam, and it is a method to efficiently and quickly analyze quantification of ⁇ -caprolactam.
  • GESS Green fluorescence linked enzyme screening system
  • the synthetic gene circuit of the present invention is composed of a nitR gene encoding a NitR protein that recognizes ⁇ -caprolactam and a nitA promoter, which is a binding site thereof, wherein the NitR protein reacted in proportion to the amount of ⁇ -caprolactam is expressed in nitA promoter.
  • the redesigned genetic circuit capable of quantitatively analyzing the epsilon caprolactam.
  • ⁇ -caprolactam is a representative substrate of NitR protein, and quantitative fluorescence analysis can be performed by the ⁇ -caprolactam detection gene circuit produced by the present invention.
  • the ⁇ -caprolactam analysis method according to the present invention requires the construction of a redesigned genetic circuit for detecting and quantifying ⁇ -caprolactam.
  • the GESS circuit obtained in the previous study was redesigned to construct a new gene circuit, CL-GESS (FIG. 2).
  • Nitrilease (NitA, nitrilase) of Rhodococcus rhodochrous J1 has been reported to promote expression by ⁇ -caprolactam, which recognizes ⁇ -caprolactam penetrated into cells by NitR, a regulatory protein of nitrile decomposed operon By activating the nitA promoter that regulates NitA transcription (Arch. Microbiol, 1990, 155: 13), (PNAS, 1996, 93: 10572-10577). In addition, R.
  • rhodochrous J1-derived nitR -P nitA transcriptional regulators were heterologously recombined with Streptomyces species and applied to an expression system for inducing overexpression of the target protein, and were present downstream of the nitA promoter by an externally added ⁇ -caprolactam. There is a report that the expression of the gene of interest is effectively overexpressed (PNAS, 2004, 101: 14031).
  • nitR- P nitA transcriptional regulators are classified into XylS / AraC form of transcriptional regulators by complementary sequence analysis.
  • XylS / AraC transcriptional control group is characterized by the presence of a complementary Helix-turn-Helix sequence at the C-terminal end as an active type factor to recognize and bind to a specific genetic sequence and to act as a dimer. In general, it binds to a specific genetic sequence and structurally and physically restricts a gene, thereby inhibiting transcriptional expression, and when the target factor is recognized, the gene is structurally released to initiate transcriptional expression (Micobiol. Mol. Biol Rev 1997, 61 (4): 393-410).
  • the nitR gene and nitA promoter may be characterized in that the nitR gene and nitA promoter from a strain having nitrilase activity, the strain having the nitrilase activity is Aeribacillus pallidus , A. pallidus DAC521, A. pallidus RAPc8, Arabidopsis thaliana, Arthrobacter sp., Arthrobacter sp. J-1, Alcaligenes faecalis, A. faecalis JM3, A. faecalis ATCC 8750, A. faecalis MTCC 10757, A.
  • rhodochrous ATCC 39484 R. rhodochrous J1, R. rhodochrous K22, R. rhodochrous MTCC-291, R. rhodochrous PA-34, R. rhodochrous tg1-A6, Rhodococcus sp., Rhodococcus sp. ATCC39484, Rhodococcus sp. NCIMB 11215, Rhodococcus sp. NCIMB 11216, Rhodococcus sp. NDB 1165, Sorghum bicolor, Synechocystis sp., Synechocystis sp. It can be PCC6803 and Zea mays .
  • the nitR gene and nitA promoter encoding the NitR protein were derived from Alcaligenes faecalis JM3.
  • the A. faecalis JM3-derived nitR -P nitA system is regulated by ⁇ -caprolactam in the same way as the R. rhodochrous J1-derived gene and has been reported to be stably maintained in heterologous Escherichia coli ( Eur. J. Biochemistry). 1990, 194: 765-772), the present invention was applied to the genetic circuit for detecting ⁇ -caprolactam.
  • nitR- P nitA system derived from A. faecalis JM3
  • the regulatory protein capable of detecting the available ⁇ -caprolactam is also used as a regulatory protein of a strain that has been reported to be nitrified. Can be used.
  • the nitA promoter of the present invention may be characterized in that the fragment of 100bp ⁇ 300bp of the nucleotide sequence of SEQ ID NO: 2.
  • each obtained DNA is Gibson assembly method Through ligation, the CLGESS100, CLGESS200 and CLGESS300 redesigned genetic circuits were constructed, respectively (FIG. 8).
  • the redesigned gene circuit containing the fragment of the nitA promoter was found to have increased fluorescence amplification compared to the wild type CLGESS when the length of the nitA promoter was 200bp and 300bp compared to the wild type CLGESS circuit. In particular, it was confirmed that the fluorescence intensity of CLGESS was highest when the length of the nitA promoter was 200bp (FIG. 9).
  • the reporter gene and the promoter for regulating the expression of the reporter gene may be characterized in that they are operably linked, and the NitR protein that recognizes the caprolactam is combined to express the downstream reporter gene.
  • the site containing the nitA promoter to induce the NitR protein may be characterized by activating a promoter of a reporter gene so that the downstream reporter gene can be expressed.
  • the gene encoding the nitR gene for recognizing the ⁇ -caprolactam and the promoter for regulating the expression of the NitR protein may be characterized in that it is operably linked.
  • the fluorescent protein may be selected from the group consisting of GFP, GFP UV , sfGFP and RFP, and the antibiotic resistance gene is a group consisting of kanamycin resistance gene, chloramphenicol resistance gene and tetracycline resistance gene. It may be characterized in that selected from.
  • the redesigned gene circuit may include a gene encoding a ribosome binding site (RBS), wherein the reporter gene is a double reporter gene consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene It can be characterized by.
  • RBS ribosome binding site
  • the redesigned gene circuit may include not only the promoter, but preferably RBS (Ribosome Binding Site) and / or transcription terminator that facilitates expression of the reporter protein. That is, as a site for regulating the expression of the regulatory protein, in addition to the promoter, it may include RBS and / or transcription terminator.
  • RBS Ribosome Binding Site
  • E. coli RBS E. coli RBS (RBS ⁇ ), or RBS (RBSx) which can be used integrally in all strains, may be used. It may be available.
  • the transcription terminator may preferably be rrnBT1T2 or tL3, and besides this, any transcription terminator commonly used in the art may be used to constitute the present invention.
  • the reporter may be one or more selected from fluorescent proteins and antibiotic resistance genes.
  • the fluorescent protein preferably, GFP, GFP UV , sfGFP or RFP can be used, and as long as the object of the present invention can be achieved, the fluorescent protein that can be used in the present invention is not limited to these examples.
  • the antibiotic resistance gene may be a conventional antibiotic resistance gene such as genes resistant to antibiotics such as kanamycin, chloramphenicol and tetracycline.
  • the reporter may be a dual reporter composed of both a fluorescent protein and an antibiotic resistance gene, a multiple reporter composed of two or more reporters.
  • a gene encoding a T7 RNA polymerase is further inserted downstream of the nitA promoter, and a T7 promoter is further inserted upstream of the reporter gene, thereby inducing expression of the reporter gene.
  • NitR protein
  • NitR protein
  • a T7 promoter system was introduced to improve the quantitative detection of ⁇ -caprolactam of the redesigned genetic circuit.
  • the T7 promoter was introduced at the position of the promoter nitA , which induces the expression of a conventional fluorescent protein, and the T7 RNA polymerase gene was introduced at the lower portion of the promoter nitA to construct a T7CLGESS-PL plasmid version (FIG. 10).
  • the T7 CLGESS-PL gene circuit system constructed in the present invention was found to be fluorescence only by ⁇ -caprolactam, and confirmed that ⁇ -caprolactam of ⁇ M level was also detected, and the fluorescence sensitivity was also wild-type CLGESS gene. It was confirmed that it is superior to the circuit. As a result, it was confirmed that gene circuits having various sensibility can be selected and used according to gene circuits and media having various sensibility.
  • vector refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host.
  • the vector may be a plasmid, phage particles, or simply a potential genomic insert. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid” and “vector” are sometimes used interchangeably in the context of the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or known in the art. Typical expression vectors for mammalian cell culture expression are based on, for example, pRK5 (EP 307,247), pSV16B (WO 91/08291) and pVL1392 (Pharmingen).
  • expression control sequence refers to a DNA sequence essential for the expression of a coding sequence operably linked in a particular host organism.
  • regulatory sequences include promoters for performing transcription, any operator sequence for regulating such transcription, sequences encoding suitable mRNA ribosomal binding sites, and sequences that control termination of transcription and translation.
  • suitable control sequences for prokaryotes include promoters, optionally operator sequences, and ribosomal binding sites.
  • Eukaryotic cells include promoters, polyadenylation signals, and enhancers. The factor that most influences the amount of gene expression in the plasmid is the promoter.
  • an SR ⁇ promoter a promoter derived from cytomegalovirus, and the like are preferably used.
  • any of a wide variety of expression control sequences can be used in the vector.
  • useful expression control sequences include, for example, early and late promoters of SV40 or adenovirus, lac system, trp system, TAC or TRC system, T3 and T7 promoters, major operator and promoter region of phage lambda, fd Regulatory regions of the code protein, promoters for 3-phosphoglycerate kinase or other glycolysis enzymes, promoters of the phosphatase such as Pho5, promoters of the yeast alpha-crossing system and prokaryotic or eukaryotic cells or viruses thereof And other sequences of constitution and induction known to modulate the expression of the genes, and various combinations thereof.
  • the T7 RNA polymerase promoter ⁇ 10 is two. It can be usefully used to express protein NSP in E. coli.
  • Nucleic acids are "operably linked” when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to allow gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s).
  • the DNA for a pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence;
  • the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence;
  • the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation.
  • "operably linked” means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame.
  • enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.
  • expression vector generally refers to a fragment of DNA that is generally double stranded as a recombinant carrier into which fragments of heterologous DNA have been inserted.
  • heterologous DNA refers to heterologous DNA, which is DNA not naturally found in host cells.
  • the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host.
  • the expression control sequence and the gene of interest are included in one expression vector including the bacterial selection marker and the replication origin. If the expression host is a eukaryotic cell, the expression vector must further comprise an expression marker useful in the eukaryotic expression host.
  • the present invention relates to a recombinant microorganism for detecting ⁇ -caprolactam containing the redesigned gene circuit for detecting ⁇ -caprolactam.
  • the host microorganism into which the gene circuit is introduced may be E. coli, Pseudomonas, yeast, plant cells, animal cells and the like.
  • electroporation in order to transform the epsilon caprolactam sensing gene circuit into a suitable microbial host, in order to increase the efficiency of transformation, electroporation may be preferably used.
  • Host cells transformed or transfected with the expression vectors described above constitute another aspect of the present invention.
  • transformation means introducing DNA into a host so that the DNA is replicable as an extrachromosomal factor or by chromosomal integration.
  • transfection means that the expression vector is accepted by the host cell whether or not any coding sequence is actually expressed.
  • the host cell of the invention may be a prokaryotic or eukaryotic cell.
  • a host having a high DNA introduction efficiency and a high expression efficiency of the introduced DNA is usually used.
  • Well-known eukaryotic and prokaryotic hosts such as E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, yeast, insect cells such as Spodoptera pruperferida (SF9), animal cells such as CHO and mouse cells, COS 1, COS African green monkey cells such as 7, BSC 1, BSC 40 and BMT 10, and tissue cultured human cells are examples of host cells that can be used.
  • an animal cell As a host.
  • an animal cell In the present invention, but not limited to CHSE-214, FHM, RTG-2 and EPC of fish origin.
  • COS cells since SV40 large T antigen is expressed in COS cells, the plasmid having the origin of replication of SV40 is present as a large number of copies of the episome in the cells. Higher expression can be expected.
  • the introduced DNA sequence may be obtained from the same species as the host cell, may be of a different species than the host cell, or it may be a hybrid DNA sequence comprising any heterologous or homologous DNA.
  • the relative strength of the sequence, the controllability, and the compatibility with the DNA sequences of the present invention should be considered, particularly with regard to possible secondary structures.
