WO2014109696A1 - Procédé d'immortalisation de lymphocytes b et ses utilisations - Google Patents

Procédé d'immortalisation de lymphocytes b et ses utilisations Download PDF

Info

Publication number
WO2014109696A1
WO2014109696A1 PCT/SE2014/050012 SE2014050012W WO2014109696A1 WO 2014109696 A1 WO2014109696 A1 WO 2014109696A1 SE 2014050012 W SE2014050012 W SE 2014050012W WO 2014109696 A1 WO2014109696 A1 WO 2014109696A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
expression
cells
bcl
arf
Prior art date
Application number
PCT/SE2014/050012
Other languages
English (en)
Inventor
Alf Grandien
Kari HÖGSTRAND
Original Assignee
Alf Grandien
Högstrand Kari
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alf Grandien, Högstrand Kari filed Critical Alf Grandien
Publication of WO2014109696A1 publication Critical patent/WO2014109696A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4612—B-cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/462—Cellular immunotherapy characterized by the effect or the function of the cells
    • A61K39/4622—Antigen presenting cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4738—Cell cycle regulated proteins, e.g. cyclin, CDC, INK-CCR
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0635—B lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C12N2510/04—Immortalised cells

Definitions

  • the present invention relates to methods for immortalizing B cells, including methods for obtaining immunoglobulin-producing cells, and it further relates to methods for identification of drug targets as well as for testing of candidate medicinal products for treatment of B cell lymphomas and myelomas.
  • B cells with the properties of indefinite growth in vitro would be referred to as immortalized B cells.
  • Such immortalized B cells would be useful in order to isolate B cells expressing antibodies with desired specificities (that is antigen binding). When cloned, such cells would be considered as producing monoclonal antibodies.
  • the variable regions of rearranged immunoglobulin of such B cells could also be cloned and expressed in other production systems in order to obtain monoclonal antibodies.
  • Antibodies expressed by immortalized B cells would either be found on the surface of the immortalized B cells, intracellularly or secreted into the culture medium.
  • v/Yro-immortalized B cells may also grow as tumors upon inoculation into animals. Such tumor transformed B cells would be useful for studying the processes of tumor transformation and could also be used for screening and testing of compounds as well as other potential regimens of tumor treatment. B cells that could be immortalized/tumor transformed at various maturation stages could serve as models for example for B cell lymphomas and myelomas. Identification of other gene combinations resulting in pre/pro-B cell immortalization has been described previously [1].
  • Monoclonal antibodies constitute the basis for many diagnostic products and research reagents. More recently, monoclonal antibodies have also found use in methods of therapeutic treatment. At present, monoclonal antibodies are used for the treatment of certain autoimmune diseases, leukemia, lymphoma, breast cancer and colon cancer. A new generation of monoclonal antibodies is being developed, with the aim of treating a number of other illnesses, such as atherosclerosis, neurodegenerative diseases, viral infections and infections caused by bacteria resistant to antibiotics. However, the currently known methods of obtaining monoclonal antibodies in other species than mouse, rat, hamster and rabbit are inefficient. The first method for production of monoclonal antibodies, the hybridoma technology, was described by Kohler/Milstein in 1975 [2].
  • Hybridoma technology is a robust method for obtaining monoclonal antibodies from mouse[2], rat[3], hamster[4], and recently also rabbit[5] but has so far shown limited success using human B cells[6][7]. Due to the low fusion frequency and limited stability of the obtained hybridomas it is likely that biases concerning antibody specificities may be introduced during isolation of hybridomas.
  • Epstein-Barr virus (EBV) transformation has been used to obtain human monoclonal antibodies (see e.g. patent publication WO2004076677 A2 and refs: [8] [9]) but is characterized by rather low frequencies of B cell transformation, stability problems and a low rate of immunoglobulin production. EBV transformation has also been used to obtain monoclonal antibodies from other primates than man[10].
  • Phage display technology is a method where rearranged immunoglobulin variable heavy- and light chain genes are isolated and expressed on the surface of phages[l 1].
  • Monoclonal antibodies with desired specificities can subsequently be obtained.
  • Rearranged immunoglobulin variable heavy- and light chain genes can also be obtained from purified B cells by single cell PCR and thereafter be expressed in desired cell types[12].
  • the patent application WO2007067046 Al and [13] describes a method for influencing the stability of an antibody-producing cell.
  • the method comprises directly or indirectly influencing the amount of BCL6 and/or BLIMP 1 (encoded by PRDMl) expression product within the antibody-producing cell, thereby extending its lifetime in vitro (up to at least one month).
  • the cell may further be modified by directly or indirectly increasing the amount of BCL-XL expression within the cell in order to allow for culture of cells at low density.
  • the method involves growing the genetically modified B cells in the presence of IL.-21 and CD40L- expressing L cells. Another possible method to isolate immunoglobulin producing B cells is based on conditional expression of an activated STAT5 [14].
  • the patent publication WO 03/089630 describes a method to obtain immortalized antibody- secreting cells from transgenic mice.
