WO2014104617A1 - 감염성 및 비감염성 염증질환 치료용 패치 키트 및 이의 용도 - Google Patents

감염성 및 비감염성 염증질환 치료용 패치 키트 및 이의 용도 Download PDF

Info

Publication number
WO2014104617A1
WO2014104617A1 PCT/KR2013/011385 KR2013011385W WO2014104617A1 WO 2014104617 A1 WO2014104617 A1 WO 2014104617A1 KR 2013011385 W KR2013011385 W KR 2013011385W WO 2014104617 A1 WO2014104617 A1 WO 2014104617A1
Authority
WO
WIPO (PCT)
Prior art keywords
patch
aluminum
copper
kit
infectious
Prior art date
Application number
PCT/KR2013/011385
Other languages
English (en)
French (fr)
Inventor
김경원
Original Assignee
Kim Kyoung Won
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kim Kyoung Won filed Critical Kim Kyoung Won
Publication of WO2014104617A1 publication Critical patent/WO2014104617A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/70—Web, sheet or filament bases ; Films; Fibres of the matrix type containing drug
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
    • A61N1/00—Electrotherapy; Circuits therefor
    • A61N1/02—Details
    • A61N1/04—Electrodes
    • A61N1/0404—Electrodes for external use
    • A61N1/0408—Use-related aspects
    • A61N1/0428—Specially adapted for iontophoresis, e.g. AC, DC or including drug reservoirs
    • A61N1/0432—Anode and cathode
    • A61N1/0436—Material of the electrode
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]

