WO2014190356A2 - Anti-b7-h5 antibodies and their uses - Google Patents

Anti-b7-h5 antibodies and their uses Download PDF

Info

Publication number
WO2014190356A2
WO2014190356A2 PCT/US2014/039621 US2014039621W WO2014190356A2 WO 2014190356 A2 WO2014190356 A2 WO 2014190356A2 US 2014039621 W US2014039621 W US 2014039621W WO 2014190356 A2 WO2014190356 A2 WO 2014190356A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
antigen binding
binding fragment
cd28h
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/039621
Other languages
English (en)
French (fr)
Other versions
WO2014190356A3 (en
Inventor
Lieping Chen
Sheng Yao
Linda Liu
Solomon Langermann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Amplimmune Inc
Original Assignee
Johns Hopkins University
Amplimmune Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University, Amplimmune Inc filed Critical Johns Hopkins University
Priority to EP14732759.7A priority Critical patent/EP3004158A2/en
Priority to BR112015029395A priority patent/BR112015029395A2/pt
Priority to AU2014268298A priority patent/AU2014268298B2/en
Priority to CN201480041706.0A priority patent/CN106414489A/zh
Priority to KR1020157036610A priority patent/KR20160129698A/ko
Priority to HK17106014.0A priority patent/HK1232243A1/zh
Priority to CA2913312A priority patent/CA2913312A1/en
Priority to US14/893,463 priority patent/US10316092B2/en
Priority to SG11201509618QA priority patent/SG11201509618QA/en
Priority to MX2015016111A priority patent/MX376808B/es
Priority to JP2016515141A priority patent/JP6682426B2/ja
Publication of WO2014190356A2 publication Critical patent/WO2014190356A2/en
Publication of WO2014190356A3 publication Critical patent/WO2014190356A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2827Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/14Drugs for dermatological disorders for baldness or alopecia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/14Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/38Drugs for disorders of the endocrine system of the suprarenal hormones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • the present invention relates to antibodies and their antigen-binding fragments and to other molecules that are capable of binding to the B7-H5 ligand of the B7-H5:CD28H pathway, and to the uses of such molecules in the treatment and diagnosis of autoimmune disease, transplant rejection and other inflammatory diseases.
  • the immune system of humans and other mammals is responsible for providing protection against infection and disease. Such protection is provided both by a humoral immune response and by a cell-mediated immune response.
  • the humoral response results in the production of antibodies and other biomolecules that are capable of recognizing and neutralizing foreign targets (antigens).
  • the cell-mediated immune response involves the activation of macrophages, natural killer cells (NK), and antigen-specific cytotoxic T-lymphocytes by T cells, and the release of various cytokines in response to the recognition of an antigen (Dong, C. et al. (2003) "Immune Regulation by Novel Costimulatory Molecules," Immunolog. Res. 28(l):39-48).
  • T cells The ability of T cells to optimally mediate an immune response against an antigen requires two distinct signaling interactions (Viglietta, V. et al. (2007) “Modulating Co-Stimulation,” Neurotherapeutics 4:666-675; Korman, A.J. et al. (2007) “Checkpoint Blockade in Cancer Immunotherapy,” Adv. Immunol. 90:297-339).
  • APC antigen-presenting cells
  • Such presentation delivers a signal via the T cell receptor (TCR) that directs the T cell to initiate an immune response that will be specific to the presented antigen.
  • a series of co-stimulatory and co-inhibitory signals mediated through interactions between the APC and distinct T cell surface molecules, triggers first the activation and proliferation of the T cells and ultimately their inhibition.
  • the first signal confers specificity to the immune response whereas the second signal serves to determine the nature, magnitude and duration of the response.
  • the immune system is tightly controlled by co-stimulatory and co- inhibitory ligands and receptors. These molecules provide the second signal for T cell activation and provide a balanced network of positive and negative signals to maximize immune responses against infection while limiting immunity to self (Wang, L. et al. (March 7, 2011) "VISTA, A Novel Mouse Ig Superfamily Ligand That Negatively Regulates T Cell Responses," J. Exp. Med. 10.1084/jem.20100619: l-16; Lepenies, B. et al. (2008) “The Role Of Negative Costimulators During Parasitic Infections," Endocrine, Metabolic & Immune Disorders - Drug Targets 8:279-288).
  • Binding of B7.1 or of B7.2 to CD28 stimulates T cell activation; binding of B7.1 or B7.2 to CTLA4 inhibits such activation (Dong, C. et al. (2003) “Immune Regulation by Novel Costimulatory Molecules,” Immunolog. Res. 28(l):39-48; Lindley, P.S. et al. (2009) “The Clinical Utility Of Inhibiting CD28-Mediated Costimulation,” Immunol. Rev. 229:307-321; Greenwald, R.J. et al. (2005) “The B7 Family Revisited,” Ann. Rev. Immunol. 23:515-548).
  • CD28 is constitutively expressed on the surface of T cells (Gross, J., et al.
  • CTLA4 is the higher affinity receptor (Sharpe, A.H. et al. (2002) “The B7-CD28 Superfamily,” Nature Rev. Immunol. 2: 116-126), binding first initiates T cell proliferation (via CD28) and then inhibits it (via nascent expression of CTLA4), thereby dampening the effect when proliferation is no longer needed.
  • B7 Superfamily a set of related B7 molecules (the "B7 Superfamily") (Coyle, A.J. et al. (2001) "The Expanding B7 Superfamily: Increasing Complexity In Costimulatory Signals Regulating T Cell Function," Nature Immunol. 2(3):203-209; Sharpe, A.H. et al. (2002) “The B7-CD28 Superfamily,” Nature Rev. Immunol. 2: 116-126; Greenwald, R.J. et al. (2005) "The B7 Family Revisited,” Ann. Rev. Immunol. 23:515- 548; Collins, M. et al.
  • B7.1 CD80
  • B7.2 CD86
  • the inducible co- stimulator ligand ICOS-L, B7-H2
  • the programmed death- 1 ligand PD-L1; B7-H1
  • the programmed death-2 ligand PD-L2; B7-DC
  • B7-H3, B7-H4 also referred to as B7x, B7-H6 and B7S1; Sica, G.L. et al. (2003) "B7-4, A Molecule Of The B7 Family, Negatively Regulates T Cell Immunity " Immunity 18:849-861 ; Zang, X. et al.
  • B7x A Widely Expressed B7 Family Member That Inhibits T Cell Activation," Proc. Natl. Acad. Sci. (USA) 100: 10388-10392; Prasad, D.V. et al. (2003) B7S1, A Novel B7 Family Member That Negatively Regulates T Cell Activation," Immunity 18:863-873), B7-H6 (Collins, M. et al. (2005) “The B 7 Family Of Immune- Regulatory Ligands," Genome Biol. 6:223.1-223.7) and B7-H5 (Flajnik, M.F. et al.
  • the B7 family of genes is essential in the regulation of the adaptive immune system. Most B7 family members contain both variable (V)- and constant (C)-type domains of the immunoglobulin superfamily (IgSF).
  • B7 ligands are expressed on the cell surface of many different cell types including antigen presenting cells (APCs) and their interaction with receptor molecules on T cells provide activating and/or inhibitory signals that regulate T cell activation and tolerance (Collins, M. et al. (2005) "The B7 Family Of Immune-Regulatory Ligands," Genome Biol. 6:223.1-223.7). Some inhibitory B7 ligands are also expressed on tumor cells, resulting in suppression of immune responses (Keir, M.E. et al. (2008) “PD-1 And Its Ligands In Tolerance And Immunity," Annu. Rev. Immunol. 26:677-704; Zou, W. et al.
  • compositions capable of providing enhanced immunotherapy for the treatment of such conditions are directed to such compositions and their use to treat inflammatory disease, autoimmune disease, and similar diseases and conditions characterized by a hyperactive immune system.
  • Antibodies and their antigen-binding fragments and other molecules that are capable of immunospecifically binding to the B7-H5 ligand of the B7-H5:CD28H pathway, and to the uses of such molecules in the treatment and diagnosis of autoimmune disease, transplant rejection and other inflammatory diseases are provided.
  • One embodiment provides an antibody or other molecule having an antigen-binding fragment of an antibody that immunospecifically binds to a mammalian B7-H5 (and in particular, a human B7-H5).
  • the B7-H5 can be, for example, arrayed on the surface of a live cell.
  • Exemplary live cells include, but are not limited to macrophage or dendritic cells.
  • the B7-H5 binding molecules can have antigen-binding fragments that contain six CDRs.
  • the CDRs can include at least one consensus CDR of the CDRs of anti-B7-H5 antibodies: 2D3 and 18C3, with all remaining CDRs selected from: (A) the three light chain and the three heavy chain CDRs of anti- B7-H5 antibody 2D3;or
  • Another embodiment provides B7-H5 binding molecules wherein the six CDRs are:
  • the molecule is a chimeric antibody that includes antigen binding fragments (Fab) from two or more different B7-H5 antibodies.
  • Fab antigen binding fragments
  • the B7-H5 binding molecules can be a monoclonal antibody, a human antibody, a chimeric antibody or a humanized antibody and/or is a bispecific, trispecific or multispecific antibody.
  • the B7-H5 binding molecules can be detectably labeled or include a conjugated toxin, drug, receptor, enzyme, or receptor ligand.
  • Still another embodiment provides a pharmaceutical composition containing a therapeutically effective amount or a prophylactically effective amount of any of the above-described B7-H5 binding molecules and a physiologically acceptable carrier or excipient.
  • a molecule that is substantially capable of blocking B7-H5's interaction with CD28H is an CD28H fusion protein, preferably an CD28H-Ig fusion protein.
  • a method for diagnosing a disease in a subject includes assaying cells of the subject for their ability to bind to any of the above-described B7- H5 binding molecules, wherein the method provides a cytologic assay for diagnosing the presence of a disease in the subject.
  • the disclosed B7-H5 binding molecules can be used to an autoimmune disease or transplant rejection.
  • Figure 1 provides a schematic depiction of B7-H5 and its counter- receptor, CD28H.
  • FIG. 1 Panels A-J, show that B7-H5 is constitutively expressed on macrophages and inducible on dendritic cells.
  • FIG. 3 Panels A-D, show that CD28H is expressed on T cells and natural killer (NK) cells, but not on B cells.
  • Figures 4A-4B show the ability of the antibodies produced by clones 2D3 and 18C3 to bind human B7-H5 expressed by a CHO transfectants.
  • Figures 5A-5C show the abilities of the isolated antibodies and control Ig to block the B7-H5:CD28H interaction.
  • Figure 6 shows the ability of a B7-H5 Ig fusion to stimulate a T cell response.
  • Figure 7 shows the ability of the B7-H5 Ig to induce the expression of cytokines: IL-2, IFN- ⁇ and IL-10.
  • Figure 8 shows that the anti-B7-H5 antibody 2D3 of the present invention is capable of binding to B7-H5 so as to block the capacity of B7- H5 to interact with its CD28H counter-receptor.
  • Figure 9 shows the ability of anti-B7-H5 antibody 2D3 to inhibit an allogeneic T cell response.
  • Figure 10A and Figure 10B show the effect of anti-human B7-H5 antibody on the percentage of CD28H + cells among activated (CD45RO + ) human T cells in the spleen ( Figure 10A) and peripheral blood (Figure 10B) in NSG mice implanted with human PBMC.
  • Figure 11A and Figure 11B show the effect of anti-human B7-H5 antibody on the percentage of CD28H + cells among naive (CD45RCT) human T cells in the spleen ( Figure 11 A) and peripheral blood ( Figure 11B) in NSG mice implanted with human PBMC.
  • Figures 12A-12C show binding properties of recombinant anti- human B7-H5 chimeric antibodies (2D3 and 18C3).
  • Figures 12A-12C show the ability of anti-human B7-H5 antibodies (2D3 and 18C3) that had been recombinantly converted from their murine IgG isotype to a human IgG4 isotype to bind human B7-H5 expressed by CHO cells.
  • Figure 13 shows the ability of recombinant anti- human B7-H5 chimeric antibodies (2D3 and 18C3) to completely block the binding of CD28H fusion protein to CHO B7-H5 transfectants.
  • Human B7- H5 FL CHO transfectants were pre-incubated with control supernatant (Panel A) or recombinant chimeric 2D3 (Panel B) and 18C3 supernatants (Panel C), and subsequently stained with biotinylated CD28HhIg fusion protein.
  • Figures 14A-14B show the epitope recognition site of anti-human B7-H5 antibodies (2D3 and 18C3).
  • Figure 14A and Figure 14B show that 2D3 and 18C3 recognize the first IgV domain of B7-H5.
  • Figure 14C shows B7-H5 IgV domain mediates B7-H5's interaction with CD28H.
  • Figure 15 compares the affinities of antibodies 2D3 and 18C3 for binding to human B7-H5 as expressed on the surface of CHO cells.
  • Figures 16A-16B show the effect of the endogenous B7- H5:CD28H interaction on the recall of TT-specific memory T cells.
  • Figure 16A shows TT vaccine-induced T cell proliferation in the presence of the B7-H5:CD28H interaction blocking antibody 2D3 (Panel B) or control Igs (Panel A).
  • Figure 16B shows the levels of expressed cytokines (Panel A) and the BrdU-positive cells (Panel B) associated with such response.
  • Figures 17A-17B show the blockade of endogenous B7-H5:CD28H interaction by 2D3 inhibits the allogeneic proliferative responses of both CD8+ ( Figure 17A, Panels A-B) and CD4+ ( Figure 17B, Panels A-B) T cells in humanized NSG mice.
  • Figure 18 shows simultaneous cross-linking of TCR and B7-H5 fusion protein induced AKT phosphor lation 30 min after stimulation, while TCR cross-linking alone induced minimal AKT phosphorylation.
  • B7-H5 antibody 2D3 prevented AKT activation, indicating B7-H5 co-stimulation utilizes the AKT pathway to promote T cell response.
  • Figure 19 shows B7-H5-CD28H pathway blockade by decoy receptor fusion protein CD28HIg suppressed the cytotoxic killing activity of allogeneic CD8 T cell against B7-H5 transfected 624Mel melanoma cell line, indicating B7-H5-CD28H pathway promotes cytotoxic killing activity of CD8 T cells on target cells.
  • Figure 20A-B show simultaneous cross-linking of CD16 and B7- H5 fusion protein on Natural Killer cells (NK) in the presence of soluble recombinant human IL-2 induced NK activation and degranulation (CD 107a surface upregulation), whereas CD 16 engagement alone did not induce significant NK degra ulation.
  • NK Natural Killer cells
  • Figure 20A A B7-H5 fusion protein dose dependent NK activation was observed ( Figure 20A).
  • inclusion of B7-H5 antibody 2D3 prevented NK activation ( Figure 20B), indicating B7-H5 co- stimulates NK activation.
  • the present invention relates to antibodies and their antigen-binding fragments and to other molecules that are capable of immunospecifically binding to the B7-H5 ligand of the B7-H5:CD28H pathway, and to the uses of such molecules in the treatment and diagnosis of autoimmune disease, transplant rejection and other inflammatory diseases.
  • the B7-H5:CD28H pathway is a cellular immunity pathway that involves the ligand B7-H5 and its counter-receptor CD28H ( Figure 1).
  • B7- H5 is expressed on antigen presenting cells; it is constitutively expressed on macrophages and inducible on dendritic cells ( Figure 2, Panels A-J).
  • CD28H is particularly expressed on naive T cells, NK cells, and plasmacytoid dendritic cells (especially in the spleen, lymph node and thymus), and its expression is down-regulated on matured or activated cells. It is not expressed on ⁇ T cells or B cells ( Figure 3), but is expressed on T n , TCM, T EM , and T EM RA T cell subsets.
  • Human cord blood T cells express CD28H as do CD4 + , CD8 + and CD4 + /CD8 + thymocytes.
  • B7-H5 interacts with the CD28H counter-receptor to stimulate the immune system, thereby promoting enhanced immune responses.
  • CD28H Down-regulation of CD28H has been found to impair activated/memory T cell survival in vivo.
  • the interaction between B7-H5 and CD28H is important for native T cell priming and activated/memory T cell survival in vivo.
  • CD28H is also seen to be down-regulated in chronically antigen-exposed / exhausted T cells.
  • CD28H is constitutively expressed on Natural Killer cell (NK).
  • NK Natural Killer cell
  • B7-H5-CD28H pathway promotes NK activation and degranulation in the presence of other NK activation signal, such as CD 16 crosslinking.
  • the present invention reflects, in part, the recognition that molecules, such as antibodies and their antigen binding fragments that immunospecifically bind to B7-H5 ("anti-B7-H5 antibodies”), and particularly anti-B7-H5 antibodies or decoy receptor fusion protein CD28HIg that block the B7-H5:CD28H interaction so as to impair (i.e., prevent or attenuate) the ability of B7-H5 to bind to CD28H, are capable of impairing the ability of B7-H5 to promote enhanced immune responses via the CD28H interaction, and thus are capable of serving as antagonists of T cell proliferation and cytokine production and NK activation.
  • molecules such as antibodies and their antigen binding fragments that immunospecifically bind to B7-H5 (“anti-B7-H5 antibodies”), and particularly anti-B7-H5 antibodies or decoy receptor fusion protein CD28HIg that block the B7-H5:CD28H interaction so as to impair (i.e., prevent or attenu
  • Such molecules are capable of mediating a physiological reduction in immune system activation and thus have utility in the treatment of inflammatory disease and autoimmune disease.
  • such antibodies are capable of reducing the percentage of activated T cells and NK cells in vivo.
  • HHLA2 human endogenous retrovirus- H long terminal repeat-associating protein 2 (HHLA2); Mager, D.L. et al. (1999) "Endogenous Retroviruses Provide The Primary Polyadenylation Signal For Two New Human Genes (HHLA2 And HHLA3," Genomics 59:255-263), that had no known function (Flajnik, M.F. et al.
  • B7-H5 is also referred to herein and elsewhere as B7-H7. Accordingly, the terms B7-H5 and B7-H7 are used interchangeably herein.
  • the human B7-H5 sequence has been found to have homologs in chicken, opossum, hoofed mammals (e.g., horse, pig), salmon, and shark. However, only pseudogenes have been thus far identified in rodents (mouse and rat).
  • the amino acid sequences of such genes reveal a similar domain structures in all species, with conservation of the canonical residues for Ig superfamily domains.
  • Human B7-H5 polypeptide is 414 amino acids in length and has been reported to contain the following: a signal sequence, an extracellular domain having 3 immunoglobulin-like (Ig-like) domains, a transmembrane domain, and a cytoplasmic domain.
  • the human B7-H5 polypeptide has been reported to contain an Ig-like V-type 1 domain, an Ig- like C-l type domain, and an Ig-like V-type 2 domain.
  • Multiple naturally occurring variants of B7-H5 exist e.g., Accession No. Q9UM44-1 (homo sapiens), NP_009003 (GL5901964, homo sapiens), and AAD48396 (GI: 15726285, homo sapiens); see WO 201 1/020024).
  • mutant-B7-H5 refers to any naturally occurring B7-H5 amino acid sequence, including immature or precursor and mature forms.
  • amino acid sequence of a representative human B7-H5, Accession No. Q9UM44-1, is (SEQ ID NO:l): [0051]
  • the human B7-H5 has been reported to contain the following: a signal sequence at approximately amino acid residues 1 to 22 of SEQ ID NO:l, an Ig-like V-type 1 domain (shown underlined above) at approximately amino acid residues 61 to 131 of SEQ ID NO:l, an Ig-like C- 1 type domain at approximately amino acid residues 138 to 222 of SEQ ID NO:l, an Ig-like V-type 2 domain at approximately amino acid residues 235 to 328 of SEQ ID NO:l, and a transmembrane domain at approximately amino acid residues 345 to 365 of SEQ ID NO:l.
  • the predicted dimer interface for human B7-H5 polypeptide is amino acid residues 141-144, 156, 158, 160, 162, 193-196, 198, 200, 201, 224, and 225 of SEQ ID NO:l.
  • the predicted N-linked glycosylation sites for human B7-H5 polypeptide are at amino acid residues 90, 103, and 318 of SEQ ID NO:l.
  • Natural variations of human B7-H5 polypeptide include BOT, N344K, and S346R (UniProt Q9UM44) (see, WO 201 1/020024, which reference is herein incorporated by reference in its entirety for its teaching of the structure and sequence of human B7-H5).
  • a DNA sequence encoding human B7-H5 (SEQ ID NO:2):
  • amino acid sequence of a representative human B7-H5 IgV domain human IgG4 fusion protein is (SEQ ID NO:3) (B7-H5 sequences are shown in boldface; IgG4 sequences are shown underlined):
  • the fusion protein may additionally comprise an N-terminal leader sequence (such residues 1-22 of SEQ ID NO:l, i.e., the naturally occurring B7-H5 leader sequence (SEQ ID NO:4):
  • a DNA sequence encoding the naturally occurring B7-H5 leader sequence is (SEQ ID NO:5):
  • B7-H5 sequences are shown fused to a human IgG4 region, in accordance with the present invention, such sequences can alternatively be fused to any Ig isotype, or indeed to any other protein.
  • An amino acid sequence of a representative human B7-H5 human IgG4P fusion protein is including the extracellular domain of B7-H5 is (SEQ ID NO:24) (B7-H5ECD-hIgG4P with B7-H5 ECD aal-340 underlined, and the Serine 228 to Proline mutation double underline)
  • the signal sequence can be the native signal sequence (SEQ ID NO:29)
  • the fusion protein can be encoded by the nucleic acid sequence (SEQ ID NO:25) atgaaggcccagaccgccctgtccttcttcctgatccacctccctgtccggcagcca gggaatcttccctctggccttcttcatctacgtgcccatgaacgagcagatcgtgatcggccc ggctggacgaggatattatcctgccctccagcttcgagcggggctccgaggtcgtgatccac tggaagtaccaggactcctacaaggtgcactcctactacaagggctcccgaccacctggaatc ccaggaccccagatacgccaaccggaccagcctgtctacaagatccagaacggcaacgcgcgcgcgaccacc
  • human B7-H5 In contrast to human B7-H4 which is widely expressed, human B7- H5 is found to exhibit more limited expression (e.g., expressed in the gut, kidney, lung, epithelial cells and lymphocytes). Human HHLA2 is found on chromosome 3ql3.33 near B7.1 and B7.2. B7-H5 is constitutively expressed on macrophages and inducible on dendritic cells (DC).
  • DC dendritic cells
  • CD28H also referred to herein and elsewhere as H7CR
  • H7CR is the counter-receptor for B7-H5. Accordingly, the terms CD28H and H7CR are used interchangeably herein.
  • the term “native CD28H” (also “native H7CR”) refers to the naturally occurring counter-receptor of B7-H5, or variations thereof. CD28H is expressed by T cells, NK cells, and plasmacytoid dendritic cells.
  • the human CD28H polypeptide is otherwise referred to as transmembrane and immunoglobulin domain containing 2 (TMIGD2) in the literature/databases (Rahimi, N. et al.
  • CD28H CD28H
  • NP_653216.1 (GL21389429; homo sapiens) and NP_653216.2 (GI:281306838; homo sapiens).
  • a representative amino acid sequence (Q96BF3-2) of the native CD28H molecule is provided below as SEQ ID NO:7:
  • a DNA sequence encoding human CD28H (SEQ ID NO:7) is
  • a molecule is said to be able to "immunospecifically bind" a second molecule if such binding exhibits the specificity and affinity of an antibody to its cognate antigen.
  • Antibodies are said to be capable of "immunospecifically binding" to a target region or conformation ("epitope") of an antigen (and in particular, the antigen B7-H5) if such binding involves the antigen recognition site of the immunoglobulin molecule.
  • An antibody that immunospecifically binds to a particular antigen may bind to other antigens with lower affinity if the other antigen has some sequence or conformational similarity that is recognized by the antigen recognition site as determined by, e.g., immunoassays, BIACORE® assays, or other assays known in the art, but would not bind to a totally unrelated antigen. Preferably, however, antibodies (and their antigen binding fragments) will not cross-react with other antigens. Antibodies may also bind to other molecules in a way that is not immunospecific, such as to FcR receptors, by virtue of binding domains in other regions/domains of the molecule that do not involve the antigen recognition site, such as the Fc region.
  • substantially as used in the context of binding or exhibited effect, is intended to denote that the observed effect is physiologically or therapeutically relevant.
  • a molecule is able to substantially block an activity of B7-H5 if the extent of blockage is physiologically or therapeutically relevant (for example if such extent is greater than 60% complete, greater than 70% complete, greater than 75% complete, greater than 80% complete, greater than 85% complete, greater than 90% complete, greater than 95% complete, or greater than 97% complete).
  • a molecule is said to have substantially the same immunospecificity and/or characteristic as another molecule, if such immunospecificities and characteristics are greater than 60% identical, greater than 70% identical, greater than 75% identical, greater than 80% identical, greater than 85% identical, greater than 90% identical, greater than 95% identical, or greater than 97% identical).
  • the term "subject” is intended to denote a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) and a primate (e.g., monkey and human), most preferably a human.
  • a primate e.g., monkey and human
  • patient is intended to denote a subject receiving a composition of the present invention for a diagnostic, therapeutic or prophylactic purpose.
  • antibody is intended to denote an immunoglobulin molecule that possesses a "variable region” antigen recognition site.
  • the term “variable region” is intended to distinguish such domain of the immunoglobulin from domains that are broadly shared by antibodies (such as an antibody Fc domain).
  • the variable region comprises a "hypervariable region” whose residues are responsible for antigen binding.
  • the hypervariable region comprises amino acid residues from a "Complementarity Determining Region” or "CDR” (i.e., typically at approximately residues 24-34 (LI), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and at approximately residues 27-35 (HI), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; Kabat et al, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD.
  • CDR Constantarity Determining Region
  • residues from a "hypervariable loop” i.e., residues 26-32 (LI), 50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26-32 (HI), 53-55 (H2) and 96- 101 (H3) in the heavy chain variable domain; Chothia and Lesk, 1987, J. Mol. Biol. 196:901-917).
  • "Framework Region” or "FR" residues are those variable domain residues other than the hypervariable region residues as herein defined.
  • antibody includes monoclonal antibodies, multi- specific antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies (See e.g., Muyldermans et al., 2001, Trends Biochem. Sci. 26:230; Nuttall et al., 2000, Cur. Pharm. Biotech. 1 :253; Reichmann and Muyldermans, 1999, J. Immunol. Meth. 231 :25; International Publication Nos. WO 94/04678 and WO 94/25591 ; U.S. Patent No.
  • scFv single-chain Fvs
  • sdFv single-chain Fvs
  • intrabodies single chain antibodies
  • anti-Id antibodies including, e.g., anti-Id and anti-anti-Id antibodies to the disclosed B7-H5 antibodies.
  • antibodies include immunoglobulin molecules of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
  • immunoglobulin molecules of any type e.g., IgG, IgE, IgM, IgD, IgA and IgY
  • class e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2 or subclass.
  • the term "antigen binding fragment" of an antibody refers to one or more portions of an antibody that contain the antibody's Complementarity Determining Regions ("CDRs") and optionally the framework residues that comprise the antibody's "variable region” antigen recognition site, and exhibit an ability to immunospecifically bind antigen.
  • CDRs Complementarity Determining Regions
  • Such fragments include Fab', F(ab')2, Fv, single chain (ScFv),and mutants thereof, naturally occurring variants, and fusion proteins comprising the antibody's "variable region” antigen recognition site and a heterologous protein (e.g., a toxin, an antigen recognition site for a different antigen, an enzyme, a receptor or receptor ligand, etc.).
