WO2014109456A1 - Composition pharmaceutique pour prévenir ou traiter une dyskératose folliculaire, contenant de la catéchine ou un dérivé de celle-ci - Google Patents

Composition pharmaceutique pour prévenir ou traiter une dyskératose folliculaire, contenant de la catéchine ou un dérivé de celle-ci Download PDF

Info

Publication number
WO2014109456A1
WO2014109456A1 PCT/KR2013/008856 KR2013008856W WO2014109456A1 WO 2014109456 A1 WO2014109456 A1 WO 2014109456A1 KR 2013008856 W KR2013008856 W KR 2013008856W WO 2014109456 A1 WO2014109456 A1 WO 2014109456A1
Authority
WO
WIPO (PCT)
Prior art keywords
egcg
catechin
pharmaceutical composition
derivative
abnormalities
Prior art date
Application number
PCT/KR2013/008856
Other languages
English (en)
Korean (ko)
Inventor
서대헌
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020130117831A external-priority patent/KR20140092205A/ko
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Publication of WO2014109456A1 publication Critical patent/WO2014109456A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0014—Skin, i.e. galenical aspects of topical compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders

Definitions

  • the present invention relates to the field of prophylaxis or treatment of hair follicular keratosis abnormalities comprising catechins or derivatives thereof.
  • Acne which is one of the follicular keratosis diseases, is known to be associated with various etiologies.
  • the excessive production of sebum in the sebaceous gland causes skin diseases such as acne.
  • the common etiology for a class of diseases called acne is the comedo that occurs in hair follicles, which may involve damage to the hair follicle unit.
  • Early scalp from acne consists of sticky keratin substances. These keratinous impaction causes bacteria to multiply, causing inflammatory symptoms in the form of pustules, papules, cysts and sintered nodes.
  • catechins is a major polyphenol component of green tea is known to inhibit tumor progression, and improve inflammatory diseases such as diabetes, allergies and the like.
  • Korean Patent Application No. 2006-0024905 discloses a cosmetic composition containing green tea extract or at least one selected from the group consisting of catechins, flavonols, and derivatives of green tea in a certain ratio Is disclosed.
  • the present application is to provide a material that is effective in the prevention, alleviation, or treatment of hair follicle keratosis diseases derived from a novel natural material based on the mechanism of the occurrence of hair follicle keratosis abnormalities.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of hair follicular keratosis abnormalities comprising a catechin or a derivative thereof.
  • the present invention may include various catechins and / or derivatives thereof as long as the effects of the present application are achieved, and for example, the catechins or derivatives thereof may be EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), or ECG (epicathechin). 3-gallate), GC (gallocatechin), CG (cathechin 3-gallate), EC (epicatechin), C (catechin), Kaempferol, Formononetin, Quercetin, or Ellagic acid includes, but is not limited to. In one embodiment in particular EGCG (epigallocatechin gallate) can be used.
  • catechins or derivatives thereof according to the present invention may be included in an amount suitable for exerting the effect according to the present application, and those skilled in the art may suitably select the amount included according to the specific purpose of the treatment and the characteristics of the specific component selected, for example, catechin Or a derivative thereof may be included in an amount of about 0.1% to 30% (w / v), but is not excluded.
  • said follicular keratosis abnormality is accompanied by inflammation, said inflammation being for example Propionibacterium acnes, Staphylococcus aureus , or Staphylo Caused by, but not limited to, Staphylococcus epidermidis .
  • compositions comprising catechins or derivatives thereof according to the present invention have an effect by affecting mechanisms associated with hair follicular keratosis abnormalities, but are not limited to the present mechanism, regulation of AMPK-SREBP-1 cell signal transduction, IGF-1 / PI3K / Inhibition of Akt cell signaling, inhibition of NF-kB and AP-1 cell signaling, reducing IL-1 ⁇ in keratinocytes.
  • the follicular keratosis disorder may include, but is not limited to, injection, pore keratosis, facial cervical follicular erythema, or inflammatory or non-inflammatory acne.
  • the disease may be interpreted as being caused by hair follicular keratosis abnormalities.
  • the present invention also relates to a pharmaceutical composition for the prevention or treatment of cystosis abnormality further comprising a catechin or a derivative thereof and a skin dermabrasion agent.
  • the peeling agent included in the composition according to the present application is representative and may include one or more of AHA (Alpha-Hydroxy Acid) or BHA (Beta-Hydroxy Acid), examples of which include glycolic acid and examples of salicylic acid It is possible, but not limited to.
  • compositions comprising the above components in combination according to the present application has a synergistic effect compared to the use alone, and may be included to exhibit such an effect, for example, the catechin or its derivative is about 0.1% to 30% ( w / v), and the peeling agent is included in about 1 to 70% (w / v).
  • a cosmetic composition for alleviation and / or amelioration of hair follicle anomaly comprising a catechin or a derivative thereof or a skin dermabrasion in combination with such a composition, for example, a face wash, soap, shampoo, lotion, lotion, cream. Or for packs.
  • the catechin or derivative thereof included in the cosmetic composition is included in 0.1% to 30% (w / v), and the peeling agent is included in about 1 to 10% (w / v).
  • a dietary supplement, functional food, or food additive for alleviating and / or ameliorating hair follicular keratosis abnormalities comprising a catechin or a derivative thereof.