  • Single cell hosts may be selected from a host for the selected vector, the toxicity of the product encoded by the DNA sequence of the invention, the secretory properties, the ability to accurately fold the protein, the culture and fermentation requirements, the product encoded by the DNA sequence of the invention from the host. It should be selected in consideration of factors such as the ease of purification. Within the scope of these variables, one skilled in the art can select a variety of vector / expression control sequence / host combinations capable of expressing the DNA sequences of the invention in fermentation or large scale animal culture.
  • binding method binding method
  • panning method panning method
  • film emulsion method film emulsion method
  • substantially pure in the definition of the present invention is meant that the polypeptide according to the present invention and the DAN sequence encoding the polypeptide are substantially free of other proteins derived from bacteria.
  • Host cells for expressing recombinant proteins are widely used by prokaryotic cells, such as Escherichia coli and Bacillus subtillis , which are capable of culturing high concentrations of cells in a short time, are easily genetically engineered, and whose genetic and physiological characteristics are well known. Has been.
  • prokaryotic cells such as Escherichia coli and Bacillus subtillis
  • yeast strains Pchia pastoris, Saccharomyces cerevisiae, Hansenula polymorpha
  • coli which is used as a host cell for recombinant protein production from higher organisms such as filamentous fungi, insect cells, plant cells, and mammalian cells, etc.). As well as using other host cells is readily applicable to those of ordinary skill in the art.
  • the present invention comprises the steps of (a) contacting the ⁇ -caprolactam detection recombinant microorganisms with ⁇ -caprolactam-containing sample; And (b) detecting the presence of ⁇ -caprolactam by analyzing the activity of an expression-induced reporter protein by detecting ⁇ -caprolactam.
  • the present invention comprises the steps of (a) contacting a sample containing ⁇ -caprolactam for detecting the recombinant microorganism and ⁇ -caprolactam; And (b) analyzing the activity of the reporter protein, the expression of which is induced by ⁇ -caprolactam present in the sample, to quantify ⁇ -caprolactam present in the sample. It is about.
  • the activity of the reporter protein can be measured using microbial colony image analysis, fluorescence spectrum analysis, fluorescence flow cytometry (FACS), antibiotic resistance measurement.
  • the microorganism transformed with the gene circuit is a sensing microorganism capable of detecting ⁇ -caprolactam.
  • the substrate addition timing may be adjusted to separate the activation steps of the cell growth-redesigned gene circuit in order to optimize the sensing response.
  • the substrate treatment step may comprise recovering healthy microorganisms grown in nutrient media and treating the recovered microorganisms with the substrate in minimal media.
  • the nutritional medium or minimal medium will be applicable to a variety of media that can be used generally in the art.
  • the substrate may be treated to optimize the enzyme activation reaction, and more preferably, the enzyme reaction proceeds for 8 to 16 hours.
  • the reaction can be optimized.
  • the fluorescent protein and antibiotic resistance protein used as a reporter in the present invention can not only apply a highly sensitive measurement method, but also are characterized in that the foreign gene is expressed in the cell because it is limited to a specific cell without passing through the cell membrane. Will be used individually. Therefore, since each single cell plays the role of an independent reactor and analyzer, it is a means to detect the activity of the reporter induced expression by detecting ⁇ -caprolactam liberated by enzymatic reaction. Bulk samples can be measured using a fluorescence flow cytometer (FACS), micro-colony fluorescence image analysis, fluorescence spectrum analysis, mass search using antibiotic selection medium, and the like.
  • FACS fluorescence flow cytometer
  • the biocaprolactam inversion process of Escherichia coli DH5 ⁇ introduced CL-GESS through heat shock for system verification and quantitative signal analysis of ⁇ -caprolactam of the redesigned genetic circuit constructed in the present invention.
  • a solid medium containing a substrate L-lysine, 6-aminocaproic acid, amino-caprolactam
  • the medium containing ⁇ -caprolactam It was confirmed that fluorescent colonies were specifically observed for E. coli grown in.
  • the present invention comprises the steps of (a) contacting the metagenomic library sample with the recombinant microorganism for detecting ⁇ -caprolactam; (b) analyzing the activity of the reporter protein whose expression is induced by ⁇ -caprolactam present in the sample to quantify ⁇ -caprolactam in the sample; And (c) selecting a strain contained in the ⁇ -caprolactam-containing sample as an ⁇ -caprolactam producing strain.
  • the step of contacting the ⁇ -caprolactam detection recombinant microorganisms with the metagenomic library sample is co-cultured strains of the metagenomic library and ⁇ -caprolactam detection recombinant microorganisms, or the ⁇ -caprolactam detection For recombinant microorganisms can be carried out by treating the culture medium of the strain contained in the metagenome library.
  • the present invention is to redesign the GESS gene circuit (Republic of Korea Patent Publication No. 2010-0131995) obtained in the previous research in order to build a redesigned genetic circuit for detecting ⁇ -caprolactam generated from various precursors by enzymes CL-GESS, a genetic circuit, was constructed (FIG. 1).
  • pGESS-T2 which is a GESS plasmid, was prepared by the method described in Korean Patent Publication No. 2010-0131995, and the manufacturing method is as follows.
  • PCR amplification of 425 bp rrnBT1T2 transcription terminator from the pHCEIIB vector (Bioreaders, Korea) with SEQ ID NOs: 3 and 4 primers, PCR product of dmpR and dmp operatorpromoter regions from the pGESS-T1, and GFP reporter protein portion was amplified by the primers of SEQ ID NOs: 5 and 6, and inserted into the C-terminus of the GFP reporter protein by homologous recombination.
  • PGESS-T1-1 is composed of 5,901bp is a clone of the transcription terminator inserted into the reporter protein of pGESS-T1.
  • the tL3 transcription terminator which was digested with pGESS-T1-1 by EcoRI and PCR amplified from pKD46 vector with SEQ ID NOs: 7 and 8 primers, was ligated to the C-terminus of dmpR and introduced into E. coli by electroporation.
  • PGESS-T2 was configured,
  • transcription factors NitR protein and mutual reporter protein sequence located downstream nitA promoter (P nitA) and nitA promoter action to be located in nitR gene in the opposite direction to unnecessary for expression of the genes Interference was excluded.
  • the transcriptional regulator nitR was obtained by PCR (polymerase chain reaction) using the primers of SEQ ID NOs: 9 and 10 after extracting the genome of the A. faecalis strain, and the nitA promoter was identically sequenced using the A. faecalis genome as a template. Obtained by PCR using primers 11, 12. Finally, the obtained P nitA - nitR -P nitR gene fragment finally constituted CL-GESS through a PCR reaction (FIG. 2).
  • the fluorescence level of Escherichia coli DH5 ⁇ having the CL-GESS system was observed using a fluorescence microscope (Nicon AZ100-M, Japan). As shown in FIG. 3, the specificity of E. coli grown in the medium containing ⁇ -caprolactam was shown. It was confirmed that fluorescent colonies were observed.
  • Escherichia coli DH5 ⁇ single colony in which CL-GESS was introduced through heat shock was inoculated into LB liquid medium containing 50 ⁇ g / ml of ampicillin for 12 hours at 37 ° C.
  • Shake culture was performed.
  • Stomach cultures were inoculated with 1% of M9 minimal liquid medium to which 50 ⁇ g / ml of ampicillin was added, followed by shaking culture at 37 ° C. for 6 hours.
  • L-lysine its intermediates (6-aminocaproic acid, amino-caprolactam) and ⁇ -caprolactam were added at 0.5% concentration, as shown in FIG. 4, 0.5% L-lysine (Lys), 0.5% 6 Fluorescence was not detected in the sample added with -aminocaproic acid (6-ACA) and 0.5% amino-caprolactam (ACL) as in the control group without addition, but was detected in the sample added with 0.5% ⁇ -caprolactam. It could be confirmed.
  • the CL-GESS system constructed in the present invention was found to be fluorescence only by ⁇ -caprolactam, it was confirmed that can detect the ⁇ -caprolactam of the mM level.
  • promoters of 100 bp, 200 bp, and 300 bp in length based on RBS were respectively primers of SEQ ID NOs: 17, 20, and primers of SEQ ID NOs: 18, 20, respectively.
  • SEQ ID NO: 19 By using PCR primers SEQ ID NO: 19, 20, was secured.
  • the backbone portion to clone the remaining 100bp, 200bp, 300bp length of the promoter is secured by PCR reaction using primers of SEQ ID NO: 21, 22, primers of SEQ ID NO: 21, 23, and primers of SEQ ID NO: 21, 24, respectively. It was.
  • Each of the obtained DNAs was ligated through the Gibson assembly to construct CLGESS100, CLGESS200, and CLGESS300 redesigned genetic circuits, respectively (FIG. 8).
  • the nitA promoter of 100bp in length does not detect fluorescence.
  • the fluorescence amplification was increased compared to the wild type CLGESS.
  • the fluorescence intensity of CLGESS was highest when the length of the nitA promoter was 200bp (FIG. 9).
  • the T7 promoter system was introduced.
  • the T7 promoter was introduced at the position of promoter nitA which induces the expression of the existing fluorescent protein, and the T7 RNA polymerase gene was introduced at the lower portion of promoter nitA to construct the T7CLGESS plasmid version (FIG. 10).
  • E. coli DH5 ⁇ single colony that introduced the T7 CLGESS-PL gene circuit through heat shock to confirm the quantitative detection function of ⁇ -caprolactam of the T7 CLGESS-PL (plasmid version) redesigned gene circuit constructed in Example 6 was inoculated in LB liquid medium to which 50 ⁇ g / ml of ampicillin was added, followed by shaking culture at 37 ° C. for 12 hours.
  • 1% of the gastric culture was inoculated into LB liquid medium containing 50 ⁇ g / ml ampicillin, and each test tube was inoculated with ⁇ -caprolactam 0 ⁇ M, 0.1 ⁇ M, 1 ⁇ M, 5 ⁇ M, 10 ⁇ M, 25 ⁇ M, 50 ⁇ M, 100 ⁇ M, 500 ⁇ M and Fluorescence was induced by addition at 1000 ⁇ M concentration and shaken for 18 hours at 37 ° C. Induced intracellular fluorescence was measured by transferring a 200 ⁇ l cell culture medium to a plate using a fluorescence plate reader (Perkin Elmer Victor V) and comparing the fluorescence values with respect to the cell volume (OD 600 ).
  • ⁇ -caprolactam 0 ⁇ M, 0.1 ⁇ M, 1 ⁇ M, 5 ⁇ M, 10 ⁇ M, 25 ⁇ M, 50 ⁇ M, 100 ⁇ M, 500 ⁇ M and Fluorescence was induced by addition at 1000 ⁇ M concentration and shaken for 18 hours at 37 ° C. Induced intracellular fluorescence was
  • the T7 CLGESS-PL gene circuit system constructed in the present invention is fluorescence-expressed only by ⁇ -caprolactam, and it is also possible to detect ⁇ -caprolactam at a ⁇ M level. It was also confirmed that the wild type CLGESS gene circuit is superior to. As a result, it was confirmed that the gene circuit having various sensibility and the gene circuit having various sensibility according to the medium can be selected and used (FIG. 11).
  • E. coli strains to detect caprolactam convertase E. coli EPI300 (EPicentre, USA) by using the DE3 Lysogenization Kit (Novagen, USA) by inserting DE3 into chromosomal DNA to secure E. coli EPI300 (DE3).
  • a metagenome library derived from a tidal flat and a CLGESS prepared in Example 1 were co-transformed into E. coli EPI300 (DE3), 50 mM aminocaproic acid, 100 ⁇ g / ml ampicillin, 34 Fluorescence was induced by plating on LB solid medium containing ⁇ g / ml chloramphenicol and incubating at 37 ° C for 24 hours. The fluorescence degree of single colonies on solid medium was observed using a fluorescence microscope (Nicon AZ100-M, Japan). As a result, single colonies with fluorescence expression within the top 5% were selected.
  • Single colonies selected for secondary selection were inoculated in LB liquid medium containing 100 ⁇ g / ml ampicillin and 34 ⁇ g / ml chloramphenicol and shaken at 37 ° C. for 12 hours.
  • the gastric cultures were placed in LB liquid medium containing 50 mM aminocapronic acid, 100 ⁇ g / ml ampicillin, 34 ⁇ g / ml chloramphenicol and LB liquid medium containing 100 ⁇ g / ml ampicillin, 34 ⁇ g / ml chloramphenicol as a control. Fluorescence was induced by shaking culture at 37 ° C. for 24 hours after each inoculation.
  • the redesigned genetic circuit that recognizes ⁇ -caprolactam according to the present invention enables the ⁇ -caprolactam regulator gene to induce the expression of fluorescent protein in proportion to the amount of ⁇ -caprolactam, thereby rapidly detecting and quantifying ⁇ -caprolactam There is an effect that can be used for purposes such as quantitative analysis of ⁇ -caprolactam and activity analysis of ⁇ -caprolactam biosynthetic enzyme.
  • the present invention it is possible to detect a very small amount of ⁇ -caprolactam of about 0.1 ⁇ M, and it is possible to analyze a cell unit that was not possible in the past. Therefore, a novel ⁇ -caprolactam producing strain from the microbial metagenome library through high-speed search and In the process of searching for genes, the present invention can be efficiently used.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 재설계 유전자 회로를 이용한 ε-카프로락탐의 감지 및 정량 방법에 관한 것으로, 더욱 자세하게는 나일론 6의 전구체로 활용되는 ε-카프로락탐을 감지할 수 있는 유전자 회로를 이용한 ε-카프로락탐의 분석 및 정량방법에 관한 것이다. 본 발명에 따른 ε-카프로락탐을 인지하는 재설계 유전자회로는 ε-카프로락탐의 양에 비례하여 ε-카프로락탐 조절유전자가 형광단백질의 발현을 유도하도록 함으로써, ε-카프로락탐을 빠르게 감지 및 정량화할 수 있어, ε-카프로락탐의 정량적 분석 및 ε-카프로락탐 생합성 효소의 활성 분석 등의 목적에 이용할 수 있는 효과가 있다. 본 발명을 통해 0.1 μM 정도의 극미량의 ε-카프로락탐도 고감도로 감지 가능하며, 기존에는 불가능하였던 세포 단위의 분석이 가능하므로, 고속 탐색을 통해 미생물 메타게놈 라이브러리로부터 신규 ε-카프로락탐 생산 균주 및 유전자를 탐색하는 과정에도 본 발명의 효율적 이용이 가능하다.