  • fragment refers to a peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, or at least 250 contiguous amino acid residues.
  • Human, chimeric or humanized derivatives of anti-human B7-H5 antibodies are particularly preferred for in vivo use in humans, however, murine antibodies or antibodies of other species may be advantageously employed for many uses (for example, in vitro or in situ detection assays, acute in vivo use, etc.).
  • a humanized antibody may comprises amino acid residue substitutions, deletions or additions in one or more non-human CDRs.
  • the humanized antibody derivative may have substantially the same binding, stronger binding or weaker binding when compared to a non- derivative humanized antibody. In specific embodiments, one, two, three, four, or five amino acid residues of the CDR have been substituted, deleted or added (i.e., mutated).
  • Completely human antibodies are particularly desirable for therapeutic treatment of human subjects.
  • Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences (see U.S. Patent Nos. 4,444,887 and 4,716, 11 1; and International Publication Nos. WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741). Human antibodies can be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes.
  • the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells.
  • the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes.
  • the mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination.
  • homozygous deletion of the JH region prevents endogenous antibody production.
  • the modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring which express human antibodies.
  • the transgenic mice are immunized using conventional methodologies with a selected antigen, e.g., all or a portion of a B7-H5 polypeptide.
  • Monoclonal antibodies directed against the antigen can be obtained from the immunized, transgenic mice using conventional hybridoma technology (see, e.g., U.S. Patent No. 5,916,771).
  • the human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation.
  • Lonberg and Huszar (1995, Int. Rev. Immunol.
  • a "chimeric antibody” is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules such as antibodies having a variable region derived from a non-human antibody and a human immunoglobulin constant region.
  • Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, 1985, Science 229: 1202; Oi et al, 1986, BioTechniques 4:214; Gillies et al, 1989, J. Immunol. Methods 125: 191-202; and U.S. Patent Nos. 6,311,415, 5,807,715, 4,816,567, and 4,816,397.
  • Chimeric antibodies comprising one or more CDPvS from a non-human species and framework regions from a human immunoglobulin molecule can be produced using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; International Publication No. WO 91/09967; and U.S. Patent Nos. 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology 28(4/5):489-498; Studnicka et al, 1994, Protein Engineering 7:805; and Roguska et al., 1994, Proc. Natl. Acad. Sci. USA 91 :969), and chain shuffling (U.S. Patent No. 5,565,332).
  • the invention particularly concerns "humanized antibodies" (see, e.g., European Patent Nos. EP 239,400, EP 592, 106, and EP 519,596; International Publication Nos. WO 91/09967 and WO 93/17105; U.S. Patent Nos. 5,225,539, 5,530,101, 5,565,332, 5,585,089, 5,766,886, and 6,407,213; and Padlan, 1991, Molecular Immunology 28(4/5):489-498; Studnicka et al, 1994, Protein Engineering 7(6):805-814; Roguska et al, 1994, PNAS 91 :969-973; Tan et al, 2002, J.
  • humanized antibody refers to an immunoglobulin comprising a human framework region and one or more CDR's from a non- human (usually a mouse or rat) immunoglobulin.
  • the non-human immunoglobulin providing the CDR's is called the "donor” and the human immunoglobulin providing the framework is called the “acceptor.”
  • Constant regions need not be present, but if they are, they must be substantially identical to human immunoglobulin constant regions, i.e., at least about 85- 90%, preferably about 95% or more identical.
  • all parts of a humanized immunoglobulin, except possibly the CDR's, are substantially identical to corresponding parts of natural human immunoglobulin sequences.
  • a humanized antibody is an antibody comprising a humanized light chain and a humanized heavy chain immunoglobulin.
  • humanized antibody would not encompass a typical chimeric antibody, because, e.g., the entire variable region of a chimeric antibody is non-human.
  • the donor antibody has been "humanized,” by the process of "humanization,” because the resultant humanized antibody is expected to bind to the same antigen as the donor antibody that provides the CDR's.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which hypervariable region residues of the recipient are replaced by hypervariable region residues from a non-human species (donor antibody) such as mouse, rat, rabbit or a non-human primate having the desired specificity, affinity, and capacity.
  • Framework Region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • humanized antibodies may comprise residues which are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable regions correspond to those of a non- human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence.
  • the humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin that immunospecifically binds to an Fc RUB polypeptide, that has been altered by the introduction of amino acid residue substitutions, deletions or additions (i.e., mutations ).
  • Fc immunoglobulin constant region
  • DNA sequences coding for preferred human acceptor framework sequences include but are not limited to FR segments from the human germline VH segment VH1-18 and JH6 and the human germline VL segment VK-A26 and JK4.
  • one or more of the CDRs are inserted within framework regions using routine recombinant DNA techniques.
  • the framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et ah, 1998, "Structural Determinants In The Sequences Of Immunoglobulin Variable Domain," J. Mol. Biol. 278: 457-479 for a listing of human framework regions).
  • a humanized or chimeric B7-H5 antibody can include substantially all of at least one, and typically two, variable domains in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin (i.e., donor antibody) and all or substantially all of the framework regions are those of a human immunoglobulin consensus sequence.
  • a B7-H5 antibody also includes at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • the constant domains of the B7-H5 antibodies may be selected with respect to the proposed function of the antibody, in particular the effector function which may be required.
  • the constant domains of the B7-H5 antibodies are (or comprise) human IgA, IgD, IgE, IgG or IgM domains.
  • human IgG constant domains especially of the IgGl and IgG3 isotypes are used, when the humanized B7-H5 antibodies is intended for therapeutic uses and antibody effector functions such as antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) activity are needed.
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • CDC complement-dependent cytotoxicity
  • IgG2 and IgG4 isotypes are used when the B7-H5 antibody is intended for therapeutic purposes and antibody effector function is not required.
  • the invention encompasses Fc constant domains comprising one or more amino acid modifications which alter antibody effector functions such as those disclosed in U.S. Patent Application Publication Nos. 2005/0037000 and 2005/0064514.
  • the B7-H5 antibody contains both the light chain as well as at least the variable domain of a heavy chain.
  • the B7-H5 antibody may further include one or more of the CHI, hinge, CH2, CH3, and CH4 regions of the heavy chain.
  • the antibody can be selected from any class of immunoglobulins, including IgM, IgG, IgD, IgA and IgE, and any isotype, including IgGl, IgG2, IgG3 and IgG4.
  • the constant domain is a complement fixing constant domain where it is desired that the antibody exhibit cytotoxic activity, and the class is typically IgGl.
  • the constant domain may be of the IgG2 class.
  • the B7-H5 antibody may comprise sequences from more than one class or isotype, and selecting particular constant domains to optimize desired effector functions is within the ordinary skill in the art.
  • the framework and CDR regions of a humanized antibody need not correspond precisely to the parental sequences, e.g., the donor CDR or the consensus framework may be mutagenized by substitution, insertion or deletion of at least one residue so that the CDR or framework residue at that site does not correspond to either the consensus or the donor antibody. Such mutations, however, are preferably not extensive. Usually, at least 75% of the humanized antibody residues will correspond to those of the parental framework region (FR) and CDR sequences, more often 90%, and most preferably greater than 95%. Humanized antibodies can be produced using variety of techniques known in the art, including, but not limited to, CDR-grafting (European Patent No. EP 239,400; International Publication No.
  • framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions.
  • methods well known in the art e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions.
  • U.S. Patent No. 5,585,089; U.S. Publication Nos. 2004/0049014 and 2003/0229208 See, e.g., Queen et al, U.S. Patent No. 5,585,089; U.S. Publication Nos. 2004/0049014 and 2003/0229208; U.S. Patent Nos. 6,350,861; 6, 180,370; 5,693,762; 5,693,761; 5,585,089; and 5,530, 101 and Riechmann et al, 1988, Nature 332:323).
  • the antibodies used in the methods of the present invention may be monospecific. Also of interest are bispecific antibodies, trispecific antibodies or antibodies of greater multispecificity that exhibit specificity to different targets in addition to B7-H5, such as other molecules of the immune system. For example, such antibodies may bind to both B7-H5 and to an antigen that is important for targeting the antibody to a particular cell type or tissue (for example, to an antigen associated with a cancer antigen of a tumor being treated).
  • such multispecific antibody binds to molecules (receptors or ligands) involved in alternative or supplemental immunomodulatory pathways, such as CTLA4, TIM3, TIM4, OX40, CD40, GITR, 4-1-BB, CD27/CD70, ICOS, B7-H4, LIGHT, PD-1 or LAG3, in order to diminish further modulate the immunomodulatory effects.
  • molecules receptors or ligands involved in alternative or supplemental immunomodulatory pathways, such as CTLA4, TIM3, TIM4, OX40, CD40, GITR, 4-1-BB, CD27/CD70, ICOS, B7-H4, LIGHT, PD-1 or LAG3, in order to diminish further modulate the immunomodulatory effects.
  • the multispecific antibody may bind to effecter molecules such as cytokines (e.g., IL-7, IL-15, IL-12, IL-4 TGF-beta, IL-10, IL-17, IFNg, Flt3, BLys) and chemokines (e.g., CCL21), which may be particularly relevant for down-modulating both acute and chronic immune responses.
  • cytokines e.g., IL-7, IL-15, IL-12, IL-4 TGF-beta, IL-10, IL-17, IFNg, Flt3, BLys
  • chemokines e.g., CCL21
  • the antibodies of the present invention may be produced by any method known in the art useful for the production of polypeptides, e.g., in vitro synthesis, recombinant DNA production, and the like.
  • the antibodies are produced by recombinant DNA technology.
  • the B7-H5 antibodies may be produced using recombinant immunoglobulin expression technology.
  • the recombinant production of immunoglobulin molecules, including humanized antibodies are described in U.S. Patent No. 4,816,397 (Boss et al), U.S. Patent Nos. 6,331,415 and 4,816,567 (both to Cabilly et al), U.K.
  • An exemplary process for the production of the recombinant chimeric B7-H5 antibodies can include the following: a) constructing, by conventional molecular biology methods, an expression vector that encodes and expresses an antibody heavy chain in which the CDRs and variable region of a murine anti-human B7-H5 monoclonal antibody are fused to an Fc region derived from a human immunoglobulin, thereby producing a vector for the expression of a chimeric antibody heavy chain; b) constructing, by conventional molecular biology methods, an expression vector that encodes and expresses an antibody light chain of the murine anti- human B7-H5 monoclonal antibody, thereby producing a vector for the expression of chimeric antibody light chain; c) transferring the expression vectors to a host cell by conventional molecular biology methods to produce a transfected host cell for the expression of chimeric antibodies; and d) culturing the transfected cell by conventional cell culture techniques so as to produce chimeric antibodies.
  • An exemplary process for the production of the recombinant humanized B7-H5 antibodies can include the following: a) constructing, by conventional molecular biology methods, an expression vector that encodes and expresses an anti-human B7-H5 heavy chain in which the CDRs and a minimal portion of the variable region framework that are required to retain donor antibody binding specificity are derived from a non-human immunoglobulin, such as a murine anti-human B7-H5 monoclonal antibody, and the remainder of the antibody is derived from a human immunoglobulin, thereby producing a vector for the expression of a humanized antibody heavy chain; b) constructing, by conventional molecular biology methods, an expression vector that encodes and expresses an antibody light chain in which the CDRs and a minimal portion of the variable region framework that are required to retain donor antibody binding specificity are derived from a non-human immunoglobulin, such as a murine anti-human B7-H5 monoclonal antibody, and the remainder of the
  • host cells may be co- transfected with such expression vectors, which may contain different selectable markers but, with the exception of the heavy and light chain coding sequences, are preferably identical. This procedure provides for equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes both heavy and light chain polypeptides.
  • the coding sequences for the heavy and light chains may comprise cDNA or genomic DNA or both.
  • the host cell used to express the recombinant B7-H5 antibody can be either a bacterial cell such as Escherichia coli, or more preferably a eukaryotic cell (e.g., a Chinese hamster ovary (CHO) cell or a HEK-293 cell).
  • a eukaryotic cell e.g., a Chinese hamster ovary (CHO) cell or a HEK-293 cell.
  • the choice of expression vector is dependent upon the choice of host cell, and may be selected so as to have the desired expression and regulatory characteristics in the selected host cell.
  • Other cell lines that may be used include, but are not limited to, CHO- Kl, NSO, and PER.C6 (Crucell, Leiden, Netherlands).
  • any of the above-described antibodies can be used to generate antiidiotype antibodies using techniques well known to those skilled in the art (see, e.g., Greenspan, N.S. et al. (1989) "Idiotypes: Structure And Immunogenicity " FASEB J. 7:437-444; and isinoff, A. (1991) "Idiotypes: Concepts And Applications," i. Immunol. 147(8):2429-2438).
  • any of the above antibodies can, if desired, be further improved by screening for variants that exhibit such desired characteristics.
  • such antibodies can be generated using various phage display methods known in the art.
  • phage display methods functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them.
  • phage can be utilized to display antigen binding domains, such as Fab and Fv or disulfide-bond stabilized Fv, expressed from a repertoire or combinatorial antibody library (e.g., human or murine).
  • Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phage used in these methods are typically filamentous phage, including fd and Ml 3. The antigen binding domains are expressed as a recombinantly fused protein to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to make the immunoglobulins, or fragments thereof, of the present invention include those disclosed in Brinkman, U. et al. (1995) "Phage Display Of Disulflde-Stabilized Fv Fragments " J. Immunol.
  • the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including humanized antibodies, or any other desired fragments, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below.
  • techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art (such as those disclosed in PCT Publication WO 92/22324; Mullinax, R.L. et al.
  • Phage display technology can be used to increase the affinity of an antibody for B7-H5. This technique would be useful in obtaining high affinity antibodies that could be used in the disclosed combinatorial methods.
  • This technology referred to as affinity maturation, employs mutagenesis or CDR walking and re-selection using such receptors or ligands (or their extracellular domains) or an antigenic fragment thereof to identify antibodies that bind with higher affinity to the antigen when compared with the initial or parental antibody (See, e.g., Glaser, S.M. et al. (1992) "Antibody Engineering By Codon-Based Mutagenesis In A Filamentous Phage Vector System," J. Immunol. 149:3903-3913).
  • Libraries can be constructed consisting of a pool of variant clones each of which differs by a single amino acid alteration in a single CDR and which contain variants representing each possible amino acid substitution for each CDR residue.
  • Mutants with increased binding affinity for the antigen can be screened by contacting the immobilized mutants with labeled antigen. Any screening method known in the art can be used to identify mutant antibodies with increased avidity to the antigen (e.g., ELISA) (see, e.g., Wu, H. et al.
  • the invention thus contemplates the use of random mutagenesis to identify improved CDRs.
  • Phage display technology can alternatively be used to increase (or decrease) CDR affinity.
  • This technology referred to as affinity maturation, employs mutagenesis or "CDR walking" and re-selection uses the target antigen or an antigenic fragment thereof to identify antibodies having CDRs that bind with higher (or lower) affinity to the antigen when compared with the initial or parental antibody (see, e.g., Glaser, S.M. et al. (1992) "Antibody Engineering By Codon-Based Mutagenesis In A Filamentous Phage Vector System," J. Immunol. 149:3903-3913).
  • Libraries can be constructed consisting of a pool of variant clones each of which differs by a single amino acid alteration in a single CDR and which contain variants representing each possible amino acid substitution for each CDR residue.
  • Mutants with increased (or decreased) binding affinity for the antigen can be screened by contacting the immobilized mutants with labeled antigen. Any screening method known in the art can be used to identify mutant antibodies with increased (or decreased) avidity to the antigen (e.g., ELISA) (see, Wu, H. et al.
  • the invention particularly contemplates the production and use of "derivatives" of any of the above-described antibodies and their antigen- binding fragments.
  • derivative refers to an antibody or antigen-binding fragment thereof that immunospecifically binds to an antigen but which comprises, one, two, three, four, five or more amino acid substitutions, additions, deletions or modifications relative to a "parental" (or wild-type) molecule.
  • amino acid substitutions or additions may introduce naturally occurring (i.e., DNA-encoded) or non-naturally occurring amino acid residues.
  • derivative encompasses, for example, chimeric or humanized variants of any of antibodies 1.3, 4.5 or 7.8, as well as variants having altered CHI, hinge, CH2, CH3 or CH4 regions, so as to form, for example antibodies, etc., having variant Fc regions that exhibit enhanced or impaired effector or binding characteristics.
  • derivative additionally encompasses non-amino acid modifications, for example, amino acids that may be glycosylated (e.g., have altered mannose, 2-N- acetylglucosamine, galactose, fucose, glucose, sialic acid, 5-N- acetylneuraminic acid, 5-glycolneuraminic acid, etc.
  • the altered carbohydrate modifications modulate one or more of the following: solubilization of the antibody, facilitation of subcellular transport and secretion of the antibody, promotion of antibody assembly, conformational integrity, and antibody- mediated effector function.
  • the altered carbohydrate modifications enhance antibody mediated effector function relative to the antibody lacking the carbohydrate modification.
  • Carbohydrate modifications that lead to altered antibody mediated effector function are well known in the art (for example, see Shields, R.L. et al.
  • a humanized antibody is a derivative.
  • Such a humanized antibody comprises amino acid residue substitutions, deletions or additions in one or more non-human CDRs.
  • the humanized antibody derivative may have substantially the same binding, better binding, or worse binding when compared to a non-derivative humanized antibody.
  • one, two, three, four, or five amino acid residues of the CDR have been substituted, deleted or added (i.e., mutated).
  • a derivative antibody or antibody fragment may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to, specific chemical cleavage, acetylation, formulation, metabolic synthesis of tunicamycin, etc.
  • an antibody derivative will possess a similar or identical function as the parental antibody.
  • an antibody derivative will exhibit an altered activity relative to the parental antibody.
  • a derivative antibody (or fragment thereof) can bind to its epitope more tightly or be more resistant to proteolysis than the parental antibody.
  • Derivatized antibodies may be used to alter the half-lives (e.g., serum half-lives) of parental antibodies in a mammal, preferably a human. Preferably such alteration will result in a half-life of greater than 15 days, preferably greater than 20 days, greater than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, greater than 2 months, greater than 3 months, greater than 4 months, or greater than 5 months.
  • half-lives e.g., serum half-lives
  • the increased half-lives of the humanized antibodies of the present invention or fragments thereof in a mammal, preferably a human results in a higher serum titer of said antibodies or antibody fragments in the mammal, and thus, reduces the frequency of the administration of said antibodies or antibody fragments and/or reduces the concentration of said antibodies or antibody fragments to be administered.
  • Antibodies or fragments thereof having increased in vivo half-lives can be generated by techniques known to those of skill in the art. For example, antibodies or fragments thereof with increased in vivo half-lives can be generated by modifying (e.g., substituting, deleting or adding) amino acid residues identified as involved in the interaction between the Fc domain and the FcRn receptor.
  • humanized B7-H5 antibodies can be engineered to increase biological half-lives (see, e.g. U.S. Patent No. 6,277,375).
  • humanized B7-H5 antibodies can be engineered in the Fc-hinge domain to have increased in vivo or serum half-lives.
  • Antibodies or fragments thereof with increased in vivo half-lives can be generated by attaching to said antibodies or antibody fragments polymer molecules such as high molecular weight polyethyleneglycol (PEG).
  • PEG polymer molecules
  • PEG can be attached to said antibodies or antibody fragments with or without a multifunctional linker either through site-specific conjugation of the PEG to the N- or C- terminus of said antibodies or antibody fragments or via epsilon-amino groups present on lysine residues. Linear or branched polymer derivatization that results in minimal loss of biological activity will be used.
  • the degree of conjugation will be closely monitored by SDS- PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the antibodies.
  • Unreacted PEG can be separated from antibody-PEG conjugates by, e.g., size exclusion or ion-exchange chromatography.
  • the B7-H5 antibodies may also be modified by the methods and coupling agents described by Davis et al. (See U.S. Patent No. 4,179,337) in order to provide compositions that can be injected into the mammalian circulatory system with substantially no immunogenic response.
  • One embodiment encompasses modification of framework residues of the humanized B7-H5 antibodies.
  • Framework residues in the framework regions may be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding.
  • These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., U.S. Patent No. 5,585,089; and Riechmann, L. et al. (1988) "Reshaping Human Antibodies For Therapy '' Nature 332:323-327).
  • Yet another embodiment encompasses anti-human B7-H5 antibodies (and more preferably, humanized antibodies) and antigen-binding fragments thereof that are recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a heterologous molecule (i.e., an unrelated molecule).
  • the fusion does not necessarily need to be direct, but may occur through linker sequences.
  • heterologous molecules are polypeptides having at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acids.
  • heterologous molecules may alternatively be enzymes, hormones, cell surface receptors, drug moieties, such as: toxins (such as abrin, ricin A, pseudomonas exotoxin (i.e., PE-40), diphtheria toxin, ricin, gelonin, or pokeweed antiviral protein), proteins (such as tumor necrosis factor, interferon (e.g., a- interferon, ⁇ -interferon), nerve growth factor, platelet derived growth factor, tissue plasminogen activator, or an apoptotic agent (e.g., tumor necrosis factor-a, tumor necrosis factor- ⁇ )), biological response modifiers (such as, for example, a lymphokine (e.g., interleukin- 1 ("IL-1
  • the B7-H5 antibodies or B7-H5 fusion molecules include an Fc portion.
  • the Fc portion of such molecules may be varied by isotype or subclass, may be a chimeric or hybrid, and/or may be modified, for example to improve effector functions, control of half-life, tissue accessibility, augment biophysical characteristics such as stability, and improve efficiency of production (and less costly).
  • Many modifications useful in construction of disclosed fusion proteins and methods for making them are known in the art, see for example Mueller, J.P. et al. (1997) "Humanized Porcine VCAM-Speciflc Monoclonal Antibodies With Chimeric IgG2/G4 Constant Regions Block Human Leukocyte Binding To Porcine Endothelial Cells," Mol.
  • the Fc region is the native IgGl, IgG2, or IgG4 Fc region.
  • the Fc region is a hybrid, for example a chimeric consisting of IgG2/IgG4 Fc constant regions.
  • Modifications to the Fc region include, but are not limited to, IgG4 modified to prevent binding to Fc gamma receptors and complement, IgGl modified to improve binding to one or more Fc gamma receptors, IgGl modified to minimize effector function (amino acid changes), IgGl with altered/no glycan (typically by changing expression host), and IgGl with altered pH- dependent binding to FcRn, and IgG4 with serine at amino acid resident #228 in the hinge region changed to proline (S228P) to enhance stability.
  • the Fc region may include the entire hinge region, or less than the entire hinge region.
  • rituximab a chimeric mouse/human IgGl monoclonal antibody against CD20
  • rituximab a chimeric mouse/human IgGl monoclonal antibody against CD20
  • Waldenstrom's macroglobulinemia correlated with the individual's expression of allelic variants of Fey receptors with distinct intrinsic affinities for the Fc domain of human IgGl.
  • FcyRIIIA low affinity activating Fc receptor CD16A
  • the Fc domain may contain one or more amino acid insertions, deletions or substitutions that reduce binding to the low affinity inhibitory Fc receptor CD32B (FcyRIIB) and retain wild-type levels of binding to or enhance binding to the low affinity activating Fc receptor CD16A (FcyRIIIA).
  • Another embodiment includes IgG 2 - 4 hybrids and i g o 4 mutants that have reduce binding to FcR which increase their half-life.