  • the present invention relates to a method for preparing a pharmaceutical composition for preventing or treating follicular keratosis abnormalities comprising a catechin derivative, wherein the catechin or a derivative thereof is dissolved by dissolving catechin or a derivative thereof in alcohol and then using water. It provides a manufacturing method, characterized in that for preparing a solution containing 0.1% to 30% (w / v).
  • the peeling agent may be included in an amount of about 1 to 70% (w / v), and the amount may vary depending on the specific purpose.
  • the catechin derivative is EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG (epicathechin 3-gallate), GC (gallocatechin), CG (cathechin 3-gallate), EC (epicatechin) , C (catechin), Kaempferol, Formononetin, Foreronetin (Quercetin), or at least one selected from Ellagic acid (Ellagic acid), in particular the catechin or derivatives thereof is EGCG (epigallocatechin gallate).
  • a pharmaceutical composition for preventing or treating follicular keratosis abnormalities comprising catechins or derivatives thereof according to the present invention, which effectively prevents follicular keratinization abnormalities without causing skin irritation without causing resistance to antibiotics, thereby causing follicular keratosis such as acne. It can be effectively used for skin diseases due to the above, and when included in a combination of skin dermabrasion, brings a synergistic effect.
  • FIG. 1 shows that EGCG inhibits the expression of sterol regulatory site binding protein (SREBP) -1 protein via AMP-activated protein kinase (AMPK) pathway to inhibit lipid formation in SEB-1 sebaceous gland cells.
  • 1a is the result of total lipid analysis of SEB-1 sebaceous gland cells in the presence of 14 C acetate 24 hours after EGCG treatment;
  • Figure 1b shows the change of lipid components in thin layer chromatography (C: cholesterol, FOH: fatty alcohol, OA: oleic acid, TAG: triglyceride, WE: wax ester, CO: cholesterol oleate, SQ: squalene), Unit : mean ⁇ SE cpm / 10 3 cells / hour;
  • FIG. 1C is a western blot result of detecting precursor or mature of SREBP according to EGCG concentration
  • FIG. 1D shows the results of real-time quantitative PCR analysis of SREBP-1a, SREBP-1c, SREBP-2, fatty acid synthase (FAS), and acetyl-CoA carboxylase (ACC) RNA after 24 hours of EGCG treatment.
  • FAS fatty acid synthase
  • ACC acetyl-CoA carboxylase
  • FIG. 2A shows that EGCG inhibits the expression of sterol regulatory site binding protein (SREBP) -1 protein via AMP-activated protein kinase (AMPK) pathway, thereby inhibiting lipid formation in SEB-1 sebaceous gland cells.
  • SREBP sterol regulatory site binding protein
  • AMPK AMP-activated protein kinase
  • 2C shows SEB-1 cells treated with 20 ⁇ M Compound C for 30 minutes and / or with EGCG for 24 hours. After treatment, it is stained with Nile Red. (scale bar 10 ⁇ m) All experiments were repeated at least five times and the results are expressed as mean ⁇ SEM.
  • FIG. 3 shows that EGCG inhibits NF-kB and activating protein 1 (AP-1) pathways to reduce inflammation caused in SEB-1 cells due to heat inactivated P. acnes .
  • Treatment of acnes stimulated SEB-1 cells with EGCG for 24 hours followed by quantitative RT-PCR data of cytokines (IL-1 ⁇ , IL-1 ⁇ , tumor necrosis factor (TNF) - ⁇ and IL-8) Result;
  • FIG. 3B shows ELISA results of proteins of TNF- ⁇ and IL-8 extracted from the culture medium of cells treated as (a);
  • FIG. 3C shows phospho-c-Jun, phospho IkB ⁇ , matrix metalloproteinase (MMP) for proteins extracted from SEB-1 cells stimulated with P.
  • MMP matrix metalloproteinase
  • FIG. 3D shows Western blot results of NF-kB p65 for nuclear and cytoplasmic fractions after heat-inactivated P. acnes stimulated SEB-1 cells with EGCG for 30 minutes and 24 hours;
  • FIG. 3E is Western blot results of phospho-IkB ⁇ , NF-kB p65, and IL-1 ⁇ before and after 24 hours treatment with EGCG in heat-inactivated P.
  • Figure 3f is a quantitative RT-PCR results for IL-1 ⁇ using RNA isolated from cells treated in the same manner as (e). All experiments (ae) were repeated at least five times, data (a, b, f) were mean ⁇ SEM and statistically analyzed using Student's t-test: * P ⁇ 0.05 (control and each P. acnes treatment group); ⁇ P ⁇ 0.05 (P. acnes treated and EGCG-untreated or each EGCG treated group).
  • Figure 4 shows the killing effect of EGCG on SEB-1 cells and the growth inhibitory effect on P. acnes
  • Figure 4a shows each cell at 24 hours or 48 hours of EGCG treatment in SEB-1 sebaceous gland cells and HaCaT keratin cells Survival was measured by MTT assay; 4B is microscopic observation showing DAPI staining (scale bar, 10 ⁇ m; X400); 4C shows results (bar.
  • FIG. 5 is a result showing the effect of 5% EGCG on acne lesions performed for 8 weeks in the clinic
  • FIG. 5A is a photograph showing the result after 8 weeks of applying EGCG to the skin of a patient according to one embodiment of the present application
  • FIG. 5B is a result showing a modified lead grade
  • FIG. 5C is a non-inflammatory site (comedones)
  • FIG. 5D is a result showing a change in inflammatory sites (papules, pustules, and nodules)
  • 5E shows the results of a visual analog scale (VAS) measurement for subjective evaluation.
  • VAS visual analog scale
  • FIG. 6 shows the results of staining with antibodies of IL-8, phospho-c-JUN, SREBP-1, and NF-kB p65 as a result of histological changes after 8 weeks of EGCG treatment in the clinic, and TUNEL analysis.
  • Scale Bar 100 ⁇ m, all experiments were repeated at least 5 times and the result was mean ⁇ SEM, was performed by Wilcoxon signed rank test, and * P ⁇ 0.05 was determined to be statistically significant compared to the default value.
  • FIG. 8 is a photograph before and after applying 1% EGCG to the affected area of the arm where follicular keratinization occurred twice daily.
  • the present application is based on the discovery that catechins and derivatives thereof can control hair follicular keratosis abnormalities in the skin.