Definitions

  • the present invention relates to a patch kit for treating infectious and non-infectious inflammatory diseases, and by using the patch kit of the present invention, it is possible to suppress the expression of proteins related to the inflammatory response and to treat the infectious and non-infectious inflammatory diseases.
  • Inflammatory diseases are reactions in the human body, including infection and non-infection. Symptoms of inflammation include fever, redness, edema, and pain. Late in the inflammatory process, the migration of white blood cells from the inflammatory site and cytokines, degradative enzymes, and bioactive lipid intermediates. Intracellular changes occur, such as transient reactive oxygen species and the production of sensitized lmphocytes. In addition, in chronic inflammatory diseases, cell activation and cell death occur due to infiltration of white blood cells. Prostaglandins and nitric oxide (NO) are important mediators for the development of carcinogenesis and inflammation.
  • NO nitric oxide
  • Nonsteroidal antiinflammatory drugs one of the drugs that control inflammation and pain, have pharmacological effects by inhibiting COX, which produces prostaglandin in the body.
  • COX has been shown to exist in two isoforms, COX-1 and COX-2, of which COX-1 produces PGs that are involved in cellular protection and regulation in the gastrointestinal mucosa, platelets, and kidneys under normal conditions.
  • COX-2 is very low in normal cells, COX-2 is induced by various stimuli (cytokine, endotoxin, mitogen) in inflammation-related cells and is involved in the production of PGs that are involved in pain or inflammation.
  • Nitric oxide is also involved in the regulation of vascular tone, neurotransmission, killing of bacteria and cancer cells. High levels of NO also occur in physiological reactions such as circulatory shock, inflammation, and carcinogenesis. Neuronal NO and endothelial NO are also present in normal conditions, whereas iNOS (NOS type 2) is induced and expressed by LPS, cytokines, and the like.
  • iNOS NOS type 2
  • LPS low-denspasmodase
  • cytokines cytokines
  • the nonsteroidal inflammatory diseases also inhibit the production of PG related to gastric mucosa protection and platelet function in addition to PGs involved in inflammatory reactions in the human body, and also have side effects such as gastrointestinal disorders and bleeding. Will appear together. Therefore, the development of a therapeutic agent for inflammatory diseases without side effects is required.
  • the present inventors completed the present invention by developing a patch kit capable of treating an inflammatory disease by inhibiting the expression of a protein related to an inflammatory response using a microcurrent generated by the difference in electronegativity.
  • an object of the present invention is to provide a patch kit for treating an inflammatory disease comprising a positive metal patch and a negative metal patch.
  • the present invention provides a patch kit for treating infectious and non-infectious inflammatory disease comprising a positive metal patch and a negative metal patch.
  • the electronegativity difference between the anode metal patch and the cathode metal patch is characterized in that the 0.01 to 1.75.
  • the current generated by the electronegativity difference between the anode metal patch and the cathode metal patch is characterized in that 1nA to 2 ⁇ A.
  • the metal is characterized in that the metal is not cytotoxic.
  • the aluminum patch is characterized in that it has a thickness of 1 ⁇ m to 100 ⁇ m.
  • the cytotoxic metal is characterized in that at least two selected from the group consisting of lithium magnesium aluminum, zinc, iron, copper, germanium, gold, silver, platinum, and tin. .
  • the patch is characterized in that it is selected from the group consisting of rectangular, polygonal, circular, oval, lattice, needle, and amorphous.
  • the patch is characterized in that it has a thickness of 1 ⁇ m to 100 ⁇ m.
  • the patch is characterized in that the purity of 95% to 99.99%.
  • the inflammatory disease is from the group consisting of inflammation and non-infection, including hepatitis, esophagitis, gastritis, dermatitis, arthritis, enteritis, vaginitis, pneumonia, cholangitis, cholecystitis, and pancreatitis It is characterized by being selected.
  • the present invention also provides a method of inhibiting the expression of an inflammation-inducing protein by attaching the kit of the present invention to a subject.
  • the subject is characterized in that the mammal.
  • the inflammation-producing protein is characterized in that the AP-1 or p38.
  • the patch for treating inflammatory diseases of the present invention generates electrical stimulation by the difference in the electronegativity between the anode metal patch and the cathode metal patch, suppresses the expression of inflammatory disease-related proteins, thereby preventing all infectious and non-infectious diseases occurring in humans.
  • the inflammatory response can be suppressed, and because of this, it is possible to treat an inflammatory disease and at the same time it does not exhibit cytotoxicity.
  • 1 is a photograph of a sticker sheet to which an aluminum patch and a copper patch of the present invention are attached.
  • Figure 2 (A) is a photograph showing that the aluminum-copper patch of the present invention attached to a dish
  • Figure 2 (B) is shown in the saline solution, RPMI1640 medium, and RPMI1640 medium cultured RAW264.7 cells, respectively
  • the patch kit of the invention is attached is a diagram showing that the current is generated.
  • Figure 3 shows the results of comparison of the production of NO in RAW264.7 cells and peritoneal macrophages
  • Figure 3 (A) is (a) untreated, (b) LPS, (c) aluminum-copper patch
  • Figure 3 (B) shows the NO production value when LPS and aluminum-copper patch treatment
  • Figure 26 (B) is treated with pam3CSK (+) / untreated (-) and aluminum-copper patch to RAW264.7 cells
  • (+) / not (-) treatment when compared to the results shown
  • Figure 3 (C) is a (a) untreated, (b) LPS, (c) aluminum-copper patch, peritoneal macrophages
  • (d) A diagram showing the amount of NO generated when the LPS + aluminum-copper patch is treated.
  • Figure 4 shows the result of comparing the production amount of PGE 2 in RAW264.7 cells
  • Figure 4 (A) (a) when not treated with both LPS and aluminum-copper patch, (b) when only LPS, c) When only the aluminum-copper patch is treated, (d) shows the PGE 2 production value when both LPS and aluminum-copper patch are treated, and FIG. 4 (B) shows (a) both pam3CSK and aluminum-copper patch. Otherwise, (b) when only pam3CSK is treated, (c) when only aluminum-copper patches are processed, and (d) when PGE 2 is processed when both pam3CSK and aluminum-copper patches are shown.
  • Figure 5 shows the viability of cells when RAW264.7 cells and HEK293 cells were exposed to aluminum-copper patch.
  • Figure 6 shows the effect of aluminum-copper patch treatment on the expression of inflammatory response genes (COX-2, iNOS, TNF- ⁇ , IL-1 ⁇ , IL-6, IFN- ⁇ , and IL-12).
  • FIG. 7 (A) shows that (a) both LPS and aluminum-copper patches, (b) only LPS, and (c) aluminum-copper patches only, (d) LPS and aluminum-copper patches.
  • Figure 7 shows the degree of COX-2 gene expression when both patches are treated.
  • FIG. 8 shows the inhibitory effect of aluminum-copper patches on activating cell nuclear translocation of inflammatory transcription factors (p65, c-Jun, and c-Fos).
  • FIG. 9 shows that phosphorylation of ERK, JNK1 / 2, and p38 transcription factors is inhibited when aluminum-copper patches are treated.
  • FIG. 10 (A) shows that MKK3 / 6, which is a major kinase of p38, was not phosphorylated when the aluminum-copper patch was treated.
  • FIG. 10 (B) shows that p38 was treated when the aluminum-copper patch was treated. The results show that the dephosphorylation agent MKP-1 is not enhanced, and
  • FIG. 10 (C) shows that the treatment of aluminum-copper patch blocks the active substance of MKK3, a phosphatase of p38.
  • the inventors of the present invention have studied to develop an agent for treating an inflammatory disease having no side effects on the human body, and have led to the development of an anode metal patch and a cathode metal patch.
  • the present inventors found that the nano current is generated by using two metals having different electronegativity, and as a result, when the electronegativity difference between the two metals is 0.01 to 1.75, the inflammatory disease can be treated. It was confirmed that the present invention was completed.
  • the patch kit of the present invention has a difference in electronegativity between the two metals, the positive electrode and the negative electrode, in the range of 0.01 to 1.75. Therefore, the metal used in the patch kit of the present invention is not limited thereto if the electronegativity difference between the anode metal patch and the cathode metal patch is 0.01 to 1.75.
  • the metals of the following drawings are all applicable to the area, but heavy metals or low purity of the metals below can not be used for cytotoxicity.
  • Metal used in the present invention should be a non-cytotoxic metal.
  • Two or more (two) selected from lithium, magnesium, aluminum, zinc, iron, copper, germanium, gold, silver, platinum or tin of the high purity non-toxic metal, and most preferably aluminum And copper may be selected, but if there is no cytotoxic metal is not limited in kind.
  • the current generated by the difference in the electronegativity may be 1nA to 2 ⁇ A, preferably 50nA as in the embodiment of the present invention, if the current generated by the electronegativity difference is not limited thereto no.
  • the patch of the present invention may be square, rectangular, polygonal, circular, oval, lattice, or needle-shaped, preferably square or rectangular, but most preferably in the rectangular form as in the embodiment of the present invention. Used, but not limited to. In particular, when used as a rectangle, the length of one side may be 1 ⁇ m to 50 cm, but is not limited thereto.
  • the patch may preferably have a thickness of 1 ⁇ m to 200 ⁇ m, more preferably 15 ⁇ m to 150 ⁇ m, and most preferably 17 ⁇ m to 100 ⁇ m as in the embodiment of the present invention. If the thickness can be generated well, it is not limited thereto.
  • the purity of the patch may be 95% to 99.99%. If the purity of the metals is less than 95%, the cells may die due to the toxicity of heavy metals that may be contained in the metals.
  • the aluminum-copper patch kit of the present invention can be used to treat inflammatory diseases.
  • the inflammatory disease may be any of hepatitis, esophagitis, gastritis, dermatitis, arthritis, enteritis, vaginitis, pneumonia, cholangitis, cholecystitis, or pancreatitis, but may be any other infectious and / or non-infectious inflammatory disease.
  • the patch kit of the present invention can be used in the form of a sticker by applying an adhesive on one side (see Fig. 1).
  • the patch kits of the present invention may be attached to an individual via a support.
  • the support consists of a front face (side exposed to the skin during use) and a back side (side exposed to the environment during use).
  • the support material is glass, cellulose plastics (CA, CP), polyethylene (PE), polyethylene terephtalate (PET), polyvinyl chlorides (PVCs), polypropylenes, Polystyrenes, polycarbonates, polyacrylics, poly (methyl methacrylate), PMMA, or fluoropolymers (e.g. PTFE) It is not limited, and is not limited if it is adhered to the object so that the anode metal patch and the cathode metal patch can generate a current.
  • CA cellulose plastics
  • PE polyethylene
  • PET polyethylene terephtalate
  • PVCs polyvinyl chlorides
  • Polystyrenes polycarbonates
  • polyacrylics poly (methyl methacrylate)
  • PMMA or flu
  • the present inventors experimented by selecting aluminum as the anode metal patch and copper as the cathode metal patch.
  • the anode-cathode metal patch kit of the present invention generates current in the cell culture medium, it was confirmed that the current is generated by comparing with and without aluminum-copper patch. (See Example 1).
  • transcription factors NF- ⁇ B, AP-1, CREB, and STAT-1 related to the inflammatory response was quantified using RT-PCT, and the expression of the gene was suppressed due to the aluminum-copper patch. (See Example 4).
  • the present invention can provide a method of inhibiting expression of AP-1 and p38 proteins by attaching an aluminum-copper patch kit to a subject, wherein the subject is a mammal.
  • the mammal may be a human, a dog, a horse, a sheep, a pig, a cat, or the like, but is not limited thereto.
  • aluminum and copper were selected as metals having no cytotoxicity, and at this time, aluminum-copper patches (nanocurrent-generating aluminum-copper patches, NGACP) were supplied from Human Nano Electrotech (Seoul, Korea, trade name: PalmiBand).
  • NGACP nanocurrent-generating aluminum-copper patches
  • Pam3CSK 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide, a tetrazole (MTT);
  • lipopolysaccharide lipopolysaccharide, E. coli 0111: B4; hereafter referred to as LPS
  • LPS lipopolysaccharide
  • EIA enzyme immunoassay
  • ELISA enzyme-linked immunosorbent assay
  • Fetal bovine serum (FBS) and RPMI 1640 culture medium in culture medium were purchased from GIBCO (Grand Island, NY), RAW264.7 and HEK293 cell lines were purchased from ATCC (Rockville, MD), etc. Other materials were supplied from Sigma as analytical grade.
  • the RAW264.7 cell line is a cell line mainly used in inflammation-related experiments
  • the HEK293 cell line is a well-transfected cell line, which is widely used for producing therapeutic proteins and viruses in gene therapy.
  • c-Fos, c-Jun, extracellular signal-related kinase (ERK), c-Jun N-terminal kinase (JNK), p38, mitogen-activated protein kinase kinase 3/6 (MKK3 / 6), MKP-1 Phospho-specific or other antibodies against, lamin A / C, and ⁇ -actin were purchased from Cell Signaling (Beverly, MA) and used.
  • the production of aluminum-copper patches was performed by using copper having 99.92% purity of copper to produce a 1 cm 2 wide metal plate having a thickness of 100 ⁇ m as a cathode, and using an aluminum patch (purity). 99.70%, thickness 17 ⁇ m, width 1cm 2 ) was prepared in the same manner and used as the anode (anode).
  • the degree of current generation was measured by comparing the case with and without the aluminum-copper patch.
  • Two electrodes (anode and cathode) are attached to a multimeter (DMM 4040, Tektronix, USA) with double-sided tape to sink in saline or each cell culture medium (saline, RPMI1640, and RPMI1640 incubated with RAW264.7) to generate current Observed.
  • DMM 4040 Tektronix, USA
  • the medium with aluminum-copper patches produced nano-level currents of 35 nA to 55 nA, and as shown on the left of FIG. 2A, medium without the aluminum-copper patch No current generation was found at all.
  • C57BL / 6 male mice (6-8 weeks old, 17-21 g) were purchased from DAEHAN BIOLINK (Chungbuk, Korea) and bred by autonomous feeding of water and food under normal circumstances. The experiment was performed according to the guidelines of Sungkyunkwan University Institutional Animal Care and Use Committee.
  • Peritoneal macrophages were harvested 4 days after injecting 1 ml of 4% thioglycolate medium (Difco Laboratories, Detroit, MI) from C57BL / 6 male mice (7-8 weeks old, weighing 17-21 g) intraperitoneally. After washing, it was obtained by washing with RPMI 1640 culture containing 2% FBS. The peritoneal macrophages (1 ⁇ 10 6 cells / ml) were placed under 5% CO 2 humidity at 37 ° C. for 4 hours in a 100-mm culture dish.
  • 4% thioglycolate medium Difco Laboratories, Detroit, MI
  • Peritoneal macrophages and cell lines (RAW264.7 and HEK293 cells) contain 10% heat-inactivated fetal bovine serum (Gibco, Grand Island, NY), glutamine, and antibiotics (penicillin and streptomycin). Incubated at 37 ° C., 5% CO 2 conditions in the added RPMI 1640 medium. For each experiment, cells were removed using a cell scraper. The cells were examined by Trypan blue dye exclusion, and the ratio of dead cells was determined to be less than 1% at a density of 2 ⁇ 10 6 cells / ml for the experiment.
  • LPS is used to promote the expression of inflammation-causing factors, namely NO, PGE 2 and TNF- ⁇ .
  • the Griess reagent and ELISA kits were analyzed to see if they inhibited the production of NO, PGE 2 , and TNF- ⁇ .
  • RAW264.7 cells stimulated with LPS or pam3CSK and peritoneal macrophages were preincubated for 18 hours, followed by incubation for 24 hours with an aluminum-copper patch. Cytotoxicity was assessed using the traditional MTT assay. Three hours before the end of the culture, 10 ⁇ l of MTT solution (10 mg / ml in phosphate buffered saline, pH 7.4) was added to each well, and the culture was continued until the end of the experiment. Thereafter, 15% sodium dodecyl sulfate was added to each well to stop the incubation, and formazan was dissolved to reduce viable cells to purple. Through this, the absorbance of 570 nm (O.D. 570-630) was measured using a Spectramax 250 microplate reader.
  • RAW264.7 cells stimulated with pam3CSK had a significantly lower NO production when the aluminum-copper patch was treated, compared to when only pam3CSK was treated.
  • peritoneal macrophages when the peritoneal macrophages are normal (a), when treated with LPS (b), when the aluminum-copper patch ( c)
  • the amount of NO produced was reduced when the aluminum-copper patch was treated.
  • the amount of PGE 2 produced by pam3CSK-stimulated RAW264.7 cells was 60 ⁇ m or less when the aluminum-copper patch was treated, and the amount of PGE 2 produced by only pam3CSK was about 100 ⁇ m. Remarkably less than that.
  • the inflammatory response related genes all showed similar expression patterns as iNOS (see FIG. 7A) and COX-2 (see FIG. 7B).
  • transcriptional activation of the inflammatory response induced by LPS can be a target of aluminum-copper patches.
  • MKK3 / 6 a major kinase of p38, was not phosphorylated (see FIG. 10 (A)) and did not enhance MKP-1, a dephosphorylating agent of p38 (see FIG. 10 (B)). Accordingly, as shown in FIG. 10 (C), it was found that the aluminum-copper patch treatment prevented the phosphorylation of MKK3 itself, thus preventing p38 from phosphorylating, so that neither p38 nor phosphorylated p38 was expressed (FIG. 10 (C). ) Reference).
  • SB203580 (hereinafter referred to as SB), an inhibitor specific to LPS-activated RAW264.7 cells, was used to confirm the functional significance of p38 in the inflammatory response. SB also inhibited the expression of COX-2 and TNF- ⁇ mRNA (see FIG. 10 (A)) and inhibited TNF- ⁇ and PGE 2 release (see FIG. 10 (B)).
  • the patch for treating inflammatory diseases of the present invention generates electrical stimulation by the difference in the electronegativity between the anode metal patch and the cathode metal patch, suppresses the expression of inflammatory disease-related proteins, thereby preventing all infectious and non-infectious diseases occurring in humans. It can suppress the inflammatory response. Therefore, it can be useful in the medical field as a patch that can treat inflammatory diseases and does not exhibit cytotoxicity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Rheumatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pain & Pain Management (AREA)
  • Organic Chemistry (AREA)
  • Radiology & Medical Imaging (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 염증성 질환을 치료하는 금속 패치 키트에 관한 것으로서, 더욱 구체적으로는 두 금속 간의 전기음성도 차이에 의해 생성되는 나노 전류를 이용해 염증성 반응과 관련된 단백질의 발현을 억제하는 방법에 관한 것이다. 본 발명의 감염 및 비감염성 염증질환 치료용 패치 키트는 염증성 반응과 관련된 단백질을 효과적으로 억제하면서도, 생체 내에서 세포독성을 나타내지 않아 안전한 장점이 있다.