  • Cells are obtained from transgenic mice expressing thermolabile large tumor antigen (TAg) (and the small tumor antigen) from the SV40 thermosensitive A58 (tsA58) strain, double transgenic mice expressing inducible c-Myc (under Ecdysone control) and Ecdysone and RXR receptors, double transgenic mice expressing inducible abl (under Ecdysone control) and Ecdysone and RXR receptors, triple transgenic mice expressing inducible c-Myc and abl (under Ecdysone control) and Ecdysone and RXR receptors, double transgenic mice expressing inducible SV40 large T antigen (under Ecdysone control) and Ecdysone and RXR receptors or from quadruple transgenic mice expressing inducible c-Myc, abl and SV40 large T antigen (under Ec
  • the cells are then cultured in vitro either, in the situation of expression of SV40 large and small T antigens, at permissive temperature, or in the situation for the double, triple and quadruple transgenic mice, in the presence of the ecdysone analog ponasterone A.
  • This is thus a technically very demanding method requiring the construction of several transgenic animals and intercrossing between them.
  • WO 03/089630 it is claimed that under these conditions, spleen cells become immortalized and produce antibodies. No information of the efficiency of this process is however given. Neither is any information revealed concerning the molecular mechanisms for the described process. Most likely, a number of unknown additional genetic or epigenetic events are necessary in order for the immortalization process to occur.
  • An objective of the present invention is to overcome the above-mentioned problems related to previously known methods of immortalizing B cells and of producing monoclonal antibodies.
  • the present invention provides efficient and reliable methods for immortalizing B cells and for obtaining immunoglobulin-producing cells from B cells originating from a variety of species including man.
  • Of special interest is the isolation of antibodies from normal human individuals or from human individuals that have been exposed to various microorganisms or parasites.
  • Another objective of the present invention is to provide methods for testing of candidate medicinal products for treatment of tumors.
  • alteration of expression of gene products in combinations, affecting three defined intracellular processes, is sufficient for immortalization of normal B cells.
  • the alteration of expression of gene products may be achieved by transfecting, or by other means altering gene expression, in a B cell with three different genetic constructs, each construct carrying genetic properties affecting one defined intracellular process.
  • the skilled person understands that the three genetic constructs may be substituted for by one single genetic construct affecting all three defined intracellular processes.
  • This alteration in gene expression results in indefinite growth of the cells in vitro. When injected into immunodeficient recipient mice, the cells give rise to B cell lymphomas. Therefore, the immortalized cells can be considered as tumor transformed although the term "immortalized" will be used in this application.
  • the immortalized B cells express immunoglobulins, on the surface, intracellularly or secreted in the culture medium. Such cells producing antibodies can be used to isolate antibodies and corresponding rearranged immunoglobulin variable heavy- and light chain genes.
  • a fourth gene or group of genes in addition to the immortalizing genes described, also results in indefinite growth in vitro, and that the cells obtain some features of myeloma cells.
  • the expression of the fourth gene or group of genes may be achieved by transfecting, or by other means altering gene expression, in an already immortalized B cell, as described above, with a genetic construct affecting the expression of the fourth gene or group of genes.
  • a B cell may be transfected, or otherwise altered, with a single genetic construct affecting all four defined intracellular processes or genes or groups of genes.
  • the resulting myeloma-like immortalized cells produce soluble immunoglobulins that can be collected from the culture supernatant.
  • the immunoglobulin producing cells can be cloned in order to obtain monoclonal antibodies. Such cells producing antibodies can be used to isolate antibodies and corresponding rearranged immunoglobulin variable heavy- and light chain genes. When injected into immunodeficient recipient mice, the cells give rise to multiple myeloma-like disease.
  • immortalized/tumor transformed B cells obtained using the method described herein can be used for identification of targets for tumor treatment. They can also be used for testing of compounds or other treatment regimens both in vitro and in vivo, after injection into animals.
  • the present invention provides a method for immortalizing a B cell, comprising
  • the member of the Myc family is MYC, MYCL1 and/or MYCN.
  • inhibiting the tumor suppressive activity of INK4A/ARF or downstream targets thereof is, in one embodiment of the method, achieved by at least one of the following: expressing BMI1, expressing a dominant negative interfering p53 mutant gene, expressing Nanog, expressing Oct3/4, expressing MDM2, and shRNA mediated silencing of mRNA encoding ARF, pl6/ARF or p53.
  • the anti-apoptotic member of the Bcl-2 family is BCL-XL, MCL1, BCL-2, BCLW and/or BFL1.
  • the at least one pro-apoptotic member of the Bcl-2 family is BAX, BAK, BOK, BID, BFM, BAD, BMF, BIK, NOXA, and/or HRK.
  • the method comprises:
  • the origin of the B cell is vertebrate, such as from a rodent (e.g. mouse, rat or hamster) or a primate (e.g. human).
  • rodent e.g. mouse, rat or hamster
  • primate e.g. human
  • Other examples of vertebrates that would be suitable according to the invention are rabbit, hen, camel, lama, horse, cow, dog, cat, donkey, goat and sheep.
  • a further embodiment of the invention relates to an immortalized B cell obtainable by the above-described method.
  • an isolated B cell characterized by being immortalized by:
  • the member of the Myc family is MYC, MYCL1 and/or MYCN.
  • the inhibition of the tumor suppressive activity of INK4A/ARF or downstream targets thereof is, in one embodiment relating to the isolated B cell, achieved by at least one of the following: expression of BMI1, expression of a dominant negative interfering p53 mutant gene, expression of Nanog, expression of Oct3/4, expression of MDM2, and shRNA mediated silencing of mRNA encoding ARF, pl6/ARF or p53.