  • Representative KJ 2 - 4 hybrids and IgG4 mutants are described in Angal, S. et al. (1993) "A Single Amino Acid Substitution Abolishes The Heterogeneity Of Chimeric Mouse/Human (Igg4) Antibody," Molec. Immunol. 30(1): 105-108; Mueller, J.P. et al. (1997) "Humanized Porcine VCAM-Speciflc Monoclonal Antibodies With Chimeric Igg2/G4 Constant Regions Block Human Leukocyte Binding To Porcine Endothelial Cells," Mol. Immun.
  • IgGi and/or IgG 2 domain is deleted for example, Angal, s. et al. describe IgGi and IgG 2 having serine 241 replaced with a proline.
  • Substitutions, additions or deletions in the derivatized antibodies may be in the Fc region of the antibody and may thereby serve to modify the binding affinity of the antibody to one or more Fc R.
  • Methods for modifying antibodies with modified binding to one or more Fc R are known in the art, see, e.g., PCT Publication Nos. WO 04/029207, WO 04/029092, WO 04/028564, WO 99/58572, WO 99/51642, WO 98/23289, WO 89/07142, WO 88/07089, and U.S. Patent Nos. 5,843,597 and 5,642,821.
  • the modification of the Fc region results in an antibody with an altered antibody-mediated effector function, an altered binding to other Fc receptors (e.g., Fc activation receptors), an altered antibody-dependent cell-mediated cytotoxicity (ADCC) activity, an altered Clq binding activity, an altered complement-dependent cytotoxicity activity (CDC), a phagocytic activity, or any combination thereof.
  • Fc receptors e.g., Fc activation receptors
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • Clq binding activity e.g., an altered Clq binding activity
  • CDC complement-dependent cytotoxicity activity
  • phagocytic activity e.g., phagocytic activity, or any combination thereof.
  • the invention encompasses antibodies whose Fc region will have been modified so that the molecule will exhibit altered Fc receptor (FcR) binding activity, for example to exhibit decreased activity toward activating receptors such as FcyRIIA or FcyRIIIA, or increased activity toward inhibitory receptors such as FcyRIIB.
  • FcR Fc receptor
  • such antibodies will exhibit decreased antibody-dependent cell-mediated cytotoxicity (ADCC) or complement dependent cytotoxicity (CDC) activities (relative to a wild-type Fc receptor).
  • Exemplary variants of human IgGl Fc domains with reduced binding to FcyRIIA or FcyRIIIA, but unchanged or enhanced binding to FcyRIIB include S239A, H268A, S267G, E269A, E293A, E293D, Y296F, R301A,V303A, A327G, K322A, E333A, K334A, K338A, A339A, D376A.
  • the invention encompasses antibodies whose Fc region will have been deleted (for example, an Fab or F(ab)2, etc.).
  • the marker amino acid sequence is a hexa-histidine peptide, the hemagglutinin "HA" tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, LA. et al. (1984) "The Structure Of An Antigenic Determinant In A Protein," Cell, 37:767-778) and the "flag" tag (Knappik, A. et al. (1994) "An Improved Affinity Tag Based On The FLAG Peptide For The Detection And Purification Of Recombinant Antibody Fragments," Biotechniques 17(4):754-761).
  • the present invention also encompasses antibodies or their antigen- binding fragments that are conjugated to a diagnostic or therapeutic agent or any other molecule for which serum half-life is desired to be increased.
  • the antibodies can be used diagnostically (in vivo, in situ or in vitro) to, for example, monitor the development or progression of a disease, disorder or infection as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals, and nonradioactive paramagnetic metal ions.
  • the detectable substance may be coupled or conjugated either directly to the antibody or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention.
  • Such diagnosis and detection can be accomplished by coupling the antibody to detectable substances including, but not limited to, various enzymes, enzymes including, but not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; prosthetic group complexes such as, but not limited to, streptavidin/biotin and avidin/biotin; fluorescent materials such as, but not limited to, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; luminescent material such as, but not limited to, luminol; bioluminescent materials such as, but not limited to, luciferase, luciferin, and aequorin; radioactive material such as, but not limited to, bismuth ( 213 Bi), carbon ( 14 C), chromium ( 51 Cr),
  • the molecules of the present invention can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980.
  • Such heteroconjugate antibodies may additionally bind to haptens (such as fluorescein, etc.), or to cellular markers (e.g., PD-1, 4-1-BB, B7-H4, B7-H5, CD4, CD8, CD 14, CD25, CD27, CD40, CD68, CD163, CTLA4, GITR, LAG-3, OX40, TIM3, TIM4, TLR2, LIGHT, etc.) or to cytokines (e.g., IL-7, IL-15, IL-12, IL-4 TGF-beta, IL-10, IL-17, IFNg, Flt3, BLys) or chemokines (e.g., CCL21), etc.
  • haptens such as fluorescein, etc.
  • cellular markers e.g., PD-1, 4-1
  • the molecules of the present invention may be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen or of other molecules that are capable of binding to target antigen that has been immobilized to the support via binding to an antibody or antigen-binding fragment of the present invention.
  • solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
  • the present invention additionally includes nucleic acid molecules (DNA or RNA) that encode any such antibodies, fusion proteins or fragments, as well as vector molecules (such as plasmids) that are capable of transmitting or of replication such nucleic acid molecules and expressing such antibodies, fusion proteins or fragments in a cell line.
  • the nucleic acids can be single-stranded, double-stranded, may contain both single-stranded and double-stranded portions.
  • the term "modulate” relates to a capacity to alter an effect or result.
  • the invention relates to polypeptides that comprise an anti-human B7-H5 antibody or any of its antigen-binding fragments that immunospecifically binds human B7-H5 or molecules that physiospecifically bind B7-H5 that are capable of modulating the binding between B7-H5 and its cognate ligands and/or of modulating the signal transduction that occurs as a consequence of B7-H5 - cognate counter- receptor binding.
  • multi-specific anti-B7-H5 antibodies, anti- B7-H5 antigen-binding fragments and their respective fusion products that have the added ability to bind CD28H or other cellular ligands or receptors have particular utility in facilitating the co-localization of cells expressing such ligands or receptors to cells that express CD28H.
  • the invention concerns antibodies, or fragments thereof, or fusion molecules that comprise such antibodies or fragments, that immunospecifically bind to B7-H5 and are capable of substantially blocking B7-H5's interaction with CD28H in vitro, or in a recipient subject or patient.
  • a molecule that is "capable of substantially blocking B7- H5's interaction with CD28H” denotes that the provision of such molecule attenuates B7-H5-CD28H interactions by more than 50%, more preferably by more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, more than 99% or most preferably completely attenuates such interaction, as measured by any of the assays disclosed herein.
  • Such antibodies, fragments and fusion molecules have particular utility in attenuating the biological effects of B7-H5 - CD28H interactions.
  • the invention thus particularly relates to the molecules of such embodiments involving humanized antibodies and fragments or human antibodies and fragments.
  • endogenous concentration refers to the level at which a molecule is natively expressed (i.e., in the absence of expression vectors or recombinant promoters) in a normal, cancer or pathogen-infected cell.
  • such molecules can be produced by screening hybridoma lines for those that produce antibody that are immunospecific for human B7-H5, and then optionally screening amongst such lines for those exhibiting modulating activity (e.g., neutralizing activity, agonizing activity, altered signal transducing activity, etc.).
  • the invention particularly provides hamster anti-human B7-H5 clones: 2D3 and 18C3.
  • Antibodies 2D3 and 18C3 are capable of binding to human B7-H5 and are substantially capable of blocking B7-H5's interaction with CD28H.
  • Antibodies that are substantially capable of blocking B7-H5's interaction with CD28H have particular use in the treatment of inflammatory disease and autoimmune disease.
  • Antibodies that are substantially incapable of blocking B7-H5's interaction with CD28H have particular use in diagnostics, since such antibodies can be used to detect the presence, location and prevalence of B7-H5:CD28H interactions.
  • the present invention permits the formation of novel antibodies and antigen-binding fragments having 1, 2, 3, 4, 5 or 6 variant CDRs. Because the methods of the present invention have identified a substantial number of distinct CDRs, the invention permits a recognition of CDR residues that are likely to be required in any variant of a particular identified CDR. Such residues are shown in boldface in Table 2 and Table 3. For those residues that are found to vary among the compared CDRs, the substitution scores of Table 1 provide a means for determining the identities of permitted substitutions.
  • any substitution of R or S having a substitution score of - 1 or greater are as likely as the observed variants (R or S) (or are more likely than R or S) to create a variant CDR having binding attributes that are sufficiently similar to those of the particular CDR to permit the variant CDR to be employed in lieu thereof so as to form a functional anti-B7-H5 antibody or antigen-binding fragment.
  • the selection of a residue having a higher substitution score is preferred over the selection of a residue having a lower substitution score.
  • Table 2 presents an analysis of the heavy chain CDRs of the anti- B7-H5 antibodies and provides the consensus sequence of the observed and preferred variant light chain (“LC”) anti-B7-H5 CDRs of the present invention.
  • Table 3 presents an analysis of the light chain CDRs of the anti- B7-H5 antibodies and provides the consensus sequence of the observed and preferred variant anti- B7-H5 heavy chain (“HC") CDRs of the present invention.
  • the invention additionally provides antibodies and antigen-binding fragments thereof that possess CDRs having the above-described light and/or heavy chain consensus sequences.
  • the present invention encompasses antibodies or fragments thereof comprising an amino acid sequence of a variable heavy chain and/or variable light chain that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of the variable heavy chain and/or light chain of the hamster monoclonal antibody produced by any of the above clones, and which exhibit immunospecific binding to B7-H5.
  • the present invention further encompasses antibodies or fragments thereof that comprise a CDR that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of a CDR of the above-listed clones and which exhibit immunospecific binding to B7-H5.
  • the determination of percent identity of two amino acid sequences can be determined by BLAST protein comparison.
  • the antibody is a immunoglobulin molecule (e.g., an antibody, diabody, fusion protein, etc.) that comprises one, two or three light chain CDRs and one, two or three heavy chain CDRs (most preferably three light chain CDRs and three heavy chain CDRs), wherein the light chain CDRs include:
  • the immunoglobulin molecule comprises one, two or three light chain CDRs and one, two or three heavy chain CDRs (most preferably three light chain CDRs and three heavy chain CDRs), wherein the heavy chain CDRs include:
  • an antibody or an antigen-binding fragment thereof of the present invention will comprise one, two, three, four, five, or more preferably, all 6 CDRs of the above-described preferred antibodies and will exhibit the ability to bind to human B7-H5.
  • CD28H fusion proteins can be antagonists of signal transduction between B7-H5 and CD28H. Therefore, CD28H fusion proteins and methods of use thereof to down-modulate the immune system are also disclosed. Therefore, receptor fusion polypeptides typically block the ability of ligands to bind to transmembrane CD28H, and induce or maintain B7-H5:CD28H mediated signal transduction.
  • CD28H fusion polypeptides disclosed herein have a first fusion partner including all or a part of a CD28H polypeptide fused (i) directly to a second polypeptide or, (ii) optionally, fused to a linker peptide sequence that is fused to the second polypeptide.
  • fusion proteins may form dimers or multimers.
  • the peptide/polypeptide linker domain can either be a separate domain, or alternatively can be contained within one of the other domains (CD28H polypeptide or second polypeptide) of the fusion protein.
  • the domain that functions to dimerize or multimerize the fusion protein can either be a separate domain, or alternatively can be contained within one of the other domains (CD28H polypeptide, second polypeptide or peptide/polypeptide linker domain) of the fusion protein.
  • the dimerization/multimerization domain and the peptide/polypeptide linker domain are the same.
  • Fusion proteins disclosed herein are of formula I: N-R1-R2-R 3 -C, wherein “N” represents the N-terminus of the fusion protein, “C” represents the C-terminus of the fusion protein.
  • “Ri” is a CD28H polypeptide
  • “R 2 " is an optional peptide/polypeptide linker domain
  • “R3” is a second polypeptide.
  • R3 may be a CD28H polypeptide and Ri may be a second polypeptide.
  • the receptor fusion proteins can include a full-length CD28H polypeptide, or can contain a fragment or variant of a full length a CD28H.
  • the first fusion partner is a soluble fragment of CD28H, for example, part or all of the extracellular domain of CD28H, or a variant thereof.
  • Any mammalian sequence CD28H can be used. As an example, human sequences, as well as known isoforms and variants thereof, are provided in the sequences above. In some embodiments, other mammalian sequences, such as mouse sequences, are known in the art and can be used.
  • Human CD28H polypeptides useful in the disclosed fusion proteins can have an amino acid sequence least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO:7, or preferably 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the extracellular domain of SEQ ID NO:7.
  • Human CD28H polypeptides useful in the disclosed fusion proteins can be encoded by a nucleic acid sequence least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO:8, or preferably 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to the extracellular domain encoded by the nucleic acid sequence of SEQ ID NO:8.
  • the CD28H polypeptide may be fused to a second polypeptide.
  • the presence of the second polypeptide can alter the solubility, stability, affinity and/or valency of the fusion polypeptide.
  • valency refers to the number of binding sites available per molecule.
  • the second polypeptide is a polypeptide from a different source or different protein.
  • the second polypeptide contains one or more domains of an immunoglobulin heavy chain constant region, preferably having an amino acid sequence corresponding to the hinge, CH2 and CH3 regions of a human immunoglobulin Cyl chain or to the hinge, CH2 and CH3 regions of a murine immunoglobulin Cy2a chain.
  • the dimer results from the covalent bonding of Cys residue in the hinge region of two of the Ig heavy chains that are the same Cys residues that are disulfide linked in dimerized normal Ig heavy chains.
  • Such proteins can be referred to as CD28H-Ig.
  • the immunoglobulin constant domain may contain one or more amino acid insertions, deletions or substitutions that enhance binding to specific cell types, increase the bioavailablity, or increase the stability of the CD28H polypeptides, fusion proteins, or fragments thereof.
  • Suitable amino acid substitutions include conservative and non- conservative substitutions, as described above.
  • the second polypeptide may have a conjugation domain through which additional molecules can be bound to the CD28H fusion proteins.
  • the conjugated molecule is capable of targeting the fusion protein to a particular organ or tissue.
  • the conjugated molecule is another immunomodulatory agent that can enhance or augment the effects of the CD28H fusion protein.
  • the conjugated molecule is Polyethylene Glycol (PEG).
  • the Fc portion of the fusion protein may be varied by isotype or subclass, may be a chimeric or hybrid, and/or may be modified, for example to improve effector functions, control of half-life, tissue accessibility, augment biophysical characteristics such as stability, and improve efficiency of production (and less costly).
  • Many modifications useful in construction of disclosed fusion proteins and methods for making them are known in the art, see for example Mueller, et al, Mol. Immun., 34(6):441-452 (1997), Swann, et al, Cur. Opin. Immun., 20:493-499 (2008), and Presta, Cur. Opin. Immun. 20:460-470 (2008).
  • the Fc region is the native IgGl, IgG2, or IgG4 Fc region.
  • the Fc region is a hybrid, for example a chimeric consisting of IgG2/IgG4 Fc constant regions.
  • Medications to the Fc region include, but are not limited to, IgG4 modified to prevent binding to Fc gamma receptors and complement, IgGl modified to improve binding to one or more Fc gamma receptors, IgGl modified to minimize effector function (amino acid changes), IgGl with altered/no glycan (typically by changing expression host), and IgGl with altered pH- dependent binding to FcRn.
  • the Fc region may include the entire hinge region, or less than the entire hinge region.
  • rituximab a chimeric mouse/human IgGl monoclonal antibody against CD20
  • rituximab a chimeric mouse/human IgGl monoclonal antibody against CD20
  • Waldenstrom's macroglobulinemia correlated with the individual's expression of allelic variants of Fey receptors with distinct intrinsic affinities for the Fc domain of human IgGl .
  • FcyRIIIA low affinity activating Fc receptor CD 16A
  • the Fc domain may contain one or more amino acid insertions, deletions or substitutions that reduce binding to the low affinity inhibitory Fc receptor CD32B (FcyRIIB) and retain wild-type levels of binding to or enhance binding to the low affinity activating Fc receptor CD16A (FcyRIIIA).
  • Another embodiment includes IgG2-4 hybrids and IgG4 mutants that have reduce binding to FcR which increase their half life.
  • Representative IG2-4 hybrids and IgG4 mutants are described in Angal, S. et al, Molecular Immunology, 30(1): 105-108 (1993); Mueller, J. et al, Molecular Immonology, 34(6): 441-452 (1997); and U.S. Patent No. 6,982,323 to Wang et al.
  • the IgGl and/or IgG2 domain is deleted for example, Angal et al. describe IgGl and IgG2 having serine 241 replaced with a proline.
  • the Fc domain contains amino acid insertions, deletions or substitutions that enhance binding to CD16A.
  • a large number of substitutions in the Fc domain of human IgGl that increase binding to CD16A and reduce binding to CD32B are known in the art and are described in Stavenhagen, et al, Cancer Res., 57(18):8882-90 (2007).
  • Exemplary variants of human IgGl Fc domains with reduced binding to CD32B and/or increased binding to CD16A contain F243L, R929P, Y300L, V305I or P296L substitutions. These amino acid substitutions may be present in a human IgGl Fc domain in any combination.
  • the human IgGl Fc domain variant contains a F243L, R929P and Y300L substitution. In another embodiment, the human IgGl Fc domain variant contains a F243L, R929P, Y300L, V305I and P296L substitution. In another embodiment, the human IgGl Fc domain variant contains an N297Q substitution, as this mutation abolishes FcR binding. [00142] c. Peptide or polypeptide linker domain
  • the disclosed CD28H fusion proteins optionally contain a peptide or polypeptide linker domain that separates the CD28H polypeptide from the second polypeptide.
  • the linker domain contains the hinge region of an immunoglobulin.
  • the hinge region is derived from a human immunoglobulin. Suitable human immunoglobulins that the hinge can be derived from include IgG, IgD and IgA. In a preferred embodiment, the hinge region is derived from human IgG. Amino acid sequences of immunoglobulin hinge regions and other domains are well known in the art.
  • Suitable peptide/polypeptide linker domains include naturally occurring or non-naturally occurring peptides or polypeptides.
  • Peptide linker sequences are at least 2 amino acids in length.
  • the peptide or polypeptide domains are flexible peptides or polypeptides.
  • a "flexible linker” herein refers to a peptide or polypeptide containing two or more amino acid residues joined by peptide bond(s) that provides increased rotational freedom for two polypeptides linked thereby than the two linked polypeptides would have in the absence of the flexible linker. Such rotational freedom allows two or more antigen binding sites joined by the flexible linker to each access target antigen(s) more efficiently.
  • Exemplary flexible peptides/polypeptides include, but are not limited to, the amino acid sequences Gly-Ser, Gly-Ser-Gly-Ser (SEQ ID NO: 16), Ala-Ser, Gly-Gly- Gly-Ser (SEQ ID NO: 17), (Gly 4 -Ser) 3 (SEQ ID NO: 18) and (Gly 4 -Ser) 4 (SEQ ID NO: 19). Additional flexible peptide/polypeptide sequences are well known in the art.
  • the first fusion partner is a fragment of CD28H.
  • the fusion protein includes the extracellular domain of CD28H, or a fragment thereof, fused to an Ig Fc region.
  • Recombinant CD28H-Ig fusion proteins can be prepared by fusing the coding region of the extracellular domain of a neuropilin or a plexin or a fragment thereof to the Fc region of human IgGl or mouse IgG2a, or other suitable Ig domain, as described previously (Chapoval, et al, Methods Mol. Med., 45:247-255 (2000)).
  • Exemplary fusion protein
  • the amino acid sequence of a representative human CD28H-Ig fusion protein is (SEQ ID NO:20), a CD28H-hIgG4 (CD28H ECD aa23-140, light chain kappa signal peptide: CD28H sequences are shown in boldface; mutated human IgG4 Fc sequences are shown underlined, with Serine 228 to Proline mutation double underline):
  • the fusion protein may additionally comprise an N-terminal leader sequence (light chain kappa leader sequence) (such residues 1-20 of SEQ ID NO:21),
  • MSVPTQVLGLLLLWLTDARC or a naturally occurring CD28H leader sequence such as (SEQ ID NO:22):
  • CD28H sequences are shown fused to a human IgG4 region, in accordance with the present invention, such sequences can alternatively be fused to any Ig isotype, or indeed to any other protein.
  • a DNA sequence encoding human CD28H-Ig of SEQ ID NO:20 including the signal sequence of SEQ ID NO:21 is (SEQ ID NO:23): ATGTCCGTGCCCACCCAGGTGCTGGGATTGCTGCTGCTGTGGCTGACCGACGCCAGATGCCT GTCTGTGCAGCAGGGCCCTAACCTGCTGCAAGTGCGGCAGGGCTCTCAGGCTACACTCGTGT GTCAGGTGGACCAGGCCACCGCCTGGGAGAGACTGAGAGTGAAGTGGACCAAGGACGGCGCC ATCCTGTGCCAGCCCTACATCACCAACGGCTCCCTGTCCCTGGGCGTGTGGACCTCAGGG CAGACTGTCTTGGCAGGCCCCTTCTCACCTGACCCTGCAGCTGGACCCTGTGTCCCTGAATC ACTCCGGCGCCTACGTGTGTTGGGCCGCTGTGGAAATCCCCGAGCTGGAAAGGCCGAGGGC AACATCACCCGGCTGTTCGTGGACCCTGACGACCCTACCCAGGAATCTAAGTACGGCCCTCCCT
  • a “therapeutically effective amount” refers to that amount of a therapeutic agent sufficient to mediate an altered immune response, and more preferably, a clinically relevant altered immune response, sufficient to mediate a reduction or amelioration of a symptom of a disease or condition. An effect is clinically relevant if its magnitude is sufficient to impact the health or prognosis of a recipient subject.
  • a therapeutically effective amount may refer to the amount of therapeutic agent sufficient to reduce or minimize disease progression, e.g., delay or minimize an autoimmune response or an inflammatory response or a transplant rejection.
  • a therapeutically effective amount may also refer to the amount of the therapeutic agent that provides a therapeutic benefit in the treatment or management of a disease.
  • a therapeutically effective amount with respect to a therapeutic agent, B7-H5 antibody or B7-H5 fusion protein or CD28H fusion protein means that amount of therapeutic agent alone, or in combination with other therapies, that provides a therapeutic benefit in the treatment or management of a disease, e.g., sufficient to enhance the therapeutic efficacy of a therapeutic antibody sufficient to treat or manage a disease.
  • prophylactic agent refers to an agent that can be used in the prevention of a disorder or disease prior to the detection of any symptoms of such disorder or disease.
  • a “prophylactically effective” amount is the amount of prophylactic agent sufficient to mediate such protection.
  • a prophylactically effective amount may also refer to the amount of the prophylactic agent that provides a prophylactic benefit in the prevention of disease.
  • a prophylactically effective amount with respect to a prophylactic agent means that amount of prophylactic agent alone, or in combination with other agents, that provides a prophylactic benefit in the prevention of disease.
  • the dosage amounts and frequencies of administration provided herein are encompassed by the terms therapeutically effective and prophylactically effective.
  • the dosage and frequency further will typically vary according to factors specific for each patient depending on the specific therapeutic or prophylactic agents administered, the severity and type of cancer, the route of administration, as well as age, body weight, response, and the past medical history of the patient. Suitable regimens can be selected by one skilled in the art by considering such factors and by following, for example, dosages reported in the literature and recommended in the Physician 's Desk Reference (56 th Ed., 2002).
  • the present invention relates to molecules, such as anti-B7-H5 antibodies (and fragments of such antibodies that bind to B7-H5) or CD28H Ig that, by binding to B7-H5 antagonize (i.e., attenuate or impair) B7-H5 function and/or binding to CD28H and thus attenuate or impair T cell proliferation and/or cytokine production.
  • B7-H5 antagonize i.e., attenuate or impair
  • CD28H i.e., attenuate or impair
  • the administration of such molecules to a subject down-modulates the immune system of the subject.
  • Such down-modulation of the immune system is desirable in the treatment of inflammatory and auto-immune diseases and transplant rejection.
  • autoimmune disorders examples include, but are not limited to, alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune diseases of the adrenal gland, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune oophoritis and orchitis, autoimmune thrombocytopenia, Behcet's disease, bullous pemphigoid, cardiomyopathy, celiac sprue- dermatitis, chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatrical pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia- fibromyositis, glomerulonephritis, Graves' disease, Guillain
  • Examples of inflammatory diseases which can be prevented, treated or managed with the disclosed anti-B7-H5 antibodies and antigen binding fragments and CD28H fusion proteins, particularly CD28H-Ig fusion proteins, thereof include, but are not limited to, asthma, encephilitis, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), allergic disorders, septic shock, pulmonary fibrosis, undifferentiated spondyloarthropathy, undifferentiated arthropathy, arthritis, inflammatory osteolysis, and chronic inflammation resulting from chronic viral or bacterial infections.
  • COPD chronic obstructive pulmonary disease
  • the anti-B7-H5 antibodies can be employed to produce anti- idiotypic peptides or antibodies (Wallmann, J. et al. (2010) “Anti-Ids in Allergy: Timeliness of a Classic Concept," World Allergy Organiz. J. 3(6): 195-201 ; Nardi, M. et al. (2000) "Antiidiotype Antibody against Platelet Anti-GpIIIa Contributes To The Regulation Of Thrombocytopenia In HIV-1-ITP Patients ,” J. Exp. Med. 191(12):2093-2100) or mimetics (Zang, Y.C. et al.