  • the present invention relates to a pharmaceutical composition for preventing or treating hair follicle keratosis abnormalities comprising catechin and derivatives thereof.
  • the term "catechin” is a type of polyphenolic compound and is a type of flavonoid.
  • “Flavonoid” refers to a non-nitrogen pigment contained in a plant having a C6-C3-C6 type carbon skeletal structure in which two phenyl groups are bonded through a C3 chain, and flavonoids according to the basic skeleton of the flavonoids depending on the structure and position of the substituents. It is divided into five types: flavonoids, flavones, anthocyanins, isoflavonoids, and neoflavonoids. The types of flavonoids to which the catechins of the present disclosure belong are listed below, but are not limited thereto:
  • Flavonoids flavone-3-ols (Flavan-3-ols), GCG (gallocatechin gallate), GC (gallocatechin), CG (cathechin 3-gallate), C (catechin), EGCG (epigallocatechin gallate), EGC (epigallocatechin), Leucoanthocyanidin, which is epicathechin 3-gallate, EC (epicatechin), flavone-4-ols, flavone-3, 4-diols ), Flavonol; Flavones: Luteolin, Apigen, Tangerine, Quercetin, Kaempferol, Myricetin, Fisetin, Iso Isorhamnetin, Pachypodium, Rhamnazin, Hesperetin, Naringenin, Eridictyol, Homocliodictyol, Taxifolin ), Dihydroquercetin, Dihydrokaempferol; Anthocyanins: anthocyanin, cyani
  • EGCG epigallocatechin gallate
  • GCG gallocatechin gallate
  • EGC epigallocatechin
  • ECG epicathechin 3-gallate
  • GC gallocatechin
  • CG cathechin 3-gallate
  • Epicatechin, C catechin
  • Kaempferol Formononetin, Quercetin, or Ellagic acid
  • the term “sebum” refers to the secretion of sebaceous glands, especially including triglycerides, free fatty acids, wax esters, squalene, cholesterol and cholesteryl esters.
  • cell death induces spontaneous killing of cells in a form in which cells are controlled and killed by genes.
  • hair follicle keratinization is one of the proteins that protects the skin, keratin (keratin) is excessively produced in the hair follicles, clogging the hair follicles, making bumps and preventing the release of sebum and scalp inflammation This means that too much keratinogenesis can occur.
  • follicular keratose abnormality or “follicular hyperkeratosis” is a red or brown area around the pores sometimes caused by a keratin stopper embedded in the hair follicles, causing aesthetic problems, which may be caused by dry skin or by atopy.
  • diseases caused by follicular keratosis abnormalities may include, but are not limited to, acne, injection, pore keratosis, or facial cervical follicular erythema.
  • acne includes any skin disease commonly referred to in the art as acne, or any skin disease invented through a mechanism similar to acne and includes inflammatory, non-inflammatory and acne lesions. Also by cause, for example, collective acne, common acne, congoblate acne, acne from cosmetic use, acne detergicans, adolescent acne, acne fulminans, acne furunculoid , Acne caused by halogen, acne acne, keloid acne, mechanical acne, drug acne, necrotic acne, lip acne, acne neonatorum, acne oil, It may include papular acne, pomade acne, premenstrual acne, acne rosacea, swelling acne, tropical acne, acne venenata, adult acne or vulgar acne. However, it is not limited thereto.
  • injection is a chronic disease with the main symptoms of papules, pustules, edema, etc., accompanied by erythema in the middle of the face such as nose and cheeks (Meyer-Hoffert U et al., J Investig Dermatol Symp Proc 2011 Dec; 15 (1): 16-23).
  • poreskeratosis is a disease in which small bumps appear along the pores of the arms, legs, and the like, and apparently show chicken skin.
  • facial hair follicle erythematous epithelium is a disease in which the pigmentation with clear borders of erythema and reddish brown, which are centered on the hair follicle, occurs mainly in the face and neck (van Pelt HP et al., Acta Derm Venereol 1999, Jan; 79 (1): 65-6)
  • Hair follicular keratosis disorders can involve inflammation, and the causes of such inflammation are, for example , Propionibacterium acnes, Staphylococcus aureus, or Staphylococcus epidermis. Dermides (Staphylococcus epidermidis) . In particular, it may be caused by Propionibacterium acnes (Propionibacterium acnes) , but is not limited thereto, the composition of the present application is effective in diseases caused by these various causative bacteria.
  • the above-mentioned diseases are all problems with normal keratinization process such as hyperkeratosis or aberrant keratinization, and the composition according to the present invention treats the keratinosis abnormality to improve or treat the disease.
  • the catechins or derivatives thereof according to the present invention are effective for improving, alleviating, preventing, or treating follicular keratosis abnormalities.
  • treatment means any action that improves or advantageously alters the symptoms of a related disease by administration of the composition.
  • prevention means any action that inhibits or delays the onset of a follicular keratosis-related disease, including acne, by administration of the composition herein. It will be apparent to those skilled in the art that the present compositions can prevent these conditions when administered prior to, or before, the appearance of follicular keratosis.
  • catechin derivatives regulate follicular keratinocytes by regulating AP (activator protein) -1 and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) signaling pathways and inhibiting cell death in sebaceous and keratinocytes. It relates to a pharmaceutical composition capable of preventing or treating abnormalities.
  • AP activator protein
  • NF-kB nuclear factor kappa-light-chain-enhancer of activated B cells
  • AP-1 is one of the major transcription factors regulated by protein kinase C, which is the target of TPA (12-O-tetradecanoylpobol 13-acetic acid).
  • AP-1 is the primary cancer gene Jun (c Jun is 340). Dog amino acid residues) and Fos (c-Fos consists of 380 amino acid residues).