  • the anti-apoptotic member of the Bcl-2 family is BCL-XL, MCL1, BCL-2, BCLW and/or BFL1.
  • the at least one pro-apoptotic member of the Bcl-2 family is BAX, BAK, BOK, BID, BIM, BAD, BMF, BIK, NOXA, and/or HRK.
  • the isolated B cell is immortalized by:
  • the origin of the isolated B cell is vertebrate, such as from a rodent (e.g. mouse, rat or hamster) or a primate (e.g. human).
  • rodent e.g. mouse, rat or hamster
  • primate e.g. human
  • Other examples of vertebrates that would be suitable according to the invention are rabbit, hen, camel, lama, horse, cow, dog, cat, donkey, goat and sheep.
  • a method for potentiating the immunoglobulin production in the above-described immortalized B cell, and for obtaining an immunoglobulin-producing myeloma-like cell comprising immortalizing a B cell according to the above-described method, and further comprising expressing IRF4, XBPls, BLIMP 1, HRAS- V12, PRDM1, Stat3-C or activated RAS or combinations thereof, in said B cell.
  • a further embodiment of the invention relates to an isolated, immunoglobulin-producing B cell obtainable by the above-described method.
  • an isolated, immunoglobulin-producing B cell is provided, being immortalized by:
  • the present invention provides immunoglobulin-producing B cells as described above, which have the ability to produce one or several isotypes of immunoglobulins, such as IgG, IgM and/or IgA.
  • a further aspect of the present invention relates to a method for producing immunoglobulin molecules and/or isolating corresponding immunoglobulin encoding genetic material, comprising culturing an immunoglobulin-producing B cell as described above in a culture medium, and isolating immunoglobulin molecules from the culture medium and/or isolating corresponding immunoglobulin encoding genetic material from the B cell.
  • the present invention further provides an immunoglobulin molecule and/or corresponding immunoglobulin encoding genetic material, produced by an immunoglobulin-producing B cell or the method as described above.
  • the present invention also provides a method for in vitro testing of a candidate medicinal product for treatment of B cell lymphoma or B cell myeloma, comprising
  • a method for in vivo testing of a candidate medicinal product for treatment of B cell lymphoma or B cell myeloma comprising
  • gene product shall be construed as meaning a protein that is encoded by mRNA originating from a defined gene.
  • Down regulation of a gene can be obtained through expression of shRNA, siRNA or miRNA targeting a particular gene. Downregulation can also be obtained through deletion of genetic material affecting the expression of a particular gene. Also, the functionality of a particular protein can be affected through expression of dominant interfering mutant or synthetic versions of the protein.
  • Referral to a gene name used for a certain species, such as human MYC, shall be construed as encompassing referral to the corresponding homologous gene or gene product originating from any species and any functional, synthetic and/or mutated variants, derivatives or analogues thereof, i.e. variants which provide the similar functions as the natural/wild-type gene and which could be used to replace the natural gene.
  • normal/resting/activated B cell shall be construed as meaning B cells of various activation stages, isolated from animals including humans. Such cells can subsequently be stimulated in vitro using antigens, mitogens, cytokines, growth factors, binding to cell surface receptors or combinations of these.
  • B cell lymphoma shall be construed as meaning an immortalized B cell with immature to mature phenotype, with the ability to grow and expand in vitro and/or in an animal with a predominant location in lymph nodes and in lymphoid tissues.
  • myeloma or “myeloma-like” cell shall be construed as meaning a cell with plasmablast- or plasma cell-like phenotype able to grow in vitro and/or expand in animals after injection.
  • the term "downstream target of MYC” should be understood as a direct transcriptional target of the transcription factor MYC, MYCL1 and/or MYCN.
  • the term “downstream target of p53” should be understood as a direct transcriptional target of the transcription factor p53.
  • downstream target of BMH should be understood as inhibition or activation of INK4A/ARF, over expression or activation of MDM2, or inhibition or inactivation of p53 and/or retinoblastoma protein or gene.
  • the present invention discloses a method for immortalizing a B cell.
  • the B cell used is a B cell with rearranged immunoglobulin variable heavy and light chain genes.
  • the B cell may be in a resting or activated state in different stages of differentiation such as mature resting B cell, memory B cell, plasmablast, plasma cell or intermediate differentiation stages.
  • the B cell can belong to various sublineages of B cells such as B l, B2 or marginal zone B cells.
  • the B cell can be isolated from various tissues, such as lymph nodes, spleen, bone marrow, thymus, or other types of organized lymphoid tissue as well as from blood or other fluids or tissues containing B cells.
  • the B cell may be stimulated in vitro with mitogens (such as poke weed mitogen, Toll like receptor (TLR) ligands, e.g. lipopolysaccharide, CpG DNA or others)), antigens, T cells or components from these, B cell receptor-stimulation, CD40 stimulation or through addition of cytokines or growth factors or combinations of these.
  • mitogens such as poke weed mitogen, Toll like receptor (TLR) ligands, e.g. lipopolysaccharide, CpG DNA or others
  • TLR Toll like receptor
  • CD40 stimulation or through addition of cytokines or growth factors or combinations of these.
  • immortalization of B cells occurs through simultaneous modification of three intracellular pathways/functions, 1; Induction/enhancement of MYC activity, 2; Inhibition of INK4A/ARF activity and 3; Inhibition of apoptosis (for example through expression of BCL- XL); and can be obtained through expression or down regulation of these, or of genes regulating these pathways, as well as through addition of proteins or compounds able to interact with gene products in these pathways/functions.