  • the antibodies and antigen-binding fragments and fusion proteins of the present invention have utility in the treatment of graft vs. host disease, inflammatory and auto-immune diseases.
  • agonist antibodies that enhance binding between such antibodies and such receptor/ligand, and other receptor agonists such a B7- H5 fusion proteins have utility as agonists of B7-H5 signaling, and therefore have utility in the treatment of cancer and infectious disease.
  • the present invention also relates to CD28H agonist molecules, such as B7- H5-Ig fusion proteins that, by binding to CD28H agonize CD28H function (i.e. signal transduction) and/or binding to B7-H5 and thus augment or stimulate T cell proliferation and/or cytokine production.
  • the administration of such molecules to a subject up-modulates the immune system of the subject and can be used to treat subjects with cancer or an infectious disease.
  • the B7-H5 pathway is involved in T cell activation, such molecules are particularly useful in combination with vaccines.
  • the CD28H agonists provided herein are generally useful in vivo and ex vivo as immune response-stimulating therapeutics.
  • the CD28H agonists are useful for stimulating or enhancing an immune response in host for treating cancer by administering to subject an amount of CD28H agonists.
  • the types of cancer that may be treated with the provided compositions and methods include, but are not limited to, the following: bladder, brain, breast, cervical, colo-rectal, esophageal, kidney, liver, lung, nasopharangeal, pancreatic, prostate, skin, stomach, uterine, ovarian, testicular and hematologic.
  • Malignant tumors which may be treated are classified herein according to the embryonic origin of the tissue from which the tumor is derived.
  • Carcinomas are tumors arising from endodermal or ectodermal tissues such as skin or the epithelial lining of internal organs and glands.
  • Sarcomas which arise less frequently, are derived from mesodermal connective tissues such as bone, fat, and cartilage.
  • the leukemias and lymphomas are malignant tumors of hematopoietic cells of the bone marrow. Leukemias proliferate as single cells, whereas lymphomas tend to grow as tumor masses. Malignant tumors may show up at numerous organs or tissues of the body to establish a cancer.
  • the CD28H agonists can be administered for the treatment of local or systemic viral infections, including, but not limited to, immunodeficiency (e.g., HIV), papilloma (e.g., HPV), herpes (e.g., HSV), encephalitis, influenza (e.g., human influenza virus A), and common cold (e.g., human rhinovirus) viral infections.
  • immunodeficiency e.g., HIV
  • papilloma e.g., HPV
  • herpes e.g., HSV
  • encephalitis e.g., human influenza virus A
  • common cold e.g., human rhinovirus
  • compositions of CD28H agonist compositions can also be administered to treat systemic viral diseases, including, but not limited to, AIDS, influenza, the common cold, or encephalitis.
  • systemic viral diseases including, but not limited to, AIDS, influenza, the common cold, or encephalitis.
  • Representative infections that can be treated include but are not limited to infections cause by microoganisms including, but not limited to,
  • the disclosed CD28H agonists or nucleic acids encoding the same may be administered alone or in combination with any other suitable treatment.
  • the CD28H agonists can be administered in conjunction with, or as a component of, a vaccine composition. Suitable components of vaccine compositions antigens and/or adjuvants.
  • the disclosed CD28H agonists can be administered prior to, concurrently with, or after the administration of a vaccine.
  • the CD28H agonist composition is administered at the same time as administration of a vaccine.
  • the disclosed CD28H agonist compositions may be administered in conjunction with prophylactic vaccines, or therapeutic vaccines, which can be used to initiate or enhance a subject's immune response to a pre-existing antigen, such as a tumor antigen in a subject with cancer.
  • the desired outcome of a prophylactic, therapeutic or de-sensitized immune response may vary according to the disease, according to principles well known in the art.
  • immune responses against cancer, allergens or infectious agents may completely treat a disease, may alleviate symptoms, or may be one facet in an overall therapeutic intervention against a disease.
  • the stimulation of an immune response against a cancer may be coupled with surgical, chemotherapeutic, radiologic, hormonal and other immunologic approaches in order to affect treatment.
  • compositions e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the antibody or fusion protein, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of a nucleic acid as part of a retroviral or other vector, etc.
  • Methods of administering antibodies and fusion proteins include, but are not limited to, parenteral administration (e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural, and mucosal (e.g., intranasal and oral routes).
  • parenteral administration e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous
  • epidural e.g., intranasal and oral routes
  • mucosal e.g., intranasal and oral routes
  • the antibodies or fusion proteins are administered intramuscularly, intravenously, or subcutaneously.
  • the compositions may be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
  • an inhaler or nebulizer e.g., a pressurized device
  • formulation with an aerosolizing agent e.g., a pressurized device
  • inhaler or nebulizer e.g., a pressurized device
  • aerosolizing agent e.g., WO 92/19244; WO 97/32572; WO 97/44013; WO 98/31346; and WO 99/66903.
  • the pharmaceutical compositions may be desirable to administer the pharmaceutical compositions locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion, by injection, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • an implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • care must be taken to use materials to which the antibody or the fusion protein does not absorb.
  • the antibodies or fusions proteins are formulated in liposomes for targeted delivery of the antibodies or fusion proteins.
  • Liposomes are vesicles comprised of concentrically ordered phopsholipid bilayers which encapsulate an aqueous phase. Liposomes typically comprise various types of lipids, phospholipids, and/or surfactants. The components of liposomes are arranged in a bilayer configuration, similar to the lipid arrangement of biological membranes. Liposomes are particularly preferred delivery vehicles due, in part, to their biocompatibility, low immunogenicity, and low toxicity.
  • Methods of preparing liposomes with a prolonged serum half-life, i.e., enhanced circulation time, such as those disclosed in U.S. Patent No. 5,013,556 can be used to make liposomes-antibody compositions.
  • Preferred liposomes are not rapidly cleared from circulation, i.e., are not taken up into the mononuclear phagocyte system (MPS).
  • MPS mononuclear phagocyte system
  • the invention encompasses sterically stabilized liposomes which are prepared using common methods known to one skilled in the art.
  • sterically stabilized liposomes contain lipid components with bulky and highly flexible hydrophilic moieties, which reduces the unwanted reaction of liposomes with serum proteins, reduces oposonization with serum components and reduces recognition by MPS.
  • Sterically stabilized liposomes are preferably prepared using polyethylene glycol.
  • the invention also encompasses liposomes that are adapted for specific organ targeting, see, e.g., U.S. Patent No. 4,544,545, or specific cell targeting, see, e.g., U.S. Patent Application Publication No. 2005/0074403.
  • Particularly useful liposomes for use in the disclosed compositions and methods can be generated by reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol, and PEG derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter.
  • a fragment of an antibody e.g., F(ab') may be conjugated to the liposomes using previously described methods, see, e.g., Martin et al, 1982, J. Biol. Chem. 257: 286-288.
  • the B7-H5 antibodies, or B7-H5 or CD28H fusion proteins may also be formulated as immunoliposomes.
  • Immunoliposomes refer to a liposomal composition, wherein an antibody or a fragment thereof is linked, covalently or non-covalently to the liposomal surface.
  • the chemistry of linking an antibody to the liposomal surface is known in the art and encompassed within the invention, see, e.g., U.S. Patent No. 6,787, 153; Allen et al, 1995, Stealth Liposomes, Boca Rotan: CRC Press, 233-44; Hansen et al, 1995, Biochim. Biophys. Acta, 1239: 133-144.
  • immunoliposomes for use in the disclosed methods and compositions are further sterically stabilized.
  • the antibodies or fusion proteins are linked covalently or non-covalently to a hydrophobic anchor, which is stably rooted in the lipid bilayer of the liposome.
  • hydrophobic anchors include, but are not limited to, phospholipids, e.g., phosoatidylethanolamine (PE), phospahtidylinositol (PI).
  • PE phosoatidylethanolamine
  • PI phospahtidylinositol
  • any of the known biochemical strategies in the art may be used, see, e.g., J.
  • a functional group on an antibody molecule may react with an active group on a liposome associated hydrophobic anchor, e.g., an amino group of a lysine side chain on an antibody may be coupled to liposome associated N-glutaryl- phosphatidylethanolamine activated with water-soluble carbodiimide; or a thiol group of a reduced antibody can be coupled to liposomes via thiol reactive anchors, such as pyridylthiopropionylphosphatidylethanolamine.
  • immunoliposomal formulations including an antibody or fusion protein are particularly effective as therapeutic agents, since they deliver the antibody or fusion protein to the cytoplasm of the target cell, i.e., the cell comprising the receptor to which the antibody or fusion protein binds.
  • the immunoliposomes preferably have an increased half-life in blood, specifically target cells, and can be internalized into the cytoplasm of the target cells thereby avoiding loss of the therapeutic agent or degradation by the endolysosomal pathway.
  • the immunoliposomal compositions include one or more vesicle forming lipids, an antibody or a fragment or derivative thereof or a fusion protein, and, optionally, a hydrophilic polymer.
  • a vesicle forming lipid is preferably a lipid with two hydrocarbon chains, such as acyl chains and a polar head group.
  • Examples of vesicle forming lipids include phospholipids, e.g., phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphatidylinositol, sphingomyelin, and glycolipids, e.g., cerebrosides, gangliosides.
  • the immunoliposomal compositions further comprise a hydrophilic polymer, e.g., polyethylene glycol, and ganglioside GM1, which increases the serum half-life of the liposome.
  • a hydrophilic polymer e.g., polyethylene glycol
  • ganglioside GM1 e.g., ganglioside GM1
  • Methods of conjugating hydrophilic polymers to liposomes are well known in the art and encompassed within the invention.
  • the antibodies and fusion proteins can be packaged in a hermetically sealed container, such as an ampoule or sachette, indicating the quantity of antibody.
  • the antibodies are supplied as a dry sterilized lyophilized powder or water free concentrate in a hermetically sealed container and can be reconstituted, e.g., with water or saline to the appropriate concentration for administration to a subject.
  • the antibodies or fusion proteins are supplied as a dry sterile lyophilized powder in a hermetically sealed container at a unit dosage of at least 5 mg, more preferably at least 10 mg, at least 15 mg, at least 25 mg, at least 35 mg, at least 45 mg, at least 50 mg, or at least 75 mg.
  • the lyophilized antibodies or fusion proteins should be stored at between 2 and 8°C in their original container and the antibodies should be administered within 12 hours, preferably within 6 hours, within 5 hours, within 3 hours, or within 1 hour after being reconstituted.
  • antibodies or fusion proteins are supplied in liquid form in a hermetically sealed container indicating the quantity and concentration of the antibody, fusion protein, or conjugated molecule.
  • the liquid form of the antibodies or fusion proteins are supplied in a hermetically sealed container at least 1 mg/ml, more preferably at least 2.5 mg/ml, at least 5 mg/ml, at least 8 mg/ml, at least 10 mg/ml, at least 15 mg/kg, at least 25 mg/ml, at least 50 mg/ml, at least 100 mg/ml, at least 150 mg/ml, at least 200 mg/ml of the antibodies of fusion proteins.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the condition, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose- response curves derived from in vitro or animal model test systems. For antibodies and fusion proteins, the dosage administered to a patient is typically 0.0001 mg/kg to 100 mg/kg of the patient's body weight.
  • the dosage administered to a patient is between 0.0001 mg/kg and 20 mg/kg, 0.0001 mg/kg and 10 mg/kg, 0.0001 mg/kg and 5 mg/kg, 0.0001 and 2 mg/kg, 0.0001 and 1 mg/kg, 0.0001 mg/kg and 0.75 mg/kg, 0.0001 mg/kg and 0.5 mg/kg, 0.0001 mg/kg to 0.25 mg/kg, 0.0001 to 0.15 mg/kg, 0.0001 to 0.10 mg/kg, 0.001 to 0.5 mg/kg, 0.01 to 0.25 mg/kg or 0.01 to 0.10 mg/kg of the patient's body weight.
  • human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible. Further, the dosage and frequency of administration of antibodies or fragments thereof, or fusion proteins may be reduced by enhancing uptake and tissue penetration of the antibodies or fusion proteins by modifications such as, for example, lipidation.
  • compositions can be delivered in a controlled release or sustained release system. Any technique known to one of skill in the art can be used to produce sustained release formulations comprising one or more antibodies or fusion proteins. See, e.g., U.S. Patent No.
  • a pump may be used in a controlled release system (See Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:20; Buchwald et al, 1980, Surgery 88:507; and Saudek et al, 1989, N. Engl. J. Med. 321 :574).
  • polymeric materials can be used to achieve controlled release of antibodies (see e.g., Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J., Macromol. Sci. Rev. Macromol. Chem. 23 :61; See also Levy et al, 1985, Science 228: 190; During et al, 1989, Ann. Neurol. 25:351 ; Howard et al, 1989, J. Neurosurg. 7 1 : 105); U.S. Patent No.
  • polymers used in sustained release formulations include, but are not limited to, poly(2-hydroxy ethyl methacrylate), poly(methyl methacrylate), poly(acrylic acid), poly(ethylene-co-vinyl acetate), poly(methacrylic acid), polyglycolides (PLG), polyanhydrides, poly(N-vinyl pyrrolidone), poly(vinyl alcohol), polyacrylamide, poly(ethylene glycol), polylactides (PLA), poly(lactide-co-glycolides) (PLGA), and polyorthoesters.
  • a controlled release system can be placed in proximity of the therapeutic target (e.g., the lungs), thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
  • polymeric compositions useful as controlled release implants are used according to Dunn et al. (See U.S. 5,945, 155). This particular method is based upon the therapeutic effect of the in situ controlled release of the bioactive material from the polymer system. The implantation can generally occur anywhere within the body of the patient in need of therapeutic treatment.
  • a non-polymeric sustained delivery system is used, whereby a non-polymeric implant in the body of the subject is used as a drug delivery system.
  • the organic solvent of the implant Upon implantation in the body, the organic solvent of the implant will dissipate, disperse, or leach from the composition into surrounding tissue fluid, and the non-polymeric material will gradually coagulate or precipitate to form a solid, microporous matrix (See U.S. 5,888,533). Controlled release systems are discussed in the review by Langer (1990, Science 249: 1527-1533). Any technique known to one of skill in the art can be used to produce sustained release formulations comprising one or more therapeutic agents, i.e., B7-H5 antibodies or CD28H fusion proteins.
  • the therapeutic or prophylactic composition is a nucleic acid encoding a B7-H5 antibody or an antigen- binding fragment thereof, or a nucleic acid encoding a CD28H fusion protein, for example, CD28H-Ig fusion protein
  • the nucleic acid can be administered in vivo to promote expression of its encoded antibody or fusion, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a retroviral vector (See U.S. Patent No.
  • a nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression by homologous recombination.
  • Treatment of a subject with a therapeutically or prophylactically effective amount of antibody or fusion protein can include a single treatment or, preferably, can include a series of treatments.
  • compositions include bulk drug compositions useful in the manufacture of pharmaceutical compositions (e.g., impure or non-sterile compositions) and pharmaceutical compositions (i.e., compositions that are suitable for administration to a subject or patient) which can be used in the preparation of unit dosage forms.
  • Such compositions comprise a prophylactically or therapeutically effective amount of a prophylactic and/or therapeutic agent disclosed herein or a combination of those agents and a pharmaceutically acceptable carrier.
  • the disclosed compositions include a prophylactically or therapeutically effective amount of antibody or fusion protein and a pharmaceutically acceptable carrier.
  • the term "pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete), excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • compositions are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • compositions can be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include, but are not limited to, those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
  • One embodiment provides a pharmaceutical pack or kit comprising one or more containers filled with antibody or fusion protein. Additionally, one or more other prophylactic or therapeutic agents useful for the treatment of a disease can also be included in the pharmaceutical pack or kit.
  • One embodiment provides a pharmaceutical pack or kit including one or more containers filled with one or more of the ingredients of the pharmaceutical compositions.
  • Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • kits that can be used in the above methods.
  • a kit comprises one or more antibodies or fusion proteins.
  • a kit further comprises one or more other prophylactic or therapeutic agents useful for the treatment of cancer, in one or more containers.
  • a kit further comprises one or more cytotoxic antibodies that bind one or more cancer antigens associated with cancer.
  • the other prophylactic or therapeutic agent is a chemotherapeutic.
  • the prophylactic or therapeutic agent is a biological or hormonal therapeutic.
  • the B7-H5 antibodies and their antigen-binding fragments can be used for diagnostic purposes, such as to detect, diagnose, or monitor diseases, disorders or infections associated with B7-H5 expression.
  • the invention provides for the detection or diagnosis of a disease, disorder or infection, particularly an autoimmune disease comprising: (a) assaying the expression of B7-H5 in cells or in a tissue sample of a subject using one or more antibodies (or fragments thereof) that immunospecifically bind to such antigens; and (b) comparing the level of the antigen with a control level, e.g., levels in normal tissue samples, whereby an increase or decrease in the assayed level of antigen compared to the control level of the antigen is indicative of the disease, disorder or infection.
  • Such antibodies and fragments are preferably employed in immunoassays, such as the enzyme linked immunosorbent assay (ELISA), the radioimmunoassay (RIA) and fluorescence-activated cell sorting (FACS).
  • One embodiment relates to the use of such antibodies and fragments, and particularly such antibodies and fragments that bind to human B7-H5, as reagents for IHC analysis in cells of an in vitro or in situ tissue sample or in vivo.
  • the antibodies and fragments of the present invention have utility in the detection and diagnosis of a disease, disorder, or infection in a human.
  • such diagnosis comprises: a) administering to a subject (for example, parenterally, subcutaneously, or intraperitoneally) an effective amount of a labeled antibody or antigen- binding fragment that immunospecifically binds to B7-H5; b) waiting for a time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject where B7-H5 is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled antibody in the subject, such that detection of labeled antibody above the background level indicates that the subject has the disease, disorder, or infection.
  • the antibody is labeled with an imaging moiety which is detectable using an imaging system known to one of skill in the art.
  • Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined for a particular system.
  • the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 5 to 10 days.
  • monitoring of a disease, disorder or infection is carried out by repeating the method for diagnosing the disease, disorder or infection, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc.
  • Presence of the labeled molecule can be detected in the subject using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the disclosed diagnostic methods include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography.
  • CT computed tomography
  • PET position emission tomography
  • MRI magnetic resonance imaging
  • sonography Sonography
  • the molecule is labeled with a radioisotope and is detected in the patient using a radiation responsive surgical instrument (Thurston et ah, U.S. Patent No. 5,441,050).
  • the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and is detected in the patient using positron emission-tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI).
  • MRI magnetic resonance imaging
  • Anti-human B7-H5 antibodies were obtained by immunizing hamsters with B7-H5, and isolating hybridomas that express B7-H5- immunoreactive antibodies.
  • Antibody -producing clones 2D3 and 18C3 were isolated.
  • Figures 4A-4B show the ability of the antibodies produced by clones 2D3 and 18C3to bind human B7-H5 expressed by a CHO transfectants.
  • An anti-B7-H5 antibody of the present invention (2D3) was tested for its ability to block the B7-H5:CD28H interaction.
  • a B7-H5 Ig fusion was prepared and found to be capable of binding to CD28H and of thereby stimulating a T cell response ( Figure 6).
  • the fusion protein is the extracellular domain of B7-H5 (SEQ ID NO:26)
  • An IgG2a sequence can be (SEQ ID NO:27)
  • mIgG2a does not require the S->P modification (discussed in more detail below and as shown in SEQ ID NO:20) to stabilize the Fab arm or deletion of the C-terminal Lys. Fusion proteins can also be made with other Ig sequences, for example, human IgG4. For human IgG4 it can be preferred to include the S->P modification and/or deletion of the final Lys residue, as illustrated in the exemplary hIgG4 proteins discussed above.
  • the fusion protein was expressed from a vector encoding the CD33 signal peptide (not the native signal peptide).
  • Figure 7 shows the ability of the B7-H5 Ig to induce the expression of cytokines (IL-2, IFN- ⁇ and IL-10), thereby confirming the ability of the molecule to stimulate the immune system.
  • the provision of the anti-B7-H5 antibody 2D3 inhibited such stimulation (Figure 8).
  • the antibody was also found to be capable of inhibiting an allogeneic T cell response ( Figure 9).
  • Anti-Human B7-H5 Antibodies Reduce the Percentage of Activated T
  • PBMCs peripheral blood mononuclear cells
  • NSG NOD scid IL2 receptor gamma chain knockout mice
  • IgG4 antibodies have unique structural and functional properties and undergo "half-antibody exchange” in vivo, resulting in recombined antibodies composed of two different binding specificities (Nirula, A. et al. (201 1) "What Is Igg4? A Review Of The Biology Of A Unique Immunoglobulin Subtype," Curr. Opin. Rheumatol. 23(1): 119-124; .Aalberse, R.C. et al. (2009) "Immunoglobulin G4: An Odd Antibody,” Clin. Exp. Allergy 39(4):469-477). Ser228 is mutated to Pro to stabilize the arm. A chimeric hIgG4P does not do "half-antibody exchange".
  • the human B7-H5-binding antibodies of the present invention (antibodies 2D3 and 18C3) were recombinantly converted to a human IgG4P isotype from their native hamster isotype. CHO transfectants that express human B7-H5 were then incubated in the presence of the recombinant antibodies. As shown in Figures 12A-C, both human IgG4P derivative antibodies were found to retain their immunospecific binding ability toward human B7-H5 and blocking capability disrupting the B7-H5-CD28H interaction ( Figure 13, Panels A-C).
  • Figures 14A-14B show that antibodies 2D3 and 18C3 recognize the first IgV domain of B7-H5, which mediates B7- H5's interaction with CD28H ( Figure 14C).
  • Figure 15 compares the affinities of antibodies 2D3 and 18C3 for binding to human B7-H5 as expressed on the surface of CHO cells.
  • mice reconstituted with human PBMCs plus autologous dendritic cells were immunized with a tetanus toxoid ("TT") vaccine.
  • mice were treated with control Ig, or anti-human B7-H5 antibody 2D3.
  • mice were treated with control Ig, or anti-human B7-H5 antibody 2D3.
  • cells in the peritoneal cavity were harvested, and re-stimulated with the TT antigen.
  • T cell division was analyzed by BrdU incorporation. Cytokines in the culture supernatant were examined by a human Thl/Th2 CBA kit.
  • mice were challenged with allogeneic human macrophages. On the same day, each mouse was inoculated with control or 2D3 mAb. On day 7, splenocytes were harvested and allogeneic CD4 and CD8 T cell proliferations were evaluated by Ki-67 expression by intracellular staining.
  • Blockade of B7-H5:CD28H Interaction Inhibits AKT activation in human T cells
  • FIG. 20A-B The results of such investigations are shown in Figure 20A-B.
  • NK Natural Killer cells
  • Figure 20A simultaneous cross-linking of CD16 and B7-IT5 fusion protein on Natural Killer cells (NK) in the presence of soluble recombinant human IL-2 induced NK activation and degranulation (CD 107a surface upregulation), whereas CD 16 engagement alone did not induce significant NK degranulat on.
  • B7-H5-CD28H pathway blockade by B7-H5 antibody 2D3 suppressed NK degranulation ( Figure 20B), indicating B7-H5 co-stimulates NK activation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Diabetes (AREA)
  • Pulmonology (AREA)
  • Hematology (AREA)
  • Endocrinology (AREA)
  • Dermatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Rheumatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Neurosurgery (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Obesity (AREA)
  • Emergency Medicine (AREA)
  • Transplantation (AREA)
  • Ophthalmology & Optometry (AREA)
PCT/US2014/039621 2013-05-24 2014-05-27 Anti-b7-h5 antibodies and their uses Ceased WO2014190356A2 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
EP14732759.7A EP3004158A2 (en) 2013-05-24 2014-05-27 Anti-b7-h5 antibodies and their uses
BR112015029395A BR112015029395A2 (pt) 2013-05-24 2014-05-27 Anticorpos anti-b7-h5 e seus usos
AU2014268298A AU2014268298B2 (en) 2013-05-24 2014-05-27 Anti-B7-H5 antibodies and their uses
CN201480041706.0A CN106414489A (zh) 2013-05-24 2014-05-27 抗-b7-h5抗体及其用途
KR1020157036610A KR20160129698A (ko) 2013-05-24 2014-05-27 항-b7-h5 항체 및 이의 용도
HK17106014.0A HK1232243A1 (zh) 2013-05-24 2014-05-27 抗-b7-h5抗体及其用途
CA2913312A CA2913312A1 (en) 2013-05-24 2014-05-27 Anti-b7-h5 antibodies and their uses
US14/893,463 US10316092B2 (en) 2013-05-24 2014-05-27 Anti-B7-H5 antibodies and their uses
SG11201509618QA SG11201509618QA (en) 2013-05-24 2014-05-27 Anti-b7-h5 antibodies and their uses
MX2015016111A MX376808B (es) 2013-05-24 2014-05-27 Anticuerpos anti-b7-h5 y sus usos.
JP2016515141A JP6682426B2 (ja) 2013-05-24 2014-05-27 抗b7−h5抗体およびその使用