Description

재설계 유전자 회로를 이용한 ε카프로락탐의 감지 및 정량 방법
본 발명은 재설계 유전자 회로를 이용한 ε-카프로락탐의 감지 및 정량방법에 관한 것으로, 더욱 자세하게는 나일론 6의 전구체로 활용되는 ε-카프로락탐을 감지할 수 있는 유전자회로를 이용한 ε-카프로락탐의 감지 및 정량 방법에 관한 것이다.
ε-카프로락탐 (ε-caprolactam)은 합성 폴리머 나일론 6, 합성 가죽, 폴리우레탄 링커의 전구체로 활용되는 물질로서 세계 시장에서 톤당 $2,700 ~ 3,300으로 각광받고 있는 모노머이다. ε-카프로락탐은 6-아미노헥산산 (ε-아미노헥산산, 6-아미노 카프론산)의 락탐형 유기 화합물로, ε-카프로락탐 단량체의 개환 중합 반응에 의해 나일론-6가 생산된다. ε-카프로락탐을 생산하기 위한 출발 화합물은 벤젠으로, 벤젠은 시클로헥산(cyclohexane) 또는 페놀(phenol)로 전환되고, 상기 시클로헥산 또는 페놀은 시클로헥사논 (cyclohexanone)을 거쳐 시클로헥사논 옥심(cyclohexanone oxime)이 되고, 이 중간체는 황산 하에서 가열된다. 이 화학 반응은 베크만 전위(Beckman rearrangement)라고 알려져 있다. 상기 출발 화합물인 벤젠은 석유 화합물들의 정제를 통해 생산된다. 하지만, 화학반응을 통해 ε-카프로락탐을 생산하는 공정은 독성물질인 벤젠의 사용, 환경오염 부산물의 생성 및 강산화제 사용 등의 문제점으로 인해 바이오공정 기술연구에 대한 필요성이 증가하고 있는 추세이다.
현재, 다른 방법으로서 바이오 생합성 과정을 통해 ε-카프로락탐의 전구체인 6-아미노헥사에노익산을 효소적 방법으로 전환하는 방법 (미국 공개특허 제2009-0137759호), 6-아미노 카프론산, ε-카프로락탐, 헥사메틸렌디아민 또는 레불린산 경로를 가지는 비-천연 미생물 유기체 (미국 공개특허 제2010-0317069), 아디페이트, 6-아미노 카프론산 또는 ε-카프로락탐 통로를 가지는 비-천연 미생물 유기체 (미국 등록특허 제7799545)에 관해 연구가 이루어지고 있다.
이에 따라 생산된 ε-카프로락탐의 신속하고 정확한 감지 및 정량 방법이 매우 필요한 실정이다. 하지만, 현재까지 보고된 ε-카프로락탐 정량 방법은 전형적인 방법으로서 HPLC (High Performance Liguid chromatography) 및 LC-MS 를 이용한 분석법만이 현재 이용되고 있다 (Juana Bustos et al. Eur Food Res Technol (2009) 230:303~313). 하지만 이러한 분석기계를 통한 방법은 고가의 장비와 고가의 크로마토그래피 컬럼 (column) 이 확보 되어야 하고, 분석하기 위하여 불순물 제거 및 효소, 미생물 등의 제거 목적으로 여과 및 전 처리가 필요하며, 컬럼과 분석 조건에 따라 다르지만, 1-10 mM 이상 농도의 시료만이 감지할 수 있다. 또한 이는 결국 세포 밖의 1-10 mM 이상 ε-카프로락탐만이 제한적으로 정량할 수 있는 단점이 있다.
최근에 세포내에서 다양한 화합물을 감지할 수 있는 조절인자를 이용한 유전자 회로에 관한 연구가 진행되고 있다. 구체적으로 페놀계 화합물과 이소프렌류, 톨루엔류 및 벤젠류 화합물을 유전자 회로의 형광 발현을 통해 감지할 수 있는 유전자회로가 보고되었다 (대한민국 등록특허 제1,222,056호). 이를 통해 미생물내의 소량의 화합물도 감지 및 정량할 수 있고, 그에 따른 신규 효소 탐색방법이 연구되었다. 또한 유전자 회로를 이용한 효소 탐색방법을 이용하게 되면, 환경이나 메타게놈 라이브러리를 비롯한 다양한 유전자 집단에서 유용유전자를 감지할 수 있고, 화합물에 대한 민감도와 발현조절을 이용하여 다양한 효소 활성을 고감도로 빠르게 감지 및 정량할 수 있다. 하지만, 이러한 다양한 연구 배경 및 장점에도 불구하고 ε-카프로락탐 화합물을 감지할 수 있는 유전자 회로는 아직 보고된 바가 없다.
이에, 본 발명자들은 ε-카프로락탐을 감지 및 정량할 수 있는 방법을 개발하고자 예의 노력한 결과, ε-카프로락탐을 감지하는 단백질인 NitR 단백질을 코딩하는 nitR 유전자와 ε-카프로락탐과 결합된 NitR 단백질에 의하여 발현이 유도되는 nitR 유전자의 프로모터(nitA)를 이용하여, ε-카프로락탐을 감지하는 재설계 유전자회로를 제작하고, 상기 재설계 유전자회로를 포함하는 미생물을 이용할 경우, ε-카프로락탐을 효율적으로 감지 및 정량할 수 있는 것을 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 ε-카프로락탐을 감지하기 위한 재설계 유전자 회로를 제공하는데 있다.
본 발명의 다른 목적은 ε-카프로락탐을 감지하기 위한 재설계 유전자 회로를 포함하는 ε-카프로락탐 감지용 재조합 미생물을 제공하는데 있다.
본 발명의 또다른 목적은 상기 ε-카프로락탐 감지용 재조합 미생물을 이용한 ε-카프로락탐 감지 및 정량방법을 제공하는데 있다.
상기의 목적을 달성하기 위하여, 본 발명은 ((i) ε-카프로락탐을 인지하는 NitR 단백질을 코딩하는 nitR 유전자; (ii) 형광 단백질을 코딩하는 유전자 및 항생제 저항성 유전자로 구성된 군에서 선택된 하나 이상의 리포터 유전자; (iii) 상기 nitR 유전자의 발현을 조절하는 프로모터; 및 (iv) 상기 ε-카프로락탐을 인지한 NitR (단백질)이 결합하여 하류의 리포터 유전자의 발현을 유도하는 nitA 프로모터를 포함하는 ε-카프로락탐 감지용 재설계 유전자회로를 제공한다.
본 발명은 또한, 상기 ε-카프로락탐 감지용 재설계 유전자회로를 함유하는 ε-카프로락탐 감지용 재조합 미생물을 제공한다.
본 발명은 또한, (a) 상기 ε-카프로락탐 감지용 재조합 미생물과 ε-카프로락탐 함유 가능성 있는 샘플을 접촉시키는 단계; 및 (b) ε-카프로락탐을 감지하여 발현이 유도된 리포터 단백질의 활성을 분석하여 ε-카프로락탐의 존재 여부를 감지하는 단계를 포함하는 ε-카프로락탐의 감지방법을 제공한다.
본 발명은 또한, (a) 상기 ε-카프로락탐 감지용 재조합 미생물과 ε-카프로락탐을 함유하는 샘플을 접촉시키는 단계; 및 (b) 상기 샘플 내에 존재하는 ε-카프로락탐에 의해 발현이 유도된 리포터 단백질의 활성을 분석하여, 샘플 내에 존재하는 ε-카프로락탐을 정량하는 단계를 포함하는 ε-카프로락탐의 정량방법을 제공한다.
본 발명의 다른 특징 및 구현예는 다음의 상세한 설명 및 첨부된 특허청구범위로부터 더욱 명백해 질 것이다.
도 1은 도 1은 바이오카프로락탐 탐지 유전자 회로(CL-GESS)를 나타낸 모식도이다.
도 2은 CL-GESS의 유전자 회로의 구축을 나타낸 모식도이다.
도 3는 CL-GESS의 여러 기질에 대한 감도를 검증하기 위하여 형광 플레이트 리더로 측정한 결과이다.
도 4는 CL-GESS의 성능 및 여러 기질에 대한 정량성을 검증하기 위하여 액체배지에서 배양한 시료를 형광유세포 분석기(FACS)로 측정한 결과이다.
도 5은 (A): CL-GESS에서 형광리포터로서 ε-카프로락탐에 대한 eGFP 와 sfGFP 를 사용한 배양액을 측정한 결과, (B): sfGFP 를 형광 리포터를 사용하였을 때 ε-카프로락탐에 대한정량 곡선 그래프이다.
도 6은 CL-GESS의 ε-카프로락탐에 대하여 민감도를 증가시키기 위해, 화합물을 인지하는 NitR 단백질과 형광리포터로서 sfGFP 의 반복 서열이 있는 유전자 회로의 구축을 나타낸 모식도이다.
도 7은 CL-GESS의 화합물을 인지하는 NitR 단백질과 형광리포터로서 sfGFP 의 반복 서열이 있는 유전자를 이용하여, ε-카프로락탐에 대하여 민감도를 나타낸 결과이다. 구체적으로 (A) : M9 배지 (B) : LB 배지이고, 각각의 심볼은 CL-GESS (●), CL-GESS-Double NitR (○), CL-GESS-Double sfGFP (▼) 이다.
도 8은 다양한 길이의 nitA 프로모터를 가진 바이오카프로락탐 탐지 유전자 회로(CL-GESS)를 나타낸 것이다.
도 9는 다양한 길이의 nitA 프로모터를 가진 바이오카프로락탐 탐지 유전자 회로의 시스템 검증 및 ε-카프로락탐에 대한 정량적 신호 분석 결과를 나타낸 것이다 (Black bar : 야생형 CLGESS 회로, white bar : CLGESS100, Dark grey bar: CLGESS200, Grey bar: CLGESS300).
도 10은 T7 프로모터 발현 시스템을 도입한 바이오카프로락탐 탐지 유전자 회로(T7-CLGESS-PL)를 나타낸 것이다.
도 11은 T7 프로모터 발현 시스템을 도입한 바이오카프로락탐 탐지 유전자 회로(T7-CLGESS-PL) 시스템 검증 및 ε-카프로락탐에 대한 정량적 신호 분석 결과를 나타낸 것이다.
도 12은 바이오카프로락탐 탐지 유전자 회로 시스템 (CLGESS)를 이용하여 메타케놈 라이브러리에서 카프로락탐 생산균주를 고체배지에서 스크리닝한후 선별된 positive 균주와 아미노카프론산을 액체배지에서 24시간 배양 후 그에 따라 생성된 ε-카프로락탐에 대한 신호 분석 결과를 나타낸 것이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명은 (i) ε-카프로락탐을 인지하는 NitR 단백질을 코딩하는 nitR 유전자; (ii) 형광 단백질을 코딩하는 유전자 및 항생제 저항성 유전자로 구성된 군에서 선택된 하나 이상의 리포터 유전자; (iii) 상기 nitR 유전자의 발현을 조절하는 프로모터; 및 (iv) 상기 ε-카프로락탐을 인지한 NitR (단백질)이 결합하여 하류의 리포터 유전자의 발현을 유도하는 nitA 프로모터를 포함하는 ε-카프로락탐 감지용 재설계 유전자회로에 관한 것이다.
본 발명은 재설계 유전자회로를 이용하여 다양한 화합물을 감지하여, 결국 다양한 화합물 합성 효소 활성을 고감도로 간편하게 감지하는 기술 (GESS: Green fluorescence linked enzyme screening system)(대한민국 등록특허 제1,222,056호)를 응용하여, ε-카프로락탐 감지 및 정량에 적용한 것으로, ε-카프로락탐의 정량을 효율적으로 신속하고 고감도로 분석할 수 있는 방법이다.
본 발명의 합성 유전자 회로는 ε-카프로락탐을 인지하는 NitR 단백질을 코딩하는 nitR 유전자와 그 결합부위인 nitA 프로모터로 구성되며, ε-카프로락탐의 양에 비례하여 이와 반응한 NitR 단백질이 nitA 프로모터의 전사 조절을 매개하여 형광단백질의 발현을 유도하도록 함으로써, 최종적으로 ε-카프로락탐을 정량적으로 분석 가능한 재설계 유전자 회로라고 할 수 있다. 도 1에 나타낸 바와 같이 ε-카프로락탐은 NitR 단백질의 대표적인 기질로써, ε-카프로락탐을 본 발명에서 제작한 ε-카프로락탐 감지 유전자 회로에 의해 정량적인 형광 분석을 할 수 있다.
본 발명에 따른 ε-카프로락탐 분석방법은 ε-카프로락탐을 감지 및 정량하기 위한 재설계 유전자회로를 구축이 필요하다. 이를 위하여 선행 연구에서 얻어진 GESS 회로를 재설계하여 새로운 유전자회로인 CL-GESS를 구축하였다 (도 2).
Rhodococcus rhodochrous J1 의 니트릴라아제 (NitA, nitrilase)는 ε-카프로락탐에 의해 발현이 촉진된다고 보고되어 있고, 이는 니트릴(nitrile)분해 오페론의 조절단백질인 NitR이 세포 내에 투과된 ε-카프로락탐을 인식하여 NitA 전사를 조절하는 nitA 프로모터를 활성화 시키는 과정에 의한 것으로 확인되었다 (Arch. Microbiol, 1990, 155:13), (PNAS, 1996, 93:10572-10577). 또한, R. rhodochrous J1 유래 nitR-PnitA 전사조절 인자는 Streptomyces 종에 이종 재조합되어 목적 단백질의 과발현 유도를 위한 발현 시스템에 적용되었으며, 외부에서 첨가된 ε-카프로락탐에 의해 nitA 프로모터 하류에 존재하는 목적 유전자의 발현이 효과적으로 과발현된다는 보고가 있다 (PNAS, 2004, 101:14031).
상기 nitR-PnitA 전사조절 인자는 상보적인 서열 분석에 의하여 XylS/AraC 형태의 전사조절 인자군으로 분류된다. XylS/AraC 전사조절군은 활성형 인자로서 C-말단부에 상보적인 Helix-turn-Helix 서열이 존재하여 특정 유전서열을 인식하여 결합하며 이량체로 역할을 하는 것을 특징으로 한다. 일반적으로 특정 유전서열에 결합되어 해당하는 유전자를 구조적ㅇ물리적으로 제한을 주어 전사발현을 저해하다가 목적 인자가 인식되면 유전자의 구조적인 풀어주어 전사발현을 개시하도록 하는 특징을 갖는다(Micobiol. Mol. Biol. Rev 1997, 61(4): 393-410).
상기 nitR 유전자 및 nitA 프로모터는 나이트릴레이즈 (nitrilase) 활성이 있는 균주 유래의 nitR 유전자 및 nitA 프로모터인 것을 특징으로 할 수 있으며, 상기 상기 나이트릴레이즈 (nitrilase) 활성이 있는 균주는 Aeribacillus pallidus, A. pallidus DAC521, A. pallidus RAPc8, Arabidopsis thaliana, Arthrobacter sp., Arthrobacter sp. J-1, Alcaligenes faecalis, A. faecalis JM3, A. faecalis ATCC 8750, A. faecalis MTCC 10757, A. faecalis MTCC 126, Alcaligenes sp., Alcaligenes sp. ECU0401, Aspergillus niger, A. niger K10, Fusarium solani, F. solani IMI 196840, F. solani O1, Mus musculus, Sorghum bicolor, Homo sapiens, Acidovorax facilis, A. facilis 72W, Acinetobacter sp., Agrobacterium sp., Arabis hirsuta, Bacillus subtilis, B. subtilis E9, Bacillus sp., Bacillus sp. OxB-1, Bacillus sp. UG-5B, Bradyrhizobium japonicum, B. japonicum USDA110, Brassica napus, B. rapa, B. rapa subsp. pekinensis, Comamonas testosteroni, Fusarium oxysporum, F. oxysporum f. sp. melonis, Gibberella moniliformis, Halomonas sp. alphaCH3, Hordeum vulgare, Klebsiella pneumoniae, K. pneumoniae subsp. ozaenae, Nocardia. globerula, N. globerula NHB-2, Nocardia sp., Penicillium marneffei, P. multicolor, Pseudomonas fluorescens, P. fluorescens 11387, P. fluorescens EBC 191, P. putida, P. putida 11388, P. putida MTCC 5110, Pseudomonas sp., Rhizobium sp. 11401, Rhodobacter sphaeroides, R. sphaeroides LHS-305, Rhodococcus equi, R. equi CCTCC.M.205114, R. fascians, R. fascians MTCC-1531, R. rhodochrous, R. rhodochrous ATCC 33278, R. rhodochrous ATCC 39484, R. rhodochrous J1, R. rhodochrous K22, R. rhodochrous MTCC-291, R. rhodochrous PA-34, R. rhodochrous tg1-A6, Rhodococcus sp., Rhodococcus sp. ATCC39484, Rhodococcus sp. NCIMB 11215, Rhodococcus sp. NCIMB 11216, Rhodococcus sp. NDB 1165, Sorghum bicolor, Synechocystis sp., Synechocystis sp. PCC6803 및 Zea mays일 수있다.