  • NF- ⁇ B is one of the most important transcription factors involved in the inflammatory mechanism in immune cells, NF- ⁇ B is due to the stimulation of various receptors involved in immunity such as T-cell receptor, B-cell receptor, CD40, Regulates expression of growth factors.
  • Abnormal NF- ⁇ B activity caused by various causes is known as a mechanism of various autoimmune diseases such as atopy, allergy, lupus, arthritis, and is involved in various physiological control mechanisms such as brain, skin, and bone in addition to immune cells.
  • EGCG animalallocatechin gallate
  • EGCG epigallocatechin gallate
  • AP-1 and NF-kB signaling pathways
  • the pharmaceutical composition comprising the catechin derivative of the present invention can inhibit sebum production and the resulting follicular keratinosis abnormalities by regulating the AMPK-SREBP-1 signaling pathway.
  • the catechin derivative EGCG activates AMP-activated protein kinase (AMPK) in sebaceous gland cells, and activated AMPK reduces lipid production and expression of SterBP (Sterol regulatory element-binding protein).
  • AMPK is an enzyme that regulates energy homeostasis in cells, inhibits cholesterol synthesis, lipid production, triglyceride synthesis, and regulates insulin secretion.
  • SREBP is a transcription factor that binds to sterol regulatory DNA and is involved in cholesterol biosynthesis and fatty acid biosynthesis and absorption.
  • the pharmaceutical composition comprising the catechin derivative of the present invention inhibits IGF-1 / PI3K / Akt cell signal transduction AMPK dependent, IGF-1 / PI3K / Akt signaling pathway is lipid production through SREBP and thereby It can suppress hair follicular keratinosis abnormalities.
  • Insulin-like growth factor-1 (IGF-1) plays an important role in cell growth and development, and the phosphatidylinositol 3-kinase (PI3K) / Akt signaling pathway is also involved in anticancer.
  • the pharmaceutical composition comprising the catechin derivative of the present invention can inhibit the inflammatory response by inhibiting NF-kB and AP-1 signaling pathways, which are very important signaling pathways of inflammation regulation.
  • EGCG a catechin derivative
  • the inflammatory response induced by P. acnes and signaling pathways of NF-kB and AP-1 by reducing the phosphorylation of IkB in sebaceous gland cells. May lead to correction of follicular keratosis abnormalities.
  • inhibition of AMPK restored the signaling pathways of NF-kB and AP-1 that were inhibited by EGCG.
  • the pharmaceutical composition comprising the catechin derivative of the present invention inhibits the follicular keratinization abnormality of hair follicle keratinocytes by reducing IL-1 ⁇ in keratinocytes.
  • the pharmaceutical composition comprising the catechin derivative of the present invention reduces cell death and cell cycle arrest by inhibiting the NF-kB or Akt signaling pathway.
  • apoptosis and cell cycle arrest are due to the antiproliferation of the catechin derivatives, thereby inhibiting sebum secretion and follicular keratinization at the sebaceous gland site.
  • the composition of the present invention is a pharmaceutical composition for the prevention or treatment of diseases caused by follicular keratosis, including acne, injection, pore keratosis, or facial cervical follicular erythema, as well as cosmetic compositions, in particular to treat, ameliorate, alleviate or prevent acne. It can be used as a cosmetic composition for.
  • the range to which the composition can be applied is not particularly limited as long as it is a site where follicular keratosis abnormalities can occur, and preferably various routes of administration to the face, scalp or the back, for example, systemic or topical, especially topical administration, oral , Transdermal, or injection, in particular by the transdermal route.
  • a cosmetic composition for preventing, ameliorating or alleviating diseases caused by hair follicular keratinosis disorders including catechins or derivatives thereof, the content of which depends on the specific use or formulation of the desired product. But may be included in about 0.1-30% (w / v) in the total composition, and may be included in about 5-25% (w / v), about 5-20% (w / v).
  • the cosmetic composition herein may include, in addition to the catechin or derivative thereof, conventional adjuvants and carriers such as antioxidants, stabilizers, solubilizers, vitamins, pigments and flavorings.
  • the cosmetic compositions herein can also be prepared in any formulations commonly prepared in the art, including, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing , Oils, powder foundations, emulsion foundations, wax foundations and sprays, and the like, but are not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, hair tonic, shampoo, rinse, cleansing cream, cleansing foam, cleansing water, pack, spray or powder. .
  • the formulation of the present composition is a paste, cream or gel, animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components.
  • animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components.
  • animal oils vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide
  • cellulose derivatives polyethylene glycols
  • silicones bentonites
  • silicas talc or zinc oxide
  • the formulation of the composition is a powder or a spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, especially in the case of a spray, additionally chlorofluorohydrocarbon, propane Propellant such as butane or dimethyl ether.
  • a solvent, solubilizing agent or emulsifying agent is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol, glycerol aliphatic ester, polyethylene glycol or sorbitan may be used.
  • liquid diluents such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystals Castle cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.
  • the formulation of the present composition is a surfactant-containing cleansing