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361827216P 2013-05-24 2013-05-24
US61/827,216 2013-05-24

Publications (2)

Publication Number Publication Date
WO2014190356A2 true WO2014190356A2 (en) 2014-11-27
WO2014190356A3 WO2014190356A3 (en) 2015-04-23

Family

ID=50983201

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/039621 Ceased WO2014190356A2 (en) 2013-05-24 2014-05-27 Anti-b7-h5 antibodies and their uses

Country Status (12)

Country Link
US (1) US10316092B2 (enExample)
EP (1) EP3004158A2 (enExample)
JP (1) JP6682426B2 (enExample)
KR (1) KR20160129698A (enExample)
CN (1) CN106414489A (enExample)
AU (1) AU2014268298B2 (enExample)
BR (1) BR112015029395A2 (enExample)
CA (1) CA2913312A1 (enExample)
HK (1) HK1232243A1 (enExample)
MX (1) MX376808B (enExample)
SG (2) SG10201709715RA (enExample)
WO (1) WO2014190356A2 (enExample)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9279008B2 (en) 2011-11-03 2016-03-08 The Trustees Of The University Of Pennsylvania Isolated B7-H4 specific compositions and methods of use thereof
EP2892558A4 (en) * 2012-09-07 2016-04-20 Dartmouth College VISTA MODULATORS FOR THE DIAGNOSIS AND TREATMENT OF CANCER
WO2017069291A1 (en) 2015-10-23 2017-04-27 Canbas Co., Ltd. Peptides and peptidomimetics in combination with t cell activating and/or checkpoint inhibiting agents for cancer treatment
WO2017220990A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 antibodies
WO2018098352A2 (en) 2016-11-22 2018-05-31 Jun Oishi Targeting kras induced immune checkpoint expression
US10273301B2 (en) 2013-12-24 2019-04-30 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
KR20190128198A (ko) * 2017-03-14 2019-11-15 파이브 프라임 테라퓨틱스, 인크. 산성 pH에서 VISTA에 결합하는 항체
WO2019241730A2 (en) 2018-06-15 2019-12-19 Flagship Pioneering Innovations V, Inc. Increasing immune activity through modulation of postcellular signaling factors
US10633456B1 (en) 2018-09-07 2020-04-28 Hummingbird Bioscience Holdings Pte. Ltd. Vista antigen-binding molecules
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
WO2020227159A2 (en) 2019-05-03 2020-11-12 Flagship Pioneering Innovations V, Inc. Methods of modulating immune activity
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
WO2021127217A1 (en) 2019-12-17 2021-06-24 Flagship Pioneering Innovations V, Inc. Combination anti-cancer therapies with inducers of iron-dependent cellular disassembly
RU2750723C1 (ru) * 2017-10-20 2021-07-01 Фармабцин Инк. Антитела против vista и их применение
JP2021518133A (ja) * 2018-03-21 2021-08-02 ファイブ プライム セラピューティクス, インコーポレイテッド 酸性pHでVISTAに結合する抗体
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
WO2022006179A1 (en) 2020-06-29 2022-01-06 Flagship Pioneering Innovations V, Inc. Viruses engineered to promote thanotransmission and their use in treating cancer
US11306150B2 (en) 2017-01-11 2022-04-19 Bristol-Myers Squibb Company Method of identifying a P-selectin glycoprotein ligand-1 (PSGL-1) antagonist
WO2022212784A1 (en) 2021-03-31 2022-10-06 Flagship Pioneering Innovations V, Inc. Thanotransmission polypeptides and their use in treating cancer
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
WO2023278641A1 (en) 2021-06-29 2023-01-05 Flagship Pioneering Innovations V, Inc. Immune cells engineered to promote thanotransmission and uses thereof
WO2023138579A1 (zh) 2022-01-21 2023-07-27 和铂医药美国股份有限公司 抗b7-h7抗体或其抗原结合片段及制备方法和应用
WO2024077191A1 (en) 2022-10-05 2024-04-11 Flagship Pioneering Innovations V, Inc. Nucleic acid molecules encoding trif and additionalpolypeptides and their use in treating cancer
WO2024151687A1 (en) 2023-01-09 2024-07-18 Flagship Pioneering Innovations V, Inc. Genetic switches and their use in treating cancer
US12091462B2 (en) 2018-07-11 2024-09-17 Five Prime Therapeutics, Inc. Antibodies binding to vista at acidic pH
US12103972B2 (en) 2018-04-06 2024-10-01 Dana-Farber Cancer Institute, Inc. KIR3DL3 as an HHLA2 receptor, anti-HHLA2 antibodies, and uses thereof
US12162928B2 (en) 2012-06-22 2024-12-10 The Trustees Of Dartmouth College VISTA-Ig constructs and the use of VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014177459A2 (en) 2013-04-29 2014-11-06 F. Hoffmann-La Roche Ag Fc-receptor binding modified asymmetric antibodies and methods of use
UA118029C2 (uk) 2013-04-29 2018-11-12 Ф. Хоффманн-Ля Рош Аг Модифіковане антитіло, що зв'язується з людським fcrn, й способи його застосування
US20160145355A1 (en) * 2013-06-24 2016-05-26 Biomed Valley Discoveries, Inc. Bispecific antibodies
MX380658B (es) 2014-01-15 2025-03-11 Hoffmann La Roche Variantes de region fc con union mejorada de la proteina a.
WO2018195772A1 (en) * 2017-04-25 2018-11-01 Sun Yat-Sen University Pd-1h as target in treatement of asthma
CN107299085B (zh) * 2017-05-26 2020-09-29 广东医科大学 分泌抗人b7-h4胞外单克隆抗体杂交瘤细胞株和抗人b7-h4单克隆抗体及其应用
WO2022062803A1 (en) * 2020-09-24 2022-03-31 The University Of Hong Kong Neutralizing antibodies against covid-19 and methods of use thereof
US20250188167A1 (en) * 2022-02-25 2025-06-12 Nanjing Probio Biotech Co., Ltd. Antibodies and variants thereof against human b7-h3
WO2025149667A1 (en) 2024-01-12 2025-07-17 Pheon Therapeutics Ltd Antibody drug conjugates and uses thereof
CN121005781A (zh) * 2024-05-24 2025-11-25 合肥天港免疫药物有限公司 高亲和力b7h7抗体或其抗原结合片段及其用途
CN121620535A (zh) * 2024-05-27 2026-03-06 杭州阿诺生物医药科技有限公司 一种多功能融合蛋白

