WO2014102241A1 - Genes/genetic elements associated with mating impairment in trichoderma reesei qm6a and its derivatives and process for their identification - Google Patents

Genes/genetic elements associated with mating impairment in trichoderma reesei qm6a and its derivatives and process for their identification Download PDF

Info

Publication number
WO2014102241A1
WO2014102241A1 PCT/EP2013/077910 EP2013077910W WO2014102241A1 WO 2014102241 A1 WO2014102241 A1 WO 2014102241A1 EP 2013077910 W EP2013077910 W EP 2013077910W WO 2014102241 A1 WO2014102241 A1 WO 2014102241A1
Authority
WO
WIPO (PCT)
Prior art keywords
trire2
seq
strain
mating
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2013/077910
Other languages
English (en)
French (fr)
Inventor
Christian P. Kubicek
Rita Linke
Bernhard Seiboth
Thomas Haarmann
Patrick Lorenz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AB Enzymes GmbH
Original Assignee
AB Enzymes GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by AB Enzymes GmbH filed Critical AB Enzymes GmbH
Priority to DK13814970.3T priority Critical patent/DK2938727T3/en
Priority to CA2891952A priority patent/CA2891952A1/en
Priority to CN201380068881.4A priority patent/CN105980565A/zh
Priority to EP13814970.3A priority patent/EP2938727B1/en
Priority to JP2015550064A priority patent/JP6660181B2/ja
Priority to US14/758,238 priority patent/US9920384B2/en
Publication of WO2014102241A1 publication Critical patent/WO2014102241A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/145Fungi isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi
    • C12R2001/885Trichoderma