  • a surfactant-containing cleansing as a carrier component, an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolium derivative, a methyltaurate, a sarcosinate, a fatty acid amide ether Sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters, etc.
  • Pharmaceutically acceptable excipients in particular dermatologically acceptable excipients.
  • composition for skin of each formulation other components than the essential ingredients described above can be selected and blended without difficulty by those skilled in the art according to other skin compositions or purposes of use.
  • composition according to the present disclosure may also include at least one adjuvant selected from thickeners, preservatives, flavorings, colorants, chemical or inorganic salt filters, humectants, thermal spring water, and the like, which are known pharmaceutical agents.
  • preservatives commonly used in cosmetics or nutraceuticals include molecules with antimicrobial activity, such as capryl derivatives (capryloylglycine and glyceryl caprylate), for example hexanediol and sodium levulinate, zinc And copper derivatives (gluconate and PCA), phytosphingosine and derivatives thereof, benzoyl peroxide, pyroxtonolamine, zinc pyrithione and selenium sulfides, econazole, ketoconazole, or topical antibiotics such as erythromycin and Clindamycin.
  • compositions herein also include sebum modifiers, antibacterial agents, antifungal agents, keratolytic agents, keratin regulators, astringents, anti-inflammatory / anti-irritants, antioxidant / free radical capture agents, wound healing agents, anti-aging agents and And / or at least one anti-acne compound selected from moisturizers.
  • the composition is prepared by dissolving catechin or a derivative thereof in an amount of an organic solvent, such as methanol, ethanol, propanol, butanol, and then using water to prepare an aqueous solution of a catechin derivative of about 0.1% to 30% (w / v). It may be, but is not limited thereto.
  • EGCG epigallocatechin gallate
  • EGCG solution is prepared by dissolving catechin or a derivative thereof in an amount of an organic solvent, such as methanol, ethanol, propanol, butanol, and then using water to prepare an aqueous solution of a catechin derivative of about 0.1% to 30% (w / v). It may be, but is not limited thereto.
  • EGCG epigallocatechin gallate
  • compositions of the present invention can be administered by various routes. All modes of administration can be envisaged, for example, may be administered by transdermal, oral, or intravenous, intramuscular or subcutaneous injection, but it is preferred to administer orally or directly to the skin, but the method of administration It is possible to modify accordingly according to the state.
  • transdermal administration is preferred, in which case a composition comprising from about 0.1% to 30% (w / v) of catechin or a derivative thereof is once daily for a period of indefinite period from day to day when acne improves in the affected area. To several times.
  • the pharmaceutical or cosmetic composition according to the present disclosure may further comprise a peeling agent.
  • Dermabrasion is a material that can injure wounds to a desired depth using certain acidic chemicals.
  • Alpha-Hydroxy Acid (AHA) or Beta-Hydroxy Acid (BHA) can be used.
  • AHAs include glycolic acid
  • BHAs include, but are not limited to, salicylic acid.
  • ECGC is mixed with a low concentration of skin dermabrasion, e.g. 1) the skin dermabrasion component removes the stratum corneum and epidermal barrier that interferes with the absorption of EGCG into the acne lesion. Increase the local concentration, 2) increase the stability of the EGCG molecule itself in a weak acidic environment, and 3) skin dermabrasion is also expected to improve acne lesions as an independent mechanism, simply because of the acne It is included in concentrations that can produce a more synergistic effect than the combined effect.
  • skin dermabrasion component removes the stratum corneum and epidermal barrier that interferes with the absorption of EGCG into the acne lesion.
  • Increase the local concentration 2) increase the stability of the EGCG molecule itself in a weak acidic environment, and 3) skin dermabrasion is also expected to improve acne lesions as an independent mechanism, simply because of the acne It is included in concentrations that can produce a more synergistic effect than the combined effect.
  • the peeling agent may be included in an amount of about 1 to 70% (w / v) and in the case of a cosmetic composition about 1 to 10% (w / v).
  • glycolic acid is included at a concentration of about 5%
  • salicylic acid at about 2%
  • EGCG may be included at a concentration of 5%, but is not limited thereto.
  • composition of the present invention can be used in various ways, such as health foods and beverages for the prevention and improvement of hair follicle anomaly.
  • Foods to which the composition of the present invention may be added include, for example, various foods, beverages, gums, teas, vitamin complexes, health supplements, and the like, and may be used in the form of powders, granules, tablets, capsules, or beverages. have.
  • composition of the present invention Since the composition of the present invention has little toxicity and side effects, it is a medicament that can be used safely even when taken for a long time for the purpose of prevention.
  • the composition of the present invention may be added to food or beverage for the purpose of preventing and improving hair follicle keratosis.
  • the amount of the composition in the food or beverage is generally added to the health food composition of the present invention to 0.01 to 15% by weight of the total food weight, the health beverage composition is 0.02 to 30 g based on 100 ml, preferably May be added in a ratio of 0.3 to 10 g, but is not limited thereto.
  • the composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the compositions of the present invention may also contain pulp for the production of natural fruit juices and fruit juice beverages and vegetable beverages. These components can be used independently or in combination.