  • Expression of a member of the MYC family may be obtained by providing the B cell with a compound capable of directly or indirectly enhancing MYC expression or MYC protein function, or by culturing the B cell in the presence of a compound capable of directly or indirectly enhancing MYC expression or activity.
  • said compound capable of enhancing MYC expression or activity may be a nucleic acid sequence encoding a member of the MYC family.
  • the method for immortalizing a B cell comprises expressing a downstream target of a member of the MYC family or a cellular signal leading to the expression of a member of the MYC family. In mammals, there are three known members of the MYC family; c-Myc, L-Myc and N-Myc.
  • the INK4A/ARF (CDKN2A) locus encodes pl6 and ARF [15].
  • p 16 and ARF have the ability to induce cellular growth arrest, senescence and apoptosis through binding to CDK4 and CDK6 and inhibiting their phosphorylation of retinoblastoma protein (Rb) family members [15] [16].
  • the ARF protein inhibits the protein MDM2 (Mdm2 p53 binding protein homolog) that normally participates in degrading p53 (TP53 - tumor protein p53) leading to increased p53 level/activity ([17]), in turn inducing growth arrest and/or apotosis.
  • the BMI1 gene encodes a protein which down-regulates expression of ARF and pl6 from the INK4A/ARF locus.
  • expression of BMI1 is equivalent to down-regulation of ARF and pi 6, which is predicted to be similar to up-regulation and/or activation of MDM2, which is equivalent to down-regulation of p53 or interference with the function of p53.
  • pl6/Arf e.g.
  • Cited2 [20]
  • members of the Poly comb complex 1 and 2 [21]
  • the trithorax member MLL1 [21]
  • CDC6 [22]
  • Twist [23]
  • CBX7 [24]
  • Tbx2/3 [25] [26]
  • viral genes able to directly or indirectly interfere with the function of p53 and/or Rb such as SV40 large T antigen ([27]) are expected to be able to replace BMI1 expression in the process of B cell immortalization.
  • Inhibition of INK4A/ARF and/or p53 may be obtained by providing the B cell with a compound capable of directly or indirectly inhibiting INK4A/ARF and/or p53 expression or INK4A/ARF and/or p53 protein function, or by culturing the B cell in the presence of a compound capable of directly or indirectly inhibiting INK4A/ARF and/or p53 expression or activity.
  • said compound capable of inhibiting INK4A/ARF and/or p53 expression or activity may be a nucleic acid sequence inhibiting INK4A/ARF and/or p53 expression.
  • the method for immortalizing a B cell comprises expressing a downstream target of INK4A/ARF and/or p53, or a cellular signal leading to the inhibition of INK4A/ARF and/or p53.
  • inhibiting INK4A/ARF and/or p53 function is achieved by at least one of the following: expressing BMI1, shRNA mediated silencing of mRNA encoding ARF, pl6/ARF, INK4a or p53, expressing a dominant negative interfering p53 mutant gene, expressing Nanog, expressing Oct3/4, and expressing or activating MDM2.
  • Inhibition of apoptosis can be obtained through expression of BCL-XL (long splice form encoded by the BCL2L1 gene) that is an anti-apoptotic member of the Bcl-2 family.
  • BCL-XL long splice form encoded by the BCL2L1 gene
  • MCL1 can substitute for BCL-XL expression.
  • other anti-apoptotic members of the Bcl-2 family such as BCL-2, BCLW, and BFLl
  • Bcl-2 family such as BAX, BAK, BOK, BID, BIM, BAD, BMF, BIK, NOXA, and HRK
  • pro-apoptotic members of the Bcl-2 family such as BAX, BAK, BOK, BID, BIM, BAD, BMF, BIK, NOXA, and HRK
  • Inhibition of apoptosis may be obtained by providing a B cell with a compound capable of directly or indirectly enhancing expression or protein function of an anti-apoptotic member of the Bcl-2 family and/or a compound capable of directly or indirectly down-regulating the expression or activity of pro-apoptotic members of the Bcl-2 family or corresponding protein function, or by culturing the B cell in the presence of a compound capable of directly or indirectly enhancing expression or activity of an anti-apoptotic member of the Bcl-2 family and/or by culturing the B cell in the presence of a compound capable of directly or indirectly down-regulating the expression or activity of pro-apoptotic members of the Bcl-2 family.
  • said compound capable of enhancing expression or activity of an anti-apoptotic member of the Bcl-2 family may be a nucleic acid sequence encoding an anti-apoptotic member of the Bcl-2 family.
  • the method for immortalizing a B cell comprises expressing a downstream target of an anti-apoptotic member of the Bcl-2 family or a cellular signal leading to the expression of an anti-apoptotic member of the Bcl-2 family.
  • said compound capable of down-regulating the expression or activity of pro- apoptotic members of the Bcl-2 family may be a nucleic acid sequence down-regulating a pro- apoptotic member of the Bcl-2 family.
  • the method for immortalizing a B cell comprises expressing a downstream target of a pro-apoptotic member of the Bcl-2 family or a cellular signal leading to the down regulation of one or several pro-apoptotic member of the Bcl-2 family.
  • the immortalized B cells obtained by the above-described immortalization method have the phenotype of a lymphoma cell, meaning surface expression of CD 19, CD45R and with variable levels of surface B cell receptor (BCR) expression.
  • the cells produce soluble immunoglobulin.
  • the present invention further discloses a method for potentiating immunoglobulin production and obtaining myeloma-like cells producing soluble immunoglobulin.
  • the B cell used is a B cell with rearranged immunoglobulin variable heavy and light chain genes.
  • the B cell may be in a resting or activated state in different stages of differentiation such as mature resting B cell, memory B cell, plasmablast, plasma cell or intermediate differentiation stages.
  • the B cell can belong to various sublineages of B cells such as B l, B2 or marginal zone B cells.