Description

감염성 및 비감염성 염증질환 치료용 패치 키트 및 이의 용도
본 발명은 감염성 및 비감염성 염증질환 치료용 패치 키트에 관한 것으로, 본 발명의 패치 키트를 이용하면, 염증성 반응과 관련된 단백질의 발현을 억제하여, 감염 및 비감염성 염증질환의 치료가 가능하다.
염증성질환은 감염 및 비감염을 포함한 인체 내의 반응이다. 염증의 증후로는 발열, 홍조, 부종, 통증 등이 있으며, 염증과정의 후반에는 염증부위로부터 백혈구의 이주 및 사이토카인(cytokine), 분해효소(degradative enzyme), 생활성지질 중간체(bioactive lipid intermediate), 일과성 반응적인 산화물질(transient reactive oxygen species), 림프구(sensitized lmphocyte)의 생성 등 세포내의 변화가 일어난다. 더불어 만성적인 염증 질환에서는 백혈구의 침윤에 의해 세포활성(cell activation) 및 세포사멸이 일어난다. 염증반응의 화학매개물 중 프로스타글란딘(prostaglandins)과 산화 질소(nitric oxide, NO)는 발암 및 염증의 진행과정에 중요한 매개물질이다.
염증이나 통증을 조절하는 약물 중 하나인 비스테로이드계 염증질환제 (nonsteroidal antiinflammatory drugs)는 체내에 프로스타글란딘(prostaglandin)을 생성하는 COX를 저해함으로써 약리작용을 나타낸다. COX는 COX-1과 COX-2의 두 가지 이성체(isoform)으로 존재한다는 것이 밝혀졌는데, 이중 COX-1은 정상상태에서 위장관 점막과 혈소판, 신장에서 세포 보호 작용과 조절 작용에 관여하는 PG류 생성에 관여하는 효소인데 반해, COX-2는 정상세포에서는 그 농도가 매우 낮으나 염증관련세포에서 여러 자극(cytokine, endotoxin,mitogen)에 의해 유도 발현되어 통증이나 염증에 관여하는 PG류 생성에 관여한다.
또한 산화질소(nitric oxide, NO)는 혈관의 긴장도(vascular tone), 신경전달(neurotransmission), 세균 및 암세포의 사멸 조절에 관여한다. 또한 높은 농도의 NO는 순환기 쇼크(circulatory shock), 염증(inflammation), 발암(carcinogenesis) 등의 생리반응에서 나타난다. 신경성 NO(Neuronal NO)와 내피성 NO(endothelial NO)는 정상적인 상태에서도 존재하며, 반면 iNOS(NOS type2)는 LPS, 사이토카인(cytokine) 등에 의해 유도되어 발현된다. 염증이나 통증을 조절하는 약물 중 상기 비스테로이드계 염증질환제 는 인체 내에서 염증 반응에 관여하는 PG류 이외에 위점막 보호, 혈소판기능과 관련된 PG의 생성도 억제하여, 위장관 장해나 출혈 등의 부작용도 함께 나타나게 된다. 따라서 부작용이 없는 염증성 질환의 치료제의 개발이 요구되고 있는 실정이다.
한편, N. Shafer, and G. Kitay, "Transcutaneous electrical nerve stimulation and pain relief: an overview," Med Electron, vol. 19, no. 5, pp. 132-136, 1988., A. Khadilkar, S. Milne, L. Brosseau, et al., "Transcutaneous electrical nerve stimulation (TENS) for chronic low-back pain," Cochrane Database Syst Rev, vol., no. 3, pp. CD003008, 2005., P. Sarzi-Puttini, M. A. Cimmino, R. Scarpa, et al., "Osteoarthritis: an overview of the disease and its treatment strategies," Semin Arthritis Rheum, vol. 35, no. 1 Suppl 1, pp. 1-10, 2005에는 약한 전기적 반응이 만성적 통증 및 염증성 증상을 개선할 수 있다고 기재되어 있다.
이에 본 발명자들은 전기음성도 차이에 의해 발생하는 미세전류를 이용하여 염증성 반응과 관련된 단백질의 발현을 억제함으로써, 염증성 질환의 치료가 가능한 패치 키트를 개발함으로써 본 발명을 완성하였다.
따라서 본 발명의 목적은 양극 금속 패치 및 음극 금속 패치를 포함하는 염증질환 치료용 패치 키트를 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 본 발명의 목적을 달성하기 위해서, 본 발명은 양극 금속 패치 및 음극 금속 패치를 포함하는 감염 및 비감염성 염증질환 치료용 패치 키트를 제공한다.
본 발명의 일구현예에 있어서, 상기 양극 금속 패치 및 음극 금속 패치의 전기음성도 차이는 0.01 내지 1.75 인 것을 특징으로 한다.
본 발명의 다른 구현예에 있어서, 상기 양극 금속 패치 및 음극 금속 패치의 전기음성도 차이에 의해 발생하는 전류는 1nA 내지 2μA 인 것을 특징으로 한다.
본 발명의 또 다른 구현예에 있어서, 상기 금속은 세포독성이 없는 금속인 것을 특징으로 한다.
본 발명의 또 다른 구현예에 있어서, 상기 알루미늄 패치는 1μm 내지 100μm의 두께를 가지는 것을 특징으로 한다.
본 발명의 또 다른 구현예에 있어서, 상기 세포독성이 없는 금속은 리튬 마그네슘 알루미늄, 아연, 철, 구리, 게르마늄, 금, 은, 백금, 및 주석으로 이루어지는 군으로부터 2 종 이상 선택되는 것을 특징으로 한다.
본 발명의 또 다른 구현예에 있어서, 상기 패치의 형태는 직사각형, 다각형, 원형, 타원형, 격자형, 침형, 및 무정형으로 이루어지는 군으로부터 선택되는 것을 특징으로 한다.
본 발명의 또 다른 구현예에 있어서, 상기 패치는 1μm 내지 100μm의 두께를 가지는 것을 특징으로 한다.
본 발명의 또 다른 구현 예에 있어서, 상기 패치의 순도는 95% 내지 99.99% 인 것을 특징으로 한다.
본 발명의 또 다른 구현 예에 있어서, 상기 염증성 질환은 간염, 식도염, 위염, 피부염, 관절염, 장염, 질염, 폐렴, 담도염, 담낭염, 및 췌장염을 포함하여 감염 및 비감염으로 발생하는 염증으로 이루어지는 군으로부터 선택되는 것을 특징으로 한다.
또한, 본 발명은 개체에 본 발명의 키트를 부착하여 염증 유발 단백질의 발현을 억제하는 방법을 제공한다.
본 발명의 일구현예에 있어서, 상기 개체는 포유동물인 것을 특징으로 한다.
본 발명의 다른 구현예에 있어서, 상기 염증 유발 단백질은 AP-1 또는 p38인 것을 특징으로 한다.
본 발명의 염증질환 치료용 패치는, 양극 금속 패치와 음극 금속 패치의 전기 음성도 차이에 의해 전기적 자극을 발생시켜, 염증성 질환 관련 단백질의 발현을 억제하여, 사람에게 발생하는 감염성 및 비감염성의 모든 염증반응을 억제할 수 있으며, 이로 인해 염증성 질환을 치료할 수 있는 동시에 세포독성을 나타내지 않는 특징이 있으므로, 생체에 적용되더라도 부작용이 없는 장점이 있다.
도 1은 본 발명의 알루미늄 패치와 구리 패치가 부착된 스티커 시트의 사진이다.
도 2(A)는 본 발명의 알루미늄-구리 패치를 디쉬(dish)에 부착한 것을 보여주는 사진이고, 도 2(B)는 각각 식염수, RPMI1640 배지, 및 RAW264.7 세포를 배양한 RPMI1640 배지에서 본 발명의 패치 키트를 부착할 경우 전류가 발생함을 보여주는 도면이다.
도 3은 RAW264.7 세포 및 복막 대식세포에서의 NO의 생성량 비교 결과를 나타낸 것으로, 도 3(A)는 (a) 무처리, (b) LPS, (c) 알루미늄-구리 패치, (d) LPS와 알루미늄-구리 패치 처리할 때의 NO 생성량 값을 나타낸 것이고, 도 3(B)는 RAW264.7 세포에 pam3CSK를 처리할 경우(+)/처리하지 않을 경우(-)와 알루미늄-구리 패치를 처리할 경우(+)/처리하지 않을 경우(-)를 비교하여 나타낸 결과이며, 도 3(C)는 복막 대식세포에 (a) 무처리, (b) LPS, (c) 알루미늄-구리 패치, (d) LPS+알루미늄-구리 패치를 처리할 때의 NO생성량을 나타낸 도면이다.