Definitions

  • the present invention relates to genes/genetic elements associated with mating impairment of strain Trichoderma reesei QM6a or strains derived thereof.
  • the invention further relates to a process for identifying genes/genetic elements associated with mating impairment in Trichoderma reesei QM6a and strains derived thereof. Said process enables a rapid and efficient identification of genes/genetic elements associated with mating impairment. Consequently, the present invention relates towards an approach to advance tools for manipulating Trichoderma reesei towards improved and facilitated strain breeding so as to be able to improve industrial producer strains by classical genetic means.
  • Filamentous fungi are capable of producing high amounts of extracellular proteins. Yet, the production level of any protein of interest in naturally occurring strains is usually too low for commercial exploitation, rendering substantial strain improvement programs essential (Punt 2002). In industrial filamentous fungi, this is traditionally done by classical mutagenesis, and/or targeted gene manipulation in combination with protein engineering. Basically, this approach consists of subjecting the fungus to sub-lethal doses of mutagens (frequently used: for example irradiation by UV light or ionizing radiation, addition of chemical mutagens like nitrosomethyl guanidine, ethylmethansulfonat or ethidium bromide) and subsequent screening of the survivors for improved production of the desired product. Obviously, this approach is only as good as the selection method.
  • mutagens frequently used: for example irradiation by UV light or ionizing radiation, addition of chemical mutagens like nitrosomethyl guanidine, ethylmethansulfonat or
  • Trichoderma reesei (teleomorph Hypocrea jecorina) is a workhorse organism for the industrial production of enzymes. Using random mutagenesis, academic and industrial research programs have, over several decades, produced strains of T. reesei whose enzyme productivity is several times higher than that of the "original" T. reesei strain QM6a that was isolated from US Army tent canvas in 1944 in the Solomon Islands (LeCrom et al. 2009).
  • jecorina belong to the group of Ascomycetes (class of Sordariomycetes) and within this group to those fungi which are heterothallic. Heterothallisnn means that the two mating type loci MAT1 -1 and MAT1 -2 which are necessary for successful sexual reproduction occur in different strains and self-fertilization is not possible.
  • T. reesei produces perithecia that are initiated by coiled or variously distinctive structures containing the ascogonium.
  • the ascogonium is the cell that will receive a nucleus during mating and go on to produce the dikaryotic hyphal system.
  • One of the cells within the coil functions as the ascogonium and the rest either remains inactive or gives rise to hyphae that branch and proliferate to surround the entire structure. In many cases neighboring hyphae also engage to envelope the coil. These surrounding hyphae eventually consolidate to form the walls or peridium of the perithecium (http://website.nbm-mnb.ca/mycologywebpages/NaturalHistoryOfFungi/
  • perithecia in T. reesei occurs ascohymenial meaning that the ascocarp formation initiates with the fertilization of the ascogonium.
  • the primordium subsequently differentiates into a true hymenium directly from the generative, ascogeneous hyphae.
  • the ascohymenial development thus begins with fertilization and differentiation of generative hyphae, followed by the development of the ascocarp.
  • Stromata (fruiting bodies) are therefore formed by the partner acting as a female during sexual reproduction.
  • strain QM6a Since all strains of T. reesei which are nowadays used in industry can be traced back to strain QM6a they all carry - as does strain QM6a - the MAT1 -2 locus. Crossing of different industrial strains with each other to further improve them by introducing favorable traits or to rid strains from mutations of genes or undesired genes such as e.g. genes conferring e.g. resistance to antibiotics, coding undesired products whose presence may interfere with regulatory requirements is therefore not possible at present.
  • genes or undesired genes such as e.g. genes conferring e.g. resistance to antibiotics, coding undesired products whose presence may interfere with regulatory requirements is therefore not possible at present.
  • T. reesei mutant strains would be to exchange the mating type locus by the opposite one at the same genomic locus.
  • T. reesei QM6a this implies to exchange the MAT1 -2 locus for the MAT1 -1 locus.
  • Kang et al. (1994) have shown that strains of Magnaporthe grisea in which the MAT locus was exchanged were fertile in crossings with strains of the opposite mating type (i.e.: strains in which the MAT1 -2 locus was replaced by the MAT1 - 1 locus were fertile in crossings with the original MAT1 -2 carrying strain).
  • strains of the opposite mating type i.e.: strains in which the MAT1 -2 locus was replaced by the MAT1 - 1 locus were fertile in crossings with the original MAT1 -2 carrying strain.
  • a successful exchange of the mating type locus was also described for Neurospora crassa (Chang, 1994).
  • WO 201 1/095374 relates to the use of mating type switching to improve the sexual behavior of filamentous fungal strains. Disclosed is the identification of mating types of Aspergillus niger and Aspergillus tubigensis so as to transform Aspergillus niger into a heterothallic fungus, i.e. filamentous fungus individuals having opposite mating types resulting in one or more pair of strains with two opposite mating types.
  • the present inventors have recently topically replaced the MAT1 -2 locus of QM6a with the opposite mating type (MAT1 -1 ) at the same genomic location, but crossings of the resulting MAT1 -1 strains with T. reesei QM6a derived MAT1 -2 strains were not successful demonstrating self-sterility.
  • the mating impairment of a Trichoderma reesei strain QM6a or a strain derived thereof is caused by defined genes/genetic elements and mutations in defined genes/genetic elements of said organism and may be corrected by correcting or eliminating said mutations, i.e. by replacing the corresponding gene(s)/genetic element(s) with a functional counterpart or by inserting the gene/genetic element that is completely or partially missing.
  • a functional counterpart of said gene(s)/genetic element(s) is a gene or genetic element that restores the mating ability of Trichoderma reesei QM6a. Said capability is conferred to said gene/genetic element by correcting the mutations as depicted in Table 3 to such an extent that the gene or genetic element performs its function in the mating process. Preferably all mutations of the respective gene/genetic element are corrected.
  • Trichoderma reesei QM6a strain or any derivative thereof the technique of backcrossing may advantageously be used for identifying the genes or genetic elements that are associated with mating impairment in Trichoderma reesei QM6a or any derivative thereof (female sterility genes).
  • mutations in certain genes are associated with mating impairment in Trichoderma reesei QM6a.
  • the mutation may be a simple point mutation, an insertion or a deletion, whereby the deletion may be a deletion within an existing gene or a full or partial deletion of a gene/genetic element per se.
  • genes or genetic elements/genetic information may be contributory to mating impairment or may cause - singly or in combination - mating impairment in Trichoderma reesei QM6a. Hence, said genes/genetic elements/genetic information may be directly or indirectly associated with the mating impairment of said organism.
  • Trichoderma reesei QM6a and its derivatives are generally genes of which the full or partial lack of functioning leads to a reduced or complete lack of formation of fruiting bodies when crossed with a corresponding organism.
  • the term "mating impairment” is to relate to all degrees of an impaired or reduced mating ability. A reduced mating ability can thus also be seen in a substantially prolonged time until mature fruiting bodies with viable ascospores become visible.
  • Corresponding genes and/or genetic elements have a direct impact on any organ or metabolic mechanism that has a direct impact on the mating ability of Trichoderma reesei QM6a and its derivatives, such as for example genes coding for pheromone receptors or genes coding for organs needed for successful mating.
  • a genetic element comprises genetic information that is not translated into a protein but is directly or indirectly related to the mating behaviour of Trichoderma reesei QM6a or its derivative. Said genetic information may be necessary for the control or regulation of the expression of a protein.
  • a genetic element may be a promoter, an enhancer, an activator, a regulator or an expression control sequence.
  • Genes/genetic elements indirectly associated with the mating impairment of Trichoderma reesei QM6a and its derivatives are genes which are not directly associated with the mating impairment of said organism but which relate to morphological structures or metabolic mechanisms that have an indirect impact on the ability of Trichoderma reesei QM6a and its derivatives to mate with a corresponding organism. Mutations in genes for example related to hyphal cell wall structure or hyphal branching could have an indirect impact on the mating ability of Trichoderma reesei QM6a and its derivatives.
  • the function of said genes may be executed by proteins encoded by said genes.
  • Said gene/genetic element may also be necessary for expression or regulation of a corresponding protein (p. ex. promoter, enhancer, activator, regulator, initiator, expression control sequence).
  • the invention therefore, relates to a process for identifying a gene/genetic element associated with mating impairment in strains of Trichoderma reesei QM6a or strains derived thereof comprising the steps of
  • a second strain being a mating competent strain of a Trichoderma reesei (Hypocrea jecorina) strain having a complementary MAT1 -1 locus,
  • step d) selecting the progeny from step c) that is mating competent for crossing with a Trichoderma reesei (Hypocrea jecorina) having a MAT1 -2 locus, and
  • step d) identifying the gene(s)/genetic element(s) associated with mating impairment by comparing the genome of the progenies selected in step d) with the genome sequences of the first strain of a) whereby said gene(s)/genetic element(s) may be fully or partially missing or existing in a mutated or in a form having deletions and/or insertions in the first strain thus being a gene or a genetic element directly or indirectly associated with mating impairment in strains of Trichoderma reesei QM6a or a strain derived thereof.
  • the invention further relates to a process as outlined above further comprising the step of inserting the functional gene(s) and/or genetic element(s) of the mating competent strain corresponding to the gene(s)/genetic element(s) associated with mating impairment identified according to the above feature e) into a Trichoderma reesei QM6a having a MAT1 -1 locus or a strain derived thereof and crossing said strain with a Trichoderma reesei QM6a having a MAT1 -2 locus or a strain derived thereof, whereby the formation of fruiting bodies by Trichoderma reesei QM6a having a MAT1 -1 locus and having inserted a gene(s) and/or genetic element(s) identified as above or a strain derived thereof is indicative of a direct association of said gene(s)/genetic element(s) with said mating impairment.
  • the invention further relates to a process for identifying a mating competent phenotype associated with a functional gene and/or genetic element corresponding to the gene/genetic element associated with mating impairment identified according to the above feature e) comprising the steps of a) providing a mating competent Trichoderma reesei QM6a MAT 1 -1 strain, b) rendering the above functional gene or genetic element non-functional and c) measuring the mating capability of said Trichoderma reesei QM6a MAT 1 -1 strain, wherein a positive mating capability of said Trichoderma reesei QM6a MAT 1 -1 strain is indicative of said gene or genetic element being non-essential for a mating competent phenotype and wherein a negative mating capability of said Trichoderma reesei QM6a MAT 1 -1 strain is indicative of said gene or genetic element being essential for a mating competent phenotype.
  • the invention further relates to a process for restoring the self-mating competence of a Trichoderma reesei QM6a strain that is not mating competent or a strain derived thereof, wherein one or more mutated or fully or partially missing gene(s) associated with mating impairment is/are replaced by or complemented with the corresponding functional gene(s).
  • the invention also relates to the self-mating competent strain of Trichoderma reesei QM6a or a derivative thereof obtained or obtainable by said process.
  • the invention moreover, relates to a fungal strain of the genus Trichoderma (Hypocrea) suitable for use in the industrial production of a product of interest, whereby the strain is a Trichoderma reesei QM6a and its derivative strains, wherein the mating competence has been corrected as above and which has been transformed with a target gene and/or a gene encoding a product of interest.
  • Hypocrea Trichoderma reesei QM6a and its derivative strains