  • the B cell can be isolated from various tissues, such as lymph nodes, spleen, bone marrow, thymus, or other types of organized lymphoid tissue as well as from blood or other fluids or tissues containing B cells.
  • the B cell may be stimulated in vitro with mitogens (such as poke weed mitogen, TLR ligands, e.g. lipopolysaccharide, CpG ODN or others), antigens, T cells or components from these, BcR-stimulation, CD40 stimulation or through addition of cytokines or growth factors or combinations of these.
  • mitogens such as poke weed mitogen, TLR ligands, e.g. lipopolysaccharide, CpG ODN or others
  • antigens such as poke weed mitogen, TLR ligands, e.g. lipopolysaccharide, CpG ODN or others
  • BcR-stimulation e.g. lipopolysaccharide, CpG ODN or others
  • Myeloma-like cells are obtained through interference with the three intracellular pathways described above (through expression of MYC, BCL-XL and BMI or other genes specified above) in addition with expression of IRF4 (Interferon regulatory factor 4).
  • the immortalized myeloma-like cells obtained by the above-described immortalization method in combination with IRF4 have the phenotype of a myeloma cell, meaning low surface expression of CD 19, CD45R and surface BCR expression and intermediate to high levels of CD138 expression.
  • the myeloma-like cells are furthermore characterized by their ability to secrete low to high levels of immunoglobulins.
  • IRF4 can be substituted for by, or co expressed with, XBPls (X-box binding protein 1 short splice form [28], BLIMP 1 (PRDM1 - PR domain containing 1, with ZNF domain), mutated HRAS-V12 (v-Ha-ras Harvey rat sarcoma viral oncogene homolog) or an activated Stat3 (Stat3-C - signal transducer and activator of transcription 3 (acute-phase response factor)) [29] or combinations thereof.
  • XBPls X-box binding protein 1 short splice form [28]
  • BLIMP 1 PRDM1 - PR domain containing 1, with ZNF domain
  • mutated HRAS-V12 v-Ha-ras Harvey rat sarcoma viral oncogene homolog
  • an activated Stat3 Stat3-C - signal transducer and activator of transcription 3 (acute-phase response factor)
  • monoclonal antibodies directly from a variety of species, including human. Consequently, such cells, after cloning, secrete monoclonal antibodies that may be used as pharmaceuticals, research or diagnostic reagents in different species.
  • the cells may also be used for isolation of rearranged immunoglobulin variable genes (or gene products) encoding antibodies with particular qualities and be expressed in other types of expression systems including prokaryotic and eukaryotic cells.
  • monoclonal antibodies having a variety of specificities can be obtained.
  • This method may thus replace hybridoma technology for generating monoclonal antibodies from mouse, rat, hamster or rabbit and also be used to obtain monoclonal antibodies from a variety of other species.
  • the method according to the present invention may be superior as it combines a high success rate, good representation of the expressed antibody repertoire and a high rate of immunoglobulin production.
  • Monoclonal antibodies from a variety of species are highly interesting for the development of diagnostic tests and as research reagents. In the future, it is likely that methods to humanize monoclonal antibodies from various species (other than mouse, such as rat, hamster and rabbit), will be developed, opening for use of monoclonal antibodies from other species as therapeutic antibodies for treatment of human diseases.
  • An important advantage of antibody production in species evolutionary distant from human is that monoclonal antibodies against antigens conserved between human, mouse, rat and/or hamster, can be obtained.
  • Another use of the present invention involves testing of candidate medicinal products for treatment of B cell lymphoma or B cell myeloma.
  • the B cells used may consist of lymphoma cells, myeloma cells and/or cells in various differentiation stages between lymphoma cells and myeloma cells.
  • the non-human animal in which a plurality of B cells are introduced, may for example be a mouse, rat, hamster, rabbit, hen, camel, lama, horse, cow, dog, cat, donkey, goat or sheep.
  • the injected cells result in B cell lymphomas and multiple myeloma- like disease, respectively.
  • the animals may be used as in vivo models for studying different treatment strategies.
  • mice Female age-matched (5-8 weeks) C57BL/6, BALB/c or C3H/HeN were obtained and bred at the Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet animal facility. Human cells. Human lymphocytes were obtained from tonsils and peripheral blood. Rabbit cells. Rabbit mononuclear cells were obtained from spleens of rabbits. All procedures were performed with relevant ethical permission according to local and national guidelines.
  • the pMSCV-IRES-GFP was obtained from Prof Arthur Nienhuis [31].
  • the pMSCV-IRES-YFP vector was produced as described previously ([32]).
  • Construction of pMSCV-IRES-GFPZeoR EGFP was amplified from MSCV-IRES-GFP with junction markers for ZeoR in 3'; forward primer EGFP-NcoI-upper; AATACCATGGTGAGCAAGGG and reverse primer EGFPZeo-lower; GGCACTGGTCAACTTGGCGTCCATGCCGAGAGTGATC.
  • ZeoR containing junction marker in 5' was amplified by PCR from pTracer-SV40 (Invitrogen); forward primer EGFPZeo-upper; GATC ACTCTCGGC ATGGACGCC AAGTTGACC AGTGCC and reverse primer Zeo-Notl-lower; ATAAGCGGCCGCTCAGTCCTGCTCCTCGG. Then, EGFP and ZeoR fragments were mixed together in a PCR reaction using forward primer EGFP- Ncol-upper; AATACCATGGTGAGCAAGGG and reverse primer Zeo-Notl-lower; ATAAGCGGCCGCTCAGTCCTGCTCCTCGG. followed by ligation into pMSCV-IRES-GFP, previously cleaved with Notl and Ncol to remove EGFP.
  • the pMSCV-BCL-XL-IRES-GFP was obtained by subcloning of an EcoRI fragment containing human BCL-XL from the pLXIN-BCL-XL expression vector ([33]).
  • Myc was isolated by PCR from cDNA from muscle cells from the Human Multiple Tissue cDNA (MTC) Panel 1 (Clontech) using the primers; ACGTGAATTCCACCATGCCCCTCAACGTTAGCTTC and TACGTCTCGAGCTTACGCACAAGAGTTCCGTAG followed by ligation into the EcoRI and Xhol sites of pMSCV-IRES-YFP to obtain the pMSCV-Myc-IRES-YFP expression vector.