도 4는 RAW264.7 세포에서의 PGE2의 생성량 비교 결과를 나타낸 것으로, 도 4(A)는 (a) LPS와 알루미늄-구리 패치 모두 처리하지 않을 경우, (b) LPS만 처리할 경우, (c) 알루미늄-구리 패치만 처리할 경우, (d) LPS와 알루미늄-구리 패치 모두 처리할 경우의 PGE2 생성량 값을 나타낸 것이고, 도 4(B)는 (a) pam3CSK와 알루미늄-구리 패치 모두 처리하지 않을 경우, (b) pam3CSK만 처리할 경우, (c) 알루미늄-구리 패치만 처리할 경우, (d) pam3CSK와 알루미늄-구리 패치 모두 처리할 경우의 PGE2 생성량 값을 나타낸 도면이다.
도 5는 RAW264.7 세포와 HEK293 세포를 알루미늄-구리 패치에 노출시켰을 때 세포의 생존활성을 나타낸 도면이다.
도 6은 염증 반응 관련 유전자(COX-2, iNOS, TNF-α, IL-1β, IL-6, IFN-β, 및 IL-12) 발현에 있어서 알루미늄-구리 패치 처리의 효과를 나타낸 도면이다.
도 7(A)는 (a) LPS와 알루미늄-구리 패치 모두 처리하지 않을 경우, (b) LPS만 처리할 경우, (c) 알루미늄-구리 패치만 처리할 경우, (d) LPS와 알루미늄-구리 패치 모두 처리할 경우의 COX-2 유전자 발현 정도를 나타낸 것이고, 도 7(B)는 (a) LPS와 알루미늄-구리 패치 모두 처리하지 않을 경우, (b) LPS만 처리할 경우, (c) 알루미늄-구리 패치만 처리할 경우, (d) LPS와 알루미늄-구리 패치 모두 처리할 경우의 iNOS 유전자 발현 정도를 나타낸 것이다.
도 8은 염증반응 전사인자(p65, c-Jun, 및 c-Fos)들의 활성화하는 세포핵 전위에 있어서의 알루미늄-구리 패치의 저해 효과를 보여주는 도면이다.
도 9는 알루미늄-구리 패치를 처리할 경우 ERK, JNK1/2, 및 p38 전사인자의 인산화가 저해되는 것을 보여주는 도면이다.
도 10(A)는 알루미늄-구리 패치를 처리할 경우, p38의 주요 인산화효소인 MKK3/6이 인산화되지 않는 것을 보여주는 결과이고, 도 10(B)는 알루미늄-구리 패치를 처리할 경우, p38의 탈인산화제인 MKP-1를 강화하지 않는 것을 보여주는 결과이며, 도 10(C)는 알루미늄-구리 패치의 처리가 p38의 인산화효소인 MKK3의 활성자체를 차단함을 보여주는 도면이다.
본 발명자들은 인체에 부작용이 없는 염증성 질환의 치료용 제재를 개발하기 위해 연구한 결과, 양극 금속 패치 및 음극 금속 패치를 개발하기에 이르렀다.
전기적으로 생성된 음 이온은 약한 전류를 발생시키고, 발생된 전류가 박테리아나 곰팡이의 성장을 억제할 수 있는 것이 알려져 있다(T. J. Berger, et al., "Antifungal properties of electrically generated metallic ions," Antimicrob Agents Chemother, vol. 10, no. 5, pp. 856-860, 1976 및 T. J. Berger, et al., "Electrically generated silver ions: quantitative effects on bacterial and mammalian cells," Antimicrob Agents Chemother, vol. 9, no. 2, pp. 357-358, 1976).
이에, 본 발명자들은 전기음성도 차이가 나는 두 금속을 이용하여, 나노전류가 발생하는 것을 발견하여 연구한 결과, 두 금속 사이의 전기음성도 차이가 0.01 내지 1.75 일 때, 염증질환의 치료가 가능한 것을 확인하고 본 발명을 완성하였다.
따라서, 본 발명의 패치 키트는 양극과 음극의 두 금속의 전기 음성도 차이가 0.01 내지 1.75 범위이다. 그러므로, 본 발명의 패치 키트에 사용되는 금속은 양극 금속 패치와 음극 금속 패치의 전기 음성도 차이가 0.01 내지 1.75라면 이에 제한되지 않는다. 그 영역으로는 하기 도면의 금속이 모두 해당되나, 하기 금속 중에서 중금속이거나 순도가 낮아 세포독성이 있는 금속은 사용할 수 없다.
Figure PCTKR2013011385-appb-I000001
본 발명에서 쓰이는 금속은 세포독성이 없는 금속이어야 한다. 상기 세포독성이 없는 순도가 높은 금속 중 리튬, 마그네슘, 알루미늄, 아연, 철, 구리, 게르마늄, 금, 은, 백금 또는 주석으로부터 2 종(두 개) 이상 선택되어 사용될 수 있고, 가장 바람직하게는 알루미늄 및 구리를 선택할 수 있으나, 세포독성이 없는 금속이라면 종류에 제한은 없다.
또한, 상기 전기음성도 차이에 의해 발생하는 전류는 1nA 내지 2μA일 수 있고, 바람직하게는 본 발명의 실시예와 같이 50nA일 수 있으나, 상기 전기음성도차이에 의해 발생하는 전류라면 이에 제한되는 것은 아니다.
본 발명의 패치의 형태는 정사각형, 직사각형, 다각형, 원형, 타원형, 격자형, 또는 침형일 수 있고, 바람직하게는 정사각형이나 직사각형일 수 있으나, 가장 바람직하게는 본 발명의 실시예와 같이 직사각형 형태로 사용되나, 이에 제한되는 것은 아니다. 특히, 직사각형으로 사용될 때 한 변의 길이는 1μm 내지 50cm일 수 있으나 역시 이에 제한되지 않는다.
상기 패치는 바람직하게는 1μm 내지 200μm의 두께를 가질 수 있으며, 더욱 바람직하게는 15μm 내지 150μm의 두께일 수 있고, 가장 바람직하게는 본 발명의 일 실시예와 같이 17μm 내지 100μm 일 수 있으나, 전류를 잘 발생시킬 수 있는 두께라면 이에 한정되는 것은 아니다.
또한, 상기 패치의 순도는 95% 내지 99.99% 일 수 있다. 만약 상기 금속들의 순도가 95% 미만일 경우, 금속 안에 포함되어 있을 수 있는 중금속의 독성으로 인해 세포가 죽을 수 있다.
본 발명의 알루미늄-구리 패치 키트를 이용하면 염증성 질환을 치료할 수 있다. 상기 염증성 질환은 간염, 식도염, 위염, 피부염, 관절염, 장염, 질염, 폐렴, 담도염, 담낭염, 또는 췌장염 중의 어느 하나일 수 있으나, 그 외 감염성 및/또는 비감염성의 모든 염증 질환일 수 있다.
본 발명의 패치 키트는 한쪽 면에 접착제를 도포시켜 스티커 형태로 사용될 수 있다(도 1 참조).
추가적으로, 본 발명의 패치 키트는 지지체를 통해 개체에 접착될 수 있다. 지지체는 앞면(사용시 피부에 노출되는 면)과 뒷면(사용시 환경에 노출되는 면)으로 구성된다. 지지체의 소재는 유리, 셀룰로오스 플라스틱(cellulose plastics; CA, CP), 폴리에틸렌(polyethylene, PE), 폴리에틸렌테레프탈레이트(polyethylene terephtalate, PET), 폴리비닐클로라이드(polyvinyl chlorides, PVCs), 폴리프로필렌(polypropylenes), 폴리스티렌(polystyrenes), 폴리카보네이트 (polycarbonates), 폴리아크릴릭 (polyacrylics), 폴리메틸메타크릴레이트(Poly (methyl methacrylate), PMMA), 또는 플로오로폴리머(fluoropolymers; 예를 들어, PTFE) 등 일 수 있으나 이에 제한되지 않으며, 개체에 접착되어 양극 금속 패치와 음극 금속 패치가 전류를 발생시킬 수 있는 것이라면 제한되지 않는다.
본 발명자들은 본 발명의 실시예에서, 양극 금속 패치로는 알루미늄을, 음극 금속 패치로는 구리를 선택하여 실험하였다. 본 발명의 양극-음극 금속 패치 키트가 세포배양배지에서 전류가 생성하는지를 알아보기 위해, 알루미늄-구리 패치가 있는 경우와 없는 경우와 알루미늄-구리 패치가 있는 경우를 비교하여, 전류가 생성됨을 확인하였다(실시예 1 참조).
이에, 알루미늄-구리 패치가 전류를 생성시킨다면 세포 안에서 반응 환경을 변경시킬 수 있는 것이므로, 염증 반응을 조절할 수 있는지 실험한 결과, 알루미늄-구리 패치 키트를 부착할 경우, 염증과 관련 있는 것으로 알려진 NO, PGE2, 및 TNF-α의 생성량이 현저히 적으며, 알루미늄-구리 패치가 부착된 경우에도 세포의 생존활성이 유지되는 것을 확인하였다(실시예 3 참조).
또한, 염증반응과 관련된 전사 인자(NF-κB, AP-1, CREB, 및 STAT-1)들의 발현을 RT-PCT을 사용하여 정량한 결과, 상기 유전자의 발현이 알루미늄-구리 패치로 인해 억제되는 것을 확인하였다(실시예 4 참조).