  • the invention relates to the gene(s)/genetic element(s) associated with mating impairment in strains of Trichoderma reesei QM6a obtained by the above process which have a sequence of SEQ ID NOs: 8 to 155 and SEQ ID NOs:163 to 174 of the enclosed sequence listing as well as to sequences related to said sequences due to the degeneracy of the genetic code, homology and/or identity as long as the same function is performed.
  • the invention also relates to the corresponding genes of the wild-type organism Hypocrea jecorina which are functional genes in terms of mating competence and which are suitable to restore female fertility of Trichoderma reesei QM6a.
  • the invention relates to the functional counterparts of SEQ ID NOs: 8 to 155 and SEQ ID NOs: 163 to 174, i.e. the sequences of SEQ ID NOs: 8 to 155 wherein at least one and preferably all of the mutations listed in Table 3 have been corrected.
  • the invention moreover relates to variants and mutants of said corrected genes and to variants and mutants of the missing genes of SEQ ID NOs: 163 to 174 as long as the mating capability is maintained.
  • Variants and mutants may comprise silent and non-silent mutations, insertions, deletions or sequence additions.
  • the mutations are preferably conservative mutations.
  • the invention also relates to the functional counterparts of said genes of Hypocrea jecorina with the proviso that said genes still have the ability to restore female fertility of Trichoderma reesei QM6a.
  • Said functional counterparts may be genes in which only the sterility-conferring mutations were corrected.
  • the invention particularly relates to the functional counterparts of the genes having SEQ ID NO: 40, SEQ ID NO: 1 10, SEQ ID NO: 1 12 and SEQ ID NO: 134, i.e. SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220 and SEQ ID NO: 222 or a functionally equivalent sequence derived therefrom.
  • sequences of said gene(s) and the putatively encoded proteins per se were known and have been published in Martinez et al. (2008), but the function with respect to mating impairment of none of them has so far been verified. Moreover, the sequence of said genes may be retrieved from the NCBI data base under the accession number as specified in the sequence listing and the further link to the corresponding gene. SEQ ID NOs: 26, 72, 82, 84, 94, 96, 100, 70, 106, 120, 130, 140 and 154 have been newly annotated. Moreover, it has not been known that mutations in said genes are associated with the mating impairment and specifically with female sterility in said organisms.
  • sequences are mutated sequences in Trichoderma reesei QM6a or strains derived thereof thus being associated with a partial or full loss of mating competence in said organism and how to replace that gene by a functional one.
  • Trichoderma reesei QM6a which in their presently existing form, which is considered to be a mutated form, are associated with mating impairment of said organism.
  • the inventors have further found that Trichoderma reesei QM6a lacks several genes the presence of which is associated with mating competence and the full or partial loss of which is associated with mating impairment.
  • Said mating impairment relates to any form of full or partial loss of the ability of Trichoderma reesei QM6a to mate with a T. reesei MAT1 -1 organism and, particularly, relates to the female sterility of said organism.
  • said genes may also be considered as genes associated with female sterility in strains of Trichoderma reesei QM6a.
  • said gene(s) By comparing said gene(s) with the corresponding gene(s) of the final mating competent progeny of the above process the corresponding functional genes could be retrieved. Said comparison reveals which gene deviation or lack of gene is associated with the observed mating impairment of said organism.
  • the gene associated with mating competence in particular female mating competence, may be used as a template for amending the corresponding gene of T. reesei QM6a, which is associated with mating impairment and female sterility, respectively.
  • the term "mating impairment” is to relate to any form of impaired ability of Trichoderma reesei QM6a and its derivatives to mate with a corresponding organism.
  • the mating impairment may be a full or a partial mating impairment of Trichoderma reesei QM6a and its derivatives.
  • the mating impairment relates to the female sterility of Trichoderma reesei QM6a or strains derived thereof.
  • Mating impairment may relate to defects in any part or structure of the sexual cycle of ascomycetes as depicted in Figure 3, for example fertilization, spermatogenesis or sex determination.
  • genes and/or genetic elements are directly or indirectly associated with mating impairment in strains of Trichoderma reesei QM6a or in strains derived thereof. This means that said genes and/or genetic elements may be contributory or causative for the respective type of mating impairment. The same holds for the mutations, insertions or deletions in the mutated form of the genes. Said deviations from the functional form may either be causative or contributory to mating impairment.
  • the present invention relates to the genes/genetic elements of SEQ ID NOs: 8 to 155 and SEQ ID NOs: 163 to 174 that have been identified to be associated with mating impairment in strains of Trichoderma reesei QM6a.
  • the sequences of SEQ ID NOs: 8 to 155 of the sequence listing are considered as mutated sequences and the changes, insertions and/or deletions of said sequences as indicated in Table 3 correlate with an improved mating competence.
  • the present invention further relates to the genes/genetic elements of SEQ ID NOS: 163 to 174 which only exist in Hypocrea jecorina and which have no counterpart in Trichoderma reesei QM6a. Said sequences as well as their contribution to the mating impairment of Trichoderma reesei QM6a were not known before. A further functional connotation according to the present invention in relation to said gene sequences is given in Table 4.
  • the above genes may be corrected or replaced singly or in combination by the corresponding functional gene(s) to restore the full mating competence of Trichoderma reesei QM6a.
  • the corresponding fully functional counterparts exist in the wild-type Hypocrea jecorina MAT 1 -1 and are known from the comparison of the sequences of the identified genes and/or genetic elements of Trichoderma reesei QM6a MAT 1 -2 with the sequences of the corresponding genes and/or genetic elements of Trichoderma reesei CBS1/A8_02, MAT 1 -1 , Trichoderma reesei CBS2/A8-1 1 or the wild-type Hypocrea jecorina MAT 1 -1 respectively.
  • sequences are provided by sequencing the genes by methods known per se.
  • the genes missing in Trichoderma reesei QM6a according to SEQ ID NOs: 163 to 174 may be inserted singly or in combination to restore the mating competence of Trichoderma reesei QM6a.
  • the insertion of said gene(s) may be combined with the above correction of mutations, insertions or deletions.
  • the following genes are replaced/complemented with the corresponding non-mutated/complete gene: SEQ ID NO: 16, SEQ ID NO: 50, SEQ ID NO: 70, SEQ ID NO: 86, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 106, SEQ ID NO: 120, SEQ ID NO: 128, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 169, SEQ ID NO: 171 .
  • a further preferred group for genes to be corrected/complemented are SEQ ID NO: 8, SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 18, SEQ ID NO: 14, SEQ ID NO: 126, SEQ ID NO: 130, SEQ ID NO: 154, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 173 and SEQ ID NO: 174.
  • SEQ ID NO: 36 SEQ ID NO: 40, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 82, SEQ ID NO: 92, SEQ ID NO: 100, SEQ ID NO: 1 10, SEQ ID NO: 1 12, SEQ ID NO: 1 18, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 134, SEQ ID NO: 138, SEQ ID NO: 144, SEQ ID NO: 146 , SEQ ID NO: 148 and SEQ ID NO: 152.
  • SEQ ID NO: 40 SEQ ID NO: 1 10
  • SEQ ID NO: 1 12 SEQ ID NO: 134.
  • sequences associated with mating competence are SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228 or SEQ ID NO: 230.
  • the invention particularly relates to the following genes essential for mating competence in Trichoderma reesei QM6a or strains derived therefrom: SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220 and SEQ ID NO: 222.
  • the invention also relates to functionally equivalent sequences of said sequences, for example, sequences related due to the degeneracy of the genetic code or sequences having a degree of homology to said sequences, for example 80%, preferably 90%, more preferably 95% or 98%.
  • the invention further relates to the polypeptides encoded by the corrected genes/genetic elements identified as associated with mating impairment in strains of Trichoderma reesei QM6a or strains derived therefrom.
  • the invention relates to the polypeptides encoded by nucleotides 888 to 2790 of SEQ ID NO: 220, nucleotides 1263 to 2726 of SEQ ID NO: 218, nucleotides 990 to 3107 of SEQ ID NO: 222 or nucleotides 919 to 6039 of SEQ ID NO: 216.
  • Said polypeptides are associated with mating competence and correspond to SEQ ID NOs: 221 , 219, 223 and 217.
  • the invention also relates to polypeptides associated with mating competence and having a degree of sequence identity of at least 80%, preferably at least 90%, more preferably at least 95%, even more preferably at least 98% with the coding sequence of SEQ ID NO: 220, the coding sequence of SEQ ID NO: 218, the coding sequence of SEQ ID NO: 222 or the coding sequence of SEQ ID NO: 216 provided that the correction of the mutations is maintained and the sequence is associated with mating competence.
  • the degree of sequence identity is preferably determined in such a way that the number of residues of the shorter sequence which is involved in the comparison and has a "corresponding" counterpart in the other sequence is determined.
  • identity is preferably determined in the usual manner by using the usual algorithms. According to the invention only the cDNAs or amino acids of the respective mature proteins are used for the comparison. Similar, preferably identical sequence counterparts were determined according to the invention as homologue sequences by means of known computer programs.
  • An example of such a program is the program Clone Manager Suite, which includes the program part Align Plus and is distributed by Scientific & Educational Software, Durham, NC, U.S.A.
  • a comparison of two DNA sequences or amino acid sequences as defined above is thereby carried out under the option local alignment either according to the FastScan - MaxScore method or according to the Needleman-Wunsch method, keeping the default values.
  • the program version "Clone Manager 7 Align Plus 5" with the functions "Compare Two Sequences/Local Fast Scan-Max Score/Compare DNA sequences” or for amino acids "Compare Two Sequences/Global/Compare sequences as Amino Acids” was particularly used to calculate the identity according to the invention.
  • the algorithms made available from the following sources were thereby used: Hirschberg, D.S. 1975. A linear space algorithm for computing maximal common subsequences.
  • the invention further relates to addition molecules and/or deletion molecules of the aforementioned polypeptides associated with mating competence.
  • a polypeptide being associated with mating competence according to the invention may be elongated by adding further sequences at the N-terminal and/or C-terminal end, whereby the thus obtained amino acid sequences still have mating competence.
  • Sequence segments of the polypeptides being associated with mating competence may also be deleted according to the invention as long as the corrected mutations are maintained.
  • the mutations, elongations and shortenings may be carried out in a way known per se and with the help of methods well known in the state of the art.
  • amino acid sequence variants of the polypeptides may be produced by mutation in the DNA.
  • Processes for mutagenesis and changes in the nucleotide sequence are well known in the state of the art (cf. for example Tomic et al. NAR, 18:1656 (1990), Giebel and Sprtiz NAR, 18:4947 (1990)).
  • the invention moreover relates to the corrected DNA sequences of the genes/genetic elements identified as associated with mating impairment in strains of Trichoderma reesei QM6a or strains derived therefrom.
  • the invention relates to DNA sequences having or comprising nucleotides 888 to 2790 or the coding sequence of SEQ ID NO: 220, nucleotides 1263 to 1476 or the coding sequence of SEQ ID NO: 218, nucleotides 990 to 3107 or the coding sequence of SEQ ID NO: 222 or nucleotides 919 to 6039 or the coding sequence of SEQ ID NO: 216.
  • sequences comprising, with the claimed nucleotide sequence and the claimed parts thereof, a homology of at least 70%, preferably at least 80%, even more preferably 90% and in particular at least 95% as long as the corresponding sequences are associated with mating competence and the correction of the mutations is maintained.
  • the homology is 70 to 100%, more preferably 80 to 100%, most preferably 90 to 100%.
  • the homology is defined as degree of identity.
  • the degree of identity is preferably defined in the way that the number of residues of the shorter sequence which takes part in the comparison and which possesses a "corresponding" complement in the other sequence is determined.