  • the proportion of such additives is generally selected from the range of 0 to about 20 weight per 100 weight of the composition of the present invention, but is not limited thereto.
  • the present invention may be practiced using conventional techniques that are within the skill of one of ordinary skill in the art of cell biology, cell culture, molecular biology, gene transformation techniques, microbiology, DNA recombination techniques unless otherwise noted. Also, a more detailed description of the general technology can be found in Molecular Biotechnology: (Bernard et al., ASM press 1994); Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. Eds., John Wiley & Sons 1999); See DNA Cloning, Volumes I and II (Glover ed., 1985).
  • SEB-1 sebocytes To determine whether EGCG can regulate lipids in human SEB-1 sebocytes, Thiboutot et al. Human skin is a steroidogenic tissue: steroidogenic enzymes and cofactors are expressed in epidermis, normal sebocytes, and an immortalized sebocyte cell line (SEB-1) .
  • SEB-1 The sebaceous gland activity model described in J Invest Dermatol 120: 905-14, 2003) Used.
  • SEB-1 was treated with different concentrations of EGCG described in Figure 1 and after 24 hours the total amount of lipids from SEB-1 sebaceous gland cells was analyzed in the presence of 14 C-acetate. Changes in the major lipid components were analyzed using thin-layer chromatography. As a result, as shown in FIG.
  • SREBPs sterol regulatory element-binding proteins
  • EGCG increased phosphorylation of AMPK Thr172 and acetyl-CoA carboxylase Ser79.
  • Gwangstein, EGCG, and capsaicin inhibit adipocyte differentiation process via activating AMP-activated protein kinase.Biochem Biophys Res Commun 338: 694-9, 2005 and Collins et al., Epigallocatechin-3-gallate ( EGCG), a green tea polyphenol, suppresses hepatic gluconeogenesis through 50-AMP-activated protein kinase.J Biol Chem 282: 30143-9, 2007), as shown in J Biol Chem 282: 30143-9, 2007). This shows that it activates.
  • Example 3 EGCG heat-inactivation P. acnes Induced inflammation reduction
  • SEB-1 cells stimulated with heat-inactivated P. acnes were treated with EGCG for 24 hours, RNA was isolated, and cytokine concentrations were measured using quantitative reverse transcription PCR.
  • heat-inactivated P. acnes induced the expression of inflammatory molecular markers, including IL-1 ⁇ , IL-1 ⁇ , tumor necrosis factor (TNF) - ⁇ and IL-8 in sebaceous gland cells
  • Treatment with EGCG for 24 hours significantly reduced mRNA levels of IL-1 ⁇ , IL-1 ⁇ , TNF- ⁇ , and IL-8. This shows the anti-inflammatory effect of EGCG.
  • IL-1 ⁇ a cytokine involved in hair follicle epithelial hyperkeratosis
  • IL-8 a cytokine involved in hair follicle epithelial hyperkeratosis
  • Treatment with EGCG also inhibited intranuclear translocation of NF-kB p65 upstream of NF-kB signaling (FIG. 3D) and increased levels of IL-1 ⁇ , NF-kB and phospho-IkB in HaCaT keratinocytes. Reduced (FIGS. 3E and F). These results show the inhibitory effect of EGCG on the main cells constituting the skin in inflammatory reactions related to acne.
  • Clinical trials were conducted to investigate the efficacy and persistence of EGCG in the treatment of facial acne. Clinical trials were conducted according to Helsinki Declaration (2000) and approved by the Institutional Review Board of Seoul National University Hospital.
  • a randomly selected 35 patients male: 17 female: 18 average age: 22.1 years
  • 17 were treated with 1% EGCG (w / v) and 18 were treated with 5% EGCG (w / v) to determine the relationship between dose and response.
  • One half of the patient's face was applied with 1 or 5% EGCG (w / v) solution twice a day and the other half with only 3% ethanol as a control.
  • Baseline visit schedules were 1, 2, 4, 6, and 8 weeks.
  • Modified Leeds scores reflecting inflammatory acne lesions such as papules, pustules, nodule, cysts and non-inflammatory acne lesions such as comedones were used to measure acne status.
  • the mean Leeds score interval corrected at baseline was 5.1 ⁇ 0.4 (mean ⁇ standard deviation, range 2-7), which is O'Brien et al., (Leeds revised acne grading system.J Dermatol Treat 9: 215-20 , 1998).
  • the modified Leeds scores decreased significantly to 1.2 ⁇ 0.4 and 1.7 ⁇ 0.6, respectively, after 8 weeks.
  • the number of inflammatory and non-inflammatory sites was significantly reduced from 53.8 ⁇ 19.8 and 10.0 ⁇ 3.1 to 15.6 ⁇ 6.2 and 1.1 ⁇ 0.5 with 1% EGCG (w / v) solution, respectively. This is a reduction of 79 and 89%, respectively, compared to the default value (FIGS. 5C and D). Similar results were obtained with 5% EGCG (w / v).
  • VAS visual analogue scale
  • EGCG treatment generally lasted well, and no serious side effects were observed. Erythema or mild irritation was observed in 4 patients treated with 5% EGCG (w / v), but sedated after several hours. Patients treated with 1% EGCG (w / v) did not see any side effects.
  • Oil red O staining was performed to measure the increase and decrease of lipid droplets accumulated in the cytoplasm of 1.
  • Each material was treated with cells cultured at concentrations of 0, 0.5, 1, 5, and 10 ⁇ M for 72 hours, and then lipid staining was performed. The effect of the substance was evaluated by showing the total area stained with oil red O per cell by increasing or decreasing the lipid droplet accumulated in the cytoplasm under a microscope. As a result, as shown in FIG.
  • the percentage of reduction (or increase) compared to the number of inflammatory-non-inflammatory acne measured at the initial visit was compared.
  • the main question is how much the EGCG and glycolic acid mixed treatment group decreased compared to the EGCG or glycolic acid individual treatment group, and how much the EGCG and salicylic acid mixed treatment group decreased compared to the EGCG or salicylic acid individual treatment group.
  • subjective satisfaction of patients in each treatment group was further analyzed.