본 발명의 일 양태에서는 NitR 단백질을 코딩하는 nitR 유전자와 nitA 프로모터는 Alcaligenes faecalis JM3 유래의 것을 사용하였다. A. faecalis JM3 유래 nitR-PnitA 시스템은 상기 R. rhodochrous J1 유래의 유전자와 동일하게 ε-카프로락탐에 의한 발현조절이 되며 이종인 대장균 내에서도 안정적으로 효과가 유지된다는 보고가 있어 (Eur. J. Biochemistry 1990, 194:765-772), 본 발명에서는 ε-카프로락탐을 감지하는 유전자 회로에 적용하였다. 하지만 본 발명에 있어서, A. faecalis JM3 유래 nitR-PnitA 시스템으로만 제한하는 것은 아니며, 사용가능한 ε-카프로락탐을 감지할 수 있는 조절 단백질은 나이트릴레이즈가 보고 되어 있는 균주의 조절 단백질로도 사용될 수 있다.
본 발명의 상기 nitA 프로모터는 서열번호 2의 염기서열 중 100bp~300bp의 단편인 것을 특징으로 할 수 있다.
본 발명의 일양태에서는 nitA 프로모터의 단편을 클로닝하기 위하여, CLGESS 유전자 회로를 주형으로 이용하여, RBS를 기준으로 100bp, 200bp, 300bp 의 길이의 프로모터를 확보하고, 확보된 각각의 DNA를 Gibson assembly 방법을 통하여, 라이게이션 시켜서 각각 CLGESS100, CLGESS200 및 CLGESS300 재설계 유전자 회로를 구성하였다 (도 8). 상기 nitA 프로모터의 단편을 함유한 재설계 유전자 회로는 야생형 CLGESS 회로와 비교해 보았을 때, nitA 프로모터의 길이가 200bp 및 300bp의 경우 야생형 CLGESS 에 비하여 형광 증폭이 증가하는 것을 확인할 수 있었다. 특히 nitA 프로모터의 길이가 200bp의 경우의 CLGESS 의 형광 세기가 가장 높은 것을 확인할 수 있었다 (도 9).
본 발명에 있어서, 상기 리포터 유전자와 상기 리포터 유전자의 발현을 조절하는 프로모터는 상호작동가능하게 연결되어 있는 것을 특징으로 할 수 있고, 상기 카프로락탐을 인지하는 NitR 단백질이 결합하여 하류의 리포터 유전자의 발현을 유도하는 nitA 프로모터가 포함된 부위는 상기 NitR 단백질이 결합하여 하류의 리포터 유전자가 발현될 수 있도록 리포터유전자의 프로모터를 활성화하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 ε-카프로락탐을 인식하는 nitR 유전자를 코딩하는 유전자와 상기 NitR 단백질의 발현을 조절하는 프로모터는 상호작동가능하게 연결되어 있는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 형광단백질은 GFP, GFPUV, sfGFP 및 RFP로 구성된 군으로부터 선택되는 것을 특징으로 할 수 있고, 상기 항생제 저항성 유전자는 카나마이신 저항성 유전자, 클로람페니콜 저항성 유전자 및 테트라사이클린 저항성 유전자로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 재설계 유전자회로는 RBS (ribosome binding site)를 코딩하는 유전자를 포함하는 것을 특징으로 할 수 있고, 상기 리포터 유전자는 형광 단백질을 코딩하는 유전자 및 항생제 저항성 유전자로 구성된 이중 리포터 유전자인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 재설계 유전자회로는, 상기 프로모터뿐만 아니라, 바람직하게는, 리포터 단백질의 발현을 용이하게 해주는 RBS (Ribosome Binding Site) 및/또는 전사종결인자를 포함할 수 있다. 즉, 상기 조절 단백질의 발현을 조절하는 부위로써, 상기 프로모터 이외에도 RBS 및/또는 전사종결인자를 포함할 수 있는 것이다.
일반적으로 단백질의 발현은 mRNA에서 개시코돈인 AUG(메티오닌) 혹은 GUG(발린)에서 시작하는데, 리보좀이 단백질 내부의 잔기에 위치한 AUG 혹은 GUG와 단백질 개시코돈으로서의 AUG와 GUG의 구분은 DNA의 퓨린 염기가 풍부한 RBS (또는 샤인-달가노 연속부분; Shine-Dalgarno (SD) sequence)에 의하여 결정되며 이 RBS는 종마다 서열이 차이가 나는 것으로 알려져 있다 (Stryer, L., (1995) Biochemistry,(4thed.) W.H.Freeman, Chapter34, Protein Synthesis). 본 발명에서 숙주인 대장균에서 리포터 단백질의 발현을 용이하게 하기 위하여 대장균용 RBS(RBSε), 또는 모든 균주에 통합적으로 사용가능한 RBS(RBSx)를 사용할 수 있으며, 본 발명의 일 실시예로서 T7 RBS 또한 사용가능할 수 있다.
본 발명에 있어서, 상기 전사종결인자는, 바람직하게는, rrnBT1T2 또는 tL3일 수 있고, 이것 이외에도, 당업계에서 통상적으로 사용되는 여하한 전사종결인자를 사용하여 본 발명을 구성할 수 있다.
본 발명에서 리포터는 형광단백질 및 항생제 저항성 유전자로부터 선택된 하나 이상일 수 있다. 형광단백질로는 바람직하게 GFP, GFPUV, sfGFP 또는 RFP를 사용할 수 있고, 본 발명의 목적을 달성할 수 있는 한 본 발명에 사용할 수 있는 형광단백질은 이러한 예에 한정되지 않는다. 또한, 상기 항생제 저항성 유전자는 카나마이신, 클로람페니콜, 테트라사이클린 등 항생제에 저항성인 유전자 등 통상의 항생제 저항성 유전자를 사용할 수 있다.
본 발명의 일 구체 예로써, 리포터는 형광단백질과 항생제 저항성 유전자 둘 모두로 구성된 이중리포터(dual reporter), 둘 이상의 리포터로 구성된 다중 리포터일 수 있다.
본 발명에 있어서, 상기 nitA 프로모터의 하류에 T7 RNA 폴리머라아제를 코딩하는 유전자가 추가로 삽입되어 있고, 상기 리포터 유전자 상류에 T7 프로모터가 추가로 삽입되어 있어, 상기 리포터 유전자의 발현 유도는 ε-카프로락탐을 인지한 NitR (단백질)이 nitA 프로모터와 결합하여, T7 RNA 폴리머라아제 유전자의 발현이 유도되고, 상기 발현이 유도된 T7 RNA 폴리머라아제에 의하여, 상기 리포터 유전자의 발현이 유도되는 것을 특징으로 할 수 있다.
본 발명의 일 양태에서는 상기 구축한 재설계 유전자회로의 ε-카프로락탐에 대한 정량적 감지기능을 향상시키기 위하여, T7 프로모터 시스템을 도입하였다. 기존의 형광 단백질의 발현을 유도하는 프로모터 nitA 의 위치에 T7 프로모터를 도입하고, 프로모터 nitA 하위에 T7 RNA polymerase 유전자를 도입하여, T7CLGESS-PL 플라스미드 버전을 구축하였다(도 10).
본 발명에서 구축된 T7 CLGESS-PL 유전자회로 시스템은 ε-카프로락탐에 의해서만 형광발현이 되는 것을 알 수 있었으며, μM 수준의 ε-카프로락탐도 감지할 수 있는 것을 확인하였고, 형광 민감도도 야생형 CLGESS 유전자 회로보다 월등하다는 것을 확인하였다. 이에 따라 다양한 감지능을 가지는 유전자 회로 및 배지에 따라 다양한 감지능을 가지는 유전자회로를 택하여 사용할 수 있는 것을 확인하였다.
용어 "벡터 (vector)"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자, 또는 간단하게 잠재적 게놈 삽입물일 수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주 게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부 경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드 (plasmid)" 및 "벡터 (vector)"는 때로 상호 교환적으로 사용된다. 그러나, 본 발명은 당업계에 알려진 또는 알려지게 되는 바와 동등한 기능을 갖는 벡터의 다른 형태를 포함한다. 포유동물 세포 배양물 발현을 위한 전형적인 발현 벡터는 예를 들면 pRK5 (EP 307,247호), pSV16B (WO 91/08291호) 및 pVL1392 (Pharmingen)을 기초로 한다.
"발현 조절 서열 (expression control sequence)"이라는 표현은 특정한 숙주 생물에서 작동가능하게 연결된 코딩 서열의 발현에 필수적인 DNA 서열을 의미한다. 그러한 조절 서열은 전사를 실시하기 위한 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 예를 들면, 원핵생물에 적합한 조절 서열은 프로모터, 임의로 오퍼레이터 서열 및 리보좀 결합 부위를 포함한다. 진핵세포는 프로모터, 폴리아데닐화 시그날 및 인핸서가 이에 포함된다. 플라스미드에서 유전자의 발현 양에 가장 영향을 미치는 인자는 프로모터이다. 고 발현용의 프로모터로서 SRα 프로모터와 사이토메가로바이러스 (cytomegalovirus) 유래 프로모터 등이 바람직하게 사용된다.
본 발명의 DNA 서열을 발현시키기 위하여, 매우 다양한 발현 조절 서열중 어느 것이라도 벡터에 사용될 수 있다. 유용한 발현 조절서열의 예에는, 예를 들어, SV40 또는 아데노바이러스의 초기 및 후기 프로모터들, lac 시스템, trp 시스템, TAC 또는 TRC 시스템, T3 및 T7 프로모터들, 파지 람다의 주요 오퍼레이터 및 프로모터 영역, fd 코드 단백질의 조절 영역, 3-포스포글리세레이트 키나제 또는 다른 글리콜분해 효소에 대한 프로모터, 상기 포스파타제의 프로모터들, 예를 들어 Pho5, 효모 알파-교배 시스템의 프로모터 및 원핵세포 또는 진핵 세포 또는 이들의 바이러스의 유전자의 발현을 조절하는 것으로 알려진 구성과 유도의 기타 다른 서열 및 이들의 여러 조합이 포함된다. T7 RNA 폴리메라아제 프로모터 Φ10은 이. 콜라이에서 단백질 NSP를 발현시키는데 유용하게 사용될 수 있다.
핵산은 다른 핵산 서열과 기능적 관계로 배치될 때 "작동가능하게 연결 (operably linked)"된다. 이것은 적절한 분자 (예를 들면, 전사 활성화 단백질)은 조절 서열(들)에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 조절 서열(들)일 수 있다. 예를 들면, 전서열(pre-sequence) 또는 분비 리더 (leader)에 대한 DNA는 폴리펩타이드의 분비에 참여하는 전단백질로서 발현되는 경우 폴리펩타이드에 대한 DNA에 작동가능하게 연결되고; 프로모터 또는 인핸서는 서열의 전사에 영향을 끼치는 경우 코딩서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 서열의 전사에 영향을 끼치는 경우 코딩 서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 번역을 용이하게 하도록 배치되는 경우 코딩 서열에 작동가능하게 연결된다. 일반적으로, "작동가능하게 연결된"은 연결된 DNA 서열이 접촉하고, 또한 분비 리더의 경우 접촉하고 리딩 프레임 내에 존재하는것을 의미한다. 그러나, 인핸서 (enhancer)는 접촉할 필요가 없다. 이들 서열의 연결은 편리한 제한 효소 부위에서 라이게이션(연결)에 의해 수행된다. 그러한 부위가 존재하지 않는 경우, 통상의 방법에 따른 합성 올리고뉴클레오티드 어댑터 (oligonucleotide adaptor) 또는 링커(linker)를 사용한다.
본원 명세서에 사용된 용어 "발현 벡터"는 통상 이종의 DNA의 단편이 삽입된 재조합 캐리어 (recombinant carrier)로서 일반적으로 이중 가닥의 DNA의 단편을 의미한다. 여기서, 이종 DNA는 숙주 세포에서 천연적으로 발견되지 않는 DNA인 이형 DNA를 의미한다. 발현 벡터는 일단 숙주 세포내에 있으면 숙주 염색체 DNA와 무관하게 복제할 수 있으며 벡터의 수 개의 카피 및 그의 삽입된 (이종) DNA가 생성될 수 있다.
당업계에 주지된 바와 같이, 숙주세포에서 형질감염 유전자의 발현 수준을 높이기 위해서는, 해당 유전자가, 선택된 발현 숙주 내에서 기능을 발휘하는 전사 및 해독 발현 조절 서열에 작동가능하도록 연결되어야만 한다. 바람직하게는 발현 조절서열 및 해당 유전자는 세균 선택 마커 및 복제 개시점 (replication origin)을 같이 포함하고 있는 하나의 발현 벡터 내에 포함되게 된다. 발현 숙주가 진핵세포인 경우에는, 발현 벡터는 진핵 발현 숙주 내에서 유용한 발현 마커를 더 포함하여야만 한다.
다른 관점에서, 본 발명은 상기ε-카프로락탐 감지용 재설계 유전자회로를 함유하는 ε-카프로락탐 감지용 재조합 미생물에 관한 것이다.
본 발명에서, 상기 유전자회로가 도입되는 숙주 미생물은 대장균, 슈도모나스, 효모, 식물세포, 동물세포 등을 사용할 수 있다.
본 발명에 따르면 ε-카프로락탐 감지 재설계 유전자회로를 적합한 미생물 숙주내로 형질전환 (transformation)시키는 데, 형질전환의 효율을 높이기 위해서, 바람직하게 전기천공법(electroporation)을 사용할 수 있다.