  • the homology is preferably determined by the usual way using the usual algorithms.
  • the program version "Clone Manager 7 Align Plus 5" with the functions "Compare Two Sequences/Local Fast Scan-Max Score/Compare DNA sequences” has especially been used for the determination of the homology.
  • the algorithms available from the following sources have been used: Hirschberg, D.S. (1975) A linear space algorithm for computing longest common subsequences, Commun Assoc Comput Mach 18:341 -343; Myers, E.W. and W. Miller. (1988) Optimal alignments in linear space, CABIOS 4:1 , 1 1 -17; Chao, K-M, W.R. Pearson and W. Miller.
  • the invention further relates to DNA sequences, which due to the degeneration of the genetic code are related to the sequences according the invention as well as allelic variations thereof.
  • the degeneration of the genetic code can be caused by natural degeneration or due to a specially chosen codon usage.
  • Natural allelic variants can be identified via the use of well-known techniques of the molecular biology like e.g. the polymerase chain reaction (PCR) and hybridisation techniques.
  • the invention also relates to DNA sequences which are associated with mating competence and which maintain the correction of the mating impairing mutations, comprising mutations, modifications or variations of the sequence. Furthermore, the invention also relates to sequences which hybridize with the aforementioned sequences under relaxed or stringent conditions. The following conditions are considered as stringent: hybridization at 65°C, 18 h in dextran sulphate solution (GenescreenPlus, DuPont), subsequent washing of the filter for 30 min, respectively, at first with 6 x SSC, twice 2 x SSC, twice 2 x SSC, 0.1 % SDS and finally with 0.2 x SSC at 65°C (membrane transfer and detection methods, Amersham).
  • a strain derived from Trichoderma reesei QM6a is, for example, a strain that has been derived by techniques known per se, such as either conventional mutagenesis (UV, gamma irradiation, nitrosoguanidine treatment and others) or by recombinant techniques from T. reesei QM6a in one or more successive steps, e.g.
  • a first parental strain being a Trichoderma reesei QM6a strain having a MAT1 -2 locus or a strain derived thereof. Said strain is crossed with a second strain which is a mating competent strain of a Trichoderma reesei (Hypocrea jecorina) having a complementary MAT1 -1 locus. Said strain has been obtained by selecting Hypocrea jecorina (the teleomorph of T.
  • strains CBS999.97 MAT1 -1 or any other mating competent MAT1 -1 Trichoderma reesei (Hypocrea jecorina) strain such as those listed by Druzhinina et al. 2010.
  • strain QM6a/MAT1 -1 is transformed with plasmids containing the functional variant(s) of the gene(s) identified in association with mating impairment in strain T. reesei QM6a/MAT1 - 2. Positive transformants were subjected to mating assays with T. reesei QM6a MAT1 -2. Mating was verified by the formation of fertile fruiting bodies. Their fertility was tested by isolating ascospores and demonstrating that they, upon germination and growing into a mycelium, are capable of mating with the opposite mating partner.
  • T. reesei QM6a/MAT1 -1 complemented with repaired candidate gene(s) and T. reesei strain QM6a/MAT1 -2 (ATCC13631 ) are co-cultured under suitable mating conditions for Trichoderma reesei.
  • An exemplary protocol is given in Example 3. The fertility is tested by isolating ascospores from the fruiting bodies, germinating them and demonstrating that the resulting colonies are capable of mating. A positive mating outcome is verified by a visible morphological change, a cell-to-cell fusion and the formation of a dikaryon.
  • jecorina show on the average a 0.5 - 1 .5 % nucleotide variation in their genome. Given that the genome is 34.1 Mbp, this means that any two wild type strains of T. reesei and/or H. jecorina will be different in 170500 - 51 1500 nucleotides. Even though the majority of them will not occur in genes, and - if still so - may result in silent mutations, the number of genes that show a non-silent nucleotide exchange are likely too many to be used to identify the genes related to female sterility.
  • the backcrossing is usually repeated for 5 to 19 cycles, preferably 6 to 12 cycles, more preferably 7 to 10 cycles, still more preferably 8 to 9 cycles and most preferably for 8 cycles.
  • a strain that is substantially identical to the parental strains is defined in relation to the number of backcrossings that said strain has undergone. This means that the substantial identity between the backcrossed and the parental strain relates to the relationship between the genes associated with mating impairment and genes not associated with mating impairment as mathematically calculated on the basis of the number of backcrossings.
  • the progeny from the above back-crossing that is mating competent for crossing with a Trichoderma reesei (Hypocrea jecorina) having a MAT1 -2 locus and contains the unmutated form of the genes for mating impairment/female sterility and/or a gene/genetic information not present in Trichoderma reesei QM6a is selected by first identifying those strains from the progeny that contain the MAT1 -1 locus, and then verifying that it can produce fertile fruiting bodies with T. reesei QM6a (MAT1 -2) by methods known per se.
  • Another disadvantage of attempting to generate mating competent Trichoderma strains merely by a backcrossing strategy will be that because of the necessity to stop at a stage where all female sterility genes have been assembled in a genome together with numerous random non-mating relevant genes from the MAT1 -1 donor genome, every line will be different from another line generated in the same way with respect to these non-mating relevant genes, creating undesired heterogeneity.
  • the use of the backcrossing strategy leads to a pool of candidate genes associated with mating impairment.
  • Said pool of candidate genes is further refined by a targeted knock-out of each identified gene in a mating competent QM6a MAT 1 -1 strain of Trichoderma reesei and the determination of the mating capability of the thus obtained Trichoderma reesei QM6a MAT 1 -1 strain using the above described mating assay. Since it is possible that more than a single gene associated with mating has become non-functional in T. reesei QM6a, and consequently the complementation with single genes would not lead to a gain of mating functionality, knock-out strains for all candidate genes in a mating competent T. reesei QM6a derivative were prepared.
  • any genes essential for mating would be identified whether solely responsible for mating deficiency in QM6a or being part of a group of inactivated essential mating genes.
  • a tku70 deleted version of strain CBS1/A8_02 (MAT1 -1 ) is generated.
  • the tku70 gene is part of the nonhomologous end joining (NHEJ) pathway present in Trichoderma reesei and other filamentous fungi.
  • NHEJ nonhomologous end joining
  • the knockout of the tku70 gene leads to an increased homologous recombination efficiency of Trichoderma reesei (Guangtao et al. 2008) thus increasing the number of strains possessing the gene knocked-outs to be tested for their relevance in mating.
  • the knock-out of the tku70 gene as well as of the respective candidate genes may be accomplished by any technique that is suitable to render said gene inoperative such as partial, substantial or functional deletion, silencing, inactivation or down-regulation.
  • a marker is inserted into the corresponding constructs to identify the corresponding knock-out organism.
  • Corresponding techniques are known in the art.
  • the knock-out organism allows to study the function of the knock-out gene, i.e. the mating behaviour of the organism.
  • the knock-out strategy may also be used to identify a mating-incompetent phenotype associated with the above-identified gene(s)/genetic elements.
  • a mating-incompetent knock-out Trichoderma reesei QM6a strain is for example a wild-type Hypocrea jecorina strain in which the respective gene/genetic element as identified above has been rendered non-functional, for example by partial, substantial or functional deletion, silencing, inactivation or down-regulation. Corresponding methods are known per se.
  • the gene(s) associated with mating impairment is/are identified by sequencing the genome of the progenies selected as above and comparing it with the genome sequences of the parental strain T. reesei QM6a (the first strain as used above).
  • the CLC Genomic Workbench version 5.1 , CLC bio, Arhus, Denmark
  • de novo assembled with newbler version 2.60, Roche/454, Brandford CT, USA
  • CLC Genomic Workbench was used to map the obtained sequences to the scaffolds of the T. reesei QM6a sequence scaffolds with BLAST (Altschul et al., 1990) and r2cat (Husemann and Stoye, 2010).
  • Single nucleotide polymorphisms (SNPs) and insertions and deletions (Indels) between the QM6a reference sequence and the aligned sequences of the two backcrossed lines were identified using a customized version of Mauve (Rissman et al., 2009).
  • SNPs and Indels were mapped to QM6a coding sequences using custom R scripts.
  • Candidate genes were then manually tested for silent mutations, and mutations that lead to a conserved amino acid exchange (e.g. E vs. D, V vs. I etc) that does not interfere with the function of the putative protein were discarded.
  • the respective nature of the mutations of course depends on the type of Hypocrea strain that is used for backcrossing.
  • the verification of the respective mutation is the restoration of the mating ability of the organism as evidenced by the formation of mature fruiting bodies with viable ascospores when crossing Trichoderma reesei QM6a having a MAT1 -1 locus with a corresponding MAT1 -2 strain of the same type as used for backcrossing.
  • Trichoderma reesei QM6a having a MAT1 -1 locus or a strain derived thereof and crossing said strain with Trichoderma reesei QM6a having a MAT1 -2 locus or a strain derived thereof, whereby the formation of fruiting bodies by Trichoderma reesei QM6a having a MAT1 -1 locus having inserted said gene or a strain derived thereof is indicative of said direct association of said gene with said mating impairment.
  • the contributory effect of a genetic element vis-a-vis mating behaviour may be verified.
  • Trichoderma reesei QM6a may be used to construct specific probes or arrays comprising specific probes for testing other microorganisms for genes associated with fertility.
  • Vector Kits may be provided allowing restoration of the genes associated with the mating ability.
  • the invention further relates to a fungal strain of the genus Trichoderma (Hypocrea) suitable for use in the industrial production of a product of interest, wherein the strain has been obtained as outlined above and has been transformed with a gene encoding a product of interest.
  • Hypocrea Trichoderma
  • a product of interest may be any product that may be of industrial use.
  • proteins or polypeptides being useful for research purposes, diagnostic purposes, therapeutic purposes such as, for example, hormones, immunoglobulins, vaccines, antibacterial proteins, antiviral proteins, enzymes etc., purposes of nutrition or for technical applications.
  • proteins or polypeptides are food enzymes such as, for example, polygalacturonidases, pectin methylesterases, xylogalacturonoidases, rhamnogalacturonidases, arabinofuranosidases, arabanases/arabinanases, amylases, phytases, xylanases, cellulases, proteases, mannanases, transglutaminases, etc., animal feed enzymes such as, for example, phytases, xylanases, endoglucanases, mannanases and proteases, as well as technical enzymes such as, for example, cellulases, proteases, amylases, laccases, oxidoreductases, etc.
  • a product of interest may also be a biopolymer.
  • Trichoderma The industrial production of a product of interest by the above Trichoderma is known to a person skilled in the art and is carried out according to fermentation methods established for fungal strains of the genus Trichoderma.
  • the Trichoderma strain is cultivated under conventional conditions for the expression and secretion of the product of interest.
  • the fungus is therefor inoculated or, respectively, initially grown on agar plates and a spore suspension or a mycelial suspension are used as an inoculum for a submerged fermentation.
  • the fermentation is carried out on media containing the required C sources and N sources as well as trace elements and mineral salts. If inducible promoters are used, the medium should also contain the inducers or their precursors.
  • the fermentation is carried out under control of temperature and pH value as well as of further fermentation conditions such as redox potential, partial oxygen content, etc.
  • a controlled management of further C sources and N sources as well as of other components of the medium may also be effected (fed batch method).
  • the culture liquid containing the product of interest is separated from the biomass by known physical methods and the product of interest is isolated during this process.