  • a dominant negative p53 construct (p53DD) was obtained from M. Oren ([19]), and subcloned using EcoRI into pMSCV-IRES-YFP, generating pMSCV-p53DD-IRES-YFP.
  • BMI1 was obtained from MGC (accession nr: BCOl 1652) and PCR amplified using primers;
  • pTOPO-MCLl [34] was obtained from Addgene (Addgene plasmid 21605) and human MCL1 was PCR amplified using primers; ACTGTGAATTCACCACCATGTTTGGCCTCAAAAGAAACGCG and TGCAGTCGACCTATCTTATTAGATATGCCAAACCAGCTCC followed by ligation into the EcoRI/XhoI site of pMSCV-IRES-GFPZeoR, generating pMSCV-MCLl-IRES- GFPZeoR.
  • LMP-sh-mouse ARF, LMP-sh-mouse pi 6/ ARF, pRetro Super- ARF and pRetroSuper- INK4a were obtained from Prof Manuel Serrano, Spanish National Research Center. Human IRF4 was amplified from cDNA clone MGC:23069 FMAGE:4861223 using
  • pMXs-Stat3-C [29] was obtained from Prof Shinya Yamanaka through Addgene (Addgene plasmid 13373).
  • HRAS-V12 was amplified from pBabe-Bleo-Ras (obtained from Prof Lars- Gunnar Larsson, Karolinska Institutet) using
  • BLFMP1 was amplified from Human MGC Verified FL cDNA (IRCM) Clone Id: 40001920 using ACGTGAATTCACCACCATGGAAAAGATCTATTCCAG and
  • TACGGTCGACTTAAGGATCCATTGGTTCAAC followed by ligation into the pMSCV- IRES-GFPZeoR, generating pMSCV-BLIMPl-IRES-GFPZeoR.
  • XBPls was provided by Dr. Laurie Glimcher and amplified using
  • p Xs-Nanog [29] was obtained from Prof Shinya Yamanaka through Addgene (Addgene plasmid 13354).
  • pMXs-Oct3/4 [29] was obtained from Prof Shinya Yamanaka through Addgene (Addgene plasmid 13366).
  • a retroviral expression plasmid SF91 ECATeGFP, encoding mCAT fused to GFP was a kind gift of Dr Axel Schambach, Hannover.
  • Retroviral particles were obtained by transient transfection of Phoenix-Eco packaging cells using Lipofectamine 2000 (Invitrogen) or in the case of SF91 -ECATeGFP, retroviral particles were obtained by transfection of the GALV envelope packaging cell line PG13 for transduction of human cells and packaged with Phoenix- Ampho cells for transduction of rabbit cells. Retroviral particles were concentrated through centrifugation at 6000 x g over night at +4°C.
  • Murine splenic B cells were prepared and stimulated with 25 igj ⁇ of LPS (Sigma), 2.5 igj ⁇ R848 (InvivoGen, San Diego, USA) or 5 ⁇ g/ml of mAb anti-mouse CD40 (clone FGK45 - a kind gift from Jan Andersson, Basel) in RPMI medium with supplements. Retroviral transduction of stimulated spleen cells was performed at day 2 and 3 after stimulation using spin infection in the presence of 6 ⁇ g/ml of polybren (Sigma, St. Louis, MO, USA). Human B cells were stimulated using L-cells expressing human CD40L with or without recombinant human IL-21 (ImmunoTools GmbH).
  • Rabbit B cells were stimulated using poke weed mitogen (Sigma). Human and rabbit cells were transduced with SF91 -ECATeGFP, retroviral particles at day 2 post stimulation followed by transduction with ecotropic viruses at day 4 and 5. Cells were replated in culture medium without stimuli at day 6 and growth followed by daily visual inspection up to 4 weeks after stimulation of the cells. In some experiments, cell numbers were determined by cell counting with a Biirker chamber using trypan blue exclusion, and expression of fluorescent reporter proteins was followed by flow cytometry.
  • LPS lipopolysaccharide
  • BMI expression negatively regulates the INK4/ARF locus, thus leading to decreased levels of pl6 and Arf Therefore it was tested if inhibition of pl6/Arf, using retrovirally encoded shRNA, could substitute for expression of BMI1, in conjunction with MYC and BCL-XL expression, during B cell immortalization. This was indeed the case, and B cells transduced with this combination of genetic constructs (Table 1, combination 2) could be kept in culture for extended periods of time (several months and more). Expression of MYC and BCL-XL in conjunction with retrovirally encoded shRNA targeting Arf also resulted in immortalization of normal B cells (Table 1, combination 3).
  • ARF has been reported to bind to MDM2, inhibiting ubiquitination of p53 and thereby leading to stabilization of p53[35]. It was therefore tested if expression of a dominant negative p53 (p53DD - [19]) in combination with expression of MYC and BCL-XL, could substitute for BMI1, shRNA targeting pl6/ARF or shRNA targeting Arf, during immortalization of B-cells. As shown in Table 1, combination 5, expression of p53DD together with expression of MYC and BCL-XL, resulted in immortalization of normal B cells.
  • MYC, BCL-XL and BMI1 in B cells from different mouse strains (C57BL/6, BALB/c and C3H/Hen) using different modes of stimulation (LPS, R848 or CD40 stimulation) resulted in immortalization in vitro.
  • the phenotype of the immortalized cells was CD45R + , CD19 + , CD138 10 with variable amounts of surface IgM.
  • mice When injected into sublethally irradiated recipient mice, the cells (from gene combination 1, 3 and 5) rapidly gave rise to lymphomas in all lymphoid organs analyzed (Table 4). Secondary tumor cell lines could readily be established from various organs of the mice. Immunohistochemical analysis revealed destruction of lymphoid structures due to massive amounts of tumor cells. Immunohistochemical analysis indicated that tumor cells were CD45 10 , CD 138 " and Pax5 + . These results indicated that mice injected with these B cell tumor cells, developed aggressive B-cell lymphomas.
  • IRF4 is a critical regulator of plasma cell development and is expressed at high levels in such cells [37]. Therefore, it was tested if expression of IRF4 together with the gene combinations described in the previous section, able to immortalize and tumor transform B cells, would result in formation of myeloma cells (tumor transformed plasma cells or plasmablasts). Normal B cells were stimulated with LPS and transduced with combinations of retroviruses as indicated in Table 5.
  • IRF4 containing combinations resulted in immortalization of normal B cells (Table 5; combination 11 : IRF4 + MYC + BCL-XL + BMI1, combination 12: IRF4 + MYC + BCL-XL + shRNA targeting pl6/Arf, combination 13 : IRF4 + MYC + BCL-XL + shRNA targeting Arf, and combination 15: IRF4 + MYC + BCL-XL + p53DD).