Citations (103)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4444887A (en) 1979-12-10 1984-04-24 Sloan-Kettering Institute Process for making human antibody producing B-lymphocytes
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
US4526938A (en) 1982-04-22 1985-07-02 Imperial Chemical Industries Plc Continuous release formulations
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
EP0239400A2 (en) 1986-03-27 1987-09-30 Medical Research Council Recombinant antibodies and methods for their production
US4716111A (en) 1982-08-11 1987-12-29 Trustees Of Boston University Process for producing human antibodies
US4741900A (en) 1982-11-16 1988-05-03 Cytogen Corporation Antibody-metal ion complexes
WO1988007089A1 (en) 1987-03-18 1988-09-22 Medical Research Council Altered antibodies
US4816397A (en) 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
WO1989007142A1 (en) 1988-02-05 1989-08-10 Morrison Sherie L Domain-modified constant region antibodies
US4880078A (en) 1987-06-29 1989-11-14 Honda Giken Kogyo Kabushiki Kaisha Exhaust muffler
WO1990002809A1 (en) 1988-09-02 1990-03-22 Protein Engineering Corporation Generation and selection of recombinant varied binding proteins
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US4980286A (en) 1985-07-05 1990-12-25 Whitehead Institute For Biomedical Research In vivo introduction and expression of foreign genetic material in epithelial cells
WO1991005548A1 (en) 1989-10-10 1991-05-02 Pitman-Moore, Inc. Sustained release composition for macromolecular proteins
US5013556A (en) 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
WO1991009967A1 (en) 1989-12-21 1991-07-11 Celltech Limited Humanised antibodies
WO1991010737A1 (en) 1990-01-11 1991-07-25 Molecular Affinities Corporation Production of antibodies using gene libraries
WO1991010741A1 (en) 1990-01-12 1991-07-25 Cell Genesys, Inc. Generation of xenogeneic antibodies
WO1992001047A1 (en) 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US5128326A (en) 1984-12-06 1992-07-07 Biomatrix, Inc. Drug delivery systems based on hyaluronans derivatives thereof and their salts and methods of producing same
WO1992018619A1 (en) 1991-04-10 1992-10-29 The Scripps Research Institute Heterodimeric receptor libraries using phagemids
WO1992019244A2 (en) 1991-05-01 1992-11-12 Henry M. Jackson Foundation For The Advancement Of Military Medicine A method for treating infectious respiratory diseases
WO1992022324A1 (en) 1991-06-14 1992-12-23 Xoma Corporation Microbially-produced antibody fragments and their conjugates
EP0519596A1 (en) 1991-05-17 1992-12-23 Merck & Co. Inc. A method for reducing the immunogenicity of antibody variable domains
WO1993011236A1 (en) 1991-12-02 1993-06-10 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
WO1993017105A1 (en) 1992-02-19 1993-09-02 Scotgen Limited Altered antibodies, products and processes relating thereto
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
WO1994004678A1 (en) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulins devoid of light chains
EP0592106A1 (en) 1992-09-09 1994-04-13 Immunogen Inc Resurfacing of rodent antibodies
WO1994025591A1 (en) 1993-04-29 1994-11-10 Unilever N.V. PRODUCTION OF ANTIBODIES OR (FUNCTIONALIZED) FRAGMENTS THEREOF DERIVED FROM HEAVY CHAIN IMMUNOGLOBULINS OF $i(CAMELIDAE)
US5413923A (en) 1989-07-25 1995-05-09 Cell Genesys, Inc. Homologous recombination for universal donor cells and chimeric mammalian hosts
WO1995015982A2 (en) 1993-12-08 1995-06-15 Genzyme Corporation Process for generating specific antibodies
US5427908A (en) 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
WO1995020401A1 (en) 1994-01-31 1995-08-03 Trustees Of Boston University Polyclonal antibody libraries
US5441050A (en) 1992-12-18 1995-08-15 Neoprobe Corporation Radiation responsive surgical instrument
US5516637A (en) 1994-06-10 1996-05-14 Dade International Inc. Method involving display of protein binding pairs on the surface of bacterial pili and bacteriophage
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
WO1996020698A2 (en) 1995-01-05 1996-07-11 The Board Of Regents Acting For And On Behalf Of The University Of Michigan Surface-modified nanoparticles and method of making and using same
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5569825A (en) 1990-08-29 1996-10-29 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
WO1996033735A1 (en) 1995-04-27 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
WO1996034096A1 (en) 1995-04-28 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5642821A (en) 1992-10-06 1997-07-01 Haefliger; Werner Mobile crane with improved boom construction
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
WO1997032572A2 (en) 1996-03-04 1997-09-12 The Penn State Research Foundation Materials and methods for enhancing cellular internalization
US5679377A (en) 1989-11-06 1997-10-21 Alkermes Controlled Therapeutics, Inc. Protein microspheres and methods of using them
WO1997038731A1 (en) 1996-04-18 1997-10-23 The Regents Of The University Of California Immunoliposomes that optimize internalization into target cells
WO1997044013A1 (en) 1996-05-24 1997-11-27 Massachusetts Institute Of Technology Aerodynamically light particles for pulmonary drug delivery
US5698426A (en) 1990-09-28 1997-12-16 Ixsys, Incorporated Surface expression libraries of heteromeric receptors
US5733743A (en) 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1998016654A1 (en) 1996-10-11 1998-04-23 Japan Tobacco, Inc. Production of a multimeric protein by cell fusion method
US5750753A (en) 1996-01-24 1998-05-12 Chisso Corporation Method for manufacturing acryloxypropysilane
WO1998023289A1 (en) 1996-11-27 1998-06-04 The General Hospital Corporation MODULATION OF IgG BINDING TO FcRn
WO1998024893A2 (en) 1996-12-03 1998-06-11 Abgenix, Inc. TRANSGENIC MAMMALS HAVING HUMAN IG LOCI INCLUDING PLURAL VH AND Vλ REGIONS AND ANTIBODIES PRODUCED THEREFROM
US5766886A (en) 1991-12-13 1998-06-16 Xoma Corporation Modified antibody variable domains
US5780225A (en) 1990-01-12 1998-07-14 Stratagene Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules
WO1998031346A1 (en) 1997-01-16 1998-07-23 Massachusetts Institute Of Technology Preparation of particles for inhalation
US5807715A (en) 1984-08-27 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin
US5814318A (en) 1990-08-29 1998-09-29 Genpharm International Inc. Transgenic non-human animals for producing heterologous antibodies
US5821047A (en) 1990-12-03 1998-10-13 Genentech, Inc. Monovalent phage display
WO1998046645A2 (en) 1997-04-14 1998-10-22 Micromet Gesellschaft Für Biomedizinische Forschung Mbh Method for the production of antihuman antigen receptors and uses thereof
WO1998050433A2 (en) 1997-05-05 1998-11-12 Abgenix, Inc. Human monoclonal antibodies to epidermal growth factor receptor
US5843597A (en) 1997-12-01 1998-12-01 Eveready Battery Company, Inc. Ribbed gasket for miniature galvanic cell
US5855913A (en) 1997-01-16 1999-01-05 Massachusetts Instite Of Technology Particles incorporating surfactants for pulmonary drug delivery
US5888533A (en) 1995-10-27 1999-03-30 Atrix Laboratories, Inc. Non-polymeric sustained release delivery system
WO1999015154A1 (en) 1997-09-24 1999-04-01 Alkermes Controlled Therapeutics, Inc. Methods for fabricating polymer-based controlled release preparations
WO1999020253A1 (en) 1997-10-23 1999-04-29 Bioglan Therapeutics Ab Encapsulation method
US5912015A (en) 1992-03-12 1999-06-15 Alkermes Controlled Therapeutics, Inc. Modulated release from biocompatible polymers
US5916597A (en) 1995-08-31 1999-06-29 Alkermes Controlled Therapeutics, Inc. Composition and method using solid-phase particles for sustained in vivo release of a biologically active agent
US5934272A (en) 1993-01-29 1999-08-10 Aradigm Corporation Device and method of creating aerosolized mist of respiratory drug
US5945155A (en) 1996-02-29 1999-08-31 International Business Machines Corporation Low dielectric constant amorphous fluorinated carbon and method of preparation
WO1999051642A1 (en) 1998-04-02 1999-10-14 Genentech, Inc. Antibody variants and fragments thereof
US5985309A (en) 1996-05-24 1999-11-16 Massachusetts Institute Of Technology Preparation of particles for inhalation
WO1999058572A1 (en) 1998-05-08 1999-11-18 Cambridge University Technical Services Limited Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
WO1999066903A2 (en) 1998-06-24 1999-12-29 Advanced Inhalation Research, Inc. Large porous particles emitted from an inhaler
US6019968A (en) 1995-04-14 2000-02-01 Inhale Therapeutic Systems, Inc. Dispersible antibody compositions and methods for their preparation and use
WO2000042072A2 (en) 1999-01-15 2000-07-20 Genentech, Inc. Polypeptide variants with altered effector function
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
US6311415B1 (en) 1998-09-14 2001-11-06 Lind Shoe Company Bowling shoe with replaceable tip
US6350861B1 (en) 1992-03-09 2002-02-26 Protein Design Labs, Inc. Antibodies with increased binding affinity
US6407213B1 (en) 1991-06-14 2002-06-18 Genentech, Inc. Method for making humanized antibodies
US20030044407A1 (en) 1999-02-22 2003-03-06 Chang Esther H. Simplified and improved method for preparing an antibody or an antibody fragment targeted immunoliposome or polyplex for systemic administration of a therapeutic or diagnostic agent
US20030229208A1 (en) 1988-12-28 2003-12-11 Protein Design Labs, Inc. Humanized immunoglobulins
WO2004028564A2 (fr) 2002-09-13 2004-04-08 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Traitement des pathologies echappant a la reponse immune par des anticorps optimises
WO2004029207A2 (en) 2002-09-27 2004-04-08 Xencor Inc. Optimized fc variants and methods for their generation
WO2004029092A2 (fr) 2002-09-13 2004-04-08 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Anticorps pour adcc et induisant la production de cytokines.
US6787153B1 (en) 1991-06-28 2004-09-07 Mitsubishi Chemical Corporation Human monoclonal antibody specifically binding to surface antigen of cancer cell membrane
US20050037000A1 (en) 2003-01-09 2005-02-17 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US20050064514A1 (en) 2003-01-09 2005-03-24 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US20050074403A1 (en) 1994-10-12 2005-04-07 Jon F. Kayyem Cell-specific gene delivery vehicles
US6982323B1 (en) 1997-12-23 2006-01-03 Alexion Pharmaceuticals, Inc. Chimeric proteins for diagnosis and treatment of diabetes
WO2011020024A2 (en) 2009-08-13 2011-02-17 The Johns Hopkins University Methods of modulating immune function

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT1781682E (pt) * 2004-06-24 2013-05-14 Mayo Foundation B7-h5, um polipéptido coestimulante
EP2130552B1 (en) * 2007-02-27 2016-06-15 Chugai Seiyaku Kabushiki Kaisha Pharmaceutical composition comprising anti-grp78 antibody as active ingredient
KR20230119259A (ko) * 2016-04-15 2023-08-16 이뮤넥스트, 인크. 항-인간 vista 항체 및 이의 용도

Patent Citations (122)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4444887A (en) 1979-12-10 1984-04-24 Sloan-Kettering Institute Process for making human antibody producing B-lymphocytes
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
US4526938A (en) 1982-04-22 1985-07-02 Imperial Chemical Industries Plc Continuous release formulations
US4716111A (en) 1982-08-11 1987-12-29 Trustees Of Boston University Process for producing human antibodies
US4741900A (en) 1982-11-16 1988-05-03 Cytogen Corporation Antibody-metal ion complexes
US4816397A (en) 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US6331415B1 (en) 1983-04-08 2001-12-18 Genentech, Inc. Methods of producing immunoglobulins, vectors and transformed host cells for use therein
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
US5807715A (en) 1984-08-27 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin
US5128326A (en) 1984-12-06 1992-07-07 Biomatrix, Inc. Drug delivery systems based on hyaluronans derivatives thereof and their salts and methods of producing same
US4980286A (en) 1985-07-05 1990-12-25 Whitehead Institute For Biomedical Research In vivo introduction and expression of foreign genetic material in epithelial cells
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
EP0239400A2 (en) 1986-03-27 1987-09-30 Medical Research Council Recombinant antibodies and methods for their production
GB2188638A (en) 1986-03-27 1987-10-07 Gregory Paul Winter Chimeric antibodies
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
GB2209757A (en) 1987-03-18 1989-05-24 Medical Res Council Altered antibodies
WO1988007089A1 (en) 1987-03-18 1988-09-22 Medical Research Council Altered antibodies
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US4880078A (en) 1987-06-29 1989-11-14 Honda Giken Kogyo Kabushiki Kaisha Exhaust muffler
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
WO1989007142A1 (en) 1988-02-05 1989-08-10 Morrison Sherie L Domain-modified constant region antibodies
WO1990002809A1 (en) 1988-09-02 1990-03-22 Protein Engineering Corporation Generation and selection of recombinant varied binding proteins
US5403484A (en) 1988-09-02 1995-04-04 Protein Engineering Corporation Viruses expressing chimeric binding proteins
US5571698A (en) 1988-09-02 1996-11-05 Protein Engineering Corporation Directed evolution of novel binding proteins
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US20040049014A1 (en) 1988-12-28 2004-03-11 Protein Design Labs, Inc. Humanized immunoglobulins
US5693761A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Polynucleotides encoding improved humanized immunoglobulins
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US20030229208A1 (en) 1988-12-28 2003-12-11 Protein Design Labs, Inc. Humanized immunoglobulins
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5693762A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Humanized immunoglobulins
US6180370B1 (en) 1988-12-28 2001-01-30 Protein Design Labs, Inc. Humanized immunoglobulins and methods of making the same
US5413923A (en) 1989-07-25 1995-05-09 Cell Genesys, Inc. Homologous recombination for universal donor cells and chimeric mammalian hosts
WO1991005548A1 (en) 1989-10-10 1991-05-02 Pitman-Moore, Inc. Sustained release composition for macromolecular proteins
US5013556A (en) 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5679377A (en) 1989-11-06 1997-10-21 Alkermes Controlled Therapeutics, Inc. Protein microspheres and methods of using them
WO1991009967A1 (en) 1989-12-21 1991-07-11 Celltech Limited Humanised antibodies
WO1991010737A1 (en) 1990-01-11 1991-07-25 Molecular Affinities Corporation Production of antibodies using gene libraries
WO1991010741A1 (en) 1990-01-12 1991-07-25 Cell Genesys, Inc. Generation of xenogeneic antibodies
US5939598A (en) 1990-01-12 1999-08-17 Abgenix, Inc. Method of making transgenic mice lacking endogenous heavy chains
US5780225A (en) 1990-01-12 1998-07-14 Stratagene Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules
US5427908A (en) 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
US5580717A (en) 1990-05-01 1996-12-03 Affymax Technologies N.V. Recombinant library screening methods
US5969108A (en) 1990-07-10 1999-10-19 Medical Research Council Methods for producing members of specific binding pairs
WO1992001047A1 (en) 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5814318A (en) 1990-08-29 1998-09-29 Genpharm International Inc. Transgenic non-human animals for producing heterologous antibodies
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5569825A (en) 1990-08-29 1996-10-29 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5698426A (en) 1990-09-28 1997-12-16 Ixsys, Incorporated Surface expression libraries of heteromeric receptors
US5821047A (en) 1990-12-03 1998-10-13 Genentech, Inc. Monovalent phage display
WO1992018619A1 (en) 1991-04-10 1992-10-29 The Scripps Research Institute Heterodimeric receptor libraries using phagemids
US5658727A (en) 1991-04-10 1997-08-19 The Scripps Research Institute Heterodimeric receptor libraries using phagemids
WO1992019244A2 (en) 1991-05-01 1992-11-12 Henry M. Jackson Foundation For The Advancement Of Military Medicine A method for treating infectious respiratory diseases
US5290540A (en) 1991-05-01 1994-03-01 Henry M. Jackson Foundation For The Advancement Of Military Medicine Method for treating infectious respiratory diseases
EP0519596A1 (en) 1991-05-17 1992-12-23 Merck & Co. Inc. A method for reducing the immunogenicity of antibody variable domains
WO1992022324A1 (en) 1991-06-14 1992-12-23 Xoma Corporation Microbially-produced antibody fragments and their conjugates
US6407213B1 (en) 1991-06-14 2002-06-18 Genentech, Inc. Method for making humanized antibodies
US6787153B1 (en) 1991-06-28 2004-09-07 Mitsubishi Chemical Corporation Human monoclonal antibody specifically binding to surface antigen of cancer cell membrane
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
WO1993011236A1 (en) 1991-12-02 1993-06-10 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US5766886A (en) 1991-12-13 1998-06-16 Xoma Corporation Modified antibody variable domains
WO1993017105A1 (en) 1992-02-19 1993-09-02 Scotgen Limited Altered antibodies, products and processes relating thereto
US6350861B1 (en) 1992-03-09 2002-02-26 Protein Design Labs, Inc. Antibodies with increased binding affinity
US5912015A (en) 1992-03-12 1999-06-15 Alkermes Controlled Therapeutics, Inc. Modulated release from biocompatible polymers
US5733743A (en) 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6005079A (en) 1992-08-21 1999-12-21 Vrije Universiteit Brussels Immunoglobulins devoid of light chains
WO1994004678A1 (en) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulins devoid of light chains
EP0592106A1 (en) 1992-09-09 1994-04-13 Immunogen Inc Resurfacing of rodent antibodies
US5642821A (en) 1992-10-06 1997-07-01 Haefliger; Werner Mobile crane with improved boom construction
US5441050A (en) 1992-12-18 1995-08-15 Neoprobe Corporation Radiation responsive surgical instrument
US5934272A (en) 1993-01-29 1999-08-10 Aradigm Corporation Device and method of creating aerosolized mist of respiratory drug
WO1994025591A1 (en) 1993-04-29 1994-11-10 Unilever N.V. PRODUCTION OF ANTIBODIES OR (FUNCTIONALIZED) FRAGMENTS THEREOF DERIVED FROM HEAVY CHAIN IMMUNOGLOBULINS OF $i(CAMELIDAE)
WO1995015982A2 (en) 1993-12-08 1995-06-15 Genzyme Corporation Process for generating specific antibodies
WO1995020401A1 (en) 1994-01-31 1995-08-03 Trustees Of Boston University Polyclonal antibody libraries
US5516637A (en) 1994-06-10 1996-05-14 Dade International Inc. Method involving display of protein binding pairs on the surface of bacterial pili and bacteriophage
US20050074403A1 (en) 1994-10-12 2005-04-07 Jon F. Kayyem Cell-specific gene delivery vehicles
WO1996020698A2 (en) 1995-01-05 1996-07-11 The Board Of Regents Acting For And On Behalf Of The University Of Michigan Surface-modified nanoparticles and method of making and using same
US6019968A (en) 1995-04-14 2000-02-01 Inhale Therapeutic Systems, Inc. Dispersible antibody compositions and methods for their preparation and use
WO1996033735A1 (en) 1995-04-27 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
WO1996034096A1 (en) 1995-04-28 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5916597A (en) 1995-08-31 1999-06-29 Alkermes Controlled Therapeutics, Inc. Composition and method using solid-phase particles for sustained in vivo release of a biologically active agent
US5888533A (en) 1995-10-27 1999-03-30 Atrix Laboratories, Inc. Non-polymeric sustained release delivery system
US5750753A (en) 1996-01-24 1998-05-12 Chisso Corporation Method for manufacturing acryloxypropysilane
US5945155A (en) 1996-02-29 1999-08-31 International Business Machines Corporation Low dielectric constant amorphous fluorinated carbon and method of preparation
WO1997032572A2 (en) 1996-03-04 1997-09-12 The Penn State Research Foundation Materials and methods for enhancing cellular internalization
US5985320A (en) 1996-03-04 1999-11-16 The Penn State Research Foundation Materials and methods for enhancing cellular internalization
WO1997038731A1 (en) 1996-04-18 1997-10-23 The Regents Of The University Of California Immunoliposomes that optimize internalization into target cells
US5985309A (en) 1996-05-24 1999-11-16 Massachusetts Institute Of Technology Preparation of particles for inhalation
WO1997044013A1 (en) 1996-05-24 1997-11-27 Massachusetts Institute Of Technology Aerodynamically light particles for pulmonary drug delivery
US5874064A (en) 1996-05-24 1999-02-23 Massachusetts Institute Of Technology Aerodynamically light particles for pulmonary drug delivery
WO1998016654A1 (en) 1996-10-11 1998-04-23 Japan Tobacco, Inc. Production of a multimeric protein by cell fusion method
US5916771A (en) 1996-10-11 1999-06-29 Abgenix, Inc. Production of a multimeric protein by cell fusion method
WO1998023289A1 (en) 1996-11-27 1998-06-04 The General Hospital Corporation MODULATION OF IgG BINDING TO FcRn
WO1998024893A2 (en) 1996-12-03 1998-06-11 Abgenix, Inc. TRANSGENIC MAMMALS HAVING HUMAN IG LOCI INCLUDING PLURAL VH AND Vλ REGIONS AND ANTIBODIES PRODUCED THEREFROM
WO1998031346A1 (en) 1997-01-16 1998-07-23 Massachusetts Institute Of Technology Preparation of particles for inhalation
US5855913A (en) 1997-01-16 1999-01-05 Massachusetts Instite Of Technology Particles incorporating surfactants for pulmonary drug delivery
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
WO1998046645A2 (en) 1997-04-14 1998-10-22 Micromet Gesellschaft Für Biomedizinische Forschung Mbh Method for the production of antihuman antigen receptors and uses thereof
WO1998050433A2 (en) 1997-05-05 1998-11-12 Abgenix, Inc. Human monoclonal antibodies to epidermal growth factor receptor
WO1999015154A1 (en) 1997-09-24 1999-04-01 Alkermes Controlled Therapeutics, Inc. Methods for fabricating polymer-based controlled release preparations
US5989463A (en) 1997-09-24 1999-11-23 Alkermes Controlled Therapeutics, Inc. Methods for fabricating polymer-based controlled release devices
WO1999020253A1 (en) 1997-10-23 1999-04-29 Bioglan Therapeutics Ab Encapsulation method
US5843597A (en) 1997-12-01 1998-12-01 Eveready Battery Company, Inc. Ribbed gasket for miniature galvanic cell
US6982323B1 (en) 1997-12-23 2006-01-03 Alexion Pharmaceuticals, Inc. Chimeric proteins for diagnosis and treatment of diabetes
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
WO1999051642A1 (en) 1998-04-02 1999-10-14 Genentech, Inc. Antibody variants and fragments thereof
WO1999058572A1 (en) 1998-05-08 1999-11-18 Cambridge University Technical Services Limited Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis
WO1999066903A2 (en) 1998-06-24 1999-12-29 Advanced Inhalation Research, Inc. Large porous particles emitted from an inhaler
US6311415B1 (en) 1998-09-14 2001-11-06 Lind Shoe Company Bowling shoe with replaceable tip
WO2000042072A2 (en) 1999-01-15 2000-07-20 Genentech, Inc. Polypeptide variants with altered effector function
US20030044407A1 (en) 1999-02-22 2003-03-06 Chang Esther H. Simplified and improved method for preparing an antibody or an antibody fragment targeted immunoliposome or polyplex for systemic administration of a therapeutic or diagnostic agent
WO2004028564A2 (fr) 2002-09-13 2004-04-08 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Traitement des pathologies echappant a la reponse immune par des anticorps optimises
WO2004029092A2 (fr) 2002-09-13 2004-04-08 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Anticorps pour adcc et induisant la production de cytokines.
WO2004029207A2 (en) 2002-09-27 2004-04-08 Xencor Inc. Optimized fc variants and methods for their generation
US20050037000A1 (en) 2003-01-09 2005-02-17 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US20050064514A1 (en) 2003-01-09 2005-03-24 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
WO2011020024A2 (en) 2009-08-13 2011-02-17 The Johns Hopkins University Methods of modulating immune function