  • Trichoderma reesei QM6a The above restoration of the mating competence of Trichoderma reesei QM6a is associated with several unique advantages. Said process allows transforming Trichoderma reesei QM6a into an organism that more closely resembles the wild-type. The process allows to combine two or more advantageous genetic traits in Trichoderma reesei QM6a and its derivatives. Said traits are then transferred into the progenies of Trichoderma reesei QM6a and its derivatives. Hence, an already existing highly efficient producer of industrially interesting compounds may further be improved. The ability to cross strains of T.
  • reesei can also be used to eliminate marker genes or other undesired genes which can be tested for by their phenotype, such as genes for secondary metabolism, pigment formation, undesired enzymes (e.g. proteases), morphology and asexual development and others.
  • marker genes or other undesired genes which can be tested for by their phenotype, such as genes for secondary metabolism, pigment formation, undesired enzymes (e.g. proteases), morphology and asexual development and others.
  • Figure 1 is a schematic drawing of the vector for the direct replacement of the MAT1 -2 locus in strain T. reesei QM6a by the MAT1 -1 locus.
  • selection marker the hph gene (hygromycin resistance) was used.
  • the hph cassette was inserted in the intergenic region between the mat1-1-3 gene and the gene with transcript ID 59147 (DNA lyase).
  • Figure 2 is the scheme of the crossing of strain QM6a with strain CBS/MAT1 -1 . Progeny (carrying the MAT1 -1 locus) of each crossing is crossed back with the parental strain QM6a. Of strains CBS1/A8-2 and CBS2/A8-1 1 DNA was extracted and subjected to whole genome sequencing.
  • Figure 3 is a schematic drawing of the sexual and asexual development in ascomycetes (Fazenda et al. 2008)
  • Figure 4 is a schematic view of the principle vector construction to transform genes associated with mating impairment.
  • the 5' insert corresponds to the different genes associated with mating impairment - here the gene with transcript ID Trire2_59740.
  • Figures 5a, 6a, 7a and 8a are the complementation vectors of the functional genes identified as essential for the mating competence of Trichoderma reesei QM6a.
  • Figures 5b (SEQ ID NOs: 220/221 ), 6b (SEQ ID NOs: 216/217), 7b (SEQ ID NOs: 218/219) and 8b (SEQ ID NOs: 222/223) relate to the respective complementation genes per se in combination with a functional promoter and terminator.
  • the promoter and terminator sequences may be exchanged by another equally functional promoter and/or terminator sequence.
  • the strain described by Seidl et al. (2009) harbors, beside the MAT1 -2 locus, also the MAT1 -1 locus.
  • This strain is able to reproduce sexually with different MAT1 -1 and MAT1 -2 carrying wildtype strains but not with the parental strain T. reesei QM6a (MAT1 -2).
  • T. reesei QM6a parental strain
  • the MAT1 -2 locus of T. reesei QM6a was directly and homologously exchanged by the MAT1 -1 locus amplified from wildtype strain H. jecorina C.P.K. 1282 (G.J.S. 85-249).
  • the MAT1 -1 locus including upstream and downstream homolog regions was amplified from H. jecorina 1282 and cloned in the vector pCR blunt (obtainable fromLife Technologies/lnvitrogen).
  • the hph gene hygromycin B phosphotransferase gene
  • Figure 1 gives a schematic overview of the vector construction and Table 1 gives the sequences of the primers used.
  • Table 2 lists the exact positions of the genes within the MAT1 -2 replacement vector. The complete sequence of the vector can be found in the Sequence listing as SEQ ID NO: 7.
  • Table 1. Sequences of the primers used for the construction of the vector for the direct MAT locus replacement.
  • MAT1-1 fuer pyr4 GTGCTGGAATTCAGGCCTGGCTTGATGCTGCTAACCTTC 10059 bp
  • MAT1-1 fuer pyr4 TCTGCAGAATTCAGGCCTACTCCGCAAGATCAAATCCG
  • cassette_rv SEQ ID NO: 6
  • the replacement cassette was amplified from the vector by PCR using primers 1 -2_replace_ cassette_fw and 1 -2_replace_ cassette_rv.
  • Per transformation reaction 10 g of the replacement cassette were used.
  • the resultant strain which was named QM6a MAT1 -2 ⁇ MAT1 -1 , is able to act successfully as mating partner for MAT1 -2 wildtype strains (e.g. CBS999.97) but mating with the parental strain T. reesei QM6a is not possible.
  • Table 2 Position of the different genes within the MAT1-2 replacement vector.
  • mat 1-1-1 (alpha-domain protein) 3806 - 5081 bp
  • hph hygromycin B phosphotransferase 9122 - 1 1398 bp ID 59147 (endonuclease/DNA lyase) 1 1535 - 12673 bp (gene not fully included in the vector construction)
  • strain QM6a (MAT1 -2) was crossed with strain CBS999.97 (MAT1 -1 ) in two independent lines to obtain sexually competent strains carrying the MAT1 -1 locus.
  • Cultures from single ascospores carrying the MAT1 -1 locus were crossed back several times with the parental strain QM6a to reduce the number of CBS999.97 specific genes which will allow the easier identification of candidate genes responsible for female sterility (FS).
  • FS female sterility
  • Two libraries for each line were prepared, with 320 bp and 8 kbp insert size, respectively.
  • DNA was fragmented using a Covaris S2 system (Covaris, Inc. Woburn, MA) and fragments were purified using the QIAquick PCR purification kit (Qiagen; Hilden, Germany). Paired-end libraries were prepared using the NEBNext DNA Sample Prep modules (New England Biolabs, Ipswich, MA) following the manufacturer's instructions. Briefly, fragments were end-repaired using Klenow and T4 DNA polymerases and phosphorylated with T4 polynucleotide kinase.
  • Ligation products of -400 bp were gel-purified using the Qiagen gel extraction kit (Qiagen; Hilden, Germany). To avoid guanine-cytosine (GC) bias introduced during the gel-purification step in the standard lllumina library preparation protocol, the gel slice was dissolved at room temperature instead of heating.
  • Qiagen Qiagen gel extraction kit
  • GC guanine-cytosine
  • the size-selected, adapter-modified DNA fragments were PCR-amplified using PE PCR primers 1 .0 and 2.0 (lllumina, San Diego, CA) using Phusion DNA polymerase (New England Biolabs, Ipswich, MA) and protocol: polymerase activation (98°C for 30 s), followed by 10 cycles (denaturation at 98°C for 10 s, annealing at 65°C for 30 s, and extension at 72°C for 50 s) with a final, 5-min extension at 72°C. Libraries were purified and quantified using the Qubit HS Assay Kit (Invitrogen, Carlsbad, CA, USA).
  • SNPs Single nucleotide polymorphisms
  • Indels insertions and deletions
  • Table 3 the following genes conferring female sterility to T. reesei QM6a were obtained (Table 3).
  • Table 4 shows the genes that were found to be missing in Trichoderma reesei QM6a.
  • Table 5 shows the genes associated with mating impairment in T. reesei QM6a as identified by the knock-out strategy.
  • Table 3 List of genes identified by repeated back crossings and sequencing and comparison with corresponding genes in QM6a as outlined above.
  • Trire2 :111374: :c..790T p.Pro27Ser
  • Trire2 :111374: :c. ,88G>A p.Gly30Arg
  • Trire2 :111374: :c. 104A>G p.Asn35Ser
  • Trire2 :111374: :c. ,107A>T p.Lys36lle
  • Trire2 :111374: :c. 118A>G p.Lys40Glu
  • Trire2 :111374: :c. ,122T>C p.Met41Thr
  • Trire2 :111374: :c. ,129G>C p.Gln43His
  • Trire2 :111374: :c. 1310G p.Thr44Arg
  • Trire2 :111374: :c. .1370T p.Thr46lle
  • Trire2 :111374: :c. 143A>G p.Asp48Gly
  • Trire2 :111374: :c. ,176G>A p.Gly59Glu
  • Trire2 :111374: :c. ,213T>A p.His71Gln
  • Trire2 :111374: :c. 283T>C p.Tyr95His
  • Trire2 :111374: :c. 4310G p.Thrl44Arg
  • Trire2 :111374: :c. ,467A>C p.Aspl56Ala
  • Trire2 :111374: :c. 570T>G p.Hisl90Gln
  • Trire2 :111374: :c. ,574A>T p.Thrl92Ser
  • Trire2 :111374: :c. .5810A p.Alal94Glu
  • Trire2 :111374: :c. ,760G>A p.Asp254Asn
  • Trire2 :111374: :c. 806G>A p.Arg269Lys
  • Trire2 :111374: :c. ,837A>C p.Gln279His
  • Trire2 :111374: :c. 908G>C p.Arg303Thr
  • Trire2 :111374: :c. 993G>T p.Glu331Asp
  • Trire2 :111374: :c. 1002A>C p.Gln334His
  • Trire2 :111374: :c. 1055T>C p.Val352Ala
  • Trire2 :111374: :c. 1166A>G p.Lys389Arg
  • Trire2 :111374: :c. ,1172T>C p.Phe391Ser
  • Trire2 :111374: :c. 1182G>T p.Lys394Asn
  • Trire2 :111374: :c, .1205G>A p.Cys402Tyr
  • Trire2 :111374: :c, .1208A>T p.Lys403lle
  • Trire2 :111374: :c. ,1237A>G p.lle413Val
  • Trire2 :111374: :c. ,1247A>G p.Asn416Ser
  • Trire2 :111374: :c, .1253A>T p.Lys418lle
  • Trire2 :123786: :c, .49541A>T p.Glul6514Val
  • Trire2 :123786: :c, .49307OT p.Alal6436Val
  • Trire2 :123786: :c, .48743A>G p.Asnl6248Ser
  • Trire2 :123786: :c, .48382G>A p.Vall6128lle
  • Trire2 :123786: :c, .48125A>T p.Glul6042Val
  • Trire2 :123786: :c, .472190T p.Alal5740Val
  • Trire2 :123786: :c, .47168G>C p.Serl5723Thr
  • Trire2 :123786: :c, .47072T>C p.Vall5691Ala
  • Trire2 :123786: :c, .47026A>G p.llel5676Val
  • Trire2 :123786: :c, .467610G p.Aspl5587Glu
  • Trire2 :123786: :c, .46759G>C p.Aspl5587His
  • Trire2 :123786: :c, .46676T>C p.Vall5559Ala
  • Trire2 :123786: :c, .46574A>G p.Aspl5525Gly
  • Trire2 :123786: :c, .46517T>C p.llel5506Thr
  • Trire2 :123786: :c, .46498T>G p.Serl5500Ala
  • Trire2 :123786: :c, .46472T>C p.llel5491Thr
  • Trire2 :123786: :c, ,46444A>G p.Lysl5482Glu
  • Trire2 :123786: :c, .464420T p.Thrl5481lle
  • Trire2 :123786: :c, .46430OT p.Thrl5477lle
  • Trire2 :123786: :c, .46360G>A p.Vall5454lle
  • Trire2 :123786: :c, .463120A p.Leul5438lle
  • Trire2 :123786: :c, .46311T>G p.Aspl5437Glu
  • Trire2 :123786: :c, .46287G>T p.Glnl5429His
  • Trire2 :123786: :c, .38753G>A p.Serl2918Asn
  • Trire2 :123786: :c, .38749G>A p.Vall2917lle
  • Trire2 :123786: :c, .386330T p.Alal2878Val
  • Trire2 :123786: :c, .38596G>C p.Alal2866Pro
  • Trire2 :123786: :c, .38488A>G p.llel2830Val
  • Trire2 :123786: :c, .38425G>T p.Alal2809Ser
  • Trire2 :123786: :c, .38230A>G p.Serl2744Gly
  • Trire2 :123786: :c, .38168A>G p.Lysl2723Arg
  • Trire2 :123786: :c, .38149G>A p.Alal2717Thr
  • Trire2 :123786: :c, .38143G>A p.Vall2715lle
  • Trire2 :123786: :c, .38059A>G p.llel2687Val
  • Trire2 :123786: :c, .38039OT p.Serl2680Leu
  • Trire2 :123786: :c, .38029G>T p.Vall2677Phe
  • Trire2 :123786: :c, .38017G>A p.Glyl2673Ser
  • Trire2 :123786: :c, .37990T>A p.Serl2664Thr
  • Trire2 :123786: :c, .37982G>A p.Glyl2661Asp
  • Trire2 :123786: :c, .37952A>G p.Hisl2651Arg
  • Trire2 :123786: :c, .37945G>A p.Glul2649Lys
  • Trire2 :123786: :c, .37919A>G p.Glul2640Gly
  • Trire2 :123786: :c, .37774A>G p.Metl2592Val
  • Trire2 :123786: :c, .377420G p.Alal2581Gly
  • Trire2 :123786: :c, .37571G>A p.Argl2524Lys
  • Trire2 :123786: :c, .37555G>T p.Alal2519Ser
  • Trire2 :123786: :c, .37382A>C p.Asnl2461Thr
  • Trire2 :123786: :c, .37357G>A p.Glul2453Lys
  • Trire2 :123786: :c, .37297A>C p.Metl2433Leu
  • Trire2 :123786: :c, .37015A>C p.Thrl2339Pro
  • Trire2 :123786: :c, .36992T>C p.Vall2331Ala
  • Trire2 :123786: :c, .369820G p.Glnl2328Glu
  • Trire2 :123786: :c, .32094OA p.Aspl0698Glu
  • Trire2 :123786: :c, .32013G>T p.Glul0671Asp
  • Trire2 :123786: :c, .31997T>C p.Leul0666Ser
  • Trire2 :123786: :c, .31924G>A p.Aspl0642Asn
  • Trire2 :123786: :c, .31833T>G p.Aspl0611Glu
  • Trire2 :123786: :c, .31813A>G p.llel0605Val
  • Trire2 :123786: :c, .31573G>A p.Vall0525lle
  • Trire2 :123786: :c, .314840T p.Thrl0495lle
  • Trire2 :123786: :c, .31412G>A p.Argl0471Gln
  • Trire2 :123786: :c, .31408A>G p.Thrl0470Ala
  • Trire2 :123786: :c, .312820A p.Prol0428Thr
  • Trire2 :123786: :c, .31280G>A p.Argl0427Gln
  • Trire2 :123786: :c, .31093OA p.Leul0365lle
  • Trire2 :123786: :c, .31084OT p.Prol0362Ser
  • Trire2 :123786: :c, .30853G>T p.Alal0285Ser
  • Trire2 :123786: :c, .30552T>G p.Aspl0184Glu
  • Trire2 :123786: :c, .30536OT p.Alal0179Val
  • Trire2 :123786: :c, .30509G>A p.Glyl0170Glu
  • Trire2 :123786: :c, .30340G>A p.Vall0114lle
  • Trire2 :123786: :c, .30321T>G p.Aspl0107Glu
  • Trire2 :123786: :c, .30319G>C p.Aspl0107His
  • Trire2 :123786: :c, .30290OT p.Alal0097Val
  • Trire2 :123786: :c, .30282A>C p.Lysl0094Asn
  • Trire2 :123786: :c, .30135A>T p.Glul0045Asp
  • Trire2 :123786: :c, .30100A>C p.Metl0034Leu
  • Trire2 :123786: :c, .30036OG p.Aspl0012Glu
  • Trire2 :123786: :c, .29989G>T p.Ala9997Ser
  • Trire2 :123786: :c, .29985G>C p.Glu9995Asp
  • Trire2 :123786: :c, .29870G>T p.Gly9957Val
  • Trire2 :123786: :c, .298630A p.Pro9955Thr
  • Trire2 :123786: :c, .29782A>C p.Asn9928His
  • Trire2 :123786: :c, .296920T p.Leu9898Phe
  • Trire2 :123786: :c, .29654T>C p.Val9885Ala
  • Trire2 :123786: :c, .29636A>C p.Gln9879Pro
  • Trire2 :123786: :c, .29560G>A p.Val9854lle
  • Trire2 :123786: :c, .29405OT p.Thr9802lle
  • Trire2 :123786: :c, .29399T>A p.Phe9800Tyr
  • Trire2 :123786: :c, .293320T p.Pro9778Ser
  • Trire2 :123786: :c, .29225A>G p.Asp9742Gly
  • Trire2 :123786: :c, .29191G>C p.Ala9731Pro
  • Trire2 :123786: :c, .29120G>A p.Arg9707Gln
  • Trire2 :123786: :c, .29111A>G p.Asn9704Ser
  • Trire2 :123786: :c, .29080G>A p.Glu9694Lys
  • Trire2 :123786: :c, .29023A>G p.Asn9675Asp
  • Trire2 :123786: :c, .28988G>A p.Arg9663Lys
  • Trire2 :123786: :c, .28813A>C p.Thr9605Pro
  • Trire2 :123786: :c, .28791T>A p.His9597Gln
  • Trire2 :123786: :c, .28574A>G p.Gln9525Arg
  • Trire2 :123786: :c, .28555G>A p.Glu9519Lys
  • Trire2 :123786: :c, .28531A>G p.Ser9511Gly
  • Trire2 :123786: :c, .28498G>A p.Asp9500Asn
  • Trire2 :123786: :c, .28483A>C p.Met9495Leu
  • Trire2 :123786: :c, .28393A>T p.Thr9465Ser
  • Trire2 :123786: :c, .28340A>G p.Asp9447Gly
  • Trire2 :123786: :c, .283280T p.Ala9443Val
  • Trire2 :123786: :c, .28316G>A p.Gly9439Asp
  • Trire2 :123786: :c, .28301T>A p.Leu9434Gln
  • Trire2 :123786: :c, .28268G>A p.Ser9423Asn
  • Trire2 :123786: :c, .281940G p.Asp9398Glu
  • Trire2 :123786: :c, .28188T>G p.lle9396Met
  • Trire2 :123786: :c, .28084G>A p.Gly9362Ser