아울러, 염증 반응에서 염증 유발 단백질들의 발현은 인산화 반응에 의해 일어나므로, 알루미늄-구리 패치가 염증성 반응 단백질의 인산화 자체를 방지하는지 확인하기 위해 면역블롯을 수행한 결과, p38가 인산화하지 못하게 한다는 것을 확인하였다(실시예 4-2 참조).
그러므로, 본 발명은 개체에 알루미늄-구리 패치 키트를 부착하여 AP-1 및 p38 단백질의 발현을 억제하는 방법을 제공할 수 있으며, 상기 개체는 포유동물인 것을 특징으로 한다.
상기 포유동물은 사람, 개, 말, 양, 돼지, 또는 고양이 등일 수 있으나, 이에 제한되지는 않는다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[재료예]
본 발명에서는 세포 독성이 없는 금속으로 알루미늄과 구리를 선정하였으며, 이때, 알루미늄-구리 패치(nanocurrent-generating aluminum-copper patch, NGACP)는 Human Nano Electrotech (Seoul, Korea, 상품명 : 팜디밴드)로부터 공급 받았고, Pam3CSK; 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a tetrazole (MTT); 및 리포폴리사카라이드(lipopolysaccharide, E. coli 0111:B4; 이하 LPS로 통칭)는 Sigma Chemical Co.(St. Louis, MO)로부터 구입했다.
또한, 프로스타글란딘 E2(Prostaglandin E2, 이하 PGE2) 및 TNF-α 레벨의 결정을 위하여 사용되는 Enzyme immunoassay (EIA) 키트 및 enzyme-linked immunosorbent assay (ELISA) 키트는 Amersham (Little Chalfont, Buckinghamshire, UK)으로부터 구입했다.
배양 배지에 넣어주는 소태아혈청 (Fetal bovine serum, FBS) 및 RPMI 1640 배양 배지는 GIBCO (Grand Island, NY) 로부터 구입하였고, RAW264.7 및 HEK293 세포주는 ATCC (Rockville, MD)로부터 구입하였으며, 기타 다른 재료들은 분석용 등급인 것으로 Sigma로부터 공급받아 사용하였다. 여기서 RAW264.7 세포주는 염증관련 실험에서 주로 사용되는 세포주이고, HEK293 세포주는 형질 주입이 잘되는 세포주로, 유전자 치료에 있어서 치료용 단백질 및 바이러스를 제조하는 것에 널리 사용된다.
또한, c-Fos, c-Jun, extracellular signal-related kinase (ERK), c-Jun N-terminal kinase (JNK), p38, mitogen-activated protein kinase kinase 3/6 (MKK3/6), MKP-1, lamin A/C, 및 β-actin에 대한 인산화 특이적 (Phospho-specific) 항체 또는 기타 다른 항체들은 Cell Signaling(Beverly, MA)으로부터 구입하여 사용하였다.
[실시예 1]
알루미늄-구리 패치의 전류 생성 측정
알루미늄-구리 패치의 제조는, 99.92%의 순도를 가진 구리를 이용하여, 100μm의 두께를 가지는 1cm2 넓이의 금속판이 되도록 연마하여 제조되는 구리 패치를 음극(cathode)으로 사용했고, 알루미늄 패치(순도 99.70%, 두께 17μm, 넓이 1cm2)도 같은 방법으로 제조하여 양극(anode)으로 사용했다.
알루미늄-구리 패치가 세포배양배지에서 전류를 생성하는지 알아보기 위해, 알루미늄-구리 패치가 없는 경우와 있는 경우를 비교하여 전류 생성정도를 측정하였다. 두 전극(양극 및 음극)을 multimeter(DMM 4040, Tektronix, USA)에 양면테이프로 부착하여 식염수 또는 각 세포배양배지(식염수, RPMI1640, 및 RAW264.7가 배양된 RPMI1640)에 가라앉혀, 생성되는 전류를 관찰했다.
그 결과, 도 2A 오른쪽에 나타낸 바와 같이, 알루미늄-구리 패치가 있는 배지는 35 nA 내지 55 nA의 나노-레벨의 전류를 생성시켰고, 도 2A의 왼쪽에 나타낸 바와 같이, 알루미늄-구리 패치가 없는 배지는 전류 생성이 전혀 발견되지 않았다. 이 결과를 통해, 세포배양배지에서 구리와 알루미늄 패치가 나노전류를 생성시켜, 세포의 반응 환경을 변경할 수 있다는 것을 알 수 있었다. 이에, 본 발명자들은 알루미늄-구리 패치 처리가 대식세포의 염증 반응을 조절할 수 있는지 실험하였고, 알루미늄-구리 패치의 염증 반응 저해 메커니즘을 연구했다.
[실시예 2]
세포의 배양
<2-1> 대식 세포의 준비
대식세포의 추출을 위해, C57BL/6 수컷 마우스 (6 내지 8주령, 17 내지 21 g)는 DAEHAN BIOLINK (Chungbuk, Korea) 로부터 구입하여 일반적인 환경에서 물과 먹이를 자율배식하여 사육했다. 실험은 Sungkyunkwan University Institutional Animal Care and Use Committee의 가이드라인에 따라 수행되었다.
복막 대식세포는 C57BL/6 수컷 마우스(7 내지 8주령, 무게 17 내지 21 g)로부터 1 ml의 4% 티오글리콜레이트 배지(Difco Laboratories, Detroit, MI)를 마우스의 복강 내에 주사하여 4일 후 적출한 뒤, 2% FBS를 포함한 RPMI 1640 배양액으로 세척하여 얻어냈다. 상기 복막 대식세포 (1×106 cells/ml)는 100-mm의 배양접시에 4시간 동안 37℃에서 5% CO2 습도 하에 놔두었다.
<2-2> 세포 배양 환경 조성
복막 대식세포 및 세포주(RAW264.7 및 HEK293 cells)는 10% 열비활성 소태아혈청(heat-inactivated fetal bovine serum; Gibco, Grand Island, NY), 글루타민(glutamine), 및 항생제(penicillin and streptomycin)를 첨가한 RPMI 1640 배지에서 37°C, 5% CO2 조건 하에서 배양되었다. 각각의 실험을 위해, 세포 스크래퍼를 이용하여 세포를 떼어냈다. 세포들은 Trypan blue dye exclusion을 통해 알아본 결과 실험을 위한 2×106 cells/ml의 밀도에서 죽은 세포의 비율이 1% 미만으로 측정되어 실험에 알맞음을 확인하였다.
<2-3> NO, PGE 2 , 및 TNF-α의 발현 촉진
RAW264.7 세포 또는 복막 대식세포(1×106 cells/ml)를 18시간 동안 회복시킨 후, 상기 세포 배양액에 알루미늄-구리 패치를 부착하여 30분 동안 방치하고, LPS(1 μg/ml)에서 24시간 동안 배양하였다. 여기서 LPS는 염증 유발 인자, 즉 NO, PGE2, TNF-α의 발현을 촉진시키는 용도로 사용되는 것이다.
[실시예 3]
NO 및 PGE 2 생성량 분석 및 독성 테스트
<3-1> NO 생성량 분석
알루미늄-구리 패치를 처리할 경우, NO, PGE2, 및 TNF-α의 생성을 저해하는지를 알아보기 위하여, the Griess 시약 및 ELISA 키트를 사용하여 분석했다.
LPS 또는 pam3CSK로 자극되어진 RAW264.7 세포와 복막 대식세포를 18시간에 걸쳐 전보온(preincubation)시킨 후, 알루미늄-구리 패치를 부착하여 24시간 동안 배양 시켰다. 세포독성(cytotoxic)은 전통적인 방법인 MTT assay를 사용하여 평가했다. 배양 종료를 3시간 앞두고, MTT 용액(10 mg/ml in phosphate buffered saline, pH 7.4) 10 μl를 각 well에 첨가해주고, 실험이 종료될 때까지 계속하여 배양했다. 이후 각 well에 15% sodium dodecyl sulfate를 각 well에 첨가하여 배양을 중단시키고, 포르마잔(formazan)을 용해시켜 생존세포를 보라색으로 환원시켰다. 이를 통해, 570 nm(O.D. 570-630)의 흡광도가 Spectramax 250 microplate reader를 사용하여 측정되었다.
그 결과, NO 생성량의 경우 흥미롭게도 도 3(A)에 나타낸 바와 같이, RAW264.7 세포는 무처리(Normal)일 때(a), LPS를 처리할 때(b), 알루미늄-구리 패치를 처리했을 때(c), LPS와 알루미늄-구리 패치를 모두 처리할 때(d), LPS만 처리할 때보다 LPS와 알루미늄-구리 패치를 모두 처리할 때의 NO 생성량이 현저히 적은 것을 확인하였다.