  • non-inflammatory acne decreased by 23.4% on the face with EGCG and 15.2% on the face with glycolic acid solution. On the face with EGCG and glycolic acid mixed solution, the average decrease was 56.5%.
  • the reduction width average of the mixed solution showed a significantly higher synergistic effect than the average for the sum of the individual solution reduction widths ( P ⁇ 0.05).
  • the experimental method is as described in Example 8. The results are shown in FIG. 10, and were effective for both non-inflammatory and non-inflammatory acne, and a synergistic effect was obtained by mixing EGCG and salicylic acid.
  • non-inflammatory acne decreased by 23.4% on the face with EGCG and 25.2% on the face with salicylic acid solution.
  • the average decrease was 59.8%.
  • the reduction width average of the mixed solution showed a significantly higher synergistic effect than the average for the sum of the individual solution reduction widths ( P ⁇ 0.05).
  • non-inflammatory acne decreased by an average of 33.2% on the face with EGCG and 26.6% on the face with salicylic acid solution. On the face with EGCG and glycolic acid mixed solution, the average decrease was 68.6%. Statistically, it was confirmed that the reduction width average of the mixed solution showed a significantly higher synergistic effect than the average for the sum of the individual solution reduction widths ( P ⁇ 0.05).
  • the patient's subjective satisfaction with the face applied with the mixed solution was 9.1 points (out of 10 points), which was significantly higher than 5.2 points of the EGCG-only surface and 4.9 points of the salicylic acid-only surface. High ( P ⁇ 0.05).
  • SEB-1 immortalized cells were generated by transfection of secondary sebaceous gland cells with SV40 Large T antigen. SEB-1 cells were treated with 5% CO 2 , 5.5 mM glucose / Ham's F-12 3: 1 (Invitrogen), fetal bovine serum 2.5% (HyClone, Logan, UT) in a 37 ° C.
  • adenine 1.8 X 10 -4 M Sigma, USA
  • DMEM comprising 0.4 ⁇ gml -1 (Sigma), insulin 10 ngml -1 (Sigma), epidermal growth factor 3 ngml -1 (Austral Biologicals, USA), and cholera toxin 1.2 X 10 -10 M Incubated in (Invitrogen).
  • Human keratinocytes HaCaT were treated with 5% fetal bovine serum, 20 mM L-glutamine, 1 mM sodium pyruvate, and antibiotic / antimycotic solution (10 Uml -1 penicillin, 10 ⁇ gml -1 streptomycin, and 0.25 ⁇ gml - in a 5% CO 2 , 37 ° C incubator. Incubated in DMEM (Invitrogen) containing 1 amphoterin).
  • DMEM Invitrogen
  • EGCG was treated to SEB-1 cells at the concentrations described in each corresponding figure and after 24 hours total RNA was extracted using Trizol (Biorad, USA). Then, cDNA was synthesized using RevertAid TM First-Strand cDNA Synthesis kit (Fermentas), and real-time PCR was performed using SYBR Green / ROX q-PCR kit (Fermentas) using 1 ⁇ g of cDNA as a template.
  • SREBP-1a (Forward): GCTGCTGACCGACATCGAA, (Reverse) TCAAATAGGCCAGGGAAGTCA; ADD / SREBP-1c (F): GGAGCCATGGATTGCACTTTC, (R): ATCTTCAATGGAGTGGGTGCAG; SREBP-2 (F): AACGGTCATTCACCCAGGTC, (R): GGCTGAAGAATAGGAGTTGCC; FAS (F): CCGAGGAACTCCCCTCAT, (R): GCCAGCGTCTTCCACACT; ACC (F): CCACTTGGCTGAGCGATT, (R): CCAGGTCCTCCAGCAGAA; And GAPDH (F): CAAGGTCATCCATGACAACTTTG, (R): GTCCACCACCCTGTTGCTGTTGCTGT
  • IL-1 ⁇ (assay ID number Hs 00174092), IL-1 ⁇ (assay ID number Hs 01555410), TNF- ⁇ (assay ID number Hs 00174128), IL-8 (assay ID number Hs 99999034) and GAPDH (assay ID number Hs 00266705) used a TaqMan probe (TaqMan® Applied Biosystems, USA). PCR conditions using the TaqMan probe were denatured at 95 ° C. for 15 seconds; Annealing / extension 60 cycles, 40 cycles were carried out with a cycle of 1 minute.
  • Protein was extracted using cell lysis (Cell Signaling Technology, Beverly, MA). The amount of protein contained in the lysate was determined using BCA protein quantification (Pierce, Rockford, IL). The same amount of protein was loaded on 10% SDS-PAGE and transferred to a PVDF (Polyvinylidene difluoride) membrane to attach the primary antibody of each protein as shown below, using anti-rabbit IgG and anti-mouse IgG as the secondary antibody. Primary antibodies were detected. Blots were developed using WESTSAVE Up (LabFrontier, Seoul, South Korea) and exposed to film. Blots of the films were analyzed and quantified by a densitometric program (TINA; Raytest Isotopenmebgerate, Straubenhardt, Germany).
  • TAA Densitometric program
  • cleaved caspase-3 (Asp175) (5A1) rabbit antibody, cyclin D1 (DCS6) mouse antibody, Bax rabbit antibody, BCL-2 mouse antibody, Akt rabbit antibody, Phospho-Akt (Thr308 ) rabbit antibody, Phospho-PI3K p85 (Tyr 458) / p55 (Tyr199) rabbit antibody, Phospho-IRS-1 (Ser307) rabbit antibody, Phospho-ACC (Ser79) rabbit antibody, Phospho-AMPKa (Thr172) rabbit antibody, AMPKa rabbit antibody, Phospho-c-Jun (Ser63) rabbit antibody, Phospho-IkB (Ser32 / 36) mouse antibody (Cell Signaling Technology), b-actin mouse antibody, Lamin A, NF-kB p65 mouse antibody, SREBP-1 rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA), Phospho-IGF 1 receptor rabbit antibody (Abcam, Cambridge, UK), MMP-2 mouse antibody, MMP-2 mouse antibody,
  • SEB-1 cells were cultured to 80% confluency in 35 mm dishes and treated with control or different concentrations of EGCG for 24 hours. In all examples cells were normalized to data. Cells were suspended in DMEM solution containing 1 ⁇ Ci 14 C-acetate and incubated at 37 ° C. for 2 hours. Extracted twice with ether ether and nonradioactive carrier lipids.
  • the sample was dissolved in a small amount of ethyl acetate and placed on a 20 cm silica gel thin layer chromatography (Merck, Darmstadt, Germany) plate, up to 19.5 cm in front of nucleic acid followed by benzene, and the last 11 cm in hexane: ethyl ether: glacial acetic acid (69.5: 30: 1.5). Lipid spots were quantified for radiation with a liquid scintillation counter. Each experiment was repeated at least five times.
  • composition for preventing or treating follicular keratosis abnormalities of the present application can be widely used in a variety of applications that require this purpose effectively without causing resistance to bacteria.