Non-Patent Citations (175)

* Cited by examiner, † Cited by third party
Title
"Controlled Drug Bioavailability, Drug Product Design and Performance", 1984, WILEY
"Gene Therapy: Advances in Pharmacology", vol. 40, 1997, ACADEMIC PRESS, pages: 399 - 435
"M ANTIBODIES FOR CANCER DETECTION AND THERAPY", ACADEMIC PRESS, article "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", pages: 303 - 16
"Medical Applications of Controlled Release", 1974, CRC PRES
"Physician's Desk Reference", 2002
AALBERSE, R.C. ET AL.: "Immunoglobulin G4: An Odd Antibody", CLIN. EXP. ALLERGY, vol. 39, no. 4, 2009, pages 469 - 477
ABRA ET AL., JOURNAL OF LIPOSOME RESEARCH, vol. 12, no. 1, 2, 2002, pages 1 - 3
AGARWAL, A. ET AL.: "The Role Of Positive Costimulatory Molecules In Transplantation And Tolerance", CURR. OPIN. ORGAN TRANSPLANT., vol. 13, 2008, pages 366 - 372
ALLEN ET AL., ADV. DRUG DELIV. REV, vol. 13, 1994, pages 285 - 309
ALLEN ET AL., FEBS LETT., vol. 223, 1987, pages 42 - 6
ALLEN ET AL.: "Stealth Liposomes, Boca Rotan", 1995, CRC PRESS, pages: 233 - 44
AMES, R.S. ET AL.: "Conversion Of Murine Fabs Isolated From A Combinatorial Phage Display Library To Full Length Immunoglobulins", J. IMMUNOL. METHODS, vol. 184, 1995, pages 177 - 186
ANGAL, S. ET AL., MOLECULAR IMMUNOLOGY, vol. 30, no. 1, 1993, pages 105 - 108
ANGAL, S. ET AL.: "A Single Amino Acid Substitution Abolishes The Heterogeneity Of Chimeric MouselHuman (Igg4) Antibody,", MOLEC. IMMUNOL., vol. 30, no. 1, 1993, pages 105 - 108
ARNON ET AL.: "MONOCLONAL ANTIBODIES AND CANCER THERAPY", 1985, ALAN R. LISS, INC., article "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", pages: 243 - 56
BACA ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 10678 - 10684
BACA ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 10678 - 84
BARDERAS, R. ET AL.: "Affinity maturation of antibodies assisted by in silico modeling", PROC. NATL. ACAD. SCI. (USA, vol. 105, no. 26, 2008, pages 9029 - 9034
BENDAS ET AL., BIODRUGS, vol. 14, no. 4, 2001, pages 215 - 224
BENDAS ET AL., BIODRUGS, vol. 15, no. 4, 2001, pages 215 - 224
BETTER, M. ET AL.: "Escherichia coli Secretion Of An Active Chimeric Antibody Fragment", SCIENCE, vol. 240, 1988, pages 1041 - 1043
BLUM ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1029, 1990, pages 91 - 7
BORREBACK: "Antibody Engineering", 1992, W. H. FREEMAN
BOSTROM, J. ET AL.: "Improving Antibody Binding Affinity And Specificity For Therapeutic Development", METHODS MOL. BIOL., vol. 525, 2009, pages 353 - 376
BRINKMAN, U. ET AL.: "Phage Display Of Disulfide-Stabilized Fv Fragments", J. IMMUNOL. METHODS, vol. 182, 1995, pages 41 - 50
BUCHWALD ET AL., SURGERY, vol. 88, 1980, pages 507
BURTON, D.R. ET AL.: "Human Antibodies From Combinatorial Libraries", ADV. IMMUNOL., vol. 57, 1994, pages 191 - 280
CALDAS ET AL., PROTEIN ENG., vol. 13, 2000, pages 353 - 360
CALDAS ET AL., PROTEIN ENG., vol. 13, 2000, pages 353 - 60
CHAPOVAL ET AL., METHODS MOL. MED., vol. 45, 2000, pages 247 - 255
CHOTHIA ET AL.: "Structural Determinants In The Sequences Of Immunoglobulin Variable Domain", J. MOL. BIOL., vol. 278, 1998, pages 457 - 479
CHOTHIA; LESK, J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
CLEEK ET AL., PRO. INT'L. SYMP. CONTROL. REL. BIOACT. MATER., vol. 24, 1997, pages 853 - 854
CLEEK ET AL.: "Biodegradable Polymeric Carriers for a bFGF Antibody for Cardiovascular Application", PRO. INT'L. SYMP. CONTROL. REL. BIOACT. MATER., vol. 24, 1997, pages 853 - 854
COLLINS, M. ET AL.: "The B7 Family Of Immune-Regulatory Ligands", GENOME BIOL., vol. 6, 2005, pages 223.1 - 223.7
COUTO ET AL., CANCER RES., vol. 55, 1995, pages 1717 - 22
COUTO ET AL., CANCER RES., vol. 55, no. 23, 1995, pages 5973S - 5977S
COYLE, A.J. ET AL.: "The Expanding B7 Superfamily: Increasing Complexity In Costimulatory Signals Regulating T Cell Function", NATURE IMMUNOL., vol. 2, no. 3, 2001, pages 203 - 209
DAVIES J. ET AL.: "Expression OfGnTIII In A Recombinant Anti-CD20 CHO Production Cell Line: Expression Of Antibodies With Altered Glycoforms Leads To An Increase In ADCC Through Higher Affinity For FC Gamma RIII", BIOTECHNOLOGY & BIOENGINEERING, vol. 74, no. 4, 2001, pages 288 - 294
DIETRICH ET AL., BIOCHEMISTRY, vol. 35, 1996, pages 1100 - 1105
DONG, C. ET AL.: "Immune Regulation by Novel Costimulatory Molecules", IMMUNOLOG. RES., vol. 28, no. 1, 2003, pages 39 - 48
DURING ET AL., ANN. NEUROL., vol. 25, 1989, pages 351
ELLIOTT, S. ET AL.: "Enhancement Of Therapeutic Protein In Vivo Activities Through Glycoengineering", NATURE BIOTECHNOL., vol. 21, 2003, pages 414 - 21
EPSTEIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 3688
FINLAY, W.J. ET AL.: "Affinity Maturation Of A Humanized Rat Antibody For Anti-RAGE Therapy: Comprehensive Mutagenesis Reveals A High Level Of Mutational Plasticity Both Inside And Outside The Complementarity-Determining Regions", J. MOL. BIOL., vol. 388, no. 3, 2009, pages 541 - 558
FLAJNIK, M.F. ET AL.: "Evolution Of The B7 Family: Co-Evolution Of B7H6 And Nkp30, Identification Of A New B7 Family Member, B7H7, And Of B7's Historical Relationship With The MHC", IMMUNOGENETICS, vol. 64, 2012, pages 571 - 590
FLIES, D.B. ET AL.: "The New B7s: Playing a Pivotal Role in Tumor Immunity", J. IMMUNOTHER., vol. 30, no. 3, 2007, pages 251 - 260
GILLIES ET AL., J. IMMUNOL. METHODS, vol. 125, 1989, pages 191 - 202
GLASER, S.M. ET AL.: "Antibody Engineering By Codon-Based Mutagenesis In A Filamentous Phage Vector System", J. IMMUNOL., vol. 149, 1992, pages 3903 - 3913
GOEDDEL ET AL.: "Gene Expression Technology Methods in Enzymology", vol. 185, 1991, ACADEMIC PRESS
GOODSON, MEDICAL APPLICATIONS OF CONTROLLED RELEASE, vol. 2, 1984, pages 115 - 138
GREENSPAN, N.S. ET AL.: "Idiotypes: Structure And Immunogenicity", FASEB J., vol. 7, 1989, pages 437 - 444
GREENWALD, R.J. ET AL.: "The B7 Family Revisited", ANN. REV. IMMUNOL., vol. 23, 2005, pages 515 - 548
GROSS, J. ET AL.: "Identification And Distribution Of The Costimulatory Receptor CD28 In The Mouse,", J. IMMUNOL., vol. 149, 1992, pages 380 - 388
GUSTCHINA, E. ET AL.: "Affinity Maturation By Targeted Diversification Of The CDR-H2 Loop Of A Monoclonal Fab Derived From A Synthetic Naive Human Antibody Library And Directed Against The Internal Trimeric Coiled-Coil Of Gp41 Yields A Set Of Fabs With Improved HIV-1 Neutralization Potency And Breadth", VIROLOGY, vol. 393, no. 1, 2009, pages 112 - 119
HACKEL, B.J. ET AL.: "Stability And CDR Composition Biases Enrich Binder Functionality Landscapes", J. MOL. BIOL., vol. 401, no. 1, 2010, pages 84 - 96
HANSEN, BIOCHIM. BIOPHYS. ACTA, vol. 1239, 1995, pages 133 - 144
HELLSTROM ET AL.: "CONTROLLED DRUG DELIVERY", 1987, MARCEL DEKKER, INC., article "Antibodies For Drug Delivery", pages: 623 - 53
HOWARD ET AL., J. NEUROSURG., vol. 7 1, 1989, pages 105
HUSTON, J.S. ET AL.: "Protein Engineering Of Single-Chain Fv Analogs And Fusion Proteins", METHODS IN ENZYMOLOGY, vol. 203, 1991, pages 46 - 88
HWANG, PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 4030 - 4
IORNS, E. ET AL.: "A New Mouse Model For The Study Of Human Breast Cancer Metastasis", PLOS ONE, vol. 7, no. 10, 31 October 2012 (2012-10-31), pages E47995
J. THOMAS: "Gene Therapy: Advances in Pharmacology", vol. 40, 1997, ACADEMIC PRESS, pages: 399 - 435
JOLIOT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 1864 - 1868
JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NATIONAL INSTITUTES OF HEALTH
KEIR, M.E. ET AL.: "PD-1 And Its Ligands In Tolerance And Immunity", ANNU. REV. IMMUNOL., vol. 26, 2008, pages 677 - 704
KETTLEBOROUGH, C.A. ET AL.: "Isolation Of Tumor Cell-Specific Single-Chain Fv From Immunized Mice Using Phage-Antibody Libraries And The Re-Construction Of Whole Antibodies From These Antibody Fragments", EUR. J. IMMUNOL., vol. 24, 1994, pages 952 - 958
KLIBANOV ET AL., BIOCHIM BIOPHYS ACTA, vol. 1062, 1991, pages 142 - 8
KLIBANOV ET AL., FEBS LETT., vol. 268, 1990, pages 235 - 7
KNAPPIK, A. ET AL.: "An Improved Affinity Tag Based On The FLAG Peptide For The Detection And Purification Of Recombinant Antibody Fragments", BIOTECHNIQUES, vol. 17, no. 4, 1994, pages 754 - 761
KORMAN, A.J. ET AL.: "Checkpoint Blockade in Cancer Immunotherapy", ADV. IMMUNOL., vol. 90, 2007, pages 297 - 339
KRAUSE, J.C. ET AL.: "An Insertion Mutation That Distorts Antibody Binding Site Architecture Enhances Function Of A Human Antibody", MBIO, vol. 2, no. 1, 2011, pages E00345 - 10
KUAN, C.T. ET AL.: "Affinity-Matured Anti-Glycoprotein NMB Recombinant Immunotoxins Targeting Malignant Gliomas And Melanomas", INT. J. CANCER, 2010
LAM ET AL., PROC. INT'L. SYMP. CONTROL REL. BIOACT. MATER., vol. 24, 1997, pages 759 - 760
LAM ET AL.: "Microencapsulation of Recombinant Humanized Monoclonal Antibody for Local Delivery", PROC. INT'L. SYMP. CONTROL REL. BIOACT. MATER., vol. 24, 1997, pages 759 - 760
LANGER, SCIENCE, vol. 249, 1990, pages 1527 - 1533
LENSCHOW, D.J. ET AL.: "CD28/B7 System of T Cell Costimulation", ANN. REV. IMMUNOL., vol. 14, 1996, pages 233 - 258
LEPENIES, B. ET AL.: "The Role Of Negative Costimulators During Parasitic Infections", ENDOCRINE, METABOLIC & IMMUNE DISORDERS - DRUG TARGETS, vol. 8, 2008, pages 279 - 288
LEVY ET AL., SCIENCE, vol. 228, 1985, pages 190
LINDLEY, P.S. ET AL.: "The Clinical Utility Of Inhibiting CD28-Mediated Costimulation", IMMUNOL. REV., vol. 229, 2009, pages 307 - 321
LINSLEY, P. ET AL.: "Intracellular Trafficking Of CTLA4 And Focal Localization Towards Sites Of TCR Engagement", IMMUNITY, vol. 4, 1996, pages 535 - 543
LITZINGER ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1190, 1994, pages 99 - 107
LOIARRO, M. ET AL.: "Targeting 1IR/lL-1R Signalling In Human Diseases", MEDIATORS INFLAMM., 8 April 2010 (2010-04-08), pages 674363
LOKE, P. ET AL.: "Emerging Mechanisms Of Immune Regulation: The Extended B7 Family And Regulatory T Cells", ARTHRITIS RES. THER., vol. 6, 2004, pages 208 - 214
LONBERG; HUSZAR, INT. REV. IMMUNOL., vol. 13, 1995, pages 65 - 93
LOUGHREY ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 901, 1987, pages 157 - 160
MAGER, D.L ET AL.: "Endogenous Retroviruses Provide The Primary Polyadenylation Signal For Two New Human Genes (HHLA2 And HHLA3", GENOMICS, vol. 59, 1999, pages 255 - 263
MARTIN ET AL., BIOCHEMISTRY, vol. 20, 1981, pages 4429 - 38
MARTIN ET AL., J. BIOL. CHEM., vol. 257, 1982, pages 286 - 288
MARUYAMA ET AL., CHEM. PHARM. BULL., vol. 39, 1991, pages 1620 - 2
MARUYAMA, BIOL. PHARM. BULL., vol. 23, no. 7, 2000, pages 791 - 799
MAYFORTH: "Designing Antibodies", 1993, ACADEMIC PRESS
MISHARIN, A.V. ET AL.: "Development Of A New Humanized Mouse Model To Study Acute Inflammatory Arthritis", J. TRANSL. MED., vol. 10, 2012, pages 190
MONTGOMERY, D.L. ET AL.: "Affinity Maturation And Characterization Of A Human Monoclonal Antibody Against HIV-1 gp41", MABS, vol. 1, no. 5, 2009, pages 462 - 474
MOREA ET AL., METHODS, vol. 20, 2000, pages 267 - 79
MORRISON, SCIENCE, vol. 229, 1985, pages 1202
MUELLER ET AL., MOL. IMMUN.,, vol. 34, no. 6, 1997, pages 441 - 452
MUELLER, J. ET AL., MOLECULAR IMMONOLOGY, vol. 34, no. 6, 1997, pages 441 - 452
MUELLER, J.P ET AL.: "Humanized Porcine VCAM-Specific Monoclonal Antibodies With Chimeric Igg2/G4 Constant Regions Block Human Leukocyte Binding To Porcine Endothelial Cells", MOL. IMMUN., vol. 34, no. 6, 1997, pages 441 - 452
MUELLER, J.P. ET AL.: "Humanized Porcine VCAM-Specific Monoclonal Antibodies With Chimeric IgG2/G4 Constant Regions Block Human Leukocyte Binding To Porcine Endothelial Cells,", MOL. IMMUN., vol. 34, no. 6, 1997, pages 441 - 452
MULLINAX, R.L. ET AL.: "Expression Of A Heterodimeric Fab Antibody Protein In One Cloning Step", BIOTECHNIQUES, vol. 12, no. 6, 1992, pages 864 - 869
MUYLDERMANS ET AL., TRENDS BIOCHEM. SCI., vol. 26, 2001, pages 230
NARDI, M. ET AL.: "Antiidiotype Antibody Against Platelet Anti-GpIIIa Contributes To The Regulation Of Thrombocytopenia In HIV-I-ITP Patients", J. EXP. MED., vol. 191, no. 12, 2000, pages 2093 - 2100
NING ET AL., RADIOTHERAPY & ONCOLOGY, vol. 39, 1996, pages 179 - 189
NING ET AL.: "Intratumoral Radioimmunotheraphy of a Human Colon Cancer Xenograft Using a Sustained-Release Gel", RADIOTHERAPY & ONCOLOGY, vol. 39, 1996, pages 179 - 189
NIRULA, A. ET AL.: "What Is Igg4? A Review Of The Biology Of A Unique Immunoglobulin Subtype,", CURR. OPIN. RHEUMATOL., vol. 23, no. 1, 2011, pages 119 - 124
NISINOFF, A.: "Idiotypes: Concepts And Applications", J. IMMUNOL., vol. 147, no. 8, 1991, pages 2429 - 2438
NUTTALL ET AL., CUR. PHARM. BIOTECH., vol. 1, 2000, pages 253
OI ET AL., BIOTECHNIQUES, vol. 4, 1986, pages 214
PADLAN, MOLECULAR IMMUNOLOGY, vol. 28, no. 4-5, 1991, pages 489 - 498
PARK, BIOSCIENCE REPORTS, vol. 22, no. 2, 2002, pages 267 - 281
PEDERSEN ET AL., J. MOL. BIOL., vol. 235, 1994, pages 959 - 73
PEDERSEN ET AL., J. MOL. BIOL., vol. 235, 1994, pages 959 - 973
PERSIC, L. ET AL.: "An Integrated Vector System For The Eukaryotic Expression Of Antibodies Or Their Fragments After Selection From Phage Display Libraries", GENE, vol. 187, 1997, pages 9 - 18
PLUCKTHUN: "The Pharmacology of Monoclonal Antibodies", vol. 113, 1994, SPRINGER-VERLAG, pages: 269 - 315
PRASAD, D.V. ET AL.: "B7SI, A Novel B7 Family Member That Negatively Regulates T Cell Activation", IMMUNITY, vol. 18, 2003, pages 863 - 873
PRESTA, CUR. OPIN. IMMUN., vol. 20, 2008, pages 460 - 470
PRESTA, CURR. OP. STRUCT. BIOL., vol. 2, 1992, pages 593 - 596
PRESTA, L.G.: "Molecular Engineering And Design Of Therapeutic Antibodies", CURR. OPIN. IMMUN., vol. 20, 2008, pages 460 - 470
RACKI, W.J. ET AL.: "NOD-scid IL2rgamma(null) Mouse Model Of Human Skin Transplantation And Allograft Rejection", TRANSPLANTATION, vol. 89, no. 5, 2010, pages 527 - 536
RAHIMI, N. ET AL.: "Identification Of IGPR-I As A Novel Adhesion Molecule Involved In Angiogenesis", MOLEC. BIOL. CELL, vol. 23, no. 9, 14 March 2012 (2012-03-14), pages 1646 - 1656
RANGER; PEPPAS, J., MACROMOL. SCI. REV. MACROMOL. CHEM., vol. 23, 1983, pages 61
REICHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 329
REICHMANN; MUYLDERMANS, J. IMMUNOL. METH., vol. 231, 1999, pages 25
RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323
RIECHMANN, L. ET AL.: "Reshaping Human Antibodies For Therapy", NATURE, vol. 332, 1988, pages 323 - 327
ROGUSKA ET AL., PNAS, vol. 91, 1994, pages 969 - 973
ROGUSKA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 969
ROGUSKA ET AL., PROC. NATL. ACAD. SCI., vol. 91, 1994, pages 969 - 973
ROGUSKA ET AL., PROTEIN ENG., vol. 9, 1996, pages 895 - 904
ROUTLEDGE, E.G. ET AL.: "The Effect Of Aglycosylation On The Immunogenicity Of A Humanized Therapeutic CD3 Monoclonal Antibody", TRANSPLANTATION, vol. 60, no. 8, 1995, pages 847 - 53
S.W. BURCHIEL ET AL.: "TUMOR IMAGING: THE RADIOCHEMICAL DETECTION OF CANCER", 1982, MASSON PUBLISHING INC., article "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments"
SANDHU, GENE, vol. 150, 1994, pages 409 - 10
SAUDEK ET AL., N. ENGL. J. MED., vol. 321, 1989, pages 574
SAWAI ET AL.: "Direct Production Of The Fab Fragment Derived From The Sperm Immobilizing Antibody Using Polymerase Chain Reaction And cDNA Expression Vectors", AM. J. REPROD. IMMUNOL., vol. 34, 1995, pages 26 - 34
SCHIER ET AL.: "Isolation Of Picomolar Affinity Anti-C-Erbb-2 Single-Chain Fv By Molecular Evolution Of The Complementarity Determining Regions In The Center Of The Antibody Binding Site", J. MOL. BIOL., vol. 263, 1996, pages 551 - 567
SEFTON, CRC CRIT. REF BIOMED. ENG., vol. 14, 1987, pages 20
SHARPE, A.H. ET AL.: "The B7-CD28 Superfamily", NATURE REV. IMMUNOL., vol. 2, 2002, pages 116 - 126
SHIELDS, R.L. ET AL.: "High Resolution Mapping of the Binding Site on Human IgGl for FcyRI, FcyRII, FcyRIII, and FcRn and Design o/ 1gG1 Variants with Improved Binding to the FcyR", J. BIOL. CHEM., vol. 276, no. 9, 2001, pages 6591 - 6604
SHIELDS, R.L. ET AL.: "Lack Of Fucose On Human IgG N-Linked Oligosaccharide Improves Binding To Human Fcgamma RIII And Antibody-Dependent Cellular Toxicity", J. BIOL. CHEM., vol. 277, no. 30, 2002, pages 26733 - 26740
SHIELDS, R.L. ET AL.: "Lack Of Fucose On Human IgG N-Linked Oligosaccharide Improves Binding To Human Fcgamma RIII And Antibody-Dependent Cellular Toxicity.", J. BIOL. CHEM., vol. 277, no. 30, 2002, pages 26733 - 26740
SHU, L. ET AL.: "Secretion Of A Single-Gene-Encoded Immunoglobulin From Myeloma Cells", PROC. NATL. ACAD. SCI. (USA, vol. 90, pages 7995 - 7999
SICA, G.L. ET AL.: "B7-4, A Molecule Of The B7 Family, Negatively Regulates T Cell Immunity", IMMUNITY, vol. 18, 2003, pages 849 - 861
SKERRA. A. ET AL.: "Assembly Of A Functional Immunoglobulin Fv Fragment In Escherichia coli", SCIENCE, vol. 240, 1988, pages 1038 - 1040
SONG ET AL., PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 50, 1995, pages 372 - 397
SONG ET AL.: "Antibody Mediated Lung Targeting of Long-Circulating Emulsions", PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 50, 1995, pages 372 - 397
STAVENHAGEN ET AL., CANCER RES., vol. 57, no. 18, 2007, pages 8882 - 90
STAVENHAGEN, J.B. ET AL.: "Fc Optimization Of Therapeutic Antibodies Enhances Their Ability To Kill Tumor Cells In Vitro And Controls Tumor Expansion In Vivo Via Low-Affinity Activating Fcgamma Receptors", CANCER RES., vol. 57, no. 18, 2007, pages 8882 - 8890
STEIDL, S. ET AL.: "In Vitro Affinity Maturation Of Human GM-CSF Antibodies By Targeted CDR-Diversification", MOL. IMMUNOL., vol. 46, no. 1, 2008, pages 135 - 144
STUDNICKA ET AL., PROTEIN ENGINEERING, vol. 7, 1994, pages 805
STUDNICKA ET AL., PROTEIN ENGINEERING, vol. 7, no. 6, 1994, pages 805 - 814
SWANN ET AL., CUR. OPIN. IMMUN.,, vol. 20, 2008, pages 493 - 499
SWANN, P.G.: "Considerations For The Development Of Therapeutic Monoclonal Antibodies", CURR. OPIN. IMMUN., vol. 20, 2008, pages 493 - 499
TAN ET AL., J. IMMUNOL., vol. 169, 2002, pages 1119 - 1125
TAN ET AL., J. IMMUNOL., vol. 169, 2002, pages 1119 - 25
TAO, M.H. ET AL.: "Studies Of Aglycosylated Chimeric Mouse-Human IgG. Role Of Carbohydrate In The Structure And Effector Functions Mediated By The Human IgG Constant Region", J. IMMUNOL., vol. 143, no. 8, 1989, pages 2595 - 2601
THORPE ET AL.: "MONOCLONAL ANTIBODIES '84: BIOLOGICAL AND CLINICAL APPLICATIONS", 1985, article "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", pages: 475 - 506
THORPE ET AL.: "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", IMMUNOL. REV., vol. 62, 1982, pages 119 - 158
TORCHILIN ET AL., J. LIPOSOME RES., vol. 6, 1996, pages 99 - 116
VIGLIETTA, V. ET AL.: "Modulating Co-Stimulation", NEUROTHERAPEUTICS, vol. 4, 2007, pages 666 - 675
VINGERHOEADS ET AL., IMMUNOMETHODS, vol. 4, 1994, pages 259 - 72
VOLK, A. ET AL.: "Comparison Of Three Humanized Mouse Models For Adoptive T Cell Transfer", J. GENE MED., vol. 14, no. 8, 2012, pages 540 - 548
WALDRON-LYNCH, F. ET AL.: "Analysis Of Human Biologics With A Mouse Skin Transplant Model In Humanized Mice", AMER. J. TRANSPLANT., vol. 12, no. 10, 17 August 2012 (2012-08-17), pages 2652 - 2662
WALLICK, S.C. ET AL.: "Glycosylation Of A VH Residue Of A Monoclonal Antibody Against Alpha (1----6) Dextran Increases Its Affinity For Antigen", J. EXP. MED., vol. 168, no. 3, 1988, pages 1099 - 1109
WALLMANN, J. ET AL.: "Anti-Ids in Allergy: Timeliness of a Classic Concept", WORLD ALLERGY ORGANIZ. J., vol. 3, no. 6, 2010, pages 195 - 201
WANG, L. ET AL.: "VISTA, A Novel Mouse Ig Superfamily Ligand That Negatively Regulates T Cell Responses", J. EXP. MED., 7 March 2011 (2011-03-07)
WANG, S. ET AL.: "Co-Signaling Molecules Of The B7-CD28 Family In Positive And Negative Regulation Of T Lymphocyte Responses", MICROBES INFECT., vol. 6, 2004, pages 759 - 766
WILSON, I.A. ET AL.: "The Structure Of An Antigenic Determinant In A Protein", CELL, vol. 37, 1984, pages 767 - 778
WU, H. ET AL.: "Stepwise In Vitro Affinity Maturation Of Vitaxin, An Alphav Beta3-Specific Humanized Mab", PROC. NATL. ACAD. SCI. (USA, vol. 95, no. 11, 1998, pages 6037 - 6042
WU; WU, J. BIOL. CHEM., vol. 262, 1987, pages 4429 - 4432
YELTON, D.E. ET AL.: "Affinity Maturation Of The BR96 Anti-Carcinoma Antibody By Codon-Based Mutagenesis", J. IMMUNOL., vol. 155, 1995, pages 1994 - 2004
ZANG, X. ET AL.: "B7x: A Widely Expressed B7 Family Member That Inhibits T Cell Activation", PROC. NATL. ACAD. SCI. (USA, vol. 100, 2003, pages 10388 - 10392
ZANG, Y.C. ET AL.: "Human Anti-Idiotypic T Cells Induced By TCR Peptides Corresponding To A Common CDR3 Sequence Motif In Myelin Basic Protein-Reactive T Cells", INT. IMMUNOL., vol. 15, no. 9, 2003, pages 1073 - 1080
ZOU, W. ET AL.: "Inhibitory B7-Family Molecules In The Tumour Microenvironment", NAT. REV. IMMUNOL., vol. 8, 2008, pages 467 - 477