  • IRF4 expression the phenotype of the resulting tumor cells was drastically different as compared to immortalized B cells without IRF4 (e.g. combinations 1, 2, 3, 5, 7, 8, 9 and 10 in Tables 1-3 and 5).
  • mice obtained from combination 11 (expressing IRF4 + MYC + BCL-XL and BMI1) were injected into sublethally irradiated recipient mice. At day 27-32, mice were moribund or dead. No signs of splenomegaly or lymphadenopathy were seen. The injected tumor cells were found predominantly in the bone marrow of the recipient animals but at later time points also in spleen (Table 6). Immunohistochemical analysis indicated that tumor cells were CD45R " , Pax5 " and CD138 + . Several of the mice injected with cells over-expressing IRF4, MYC, BCL-XL and BMI1 developed fractures in hind or back legs. X-ray analysis indicated bone destruction. Taken together, mice injected with cells expressing IRF4, MYC, BCL-XL and BMI1 developed a multiple myeloma-like disease.
  • XBPls X-box binding protein 1 short splice form
  • Mononuclear cells were obtained from spleens of normal rabbits and stimulated in vitro with PWM. At day 2, the cells were transduced with retroviral particles carrying mCAT making the cells receptive to subsequent transduction with ecotropic retroviral particles carrying indicated genes (Table 9). Immortalized rabbit B cells secreting IgM and IgG into the culture supernatant were obtained (Table 9).
  • Tbx2) and the polycomb group (PcG) genes (Cbx7, Mel 18) will be able to substitute for BMI1 expression during B cell transformation/immortalization. It is also possible that the relative importance of the effectors downstream of BMI1, such as pi 6, and ARF and their targets (p53 and Rb) in turn may show strain variations as has been discussed [15] [18] [27]. Expression of MYC together with inhibition of the tumor suppressive activities of the INK4a/Arf locus or downstream targets thereof is however not sufficient in order to obtain B cell immortalization.
  • apoptosis induction has to be blocked through expression of BCL-XL, MCL1 or other anti-apoptotic member of the Bcl- 2 family. Inhibition of intrinsic apoptosis induction could be obtained through expression of Bcl- XL or MCL1.
  • BCL-2, BCLW and BFLl anti-apoptotic members of the Bcl-2 family
  • BCL-2, BCLW and BFLl anti-apoptotic members of the Bcl-2 family
  • Other signals leading to expression of an anti-apoptotic member of the Bcl-2 family could substitute for expression of BCL-XL or MCL1.
  • signals or stimuli leading to down-regulation/inhibition of the activity of pro-apoptotic members of the Bcl-2 family would also be able to substitute for BCL-XL or MCL1 expression.
  • a method for mediating immortalization of normal B cells by use of certain specific gene products has been disclosed. Thereby, it is possible to identify the downstream gene products that are essential for the proliferation and survival of the immortalized cell. Consequently, the findings described herein could be useful for the identification of new drug targets and medicinal products for the treatment of lymphomas and multiple myeloma and possibly other tumors as well. Further, a method for obtaining immunoglobulin-producing myeloma like-cells from normal B cells from mouse, rabbit and man has been disclosed, which is very useful for the production of monoclonal antibodies from a variety of species including mouse, rabbit and man.
  • IgM cone IgM concentration in culture supernatant ⁇ g/ml).
  • Sh short hairpin RNA.
  • Immort immortalization
  • sig surface immunoglobulin.
  • # gene combination.
  • LN lymph node.
  • BM bone marrow.
  • Sh short hairpin RNA.
  • Immort immortalization
  • sig surface immunoglobulin
  • na not analyzed. * indicates that there are two populations, one sig positive and the other sig negative.
  • IgM cone IgM concentration in culture supernatant ⁇ g/ml).
  • LN lymph node.
  • BM bone marrow.
  • CD138 lo+hl indicates that there are two populations of cells; one CD138 10 and one CD138 hi .
  • gM cone IgM concentration in culture supernatant ⁇ g/ml).
  • Sh short hairpin RNA.
  • na not analyzed.
  • IgM cone IgM concentration in culture supernatant ⁇ g/ml).
  • IgG cone IgG concentration in supernatant ⁇ g/ml).
  • IgA cone IgA concentration in supernatant ⁇ g/ml).
  • Sh short hairpin RNA.
  • na not analyzed.
  • IgM cone IgM concentration in culture supernatant ⁇ g/ml).
  • IgG cone IgG concentration in supernatant ⁇ g/ml).
  • # gene combination. M. Nakagawa, S. Tsuzuki, K. Honma, 0. Taguchi, and M. Seto, "Synergistic effect of Bcl2, Myc and Ccndl transforms mouse primary B cells into malignant cells.," Haematologica, vol. 96, no. 9, pp. 1318-1326, Sep. 2011.
  • synthase kinase-3 regulates mitochondrial outer membrane permeabilization and apoptosis by destabilization of MCL-1.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Wood Science & Technology (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Oncology (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des procédés pour l'immortalisation de lymphocytes B, comprenant des procédés d'obtention de cellules produisant une immunoglobuline, et concerne en outre des procédés d'identification de cibles de médicament, ainsi que le test de produits médicinaux candidats pour le traitement de lymphomes et de myélomes à cellules B. Le procédé d'immortalisation d'un lymphocyte B comprend l'expression d'un élément de la famille Myc, l'inhibition de l'activité de suppression de tumeur de INK4A/ARF ou de ses cibles en aval, et l'expression d'un élément anti-apoptotique de la famille Bcl-2 et/ou la régulation à la baisse de l'activité d'au moins un élément pro-apoptotique de la famille Bcl-2, dans un lymphocyte B in vitro. Pour potentialiser la production d'immunoglobuline dans le lymphocyte B immortalisé et pour obtenir une cellule de type myélome produisant une immunoglobuline, le procédé comprend en outre l'expression de IRF4, XBP1s, BLIMP1, HRAS-V12, PRDM1, Stat3-C ou RAS activé ou des combinaisons de ceux-ci dans le lymphocyte B.
PCT/SE2014/050012 2013-01-10 2014-01-09 Procédé d'immortalisation de lymphocytes b et ses utilisations WO2014109696A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361848740P 2013-01-10 2013-01-10
US61/848,740 2013-01-10