상술한 발현 벡터에 의해 형질전환 또는 형질감염된 숙주 세포는 본 발명의 또 다른 측면을 구성한다. 본원 명세서에 사용된 용어 "형질전환"은 DNA를 숙주로 도입하여 DNA가 염색체외 인자로서 또는 염색체 통합완성에 의해 복제가능하게 되는 것을 의미한다. 본원 명세서에 사용된 용어 "형질감염"은 임의의 코딩 서열이 실제로 발현되든 아니든 발현 벡터가 숙주 세포에 의해 수용되는 것을 의미한다.
발명의 숙주 세포는 원핵 또는 진핵생물 세포일 수 있다. 또한, DNA의 도입효율이 높고, 도입된 DNA의 발현효율이 높은 숙주가 통상 사용된다. 이. 콜라이, 슈도모나스, 바실러스, 스트렙토마이세스, 진균, 효모와 같은 주지의 진핵 및 원핵 숙주들, 스포도프테라 프루기페르다(SF9)와 같은 곤충 세포, CHO 및 생쥐 세포같은 동물 세포, COS 1, COS 7, BSC 1, BSC 40 및 BMT 10과 같은 아프리카 그린 원숭이 세포, 및 조직배양된 인간 세포는 사용될 수 있는 숙주 세포의 예이다. 본 발명의 NSP 단백질을 코딩하는 cDNA를 클로닝할 때에는 동물세포를 숙주로 하는 것이 바람직하다. 본 발명에서는 어류 기원의 CHSE-214, FHM, RTG-2 및 EPC를 예시하였으나 물론 이에 제한되는 것은 아니다. COS 세포를 이용하는 경우에는 COS 세포에서 SV40 라지 T안티겐(large T antigen)이 발현하고 있으므로 SV40의 복제개시점을 갖는 플라스미드는 세포중에서 다수 카피(copy)의 에피솜(episome)으로 존재하도록 되고 통상보다 고 발현이 기대될 수 있다. 도입된 DNA 서열은 숙주 세포와 동일한 종으로부터 얻을 수 있거나, 숙주 세포와 다른 종의 것일 수 있거나, 또는 그것은 어떠한 이종 또는 상동성 DNA를 포함하는 하이브리드 DNA 서열일 수 있다.
물론 모든 벡터와 발현 조절 서열이 본 발명의 DNA 서열을 발현하는데 모두 동등하게 기능을 발휘하지는 않는다는 것을 이해하여야만 한다. 마찬가지로 모든 숙주가 동일한 발현 시스템에 대해 동일하게 기능을 발휘하지는 않는다. 그러나, 당업자라면 과도한 실험적 부담없이 본 발명의 범위를 벗어나지 않는 채로 여러 벡터, 발현 조절 서열 및 숙주 중에서 적절한 선택을 할 수 있다. 예를 들어, 벡터를 선택함에 있어서는 숙주를 고려하여야 하는데, 이는 벡터가 그 안에서 복제되어야만 하기 때문이다. 벡터의 복제 수, 복제 수를 조절할 수 있는 능력 및 당해 벡터에 의해 코딩되는 다른 단백질, 예를 들어 항생제 마커의 발현도 또한 고려되어야만 한다. 발현 조절 서열을 선정함에 있어서도, 여러 가지 인자들을 고려하여야만 한다. 예를 들어, 서열의 상대적 강도, 조절가능성 및 본 발명의 DNA 서열과의 상용성 등, 특히 가능성있는 이차 구조와 관련하여 고려하여야 한다. 단세포 숙주는 선정된 벡터, 본 발명의 DNA 서열에 의해 코딩되는 산물의 독성, 분비 특성, 단백질을 정확하게 폴딩시킬 수 있는 능력, 배양 및 발효 요건들, 본 발명 DNA 서열에 의해 코딩되는 산물을 숙주로부터 정제하는 것의 용이성 등의 인자를 고려하여 선정되어야만 한다. 이들 변수의 범위내에서, 당업자는 본 발명의 DNA 서열을 발효 또는 대규모 동물 배양에서 발현시킬 수 있는 각종 벡터/발현 조절 서열/숙주 조합을 선정할 수 있다. 발현 클로닝에 의해 NSP 단백질의 cDNA를 클로닝 하려고 할 때의 스크리닝법으로서 바인딩법(binding법), 페닝법(panning법), 필름에멀션법(film emulsion 법)등이 적용될 수 있다.
본 발명의 정의상 "실질적으로 순수한"이란 본 발명에 따른 폴리펩타이드 및 폴리펩타이드를 코딩하는 DAN 서열이 박테리아로부터 유래된 다른 단백질을 실질적으로 포함하지 않는 것을 의미한다.
재조합 단백질을 발현하기 위한 숙주세포는 짧은 시간 내 고농도 균체 배양이 가능하고 유전자 조작이 용이하고 유전학적, 생리적 특징이 잘 밝혀져 있는 대장균 (Escherichia coli), 고초균 (Bacillus subtillis) 등과 같은 원핵세포가 널리 이용되어 왔다. 그러나, 단백질의 번역 후 수식 (post-translational modification), 분비과정 및 활성형의 3차원 구조, 단백질의 활성상태의 문제점들을 해결하기 위해 최근 단세포 진핵세포인 효모 계열 (Pichia pastoris, Saccharomyces cerevisiae, Hansenula polymorpha 등), 사상성 진균류 (filamentous fungi), 곤충세포 (insect cells), 식물세포, 포유동물세포 (mammalian cells) 등 고등생물에 이르기까지 재조합 단백질 생산의 숙주세포로 활용하고 있으므로, 실시예에서 예시된 대장균 뿐만 아니라 다른 숙주세포를 이용하는 것은 당업계의 통상의 지식을 가진 자에게 있어서 용이하게 적용가능하다.
또 다른 관점에서, 본 발명은 (a) 상기 ε-카프로락탐 감지용 재조합 미생물과 ε-카프로락탐 함유가능성 있는 샘플을 접촉시키는 단계; 및 (b) ε-카프로락탐을 감지하여 발현이 유도된 리포터 단백질의 활성을 분석하여 ε-카프로락탐의 존재 여부를 감지하는 단계를 포함하는 ε-카프로락탐의 감지 방법에 관한 것이다.
또 다른 관점에서 본 발명은 (a) 상기 ε-카프로락탐 감지용 재조합 미생물과 ε-카프로락탐을 함유하는 샘플을 접촉시키는 단계; 및 (b) 상기 샘플 내에 존재하는 ε-카프로락탐에 의해 발현이 유도된 리포터 단백질의 활성을 분석하여, 샘플 내에 존재하는 ε-카프로락탐을 정량하는 단계를 포함하는 ε-카프로락탐의 정량 방법에 관한 것이다.
본 발명에서, 상기 리포터 단백질의 활성 측정은 미생물 콜로니 이미지 분석, 형광스펙트럼 분석, 형광유세포분석 (FACS), 항생제 내성 측정법을 이용하여 측정할 수 있다.
본 발명에 따르면, 상기 유전자회로로 형질전환된 미생물은 ε-카프로락탐을 감지할 수 있는 감지 미생물 (sensing microorganism)이 된다. 바람직하게는, 감지 반응을 최적화하기 위하여 세포생장-재설계 유전자회로의 활성화 단계가 분리되도록 기질 첨가시기를 조절할 수 있다. 예를 들어, 기질 처리 단계는 영양배지에서 성장된 건강한 미생물을 회수하는 단계 및 회수된 미생물을 최소배지에서 기질로 처리하는 단계로 이루어질 수 있다.
상기 영양 배지 또는 최소배지는 기술 분야에 일반적으로 사용될 수 있는 다양한 배지가 적용 가능할 것이다.
바람직하게는, 형질전환된 미생물의 세포 성장(OD600)이 약 0.4∼0.6 사이일 때 기질을 처리하여 효소 활성화반응을 최적화할 수 있고, 더욱 바람직하게는 활성화반응을 8 ～ 16시간 진행시켜 효소반응을 최적화할 수 있다.
ε-카프로락탐을 감지하는 재설계 유전자회로를 함유한 재조합 미생물에 임의의 ε-카프로락탐을 처리하면 세포내 효소유전자의 기능 및 활성도에 따라서 상기 화합물의 농도가 변화하게 된다. 따라서 ε-카프로락탐의 발현유도 기능에 의한 형광, 항생제저항성 등 리포터의 정량적 증가를 형광분석기, 항생제저항성 등 다양한 측정기술을 이용하여 탐색하면 세포내외의 ε-카프로락탐을 고감도로 감지 및 정량할 수 있는 새로운 측정방법을 제공하게 된다.
또한, 본 발명에서 리포터로 사용되는 형광단백질, 항생제저항성 단백질은 고도의 민감성 측정방법을 적용할 수 있을 뿐만 아니라, 세포막을 통과하지 않고 특정세포 내부에 한정되므로 그 세포 내에서 발현되는 외래 유전자의 특성을 개별적으로 발휘하게 된다. 따라서 하나하나의 세포 (single cell)가 독립적인 반응조 및 분석기의 역할을 수행하게 되므로 효소반응에 의해 유리된 ε-카프로락탐을 감지하여 발현이 유도된 리포터의 활성을 측정하는 수단으로 수백-수천만 개의 대량시료를 형광유세포분석기 (FACS), 미세콜로니 형광이미지분석, 형광스펙트럼분석, 항생제 선택배지를 이용한 대량탐색 등을 이용하여 측정할 수 있다.
본 발명의 일 실시예에서, 본 발명에서 구축한 재설계 유전자회로의 시스템 검증 및 ε-카프로락탐 에 대한 정량적 신호 분석하기 위하여 CL-GESS를 열 충격을 통해 도입한 대장균 DH5α을 바이오카프로락탐 전화공정 구간상에 존재하는 기질(L-lysine, 6-aminocaproic acid, amino-caprolactam)이 포함된 고체 배지에 도말하여 형광발현정도를 측정한 결과, 도 3에서 보는 바와 같이 ε-카프로락탐이 포함된 배지에서 자란 대장균에 대해서 특이적으로 형광콜로니가 관찰되는 것을 확인하였다.
또한, CL-GESS 시스템을 가지는 대장균 DH5α의 각 유도체에 의하여 유도된 세포 내 형광량을 FACS로 분석한 결과, L-lysine과 그 중간체 (6-aminocaproic acid, amino-caprolactam) 들과 ε-카프로락탐이 각각 0.5% 농도로 첨가한 경우, 도 4에서 보는 바와 같이 0.5% L-lysine(Lys), 0.5% 6-aminocaproic acid (6-ACA), 0.5% amino-caprolactam (ACL)를 첨가한 시료에서는 아무것도 첨가하지 않은 대조군과 마찬가지로 형광이 감지되지 않았지만, 0.5 %의 카프로락탐을 첨가한 시료에서는 형광이 감지되는 것을 확인할 수 있었다.
또 다른 관점에서, 본 발명은 (a) 상기 ε-카프로락탐 감지용 재조합 미생물과 메타게놈 라이브러리 샘플을 접촉시키는 단계; (b) 상기 샘플 내에 존재하는 ε-카프로락탐에 의해 발현이 유도된 리포터 단백질의 활성을 분석하여, 샘플 내에 ε-카프로락탐을 정량하는 단계; 및 (c) ε-카프로락탐이 함유된 샘플에 함유된 균주를 ε-카프로락탐 생산균주로 선별하는 단계를 포함하는 ε-카프로락탐 생산균주의 스크리닝 방법을 제공한다.
본 발명에 있어서, 상기 ε-카프로락탐 감지용 재조합 미생물과 상기 메타게놈 라이브러리 샘플을 접촉시키는 단계는 메타게놈 라이브러리의 균주와 ε-카프로락탐 감지용 재조합 미생물을 공배양하거나, 상기 ε-카프로락탐 감지용 재조합 미생물에 상기 메타게놈 라이브러리에 포함된 균주의 배양액을 처리하여 수행할 수 있다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당해 기술분야에서 통상의 지식을 가진 자에게 있어 자명한 것이다.
실시예 1
재설계 유전자 회로의 구축
본 발명은 효소에 의해 다양한 전구체로부터 생성되는 ε-카프로락탐을 감지하기위한 재설계 유전자회로를 구축하기 위해, 선행연구에서 얻어진 GESS 유전자회로 (대한민국 공개특허 제2010-0131995호)를 재설계하여 새로운 유전자 회로인 CL-GESS 를 구축하였다 (도 1).
CL-GESS 를 구축하기 위한 유전자 클로닝 과정은 다음과 같다. 먼저 선행연구를 통해 구축한 GESS 플라스미드를 기반으로 기질분해효소 조절 유전자(dmpR) 및 리포터 발현을 위한 프로모터 부분을 Alcaligenes faecalis JM3 유래의 nitR 유전자로 치환하기 위해 리컴비니어링 (recombineering) 방법을 도입하였다.
먼저, GESS 플라스미드인 pGESS-T2는 대한민국 공개특허 제2010-0131995호에 기재된 방법으로 제작하였으며, 제작방법은 다음과 같다.
pHCEIIB 벡터 (바이오리더스, 한국)로부터 425bp의 rrnBT1T2전사종결인자를 서열번호 3과 4 프라이머로 PCR 반응하여 증폭하고, pGESS-T1으로부터 dmpR과 dmp operatorpromoter영역, 그리고 GFP 리포터 단백질 부분의 2,831bp의 PCR 산물을 서열번호 5와 6의 프라이머로 증폭한후 GFP 리포터 단백질의 C-말단에 상동성 재조합 방법으로 삽입하였다. 이렇게 구성된 pGESS-T1-1은 5,901bp로 구성되며 pGESS-T1의 리포터 단백질에 전사종결인자가 삽입된 형태의 클론이다. pGESS-T1-1을 EcoRI으로 절단한 후 pKD46 벡터로부터 서열번호 7과 8 프라이머로 PCR 증폭한 tL3 전사종결인자를 dmpR의 C-말단에 라이게이션시키고 전기천공법으로 대장균에 도입시켜 최종적으로 6,171bp의 pGESS-T2를 구성하였다,
서열번호 3: 5'-ATGGACAAGCTGTACAAGTAAGCTTCTGTTTTGGCGGATGAGAGAAGA -3'
서열번호 4: 5'-AGCGGATAACAATTTCACACAGAAACAGCTATGACCATGATTACGCCAAGAGTTTGTAGAAACGCAAAAAGG-3'
서열번호 5: 5'-TCTCTCATCCGCCAAAACAGGAATTCCTAGCCTTCGATGCCGATTT-3'
서열번호 6: 5'-TCTTCTCTCATCCGCCAAAACAGAAGCTTACTTGTACAGCTTGTCCAT-3'
서열번호 7: 5'-CCCGAATTCTTCTTCGTCTGTTTCTACTG-3'
서열번호 8: 5'-CCCGAATTCAATGGCGATGACGCATCCTCA-3'
상기 pGESS-T2를 벡본으로 하여, 전사조절인자 NitR 단백질과 상호작용하는 nitA 프로모터(P nitA ) 및 nitA 프로모터 하류에 위치한 리포터 단백질 서열은 nitR 유전자와 반대방향으로 위치하게 하여 각 유전자의 발현에 대한 불필요한 간섭을 배제 하였다. 전사조절 인자인 nitR은 A. faecalis 균주의 유전체를 추출한 후 서열번호 9, 10의 프라이머를 이용한 PCR (polymerase chain reaction)을 통해 얻었으며, nitA 프로모터 부분도 동일하게 A. faecalis 유전체를 주형으로 서열번호 11, 12의 프라이머를 이용하여 PCR을 통해 얻었다. 마지막으로 얻어진 P nitA -nitR-PnitR 유전자 단편은 PCR 반응을 통하여 최종적으로 CL-GESS를 구성하였다 (도 2).
서열번호 9 - CGACAAGGAGGATGTCCATGGATGGAGCAATGGTCCACCA
서열번호 10 - AGAAGGAATAAGCTTGCCGGCCTTCATGATGATG
서열번호 11 - GGGGCCGGCAAGCTTGCCGGCCTTCATGATGATG
서열번호 12 - AAGGCCGGCAAGCTTGCCGGCCCCAGGT
실시예 2
재설계 유전자회로의 시스템 검증 및 ε-카프로락탐에 대한 정량적 신호 분석
상기 실시예 1에서 구축한 재설계 유전자회로의 ε-카프로락탐에 대한 정량적 감지기능을 확인하기 위하여 CL-GESS를 열 충격을 통해 도입한 대장균 DH5α 단일 콜로니를 50㎍/㎖의 앰피실린을 첨가한 4% 글루코스, 0.01% 티아민이 들어있는 M9 최소 고체배지에 도말하여 약 36시간 동안 37℃에서 배양하였다. 각 배지에는 바이오 카프로락탐 전환공정 구간 상에 존재하는 기질인 L-lysine과 그 중간체 (6-aminocaproic acid, amino-caprolactam) 들과 ε-카프로락탐이 각각 0.5% 농도로 첨가하여 형광발현을 유도하였다.