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Botany (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
PCT/EP2013/077910 2012-12-28 2013-12-23 Genes/genetic elements associated with mating impairment in trichoderma reesei qm6a and its derivatives and process for their identification Ceased WO2014102241A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
DK13814970.3T DK2938727T3 (en) 2012-12-28 2013-12-23 GENES / GENETIC ELEMENTS ASSOCIATED WITH PARRIING DISORDER IN TRICHODERMA REESEI QM6A AND ITS DERIVATIVES AND PROCEDURE FOR IDENTIFICATION THEREOF
CA2891952A CA2891952A1 (en) 2012-12-28 2013-12-23 Genes/genetic elements associated with mating impairment in trichoderma reesei qm6a and its derivatives and process for their identification
CN201380068881.4A CN105980565A (zh) 2012-12-28 2013-12-23 里氏木霉qm6a及其衍生株中与交配损伤相关的基因/遗传元件及其鉴定方法
EP13814970.3A EP2938727B1 (en) 2012-12-28 2013-12-23 Genes/genetic elements associated with mating impairment in trichoderma reesei qm6a and its derivatives and process for their identification
JP2015550064A JP6660181B2 (ja) 2012-12-28 2013-12-23 トリコデルマリーセイQM6aおよびその誘導体中の交配障害と関連する遺伝子/遺伝要素ならびにその同定方法
US14/758,238 US9920384B2 (en) 2012-12-28 2013-12-23 Genes/genetic elements associated with mating impairment in Trichoderma reesei QM6a and its derivatives and process for their identification