Publications (1)

Publication Number Publication Date
WO2014109696A1 true WO2014109696A1 (fr) 2014-07-17

Family

ID=51167225

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE2014/050012 WO2014109696A1 (fr) 2013-01-10 2014-01-09 Procédé d'immortalisation de lymphocytes b et ses utilisations

Country Status (1)

Country Link
WO (1) WO2014109696A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017500052A (ja) * 2013-12-24 2017-01-05 アイム・セラピューティクス・べー・フェー ｅｘ ｖｉｖｏの抗体生成
WO2017087810A1 (fr) * 2015-11-20 2017-05-26 Memorial Sloan-Kettering Cancer Center Procédé de criblage d'inhibiteurs ciblant des voies de survie anti-apoptotiques
US10975051B2 (en) 2015-08-12 2021-04-13 Memorial Sloan Kettering Cancer Center Phenylsulfonamido-benzofuran derivatives and uses thereof in the treatment of proliferative diseases
CN114752628A (zh) * 2022-05-30 2022-07-15 四川大学华西医院 C57bl/6小鼠多发性骨髓瘤模型的构建方法及应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1103615A1 (fr) * 1999-11-25 2001-05-30 Universite De Geneve Vecteurs capables d'immortaliser les cellules ne se divisant pas et les cellules immortalisées par ces vecteurs
WO2003089630A1 (fr) * 2002-04-17 2003-10-30 Granta Biotechnology Limited Procedes de production de cellules secretrices d'anticorps immortalisees
WO2012059223A1 (fr) * 2010-11-02 2012-05-10 Helmholtz-Zentrum für Infektionsforschung GmbH Procédés et vecteurs pour l'immortalisation de cellules
WO2012178150A2 (fr) * 2011-06-24 2012-12-27 Neoclone Biotechnology International, Llc Procédés de développement de lignées cellulaires produisant des anticorps spécifiques à un antigène et d'anticorps monoclonaux

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1103615A1 (fr) * 1999-11-25 2001-05-30 Universite De Geneve Vecteurs capables d'immortaliser les cellules ne se divisant pas et les cellules immortalisées par ces vecteurs
WO2003089630A1 (fr) * 2002-04-17 2003-10-30 Granta Biotechnology Limited Procedes de production de cellules secretrices d'anticorps immortalisees
WO2012059223A1 (fr) * 2010-11-02 2012-05-10 Helmholtz-Zentrum für Infektionsforschung GmbH Procédés et vecteurs pour l'immortalisation de cellules
WO2012178150A2 (fr) * 2011-06-24 2012-12-27 Neoclone Biotechnology International, Llc Procédés de développement de lignées cellulaires produisant des anticorps spécifiques à un antigène et d'anticorps monoclonaux

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHO-VEGA J.H. ET AL.: "MCL-1 expression in B- cell non- Hodgkin's lymphomas", HUM PATHOL, vol. 35, 2004, pages 1095 - 1100 *
SHAFER A.L. ET AL.: "XBP1, downstream of Blimp-1, expands the secretory apparatus and other organells, and increases protein synthesis in plasma cell differentiation", IMMUNITY, vol. 21, 2004, pages 81 - 93 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017500052A (ja) * 2013-12-24 2017-01-05 アイム・セラピューティクス・べー・フェー ｅｘ ｖｉｖｏの抗体生成
US10975051B2 (en) 2015-08-12 2021-04-13 Memorial Sloan Kettering Cancer Center Phenylsulfonamido-benzofuran derivatives and uses thereof in the treatment of proliferative diseases
US11098021B2 (en) 2015-08-12 2021-08-24 Memorial Sloan-Kettering Cancer Center Phenylsulfonamido-benzofuran derivatives and uses thereof in the treatment of proliferative diseases
WO2017087810A1 (fr) * 2015-11-20 2017-05-26 Memorial Sloan-Kettering Cancer Center Procédé de criblage d'inhibiteurs ciblant des voies de survie anti-apoptotiques
US20180335421A1 (en) * 2015-11-20 2018-11-22 Memorial Sloan-Kettering Cancer Center Method for screening inhibitors targeting anti-apoptotic survival pathways
CN114752628A (zh) * 2022-05-30 2022-07-15 四川大学华西医院 C57bl/6小鼠多发性骨髓瘤模型的构建方法及应用
CN114752628B (zh) * 2022-05-30 2023-06-30 四川大学华西医院 C57bl/6小鼠多发性骨髓瘤模型的构建方法及应用

Similar Documents

Publication Publication Date Title
RU2670147C1 (ru) Вектор экспрессии car и car-экспрессирующие т-клетки
JP5753339B2 (ja) 抗体産生細胞の安定性に影響を与える手段および方法
Bussmann et al. A robust and highly efficient immune cell reprogramming system
JP2021516256A (ja) Ｃｄ１９に基づくキメラ抗原受容体及びその利用
EP2578600A2 (fr) Molécules à liaison spécifiques RSV et leur moyen de fabrication
US11180729B2 (en) Compositions and methods including cytotoxic B lymphocyte cell line expressing exogenous membrane immunoglobulin different from secreted immunoglobulin
CN109689694A (zh) 与其受体IL-2Rβ结合的白细胞介素-2作为用来增强自然杀伤细胞和调节性T细胞活性的平台
JP2005525800A (ja) 遺伝的に修飾された脊椎動物前駆体リンパ球の生成方法及び異種結合タンパク質の産生を目的としたその使用。
WO2014109696A1 (fr) Procédé d'immortalisation de lymphocytes b et ses utilisations
Alishah et al. CRISPR/Cas9-mediated TGFβRII disruption enhances anti-tumor efficacy of human chimeric antigen receptor T cells in vitro
CN102321579A (zh) 制备细胞毒性淋巴细胞的方法
Caeser et al. Genetic manipulation and immortalized culture of ex vivo primary human germinal center B cells
EP1321477A1 (fr) Procédure pour la production de cellules précurseur lymphocytaires, génétiquement modifiées et leur utilisation pour la production de protéines de liaison hétérologues
EP1497413B1 (fr) Procedes de production de cellules secretrices d'anticorps immortalisees
US20200149007A1 (en) Ex vivo antibody production
US20200172615A1 (en) Novel method for producing antibodies
Ito et al. Antigen-specific antibody production of human B cells in NOG mice reconstituted with the human immune system
Hibi et al. Phenotype, frequency, and EBV responsiveness of human marrow B and pre-B cells.
US20110171688A1 (en) Method of providing immunoglobulin secreting b lymphocytes and human antibodies
Garcés Lázaro Restoring NK cells function against cancer.
Khazaie et al. Cancer Immunology in an Inducible Model of Breast Cancer
Cotta The role of the transcription factors Pax5 and E47 in early lymphopoiesis
Lacombe The regulation of T/B lineage commitment by Lunatic Fringe and Notch1
NZ722156B2 (en) Ex vivo antibody production
EA044991B1 (ru) Образование антител ex vivo

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14737818

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14737818

Country of ref document: EP

Kind code of ref document: A1