Abstract

La présente invention concerne une composition pharmaceutique pour prévenir ou traiter une dyskératose folliculaire, contenant de la catéchine, un dérivé de celle-ci, ou une combinaison de catéchine ou d'un dérivé de celle-ci et d'un agent de dermabrasion ; ou une composition cosmétique pour soulager ou atténuer une dyskératose folliculaire, contenant l'ingrédient. La composition selon la présente invention peut être utilisée efficacement pour traiter ou soulager une dyskératose folliculaire sans irriter la peau ni entraîner de résistance aux antibiotiques.
PCT/KR2013/008856 2013-01-14 2013-10-04 Composition pharmaceutique pour prévenir ou traiter une dyskératose folliculaire, contenant de la catéchine ou un dérivé de celle-ci WO2014109456A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20130003750 2013-01-14
KR10-2013-0003750 2013-01-14
KR1020130117831A KR20140092205A (ko) 2013-01-14 2013-10-02 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물
KR10-2013-0117831 2013-10-02

Publications (1)

Publication Number Publication Date
WO2014109456A1 true WO2014109456A1 (fr) 2014-07-17

Family

ID=51167082

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/008856 WO2014109456A1 (fr) 2013-01-14 2013-10-04 Composition pharmaceutique pour prévenir ou traiter une dyskératose folliculaire, contenant de la catéchine ou un dérivé de celle-ci

Country Status (1)

Country Link
WO (1) WO2014109456A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070094340A (ko) * 2006-03-17 2007-09-20 (주)아모레퍼시픽 피지분비 억제용 조성물
KR20090064369A (ko) * 2006-08-04 2009-06-18 존슨 앤드 존슨 컨수머 캄파니즈, 인코포레이티드 칼콘을 함유하는 조성물 및 이의 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070094340A (ko) * 2006-03-17 2007-09-20 (주)아모레퍼시픽 피지분비 억제용 조성물
KR20090064369A (ko) * 2006-08-04 2009-06-18 존슨 앤드 존슨 컨수머 캄파니즈, 인코포레이티드 칼콘을 함유하는 조성물 및 이의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YOON, J.Y ET AL.: "Epigallocatechin-3-Gallate Improves Acne in Humans by Modulating Intracellular Molecular Targets and Inhibiting P. acnes", JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 133, October 2012 (2012-10-01), pages 429 - 440 *

Similar Documents

Publication Publication Date Title
US8679552B2 (en) Acne vulgaris treatment regimen
AU778261B2 (en) Extracts of feverfew (tanacetum parthenium) against inflammatory disorders
CA2332808C (fr) Agents preventifs/therapeutiques pour les affections cutanees
US20070042026A1 (en) Prophylactic and therapeutic treatment of topical and transdermal drug-induced skin reactions
US9775789B2 (en) Topical liposome compositions containing phenolic anti-inflammatory agents and their methods of preparation
US7763288B2 (en) Skin care compositions and methods
US20060293257A1 (en) Methods for the treatment of scar tissue
KR20070073639A (ko) 박하 추출물의 화장 용도
JP2000186036A (ja) ケミカルピーリング剤組成物
KR20140092205A (ko) 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물
EP2306999B1 (fr) Compositions pour traiter la rosacée comprenants du chitosane et un amide dicarboxylique
KR20170112651A (ko) 클로로겐산 및 루틴 화합물을 유효성분으로 포함하는 피부 주름 예방 또는 개선용 조성물
WO2014109456A1 (fr) Composition pharmaceutique pour prévenir ou traiter une dyskératose folliculaire, contenant de la catéchine ou un dérivé de celle-ci
JP2023509009A (ja) Ｐｐａｒアゴニスト複合体およびその使用方法
KR20080063005A (ko) 피세아타놀 및 비타민 ａ류 (레티노이드)를 함유하는화장품 조성물
US20180140535A1 (en) Skin barrier repair and maintenance composition
JP2014144929A (ja) ビタミン類を含有するニキビの予防又は治療用組成物
Farrisa Cosmeceuticals for Acne and Rosacea
KR20170136220A (ko) 클로로겐산, 미르센, 또는 이들의 혼합물을 유효성분으로 함유하는 피부상태 개선용 조성물
MICHELLE et al. Skin Barrier Repair
RU2481845C2 (ru) Стабилизированная композиция местного применения, обладающая противоугревым и антибиотическим действием
CA3203878A1 (fr) Substances botaniques comme activateurs des wnt/.beta.- catenine, regulateurs des voies moleculaires, regenerateurs tissulaires et regulateurs biomarquers de la sante
Waranucha et al. Growth Suppression of Hamster Flank Glands by Topical Application of an Extract from" Kwao Keur"(Pueraria mirifica)
ITMI20120117A1 (it) Composizione per il trattamento delle malattie della pelle.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13871210

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13871210

Country of ref document: EP

Kind code of ref document: A1