CL-GESS 시스템을 가지는 대장균 DH5α의 형광정도를 형광현미경(Nicon AZ100-M, 일본)를 이용하여 관찰한 결과, 도 3에서 보는 바와 같이 ε-카프로락탐이 포함된 배지에서 자란 대장균에 대해서 특이적으로 형광콜로니가 관찰되는 것을 확인하였다.
또한, 단일세포 단위에서 발현되는 형광량을 확인 하기 위하여 CL-GESS를 열 충격을 통해 도입한 대장균 DH5α 단일 콜로니를 50㎍/㎖의 앰피실린을 첨가한 LB액체 배지에 접종하여 37℃에서 12시간 진탕 배양하였다. 위 배양액을 50㎍/㎖의 앰피실린을 첨가한 M9 최소 액체배지에 1% 접종한 후 6시간 동안 37℃에서 진탕 배양하였다. 각 시험관에 바이오 카프로락탐 전환공정 구간 상에 존재하는 기질인 L-lysine과 그 중간체 (6-aminocaproic acid, amino-caprolactam) 들과 ε-카프로락탐을 각각 0.5% 농도로 첨가하고 37℃에서 18시간 진탕배양시켜 형광발현을 유도하였다. 유도된 세포내 형광량은 FACS Calibur system(Becton Dickinson, 미국)으로 분석하였다. Detector로는 FSC, SSC, FL1-H (excitation = 488nm, emission = 530/30nm) 를 감지하도록 세팅하였고, 10,000개의 표본세포를 관찰한 데이터를 FlowJo(Tree Star, Inc. 미국)로 분석하였다.
L-lysine과 그 중간체 (6-aminocaproic acid, amino-caprolactam) 들과 ε-카프로락탐을 각각 0.5% 농도로 첨가한 경우, 도 4에서 보는 바와 같이 0.5% L-lysine (Lys), 0.5% 6-aminocaproic acid (6-ACA), 0.5% amino-caprolactam(ACL)를 첨가한 시료에서는 아무것도 첨가하지 않은 대조군과 마찬가지로 형광이 감지되지 않았지만, 0.5%의 ε-카프로락탐을 첨가한 시료에서는 형광이 감지되는 것을 확인할 수 있었다.
또한, ε-카프로락탐을 0.001% 내지 0.5%로 첨가하여 CL-GESS를 단일 세포 단위로 FACS를 이용하여 분석한 결과, 0.01%(약 0.88mM) ε-카프로락탐에서부터 미세하게 감지되기 시작해 농도가 증가할수록 형광양이 증가하는 것을 확인할 수 있었다 (도 4).
상기 결과로부터, 본 발명에서 구축된 CL-GESS 시스템은 ε-카프로락탐에 의해서만 형광발현이 되는 것을 알 수 있었으며, mM 수준의 ε-카프로락탐도 감지할 수 있는 것을 확인하였다.
실시예 3
재설계 유전자회로의 시스템 최적화, ε-카프로락탐에 대한 민감도 증가 및 정량적 신호 분석
CL-GESS 의 ε-카프로락탐 에 관하여 민감도를 증가시키기 위하여, 그에 따른 추가 연구가 수행되었다. 첫 번째로, 형광발현 리포터를 sfGFP (Gene accession No. HQ873313.1, Nature biotechnology, 2006, 24:79-88)로 치환하기로 하였다. 기존에 있던 형광 발현 리포터를 sfGFP 로 치환하기 위한 방법으로서 깁슨 어셈블리 (gibson assembly) 방법이 사용되었고, 제작 방법은 다음과 같다. 서열번호 13, 14로 sfGFP를 증폭하고, 서열번호 15, 16로 CL-GESS에서 형광 발현 리포터가 제외된 전체 백본 (back bone) 부분을 증폭하였다. 이후 두 유전자 조각을 깁슨 어셈블리에 의하여, 라이게이션시키고 전기천공법으로 대장균에 도입시켜 최종적으로 sfGFP 가 삽입된 CL-GESS 를 구성하였다,
서열번호 13 - TCGCGGATACCGCGACAAGGAGATATACATATGAGCAAAGGTGAAGAACTGTTTACCGGC
서열번호 14 - ATCTTCTCTCATCCGCCAAAACAGAAGCTTATTTTTCGAACTGCGGATGGCTCCAC
서열번호 15 - GTGGAGCCATCCGCAGTTCGAAAAATAAGCTTCTGTTTTGGCGGATGAGAGAAGAT
서열번호 16 - GCCGGTAAACAGTTCTTCACCTTTGCTCATATGTATATCTCCTTGTCGCGGTATCCGCGA
그 결과, 기질 0.5%에서 형광발현 리포터를 eGFP로 사용하는 유전자 회로에 비해 sfGFP로 사용하는 유전자 회로에서 5배 증가되는 형광값을 얻을 수 있었고, 0.05% ε-카프로락탐 (400μM) 까지 감지 하는 것을 확인하였다 (도 5).
추가적인 연구로써, ε-카프로락탐을 인지하는 NitR 유전자 와 형광발현 리포터인 sfGFP 의 복제 (copy) 수를 두배로 늘리는 유전자 회로를 제작하였다. 각각 프로모터, RBS, 그리고 터미네이터를 한 세트로서, 기존 CL-GESS 말단에 한 프로모터, ORF, 터미네이터 세트를 깁슨 어셈블리로 제작하였다 (도 6). 그 결과, M9 배지에서는 야생형 CL-GESS 가 가장 감지 능력이 좋았지만 (도 7가), LB 배지에서는 NitR 유전자가 두 번 반복된 유전자 회로에서 기존에서는 관찰할 수 없었던 25 μM 수준의 ε-카프로락탐을 감지하는 것을 확인할 수 있었다 (도 7나). 이에 따라 다양한 감지능을 가지는 유전자 회로 및 배지에 따라 다양한 감지능을 가지는 유전자 회로를 택하여 사용할 수 있음을 확인 하였다.
실시예 4
다양한 길이의 nitA 프로모터를 가진 CLGESS의 재설계 유전자 회로의 구축
다양한 길이의 nitA 프로모터를 클로닝하기 위하여, 야생형 CLGESS 유전자 회로를 주형으로 이용하여, RBS 를 기준으로 100bp, 200bp, 300bp 의 길이의 프로모터를 각각 서열번호 17, 20의 프라이머, 서열번호 18, 20의 프라이머, 서열번호 19, 20의 프라이머를 이용하여 PCR 반응을 통하여, 확보하였다. 또한 나머지 100bp, 200bp, 300bp 의 길이의 프로모터를 클로닝할 backbone 부분을 각각 서열번호 21, 22의 프라이머, 서열번호 21, 23의 프라이머 및 서열번호 21, 24의 프라이머를 이용하여 PCR 반응을 통하여, 확보하였다. 확보된 각각의 DNA를 Gibson assembly를 통하여, 라이게이션 시켜서 각각 CLGESS100, CLGESS200 및 CLGESS300 재설계 유전자 회로를 구성하였다 (도 8).
서열번호 17
acctaggactgagctagccgtcaaaagctttcaattcatcgccaccttcccctcctacac
서열번호 18
acctaggactgagctagccgtcaaaagcttcccccaaccctcttgttcactgcacggacgg
서열번호 19
acctaggactgagctagccgtcaaaagcttcaccattcccggcttgctgatgcgccccatccc
서열번호 20
ttcttcacctttgctcatatgtatatctccttgtcgcggtatccgcgatcctgatcgccag
서열번호 21
ctggcgatcaggatcgcggataccgcgacaaggagatatacatatgagcaaaggtgaagaa
서열번호 22
Gtgtaggaggggaaggtggcgatgaattgaaagcttttgacggctagctcagtcctaggt
서열번호 23
Ccgtccgtgcagtgaacaagagggttgggggaagcttttgacggctagctcagtcctaggt
서열번호 24
gggatggggcgcatcagcaagccgggaatggtgaagcttttgacggctagctcagtcctaggt
실시예 5
다양한 길이의 nitA 프로모터를 가진 CLGESS의 재설계 유전자 회로의 시스템 검증 및 ε-카프로락탐에 대한 정량적 신호 분석
실시예 4에서 구축한 재설계 유전자회로의 ε-카프로락탐에 대한 정량적 감지기능을 확인하기 위하여 야생형 CLGESS, CLGESS100, CLGESS200 및 CLGESS300를 열 충격을 통해 도입한 대장균 DH5α 단일 콜로니를 50㎍/㎖의 앰피실린을 첨가한 LB액체 배지에 접종하여 37℃에서 12시간 진탕 배양하였다. 상기 배양액을 50㎍/㎖의 앰피실린을 첨가한 LB 액체배지에 1% 접종한 후 각 시험관에 ε-카프로락탐을 각각 0mM, 0.5mM 및 50 mM 농도로 첨가하고, 37℃에서 18시간 진탕배양 시켜, 형광발현을 유도하였다. 유도된 세포내 형광량은 FACS Calibur system(Becton Dickinson, 미국)으로 분석하였다. Detector로는 FSC, SSC, FL1-H (excitation = 488nm, emission = 530/30nm) 를 감지하도록 세팅하였고, 10,000개의 표본세포를 관찰한 데이터를 FlowJo(Tree Star, Inc. 미국)로 분석하였다.
그 결과, 야생형 CLGESS 회로와 비교해 보았을 때, nitA 프로모터 의 길이가 100bp의 경우 형광 감지가 되지 않음을 확인할 수 있었다. 하지만, nitA 프로모터 의 길이가 200bp 및 300bp의 경우 야생형 CLGESS 에 비하여 형광 증폭이 증가하는 것을 확인할 수 있었다. 특히 nitA 프로모터 의 길이가 200bp의 경우의 CLGESS 의 형광 세기가 가장 높은 것을 확인할 수 있었다 (도 9).
실시예 6
T7 CLGESS 의 재설계 유전자 회로의 구축
구축한 재설계 유전자회로의 ε-카프로락탐에 대한 정량적 감지기능을 향상시키기 위하여, T7 프로모터 시스템을 도입하였다. 기존의 형광 단백질의 발현을 유도하는 프로모터 nitA 의 위치에 T7 프로모터를 도입하고, 프로모터 nitA 하위에 T7 RNA polymerase 유전자를 도입하여, T7CLGESS 플라스미드 버전을 구축하였다 (도 10).
실시예 7
T7 CLGESS 의 재설계 유전자 회로의 시스템 검증 및 ε-카프로락탐에 대한 정량적 신호 분석
실시예 6에서 구축한 T7 CLGESS-PL (프라스미드 버전) 재설계 유전자회로의 ε-카프로락탐에 대한 정량적 감지기능을 확인하기 위하여 T7 CLGESS-PL 유전자회로를 열 충격을 통해 도입한 대장균 DH5α 단일 콜로니를 50㎍/㎖의 앰피실린을 첨가한 LB액체 배지에 접종하여 37℃에서 12시간 진탕 배양하였다. 위 배양액을 50㎍/㎖의 앰피실린을 첨가한 LB 액체배지에 1% 접종한 후 각 시험관에 ε-카프로락탐을 각각 0μM , 0.1μM , 1μM , 5μM , 10μM , 25μM , 50μM , 100μM , 500μM 및 1000 μM 농도로 첨가하고 37℃에서 18시간 진탕배양시켜, 형광발현을 유도하였다. 유도된 세포내 형광량은 형광 플레이트리더(Perkin Elmer Victor V)를 사용하여 200μl의 세포배양액을 plate에 옮긴 후 형광을 측정하고, 세포량(OD600) 대비 형광 값을 비교하였다.
그 결과, 야생형 CLGESS 회로 와 비교해 보았을 때, T7 CLGESS-PL 유전자회로 의 경우 매우 낮은 농도 (>0.1μM)의 ε-카프로락탐에서 형광세기가 관찰되었다 (도 11).
상기 결과로부터, 본 발명에서 구축된 T7 CLGESS-PL 유전자회로 시스템은 ε-카프로락탐에 의해서만 형광발현이 되는 것을 알 수 있었으며, μM 수준의 ε-카프로락탐도 감지할 수 있는 것을 확인하였고, 형광 민감도도 야생형 CLGESS 유전자 회로보다 월등하다는 것을 확인 하였다. 이에 따라 다양한 감지능을 가지는 유전자 회로 및 배지에 따라 다양한 감지능을 가지는 유전자 회로를 택하여 사용할 수 있는 걱을 확인하였다 (도 11).
실시예 8
CLGESS 를 이용한 카프로락탐 전환효소의 발굴
카프로락탐 전환효소를 발굴하기 위한 대장균 균주는, 대장균 EPI300 (EPicentre, 미국)에 DE3 Lysogenization Kit (Novagen, 미국)을 이용하여 DE3를 chromosomal DNA 에 삽입하여, 대장균 EPI300 (DE3)를 확보 하였다.
카프로락탐 전환효소를 발굴하기 위하여, 갯벌 유래의 메타게놈 라이브러리와 실시예 1에서 제조된 CLGESS를 대장균 EPI300 (DE3)에 공동형질 전환하여, 50 mM 아미노카프론 산, 100 ㎍/㎖ 앰피실린, 34 ㎍/㎖ 클로람페니콜이 포함된 LB 고체 배지에 도말하여 37℃에서 24시간 배양하여 형광발현을 유도하였다. 고체 배지상의 단일 콜로니의 형광정도를 형광현미경 (Nicon AZ100-M, 일본)을 이용하여 관찰한 결과, 상위 5% 내의 형광 발현이 된 단일 콜로니를 선별하였다.
2차 선별을 위하여 선별된 단일 콜로니를 100 ㎍/㎖ 앰피실린, 34 ㎍/㎖ 클로람페니콜이 포함된 LB 액체 배지에 접종하여 37℃에서 12시간 진탕 배양하였다. 위 배양액을 50 mM 아미노카프론 산, 100 ㎍/㎖ 앰피실린, 34 ㎍/㎖ 클로람페니콜이 포함된 LB 액체 배지와 대조군으로서 100 ㎍/㎖ 앰피실린, 34 ㎍/㎖ 클로람페니콜이 포함된 LB 액체 배지에 각각 접종한 후 24시간 동안 37℃에서 진탕 배양하여 형광발현을 유도하였다. 유도된 세포내 형광량은 FACS Calibur system(Becton Dickinson, 미국)으로 분석하였다. Detector로는 FSC, SSC, FL1-H (excitation = 488nm, emission = 530/30nm)를 감지하도록 세팅하였고, 10,000개의 표본세포를 관찰한 데이터를 FlowJo(Tree Star, Inc. 미국)로 분석하였다. 분석한 결과, 1개의 단일 콜로니에서 대조군과 비교하여 형광이 약 3.4 배 증가 되는 것을 확인하였다 (도12). 이에 따라 단일 콜로니로부터 메타게놈 유전자를 분리하여, 전체서열(서열번호 25)을 확인하였다(마크로젠, 한국).
본 발명에 따른 ε-카프로락탐을 인지하는 재설계 유전자회로는 ε-카프로락탐의 양에 비례하여 ε-카프로락탐 조절유전자가 형광단백질의 발현을 유도하도록 함으로써, ε-카프로락탐을 빠르게 감지 및 정량화할 수 있어, ε-카프로락탐의 정량적 분석 및 ε-카프로락탐 생합성 효소의 활성 분석 등의 목적에 이용할 수 있는 효과가 있다. 본 발명을 통해 0.1 μM 정도의 극미량의 ε-카프로락탐도 고감도로 감지 가능하며, 기존에는 불가능하였던 세포 단위의 분석이 가능하므로, 고속 탐색을 통해 미생물 메타게놈 라이브러리로부터 신규 ε-카프로락탐 생산 균주 및 유전자를 탐색하는 과정에도 본 발명의 효율적 이용이 가능하다.
이상으로 본 발명의 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (23)