Cited By (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
US12071473B2 (en) 2010-03-26 2024-08-27 The Trustees Of Darmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
US10259849B2 (en) 2011-11-03 2019-04-16 The Trustees Of The University Of Pennsylvania Isolated B7-H4 specific compositions and methods of use thereof
US9422351B2 (en) 2011-11-03 2016-08-23 The Trustees Of The University Of Pennsylvania Isolated B7-H4 specific compositions and methods of use thereof
US9279008B2 (en) 2011-11-03 2016-03-08 The Trustees Of The University Of Pennsylvania Isolated B7-H4 specific compositions and methods of use thereof
US10961288B2 (en) 2011-11-03 2021-03-30 The Trustees Of The University Of Pennsylvania Isolated B7-H4 specific compositions and methods of use thereof
US11752189B2 (en) 2012-06-22 2023-09-12 The Trustees Of Dartmouth College Vista antagonist and methods of use
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US12064463B2 (en) 2012-06-22 2024-08-20 King's College London Vista antagonist and methods of use
US12162928B2 (en) 2012-06-22 2024-12-10 The Trustees Of Dartmouth College VISTA-Ig constructs and the use of VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
US11529416B2 (en) 2012-09-07 2022-12-20 Kings College London Vista modulators for diagnosis and treatment of cancer
EP3552628A1 (en) * 2012-09-07 2019-10-16 The Trustees Of Dartmouth College Vista modulators for diagnosis and treatment of cancer
EP2892558A4 (en) * 2012-09-07 2016-04-20 Dartmouth College VISTA MODULATORS FOR THE DIAGNOSIS AND TREATMENT OF CANCER
US10273301B2 (en) 2013-12-24 2019-04-30 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US12441801B2 (en) 2013-12-24 2025-10-14 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments, uses thereof, and methods of identifying same
US12516122B2 (en) 2013-12-24 2026-01-06 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
US11242392B2 (en) 2013-12-24 2022-02-08 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
US12188938B2 (en) 2015-06-24 2025-01-07 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
WO2017069291A1 (en) 2015-10-23 2017-04-27 Canbas Co., Ltd. Peptides and peptidomimetics in combination with t cell activating and/or checkpoint inhibiting agents for cancer treatment
US11987630B2 (en) 2016-02-12 2024-05-21 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
US11649283B2 (en) 2016-04-15 2023-05-16 Immunext, Inc. Anti-human vista antibodies and use thereof
US12139532B2 (en) 2016-04-15 2024-11-12 Immunext, Inc. Anti-human vista antibodies and use thereof
US11603402B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11603403B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
WO2017220990A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 antibodies
WO2017220989A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 and il-2 cytokines
WO2017220988A1 (en) 2016-06-20 2017-12-28 Kymab Limited Multispecific antibodies for immuno-oncology
WO2018098352A2 (en) 2016-11-22 2018-05-31 Jun Oishi Targeting kras induced immune checkpoint expression
US11306150B2 (en) 2017-01-11 2022-04-19 Bristol-Myers Squibb Company Method of identifying a P-selectin glycoprotein ligand-1 (PSGL-1) antagonist
JP2020509756A (ja) * 2017-03-14 2020-04-02 ファイヴ プライム セラピューティクス インク 酸性pHでVISTAに結合する抗体
IL269240B1 (en) * 2017-03-14 2026-04-01 Five Prime Therapeutics Inc Antibodies that bind to VISTA at acidic pH
JP7211961B2 (ja) 2017-03-14 2023-01-24 ファイヴ プライム セラピューティクス インク 酸性pHでVISTAに結合する抗体
US11603406B2 (en) 2017-03-14 2023-03-14 Five Prime Therapeutics, Inc. Antibodies binding to VISTA at acidic pH
JP2025023919A (ja) * 2017-03-14 2025-02-19 ファイヴ プライム セラピューティクス インク 酸性pHでVISTAに結合する抗体
KR102715540B1 (ko) * 2017-03-14 2024-10-08 파이브 프라임 테라퓨틱스, 인크. 산성 pH에서 VISTA에 결합하는 항체
US12195535B2 (en) 2017-03-14 2025-01-14 Five Prime Therapeutics, Inc. Antibodies binding to VISTA at acidic pH
CN110740749A (zh) * 2017-03-14 2020-01-31 戊瑞治疗有限公司 在酸性pH下与VISTA结合的抗体
EP3595720A4 (en) * 2017-03-14 2021-05-26 Five Prime Therapeutics, Inc. ANTIBODIES BINDING VISTA AT ACIDIC PH VALUE
KR20190128198A (ko) * 2017-03-14 2019-11-15 파이브 프라임 테라퓨틱스, 인크. 산성 pH에서 VISTA에 결합하는 항체
US11407833B2 (en) 2017-10-20 2022-08-09 Pharmabcine Inc. Anti-VISTA antibody and use thereof
RU2750723C1 (ru) * 2017-10-20 2021-07-01 Фармабцин Инк. Антитела против vista и их применение
JP2024050577A (ja) * 2018-03-21 2024-04-10 ファイヴ プライム セラピューティクス インク 酸性pHでVISTAに結合する抗体
US12173069B2 (en) 2018-03-21 2024-12-24 Five Prime Therapeutics, Inc. Antibodies binding to vista at acidic pH
JP2021518133A (ja) * 2018-03-21 2021-08-02 ファイブ プライム セラピューティクス, インコーポレイテッド 酸性pHでVISTAに結合する抗体
US12103972B2 (en) 2018-04-06 2024-10-01 Dana-Farber Cancer Institute, Inc. KIR3DL3 as an HHLA2 receptor, anti-HHLA2 antibodies, and uses thereof
WO2019241730A2 (en) 2018-06-15 2019-12-19 Flagship Pioneering Innovations V, Inc. Increasing immune activity through modulation of postcellular signaling factors
US12091462B2 (en) 2018-07-11 2024-09-17 Five Prime Therapeutics, Inc. Antibodies binding to vista at acidic pH
US11873346B2 (en) 2018-09-07 2024-01-16 Hummingbird Bioscience Pte. Ltd. VISTA antigen-binding molecules
US10633456B1 (en) 2018-09-07 2020-04-28 Hummingbird Bioscience Holdings Pte. Ltd. Vista antigen-binding molecules
WO2020227159A2 (en) 2019-05-03 2020-11-12 Flagship Pioneering Innovations V, Inc. Methods of modulating immune activity
WO2021127217A1 (en) 2019-12-17 2021-06-24 Flagship Pioneering Innovations V, Inc. Combination anti-cancer therapies with inducers of iron-dependent cellular disassembly
WO2022006179A1 (en) 2020-06-29 2022-01-06 Flagship Pioneering Innovations V, Inc. Viruses engineered to promote thanotransmission and their use in treating cancer
WO2022212784A1 (en) 2021-03-31 2022-10-06 Flagship Pioneering Innovations V, Inc. Thanotransmission polypeptides and their use in treating cancer
WO2023278641A1 (en) 2021-06-29 2023-01-05 Flagship Pioneering Innovations V, Inc. Immune cells engineered to promote thanotransmission and uses thereof
WO2023138579A1 (zh) 2022-01-21 2023-07-27 和铂医药美国股份有限公司 抗b7-h7抗体或其抗原结合片段及制备方法和应用
WO2024077191A1 (en) 2022-10-05 2024-04-11 Flagship Pioneering Innovations V, Inc. Nucleic acid molecules encoding trif and additionalpolypeptides and their use in treating cancer
WO2024151687A1 (en) 2023-01-09 2024-07-18 Flagship Pioneering Innovations V, Inc. Genetic switches and their use in treating cancer

Also Published As

Publication number Publication date
US10316092B2 (en) 2019-06-11
CN106414489A (zh) 2017-02-15
AU2014268298A1 (en) 2016-01-21
SG11201509618QA (en) 2015-12-30
BR112015029395A2 (pt) 2017-09-19
JP6682426B2 (ja) 2020-04-15
US20160096891A1 (en) 2016-04-07
CA2913312A1 (en) 2014-11-27
MX2015016111A (es) 2016-10-26
MX376808B (es) 2025-03-07
AU2014268298B2 (en) 2019-01-17
SG10201709715RA (en) 2017-12-28
JP2016527187A (ja) 2016-09-08
KR20160129698A (ko) 2016-11-09
HK1232243A1 (zh) 2018-01-05
EP3004158A2 (en) 2016-04-13
WO2014190356A3 (en) 2015-04-23

Similar Documents

Publication Publication Date Title
AU2014268298B2 (en) Anti-B7-H5 antibodies and their uses
US9676854B2 (en) Anti-B7-H4 antibodies and their uses
AU2013361275B2 (en) Anti-human B7-H4 antibodies and their uses
US9205148B2 (en) Antibodies and other molecules that bind B7-H1 and PD-1
AU2017201231B2 (en) ANTI-H7CR Antibodies
HK1200493B (en) Anti-b7-h4 antibodies and their uses

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14732759

Country of ref document: EP

Kind code of ref document: A2

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2016515141

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2014732759

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2913312

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14893463

Country of ref document: US

Ref document number: MX/A/2015/016111

Country of ref document: MX

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015029395

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20157036610

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2014268298

Country of ref document: AU

Date of ref document: 20140527

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112015029395

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20151124