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261746861P 2012-12-28 2012-12-28
EP12199606.0 2012-12-28
US61/746,861 2012-12-28
EP12199606 2012-12-28

Publications (1)

Publication Number Publication Date
WO2014102241A1 true WO2014102241A1 (en) 2014-07-03

Family

ID=47458776

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/077910 Ceased WO2014102241A1 (en) 2012-12-28 2013-12-23 Genes/genetic elements associated with mating impairment in trichoderma reesei qm6a and its derivatives and process for their identification

Country Status (7)

Country Link
US (1) US9920384B2 (https=)
EP (1) EP2938727B1 (https=)
JP (1) JP6660181B2 (https=)
CN (1) CN105980565A (https=)
CA (1) CA2891952A1 (https=)
DK (1) DK2938727T3 (https=)
WO (1) WO2014102241A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015051012A3 (en) * 2013-10-02 2015-06-04 Academia Sinica Method for producing segmental aneuploidy (san) strains of trichoderma reesei via sexual crossing and san strains produced therefrom
WO2015086701A1 (en) * 2013-12-10 2015-06-18 Technische Universität Wien Introducing or inactivating female fertility in filamentous fungal cells
CN108138213A (zh) * 2015-02-20 2018-06-08 罗尔公司 控制蛋白酶产生的方法
WO2019008303A1 (fr) 2017-07-07 2019-01-10 IFP Energies Nouvelles Procede de rétablissement de la reproduction sexuee chez le champignon trichoderma reesei
CN114703202A (zh) * 2022-03-30 2022-07-05 四川省农业科学院植物保护研究所 淡紫紫孢菌Pth11基因及其功能验证方法
WO2024118882A1 (en) * 2022-12-01 2024-06-06 Genencor International Bv Iterative multiplex genome engineering in microbial cells using a selection marker swapping system

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107365368B (zh) * 2016-05-11 2020-09-08 中国科学院微生物研究所 Asperphenamate合成相关蛋白及其编码基因与应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011095374A2 (en) 2010-02-04 2011-08-11 Dsm Ip Assets B.V. Process for preparing filamentous fungal strains having a sexual cycle and a process for preparing sexually crossed filamentous fungal strains

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160304887A1 (en) 2013-12-10 2016-10-20 Technische Universitat Wein Introducing or Inactivating Female Fertility in Filamentous Fungal Cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011095374A2 (en) 2010-02-04 2011-08-11 Dsm Ip Assets B.V. Process for preparing filamentous fungal strains having a sexual cycle and a process for preparing sexually crossed filamentous fungal strains

Non-Patent Citations (40)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL SF.; GISH W.; MILLER W.; MYERS EW.; LIPMAN DJ.: "Basic local alignment search tool", J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ANDRÉ SCHUSTER ET AL: "A versatile toolkit for high throughput functional genomics with Trichoderma reesei", BIOTECHNOLOGY FOR BIOFUELS, BIOMED CENTRAL LTD, GB, vol. 5, no. 1, 2 January 2012 (2012-01-02), pages 1, XP021094241, ISSN: 1754-6834, DOI: 10.1186/1754-6834-5-1 *
C. SEIBEL ET AL: "ENVOY Is a Major Determinant in Regulation of Sexual Development in Hypocrea jecorina (Trichoderma reesei)", EUKARYOTIC CELL, vol. 11, no. 7, 11 May 2012 (2012-05-11) - 1 July 2012 (2012-07-01), pages 885 - 895, XP055105548, ISSN: 1535-9778, DOI: 10.1128/EC.05321-11 *
CHANG S.; STABEN C.: "Directed Replacement of mt A by mt a-1 Effects a Mating Type Switch in Neurospora crassa", GENETICS, vol. 138, 1994, pages 75 - 81
CHAO, K-M; W.R. PEARSON; W. MILLER: "Aligning two sequences within a specified diagonal band", CABIOS, vol. 8, no. 5, 1992, pages 481 - 487
CHIA-LING CHEN ET AL: "Blue Light Acts as a Double-Edged Sword in Regulating Sexual Development of Hypocrea jecorina (Trichoderma reesei)", PLOS ONE, vol. 7, no. 9, 18 September 2012 (2012-09-18), pages e44969, XP055105543, DOI: 10.1371/journal.pone.0044969 *
CHRISTIAN SEIBEL ET AL: "The role of pheromone receptors for communication and mating in Hypocrea jecorina (Trichoderma reesei)", FUNGAL GENETICS AND BIOLOGY, vol. 49, no. 10, 3 August 2012 (2012-08-03) - 1 October 2012 (2012-10-01), pages 814 - 824, XP055105390, ISSN: 1087-1845, DOI: 10.1016/j.fgb.2012.07.004 *
COLOT HV; PARK G; TURNER GE; RINGELBERG C; CREW CM ET AL.: "A high throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors", PROC NATL ACAD SCI USA, vol. 103, 2006, pages 10352 - 10357
DATABASE UniProt [online] 19 October 2011 (2011-10-19), "Mating pheromone", XP002721366, retrieved from EBI accession no. UNIPROT:G0RBZ8 Database accession no. G0RBZ8 *
DATABASE UniProt [online] 19 October 2011 (2011-10-19), "SubName: Full=Predicted protein;", XP002721362, retrieved from EBI accession no. UNIPROT:G0RG37 Database accession no. G0RG37 *
DATABASE UniProt [online] 19 October 2011 (2011-10-19), "SubName: Full=Predicted protein;", XP002721363, retrieved from EBI accession no. UNIPROT:G0RGD6 Database accession no. G0RGD6 *
DATABASE UniProt [online] 19 October 2011 (2011-10-19), "SubName: Full=Predicted protein;", XP002721364, retrieved from EBI accession no. UNIPROT:G0RGE1 Database accession no. G0RGE1 *
DATABASE UniProt [online] 19 October 2011 (2011-10-19), "SubName: Full=Predicted protein;", XP002721365, retrieved from EBI accession no. UNIPROT:G0RSI4 Database accession no. G0RSI4 *
DATABASE UniProt [online] 19 October 2011 (2011-10-19), "SubName: Full=tRNA-specific adenosine deaminase;", XP002721361, retrieved from EBI accession no. UNIPROT:G0RAK9 Database accession no. G0RAK9 *
DAYHOFF ET AL.: "Atlas of Protein Sequence and Structure", 1978, NATL. BIOMED. RES. FOUND.
DIEGO MARTINEZ ET AL: "Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina)", NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 26, no. 5, 1 May 2008 (2008-05-01), pages 553 - 560, XP002689190, ISSN: 1087-0156, [retrieved on 20080504], DOI: 10.1038/NBT1403 *
DIEGO MARTINEZ ET AL: "Supplementary Text and Figures to: Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina)", NATURE BIOTECHNOLOGY, vol. 26, no. 5, 4 May 2008 (2008-05-04), pages 553 - 560, XP055105609, ISSN: 1087-0156, DOI: 10.1038/nbt1403 *
DRUZHININA I.; KOMON -ZELAZOWSKA M.; ATANASOVA L.; SEIDL V.; KUBICEK C.: "Evolution and Ecophysiology of the Industrial Producer Hypocrea jecorina (Anamorph Trichoderma reesei) and a New Sympatric Agamospecies Related to It", PLOS ONE, vol. 5, no. 2, 2010, pages E9191
FAZENDA ET AL.: "Submerged culture fermentation of ''higher fungi'': the macrofungi", ADVANCES IN MICROBIOLOGY, vol. 63, 2008, pages 33 - 103
GIEBEL; SPRTIZ, NAR, vol. 18, 1990, pages 4947
GRUBER, F.; J. VISSER; C. P. KUBICEK; L. H. DE GRAAFF: "The development of a heterologous transformation system for the cellulolytic fungus Trichoderma reesei based on a pyrG-negative mutant strain", CURR GENET, vol. 18, 1990, pages 71 - 76
GUANGTAO, Z.; L. HARTL; A. SCHUSTER; S. POLAK; M. SCHMOLL; T. WANG; V. SEIDL; B. SEIBOTH: "Gene targeting in a nonhomologous end joining deficient Hypocrea jecorina", JOURNAL OF BIOTECHNOLOGY, vol. 139, 2009, pages 146 - 151
HIRSCHBERG, D.S.: "A linear space algorithm for computing longest common subsequences", COMMUN ASSOC COMPUT MACH, vol. 18, 1975, pages 341 - 343
HIRSCHBERG, D.S.: "A linear space algorithm for computing maximal common subsequences", COMMUN ASSOC COMPUT MACH, vol. 18, 1975, pages 341 - 343
HUSEMANN P; STOYE J: "r2cat: synteny plots and comparative assembly", BIOINFORMATICS, vol. 26, no. 4, 2010, pages 570 - 571
KANG S.; CHUMLEY F.; VALENT B.: "Isolation of the Mating-Type Genes of the Phytopathogenic Fungus Magnaporthe grisea Using Genomic Subtraction", GENETICS, vol. 138, 1994, pages 289 - 296
KUHLS K; LIECKFELDT E; SAMUELS GJ; KOVACS W; MEYER W ET AL.: "Molecular evidence that the asexual industrial fungus Trichoderma reesei is a clonal derivative of the ascomycete Hypocrea jecorina", PNAS, vol. 93, 1996, pages 7755 - 7760
LECROM ET AL.: "Tracking the roots of cellulase hyperproduction by the fungus Trichoderma reesei using massively parallel DNA sequencing", PNAS, vol. 106, no. 38, 2009, pages 16151 - 16156
LIU D.; COLOE S.; BAIRD R.; PEDERSEN J.: "Rapid Mini-Preparation of Fungal DNA for PCR", JOURNAL OF MICROBIOLOGY, vol. 38, no. 1, 2000, pages 471
MACH RL; SCHINDLER M; KUBICEK CP: "Transformation of Trichoderma reesei based on hygromycin B resistance using homologous expression signals", CURR GENET, vol. 25, 1994, pages 567 - 570
MARTINEZ D. ET AL.: "Genome Sequence Analysis of the Cellulolytic Fungus Trichoderma reesei (syn. Hypocrea jecorina) Reveals a Surprisingly Limited Inventory of Carbohydrate Active Enzymes", NATURE BIOTECHNOLOGY, vol. 26, 2008, pages 553 - 560
MYERS, E.W.; W. MILLER.: "Optimal alignments in linear space", CABIOS, vol. 4, no. 1, 1988, pages 11 - 17
NAMIKI, F.; MATSUNAGA, M.; OKUDA, M.; INOUE, I.; NISHI, K.; FUJITA, Y.; TSUGE, T.: "Mutation of an arginine biosynthesis gene causes reduced pathogenicity in Fusarium oxysporum f. sp. melonis", MOL. PLANT-MICROBE INTERACT, vol. 14, 2001, pages 580 - 584
PICARD M.; DEBUCHY R.; COPPIN E.: "Cloning the Mating Types of the Heterothallic Fungus Podospora anserina: Developmental Features of Haploid Transformants Carrying Both Mating Types", GENETICS, vol. 148, 1991, pages 539 - 547
PUNT ET AL.: "Filamentous fungi as cell factories for heterologous protein production", TRENDS IN BIOTECHNOLOGY, vol. 20, no. 5, 2002, pages 200 - 206
RISSMAN AI; MAU B; BIEHL BS; DARLING AE; GLASNER JD; PERNA NT: "Reordering contigs of draft genomes using the Mauve aligner", BIOINFORMATICS, vol. 25, no. 16, 2009, pages 2071 - 2073
SEIDL ET AL.: "Sexual development in the industrial workhorse Trichoderma reesei", PNAS, vol. 106, no. 33, 2009, pages 13909 - 13914
TOMIC ET AL., NAR, vol. 18, 1990, pages 1656
V. SEIDL ET AL: "Sexual development in the industrial workhorse Trichoderma reesei", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 106, no. 33, 18 August 2009 (2009-08-18), pages 13909 - 13914, XP055105403, ISSN: 0027-8424, DOI: 10.1073/pnas.0904936106 *
VERENA SEIDL & BERNHASRD SEIBOTH: "Trichoderma reesei:genetic approaches to improving srain efficiency", BIOFUELS, FUTURE SCIENCE LTD, GB, vol. 1, no. 2, 1 March 2010 (2010-03-01), pages 343 - 354, XP002658903, ISSN: 1759-7269, DOI: 10.4155/BFS.10.1 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015051012A3 (en) * 2013-10-02 2015-06-04 Academia Sinica Method for producing segmental aneuploidy (san) strains of trichoderma reesei via sexual crossing and san strains produced therefrom
US9598738B2 (en) 2013-10-02 2017-03-21 Academia Sinica Method for producing segmental aneuploidy (SAN) strains of Trichoderma reesei via sexual crossing and SAN strains produced therefrom
WO2015086701A1 (en) * 2013-12-10 2015-06-18 Technische Universität Wien Introducing or inactivating female fertility in filamentous fungal cells
CN108138213A (zh) * 2015-02-20 2018-06-08 罗尔公司 控制蛋白酶产生的方法
US10883131B2 (en) 2015-02-20 2021-01-05 Roal Oy Methods for controlling protease production
WO2019008303A1 (fr) 2017-07-07 2019-01-10 IFP Energies Nouvelles Procede de rétablissement de la reproduction sexuee chez le champignon trichoderma reesei
FR3068710A1 (fr) * 2017-07-07 2019-01-11 IFP Energies Nouvelles Procede de retablissement de la reproduction sexuee chez le champignon trichoderma reesei
CN110832064A (zh) * 2017-07-07 2020-02-21 Ifp新能源公司 在真菌里氏木霉中恢复有性繁殖的方法
US11401497B2 (en) 2017-07-07 2022-08-02 IFP Energies Nouvelles Method for restoring sexual reproduction in the fungus Trichoderma reesei
CN110832064B (zh) * 2017-07-07 2023-09-15 Ifp新能源公司 在真菌里氏木霉中恢复有性繁殖的方法
CN114703202A (zh) * 2022-03-30 2022-07-05 四川省农业科学院植物保护研究所 淡紫紫孢菌Pth11基因及其功能验证方法
WO2024118882A1 (en) * 2022-12-01 2024-06-06 Genencor International Bv Iterative multiplex genome engineering in microbial cells using a selection marker swapping system