  1. 다음을 포함하는 ε-카프로락탐 감지용 재설계 유전자회로;
    (i) ε-카프로락탐을 인지하는 NitR 단백질을 코딩하는 nitR 유전자;
    (ii) 형광 단백질을 코딩하는 유전자 및 항생제 저항성 유전자로 구성된 군에서 선택된 하나 이상의 리포터 유전자;
    (iii) 상기 nitR 유전자의 발현을 조절하는 프로모터; 및
    (iv) 상기 ε-카프로락탐을 인지한 NitR (단백질)이 결합하여 하류의 리포터 유전자의 발현을 유도하는 nitA 프로모터.
  2. 제1항에 있어서, 상기 nitR 유전자 및 nitA 프로모터는 나이트릴레이즈 (nitrilase) 활성이 있는 균주 유래의 nitR 유전자 및 nitA 프로모터인 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  3. 제2항에 있어서, 상기 나이트릴레이즈 (nitrilase) 활성이 있는 균주는 Aeribacillus pallidus, A. pallidus DAC521, A. pallidus RAPc8, Arabidopsis thaliana, Arthrobacter sp., Arthrobacter sp. J-1, Alcaligenes faecalis, A. faecalis JM3, A. faecalis ATCC 8750, A. faecalis MTCC 10757, A. faecalis MTCC 126, Alcaligenes sp., Alcaligenes sp. ECU0401, Aspergillus niger, A. niger K10, Fusarium solani, F. solani IMI 196840, F. solani O1, Mus musculus, Sorghum bicolor, Homo sapiens, Acidovorax facilis, A. facilis 72W, Acinetobacter sp., Agrobacterium sp., Arabis hirsuta, Bacillus subtilis, B. subtilis E9, Bacillus sp., Bacillus sp. OxB-1, Bacillus sp. UG-5B, Bradyrhizobium japonicum, B. japonicum USDA110, Brassica napus, B. rapa, B. rapa subsp. pekinensis, Comamonas testosteroni, Fusarium oxysporum, F. oxysporum f. sp. melonis, Gibberella moniliformis, Halomonas sp. alphaCH3, Hordeum vulgare, Klebsiella pneumoniae, K. pneumoniae subsp. ozaenae, Nocardia. globerula, N. globerula NHB-2, Nocardia sp., Penicillium marneffei, P. multicolor, Pseudomonas fluorescens, P. fluorescens 11387, P. fluorescens EBC 191, P. putida, P. putida 11388, P. putida MTCC 5110, Pseudomonas sp., Rhizobium sp. 11401, Rhodobacter sphaeroides, R. sphaeroides LHS-305, Rhodococcus equi, R. equi CCTCC.M.205114, R. fascians, R. fascians MTCC-1531, R. rhodochrous, R. rhodochrous ATCC 33278, R. rhodochrous ATCC 39484, R. rhodochrous J1, R. rhodochrous K22, R. rhodochrous MTCC-291, R. rhodochrous PA-34, R. rhodochrous tg1-A6, Rhodococcus sp., Rhodococcus sp. ATCC39484, Rhodococcus sp. NCIMB 11215, Rhodococcus sp. NCIMB 11216, Rhodococcus sp. NDB 1165, Sorghum bicolor, Synechocystis sp., Synechocystis sp. PCC6803 및 Zea mays로 구성된 군에서 선택되는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  4. 제1항에 있어서, 상기 nitR 유전자는 Alcaligenes faecalis JM3 유래로서 서열번호 1로 표시되는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  5. 제1항에 있어서, 상기 nitA 프로모터 유전자는 Alcaligenes faecalis JM3 유래로서 서열번호 2로 표시되는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  6. 제1항에 있어서, 상기 리포터 유전자와 상기 리포터 유전자의 발현을 조절하는 프로모터는 상호작동가능하게 연결되어 있는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  7. 제1항에 있어서, 상기 리포터 유전자의 발현을 유도하는 nitA 프로모터를 포함하는 부위에 ε-카프로락탐과 결합한 상기 ε-카프로락탐을 인지하는 NitR 단백질이 결합하여 nitA 프로모터를 활성화시켜, 상기 리포터 유전자의 발현을 유도하는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  8. 제1항에 있어서, 상기 ε-카프로락탐에 의해 발현이 유도되는 nitR 유전자를 코딩하는 유전자와 상기 NitR 단백질의 발현을 조절하는 프로모터는 상호 작동가능하게 연결되어 있는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  9. 제1항에 있어서, 상기 형광단백질은 GFP, GFPUV, sfGFP 및 RFP로 구성된 군으로부터 선택되는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  10. 제1항에 있어서, 상기 항생제 저항성 유전자는 카나마이신 저항성 유전자, 클로람페니콜 저항성 유전자 및 테트라사이클린 저항성 유전자로 구성된 군에서 선택되는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  11. 제1항에 있어서, RBS (ribosome binding site)를 코딩하는 유전자를 추가로 포함하는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로
  12. 제1항에 있어서, 상기 리포터 유전자는 형광 단백질을 코딩하는 유전자 및 항생제 저항성 유전자로 구성된 이중 리포터 유전자인 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  13. 제1항에 있어서, 상기 nitR 유전자와 상기 nitR 유전자의 발현을 조절하는 프로모터가 2 이상 포함되어 있는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  14. 제1항에 있어서, 상기 리포터 유전자 및 상기 리포터 유전자의 발현을 유도하는 nitA 프로모터가 2 이상 포함되어 있는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  15. 제1항에 있어서, 상기 nitA 프로모터는 서열번호 2의 염기서열 중 100bp~300bp의 단편인 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  16. 제1항에 있어서, 상기 nitA 프로모터의 하류에 T7 RNA 폴리머라아제를 코딩하는 유전자가 추가로 삽입되어 있고, 상기 리포터 유전자 상류에 T7 프로모터가 추가로 삽입되어 있어, 상기 리포터 유전자의 발현 유도는 ε-카프로락탐을 인지한 NitR (단백질)이 nitA 프로모터와 결합하여, T7 RNA 폴리머라아제 유전자의 발현이 유도되고, 상기 발현이 유도된 T7 RNA 폴리머라아제에 의하여, 상기 리포터 유전자의 발현이 유도되는 것을 특징으로 하는 ε-카프로락탐 감지용 재설계 유전자회로.
  17. 제1항 내지 제16항 중 어느 한 항의 ε-카프로락탐 감지용 재설계 유전자회로를 함유하는 ε-카프로락탐 감지용 재조합 미생물.
  18. 제17항에 있어서, 미생물은 세균, 효모, 식물세포 및 동물세포로 이루어진 군으로부터 선택되는 것을 특징으로 하는 ε-카프로락탐 감지용 재조합 미생물.
  19. 다음 단계를 포함하는 ε-카프로락탐의 감지방법:
    (a) 제17항의 ε-카프로락탐 감지용 재조합 미생물과 ε-카프로락탐 함유가능성 있는 샘플을 접촉시키는 단계; 및
    (b) ε-카프로락탐을 감지하여 발현이 유도된 리포터 단백질의 활성을 분석하여 ε-카프로락탐의 존재 여부를 감지하는 단계.
  20. 제19항에 있어서, 상기 리포터 단백질의 활성 측정은 미생물 콜로니 이미지 분석, 형광스펙트럼 분석, 형광유세포분석 (FACS) 및 항생제 내성 측정법으로 구성된 군에서 선택되는 방법을 이용하는 것을 특징으로 하는 방법.
  21. 다음 단계를 포함하는 ε-카프로락탐의 정량방법:
    (a) 제17항의 ε-카프로락탐 감지용 재조합 미생물과 ε-카프로락탐을 함유하는 샘플을 접촉시키는 단계; 및
    (b) 상기 샘플 내에 존재하는 ε-카프로락탐에 의해 발현이 유도된 리포터 단백질의 활성을 분석하여, 샘플 내에 존재하는 ε-카프로락탐을 정량하는 단계.
  22. 제21항에 있어서, 상기 리포터 단백질의 활성 측정은 미생물 콜로니 이미지 분석, 형광스펙트럼 분석, 형광유세포분석 (FACS) 및 항생제 내성 측정법으로 구성된 군에서 선택되는 방법을 이용하는 것을 특징으로 하는 방법.
  23. 다음 단계를 포함하는 ε-카프로락탐 생산균주의 스크리닝 방법:
    (a) 제17항의 ε-카프로락탐 감지용 재조합 미생물과 메타게놈 라이브러리 샘플을 접촉시키는 단계;
    (b) 상기 샘플 내에 존재하는 ε-카프로락탐에 의해 발현이 유도된 리포터 단백질의 활성을 분석하여, 샘플 내에 ε-카프로락탐을 정량하는 단계; 및
    (c) ε-카프로락탐이 함유된 샘플에 함유된 균주를 ε-카프로락탐 생산균주로 선별하는 단계.
PCT/KR2014/010951 2013-11-14 2014-11-14 재설계 유전자 회로를 이용한 ε카프로락탐의 감지 및 정량 방법 WO2015072776A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20130138399 2013-11-14
KR10-2013-0138399 2013-11-14