또한, 도 3(B)에 나타낸 바와 같이, pam3CSK로 자극된 RAW264.7 세포는 알루미늄-구리 패치가 처리될 경우의 NO 생성량은 6μm 이하로, pam3CSK만 처리될 때와 비교하여 현저히 적었다.
아울러, 복막 대식세포의 경우를 도 3(C)에 나타내었는데, 복막 대식세포는 무처리(Normal)일 때(a), LPS를 처리할 때(b), 알루미늄-구리 패치를 처리했을 때(c), LPS와 알루미늄-구리 패치를 모두 처리할 때(d)를 비교한 결과, 알루미늄-구리 패치를 처리할 때 NO의 생성량이 줄어드는 것을 확인할 수 있었다.
<3-2> PGE 2 생성량 분석
PGE2의 생성량은 도 4(A)에 나타낸 바와 같이, RAW264.7 세포에서 또한 LPS만 처리할 때(b)와 비교하여 LPS와 알루미늄-구리 패치를 함께 처리한 경우(d)가 PGE2의 생성량이 현저히 낮은 것을 확인하였다.
또한, 도 4(B)에 나타낸 바와 같이, pam3CSK로 자극된 RAW264.7 세포의 PGE2의 생성량은 알루미늄-구리 패치가 처리될 경우 60μm 이하로, pam3CSK만 처리될 때 PGE2의 생성량이 약 100μm인 것과 비교하여 현저히 적었다.
<3-3> 세포 생존활성 테스트(cell viability test)
아울러, 도 5에 나타낸 바와 같이, RAW264.7 및 HEK293 세포에 알루미늄-구리 패치 처리하여도 생존활성을 그대로 유지함을 보여주므로, 알루미늄-구리 패치 처리는 생체 내에서 비독성이라는 것을 알 수 있다.
상기 결과를 통해, 알루미늄-구리 패치 처리는 LPS나 pam3CSK에 의해 유도되는 염증성 반응을 억제 할 수 있을 뿐만 아니라, 생체 내에서 비독성이라는 결론을 얻을 수 있었다.
[실시예 4]
알루미늄-구리 패치가 염증 관련 인자에 미치는 영향 분석
<4-1> RT-PCR(real-time reverse transcriptase polymerase chain reaction)을 이용한 염증반응 관련 유전자들의 mRNA 레벨 분석
사이토카인 mRNA 표현 레벨 결정을 위해, 전체 RNA가 LPS-처리 RAW264.7 세포로부터 TRIzol Reagent (Gibco BRL)를 사용하여 분리되었다. 전체 RNA는 사용 전까지 영하 70℃에서 보관되었으며, mRNA의 정량은 real-time RT-PCR (SYBR Premix Ex Taq, Takara, Japan)과 real-time thermal cycler (Bio-Rad, Hercules, CA)를 사용하여 수행되었다.
NO 및 PGE2 생성의 저해 효과를 확인하기 위하여, 전사 레벨에 있어서의 저해를 측정했다. 알루미늄-구리 패치 처리 하에서 COX-2, iNOS, TNF-α, IL-1β, IL-6, IFN-β, and IL-12 과 같은 염증반응과 관련된 유전자들의 mRNA 레벨을 측정하였다(대조군 GAPDH). 그 결과 도 6에 나타낸 바와 같이, IL-1β를 제외한 대부분의 염증반응 관련 유전자들의 발현은 알루미늄-구리 패치 처리에 의해 억제되었다.
결과는 GAPDH에 대한 광학밀도로 표현하였다. 또한, mRNA 표현 레벨의 양적 평가를 위해 semi-quantitative RT reactions을 수행하였으며, 사용된 프라이머(Bioneer, Daejeon, Korea)는 하기 표 1에 기재하였다.
표 1
Name Sequence (5' to 3')
Real-time PCR
iNOS F GGA GCC TTT AGA CCT CAA CAG A
R TGA ACG AGG AGG GTG GTG
COX-2 F GGGAGTCTGGAACATTGTGA
R GCACATTGTAAGTAGGTGGA
TNF-α F TGC CTA TGT CTC AGC CTC TT
R GAG GCC ATT TGG GAA CTT CT
GAPDH F CAA TGA ATA CGG CTA CAG CAA C
R AGG GAG ATG CTC AGT GTT GG
Semiquantitative RT-PCR
TNF-α F TTGACCTCAGCGCTGAGTTG
R CCTGTAGCCCACGTCGTAGC
IL-1β F CAGGATGAGGACATGAGCACC
R CTCTGCAGACTCAAACTCCAC
IL-6 F GTACTCCAGAAGACCAGAGG
R TGCTGGTGACAACCACGGCC
COX-2 F CACTACATCCTGACCCACTT
R ATGCTCCTGCTTGAGTATGT
iNOS F CCCTTCCGAAGTTTCTGGCAGCAGC`
R GGCTGTCAGAGCCTCGTGGCTTTGG
IFN-β F CCACCACAGCCCTCTCCATCAACTAT
R CAAGTGGAGAGCAGTTGAGGACATC
IL-12 F CAGAAGCTAACCATCTCCTGGTTTG
R TCCGGAGTAATTTGGTGCTTCACAC
GAPDH F CACTCACGGCAAATTCAACGGCAC
R GACTCCACGACATACTCAGCA
이에 더하여, 염증 반응 관련 유전자들은 도 7에 나타낸 바와 같이, 모두 iNOS(도 7A 참조) 및 COX-2(도 7B 참조)와 비슷한 발현 패턴을 나타내었다.
상기 결과로부터 LPS에 의해 유도된 염증반응의 전사활성화는 알루미늄-구리 패치의 표적이 될 수 있다는 결론을 얻을 수 있다.
<4-2> 총 용균액, 핵 추출물 제조 및 면역블롯(immunoblotting)
알루미늄-구리 패치를 미리 처리해둔 LPS-treated RAW264.7 세포로부터 용균액 및 핵추출물을 얻어내어 인산화 정도, 또는 전체 전사인자 (p65, c-Jun, 및 c-Fos), lamin A/C, MAPKs (ERK, p38, 및 JNK), MKK 3/6, MKP-1, 및 β-actin에 대한 면역블롯 분석을 수행하였다.
그 결과, 도 8에 나타낸 바와 같이, 알루미늄-구리 패치 처리는 6시간 처리할 경우 c-Jun의 세포핵 전위를 대부분 차단하고, 다른 전사 인자들 또한 저해된다는 것을 알 수 있다. 따라서, c-Jun은 대표적인 ERK, p38 및 JNK 효소의 전사 인자이므로, 상기 효소들의 활성이 알루미늄-구리 패치 처리에 의해 차단됨을 확인하기 위하여 인산화반응 레벨 분석을 실시하였다.
그 결과는 도 9에 나타낸 바와 같이, 반응 1시간 만에 ERK, JNK1/2, p38의 인산화는 알루미늄-구리 패치 처리에 의해 강하게 저해되었다.
특히, p38의 주요 인산화효소인 MKK3/6가 인산화되지 않으며(도 10(A) 참조), p38의 탈인산화제인 MKP-1을 강화하지 않았다(도 10(B) 참조). 이에 따라, 도 10(C)에 나타낸 바와 같이, 알루미늄-구리 패치 처리는 MKK3의 인산화 자체를 방지하여, p38 또한 인산화하지 못하게 하므로 p38 및 인산화된 p38 또한 발현되지 않는다는 것을 발견하였다(도 10(C) 참조).
상기 발견은, MKK3/p38 경로가 염증 반응을 저해하는 알루미늄-구리 패치 처리의 주된 타겟이 될 수 있다는 것을 의미한다. 또한 LPS가 활성화된 RAW264.7 세포에 특이적인 저해제인 SB203580(이하 SB)를 사용하여, 염증 반응에 있어서 p38의 기능적 중요성을 확인하였다. SB는 또한 COX-2 및 TNF-α mRNA의 발현을 억제하고(도 10(A) 참조), TNF-α 및 PGE2 방출을 저해하였다(도 10(B) 참조).
상기로부터, 본 발명의 알루미늄-구리 패치를 처리하면, p38의 인산화를 억제하는 것이 가능하고, 염증 반응을 일으키는 NO 및 PGE2의 생성을 저해할 수 있으며, 세포독성이 없음을 알 수 있다. 즉, 염증을 유발하는 p38/AP-1 경로에 본 발명에 따른 알루미늄-구리 패치를 처리할 경우, 염증 반응을 방지할 수 있는 효과가 있다.
따라서 상기 결과들은 알루미늄-구리 패치 처리가 관절염이나 대장염과 같은 여러 염증성 질환에 있어 부작용없이 적용될 수 있다는 것을 의미한다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해되어야 한다.
본 발명의 염증질환 치료용 패치는, 양극 금속 패치와 음극 금속 패치의 전기 음성도 차이에 의해 전기적 자극을 발생시켜, 염증성 질환 관련 단백질의 발현을 억제하여, 사람에게 발생하는 감염성 및 비감염성의 모든 염증반응을 억제할 수 있다. 따라서 이로 인해 염증성 질환을 치료할 수 있는 동시에 세포독성을 나타내지 않는 패치로써, 의료 분야에서 유용하게 이용될 수 있다.