Also Published As

Publication number Publication date
JP6660181B2 (ja) 2020-03-11
EP2938727B1 (en) 2018-11-14
US20150361510A1 (en) 2015-12-17
DK2938727T3 (en) 2019-01-14
US9920384B2 (en) 2018-03-20
EP2938727A1 (en) 2015-11-04
JP2016501549A (ja) 2016-01-21
CN105980565A (zh) 2016-09-28
CA2891952A1 (en) 2014-07-03

Similar Documents

Publication Publication Date Title
US9920384B2 (en) Genes/genetic elements associated with mating impairment in Trichoderma reesei QM6a and its derivatives and process for their identification
Schumacher Tools for Botrytis cinerea: new expression vectors make the gray mold fungus more accessible to cell biology approaches
CA2834716C (en) Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
EP3329001A1 (en) Genome editing systems and methods of use
WO2016100562A1 (en) Compositions and methods for helper strain-mediated fungal genome modification
CN113564199B (zh) 创制高产大豆的方法
Li et al. Rational design for fungal laccase production in the model host Aspergillus nidulans
Kim et al. Identification and functional analysis of pheromone and receptor genes in the B3 mating locus of Pleurotus eryngii
JP2021521821A (ja) 粘性が低下した表現型を含む糸状菌株
EP3374377A1 (en) Wap genes and proteins that improve bacillus competitiveness
WO1999027072A1 (en) Reagents and methods for diversification of dna
Davolos et al. A molecular and bioinformatic study on the ochratoxin A (OTA)-producing Aspergillus affinis (section Circumdati)
Kuo et al. Improvement in the secretory expression of recombinant Candida rugosa lipase in Pichia pastoris
JP6599583B1 (ja) 多重遺伝子破壊アスペルギルス属微生物及びその製造方法
US20210301276A1 (en) Mutant and genetically modified filamentous fungal strains comprising enhanced protein productivity phenotypes and methods thereof
JP2012223137A (ja) デンプン顆粒結合型デンプン合成酵素をコードする核酸、プライマー対、抑制剤およびモチ性ソバ属植物
Class et al. Patent application title: GENES/GENETIC ELEMENTS ASSOCIATED WITH MATING IMPAIRMENT IN TRICHODERMA REESEI QM6A AND ITS DERIVATIVES AND PROCESS FOR THEIR IDENTIFICATION Inventors: Christian P. Kubicek (Wien, AT) Rita Linke (Wien, AT) Bernhard Seiboth (Wien, AT) Thomas Haarmann (Alsbach-Hahnlein, DE) Patrick Lorenz (Lorsch, DE)
Tauati et al. Investigating the role of dicer 2 (dcr2) in gene silencing and the regulation of mycoviruses in Botrytis cinerea
JP7358105B2 (ja) アスペルギルス属糸状菌のピリチアミン耐性変異株
EP3030661B1 (en) Increasing the expression of a transgene in eukaryotic cells by reducing rna interference
Dornte et al. Split trp1+ gene markers for selection in sequential transformations of the Agaricomycete Coprinopsis cinerea
RU2439157C2 (ru) ГЕНЕТИЧЕСКАЯ КОНСТРУКЦИЯ ДЛЯ ПОЛУЧЕНИЯ СТАБИЛЬНЫХ ТРАНСФОРМАНТОВ ГРИБОВ РОДА Rhizopus
US9598738B2 (en) Method for producing segmental aneuploidy (SAN) strains of Trichoderma reesei via sexual crossing and SAN strains produced therefrom
JP2024524924A (ja) バナナ果実における褐変の遅延又は防止
KR101454157B1 (ko) 포자형성을 억제하면서 아스퍼질러스 푸미가투스를 배양하는 방법 및 고온배양 시 포자형성이 억제되는 아스퍼질러스 푸미가투스

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13814970

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2891952

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2015550064

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 14758238

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015015329

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2013814970

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 112015015329

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150624