Publications (1)

Publication Number Publication Date
WO2015072776A1 true WO2015072776A1 (ko) 2015-05-21

Family

ID=53057647

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/010951 WO2015072776A1 (ko) 2013-11-14 2014-11-14 재설계 유전자 회로를 이용한 ε카프로락탐의 감지 및 정량 방법

Country Status (2)

Country Link
KR (1) KR101723868B1 (ko)
WO (1) WO2015072776A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016048048A1 (ko) * 2014-09-23 2016-03-31 한국생명공학연구원 신규 카프로락탐 전환 효소를 이용한 ε-카프로락탐의 제조 방법
CN111778199A (zh) * 2020-09-07 2020-10-16 鲁东大学 一株枯草芽孢杆菌及其应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101971480B1 (ko) 2017-09-26 2019-04-23 한국생명공학연구원 돌연변이 재설계 유전자 회로를 이용한 니트릴계, 락톤계 또는 락탐계 화합물의 감지 및 정량 방법

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH10221325A (ja) * 1997-02-04 1998-08-21 Mitsubishi Chem Corp ε−カプロラクタムの分析方法
KR101222056B1 (ko) * 2009-06-08 2013-01-14 한국생명공학연구원 재설계 유전자회로를 이용한 목적 효소 활성의 신규 탐색 및 정량 방법

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100464068B1 (ko) * 2002-05-16 2005-01-03 학교법인 동서학원 페놀계 화합물 검출용 바이오센서 및 그 제조방법
KR101128080B1 (ko) * 2009-12-23 2012-03-29 한국생명공학연구원 메타게놈 라이브러리 유래 효소활성의 탐색 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH10221325A (ja) * 1997-02-04 1998-08-21 Mitsubishi Chem Corp ε−カプロラクタムの分析方法
KR101222056B1 (ko) * 2009-06-08 2013-01-14 한국생명공학연구원 재설계 유전자회로를 이용한 목적 효소 활성의 신규 탐색 및 정량 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BONIFACI, L. ET AL.: "Analysis of e -caprolactam and its cyclic oligomers by high-performance liquid chromatography", JOURNAL OF CHROMATOGRAPHY A, vol. 585, no. 2, 1 November 1991 (1991-11-01), pages 333 - 336 *
HERAI, S. ET AL.: "Hyper-inducible expression system for streptomycetes", PROC. NATL. ACAD. SCI. USA, vol. 101, no. 39, 17 September 2004 (2004-09-17), pages 14031 - 14035 *
PANDEY, A. K. ET AL.: "Nitrile-inducible gene expression in mycobacteria", TUBERCULOSIS, vol. 89, no. 1, 17 September 2008 (2008-09-17), pages 12 - 16 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016048048A1 (ko) * 2014-09-23 2016-03-31 한국생명공학연구원 신규 카프로락탐 전환 효소를 이용한 ε-카프로락탐의 제조 방법
CN111778199A (zh) * 2020-09-07 2020-10-16 鲁东大学 一株枯草芽孢杆菌及其应用
CN111778199B (zh) * 2020-09-07 2020-11-24 鲁东大学 一株枯草芽孢杆菌及其应用

Also Published As

Publication number Publication date
KR20150056072A (ko) 2015-05-22
KR101723868B1 (ko) 2017-04-07

Similar Documents

Publication Publication Date Title
Hentschel et al. Destabilized eYFP variants for dynamic gene expression studies in C orynebacterium glutamicum
WO2015072776A1 (ko) 재설계 유전자 회로를 이용한 ε카프로락탐의 감지 및 정량 방법
US6329160B1 (en) Biosensors
KR20120099202A (ko) 재설계 유전자회로를 이용한 목적 효소 활성의 신규 탐색 및 정량 방법
Wasilko et al. Sulfur availability for Vibrio fischeri growth during symbiosis establishment depends on biogeography within the squid light organ
Vaughn et al. Characterization of salA, syrF, and syrG genes and attendant regulatory networks involved in plant pathogenesis by Pseudomonas syringae pv. syringae B728a
Hwang et al. Biosensor-guided discovery and engineering of metabolic enzymes
WO2014129808A1 (en) Method for screening and quantifying isoprene biosynthesis enzyme activity
Vannini et al. A convenient and robust in vivo reporter system to monitor gene expression in the human pathogen Helicobacter pylori
WO2011055987A2 (en) Method for screening of quorum sensing inhibitors
WO2015183052A1 (ko) 재설계 유전자회로를 이용한 아미노카프론산의 감지 및 정량 방법
KR101971480B1 (ko) 돌연변이 재설계 유전자 회로를 이용한 니트릴계, 락톤계 또는 락탐계 화합물의 감지 및 정량 방법
WO2021256582A1 (ko) 전사 활성 인자 및 토홀드 스위치를 포함하는 트립토판 검출용 바이오센서
KR100464068B1 (ko) 페놀계 화합물 검출용 바이오센서 및 그 제조방법
CN114480388A (zh) 一种响应爆炸物分子的新型启动子元件的筛选和应用
KR101430685B1 (ko) 난분해성 유해 방향족 화합물 감지용 인공바이오센서 및 이의 제조방법
KR101775350B1 (ko) 재설계 유전자회로를 이용한 아미노카프론산의 감지 및 정량 방법
WO2020089235A1 (en) Assay for screening of recombinant cells and microbes
WO2015147379A1 (ko) 숙주세포의 생체 회로 간섭 없이 외래 유전자를 발현하기 위한 재조합 벡터 및 이의 용도
US20040209270A1 (en) Method for identifying macrocyclic polyketides
WO2017010805A1 (ko) 미생물 프로토타이핑 유전자 회로 기반 신규 미생물자원 탐색 시스템
KR101612713B1 (ko) 테트라사이클린 저항성 유전자를 이용한 테트라사이클린 계열 항생제 탐지용 바이오센서 균주
WO2023234691A1 (ko) 타겟 핵산 검출용 조성물 및 이의 용도
WO2017003104A1 (ko) 신규 트랜스아미나제 및 이를 이용한 아미노 화합물의 탈아민 방법
KR100470961B1 (ko) 유전자 손상 및 산화적 손상을 동시에 탐지할 수 있는재조합 발광/형광 박테리아

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14862672

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14862672

Country of ref document: EP

Kind code of ref document: A1