Claims (12)

  1. 양극 금속 패치 및 음극 금속 패치를 포함하는 감염 및 비감염성 염증질환 치료용 패치 키트.
  2. 제 1항에 있어서,
    상기 양극 금속 패치 및 음극 금속 패치의 전기음성도 차이는 0.01 내지 1.75 인 것을 특징으로 하는, 패치 키트.
  3. 제 1항에 있어서,
    상기 양극 금속 패치 및 음극 금속 패치의 전기음성도 차이에 의해 발생하는 전류는 1nA 내지 2μA 인 것을 특징으로 하는, 패치 키트.
  4. 제 1항에 있어서,
    상기 금속은 세포독성이 없는 금속인 것을 특징으로 하는, 패치 키트.
  5. 제 4항에 있어서,
    상기 세포독성이 없는 금속은 리튬, 마그네슘, 알루미늄, 아연, 철, 구리, 게르마늄, 금, 은, 백금, 및 주석으로 이루어지는 군으로부터 2종 이상 선택되는 것을 특징으로 하는, 패치 키트.
  6. 제 1항에 있어서,
    상기 패치의 형태는 직사각형, 다각형, 원형, 타원형, 격자형, 침형, 및 무정형으로 이루어지는 군으로부터 선택되는 것을 특징으로 하는, 패치 키트.
  7. 제 1 항에 있어서,
    상기 패치는 1μm 내지 100μm의 두께를 가지는 것을 특징으로 하는, 패치 키트.
  8. 제 1항에 있어서,
    상기 패치의 순도는 95% 내지 99.99% 인 것을 특징으로 하는, 패치 키트.
  9. 제 1항에 있어서,
    상기 염증질환은 간염, 식도염, 위염, 피부염, 관절염, 장염, 질염, 폐렴, 담도염, 담낭염, 및 췌장염으로 이루어지는 군으로부터 선택되는 것을 특징으로 하는, 패치 키트.
  10. 개체에 제 1항의 패치 키트를 부착하여 염증 유발 단백질의 발현을 억제하는 방법.
  11. 제 10항에 있어서,
    상기 개체는 포유동물인 것을 특징으로 하는, 방법.
  12. 제 10항에 있어서,
    상기 염증 유발 단백질은 AP-1 또는 p38인 것을 특징으로 하는, 방법.
PCT/KR2013/011385 2012-12-24 2013-12-10 감염성 및 비감염성 염증질환 치료용 패치 키트 및 이의 용도 WO2014104617A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020120152103A KR101445005B1 (ko) 2012-12-24 2012-12-24 감염성 및 비감염성 염증질환 치료용 패치 키트 및 이의 용도
KR10-2012-0152103 2012-12-24

Publications (1)

Publication Number Publication Date
WO2014104617A1 true WO2014104617A1 (ko) 2014-07-03

Family

ID=51021610

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/011385 WO2014104617A1 (ko) 2012-12-24 2013-12-10 감염성 및 비감염성 염증질환 치료용 패치 키트 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101445005B1 (ko)
WO (1) WO2014104617A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20230080524A1 (en) * 2021-08-24 2023-03-16 Industry-Academic Cooperation Foundation Pharmaceutical composition for treating inflammatory diseases comprising germanium telluride nanosheets coated with polyvinylpyrrolidone

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102596674B1 (ko) 2020-02-27 2023-11-01 연세대학교 원주산학협력단 전기자극을 이용한 여드름 개선 장치

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040053184A (ko) * 2001-10-24 2004-06-23 파워 페이퍼 리미티드 피부 패치
KR20050121277A (ko) * 2003-06-02 2005-12-26 파워 페이퍼 리미티드 피부 내로 산화제의 조절된 운반을 위한 키트, 디바이스 및그의 방법
KR101203768B1 (ko) * 2011-02-23 2012-11-21 신현우 통증 및 염증 완화성분을 함유한 저주파 자극기용 전도성 하이드로겔 전극 패취

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040053184A (ko) * 2001-10-24 2004-06-23 파워 페이퍼 리미티드 피부 패치
KR20050121277A (ko) * 2003-06-02 2005-12-26 파워 페이퍼 리미티드 피부 내로 산화제의 조절된 운반을 위한 키트, 디바이스 및그의 방법
KR101203768B1 (ko) * 2011-02-23 2012-11-21 신현우 통증 및 염증 완화성분을 함유한 저주파 자극기용 전도성 하이드로겔 전극 패취

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20230080524A1 (en) * 2021-08-24 2023-03-16 Industry-Academic Cooperation Foundation Pharmaceutical composition for treating inflammatory diseases comprising germanium telluride nanosheets coated with polyvinylpyrrolidone
US11896609B2 (en) * 2021-08-24 2024-02-13 Industry-Academic Cooperation Foundation Pharmaceutical composition for treating inflammatory diseases comprising germanium telluride nanosheets coated with polyvinylpyrrolidone

Also Published As

Publication number Publication date
KR101445005B1 (ko) 2014-09-26
KR20140082306A (ko) 2014-07-02

Similar Documents

Publication Publication Date Title
Arruda et al. Calcium homeostasis and organelle function in the pathogenesis of obesity and diabetes
Lee et al. Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress
Carling et al. Beyond energy homeostasis: the expanding role of AMP-activated protein kinase in regulating metabolism
Ranganathan et al. Tumor cell dormancy induced by p38SAPK and ER-stress signaling: an adaptive advantage for metastatic cells?
Kyung et al. Rutin inhibits osteoclast formation by decreasing reactive oxygen species and TNF-α by inhibiting activation of NF-κB
JP3859699B2 (ja) 治療用組成物
Hu et al. Role of Extracellular Signal-Regulated Kinase, p38 Kinase, and Activator Protein-1 in Transforming Growth Factor-β 1–Induced Alpha Smooth Muscle Actin Expression in Human Fetal Lung Fibroblasts In Vitro
McCloskey et al. Chemotaxis of rat mast cells toward adenine nucleotides
Zituni et al. The growth of Staphylococcus aureus and Escherichia coli in low-direct current electric fields
Kim et al. Indoprofen prevents muscle wasting in aged mice through activation of PDK1/AKT pathway
WO2010151005A2 (ko) 하이드록시클로로퀸을 포함하는 항암 치료를 위한 국소 투여용 주사제 조성물
WO2014104617A1 (ko) 감염성 및 비감염성 염증질환 치료용 패치 키트 및 이의 용도
Asai et al. Identification of small-molecule inhibitors of nucleoside triphosphate hydrolase in Toxoplasma gondii
Miyata et al. Mitogen‐activated protein kinase/extracellular signal‐regulated protein kinase activation of cultured human dental pulp cells by low‐power gallium‐aluminium‐arsenic laser irradiation
Lichtenstein Cancer: evolutionary, genetic and epigenetic aspects
Laychock Evidence for guanosine 3’, 5’-monophosphate as a putative mediator of insulin secretion from isolated rat islets
Forrest et al. Calcium-dependent regulation of the membrane potential and extrajunctional acetylcholine receptors of rat skeletal muscle
Rizzo et al. Arachidonic acid induces mobilization of calcium stores and c-jun gene expression: evidence that intracellular calcium release is associated with c-jun activation
Mesto et al. Involvement of P2Y signaling in the restoration of glucose‐induced insulin exocytosis in pancreatic β cells exposed to glucotoxicity
Xia et al. The Role of Fgf9 in the Antidepressant Effects of Exercise and Fluoxetine in Chronic Unpredictable Mild Stress Mice
Wu et al. Effects of ibandronate sodium, a nitrogen-containing bisphosphonate, on intermediate-conductance calcium-activated potassium channels in osteoclast precursor cells (RAW 264.7)
García-Velázquez et al. An update on the molecular pillars of aging
Wurtz et al. Phenotypic and transcriptomic analyses of Plasmodium falciparum protein kinase A catalytic subunit inhibition
WO2017069376A1 (ko) ＩＫＫε 억제제를 함유하는 염증질환의 치료용 조성물
Harper et al. Targeting macrophages and their recruitment in the oral cavity using swellable (+) alpha tocopheryl phosphate nanostructures

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13869508

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13869508

Country of ref document: EP

Kind code of ref document: A1