WO2014090122A1

WO2014090122A1 - Pharmaceutical compositions for reducing sugar level, preparation methods and applications thereof

Info

Publication number: WO2014090122A1
Application number: PCT/CN2013/088841
Authority: WO
Inventors: 吴以岭; 田书彦; 赵韶华; 高学东; 李向军; 刘敏彦; 董超; 秦拢; 王宏涛; 唐思文; 徐登峰; 安军永
Original assignee: 石家庄以岭药业股份有限公司
Priority date: 2012-12-12
Filing date: 2013-12-09
Publication date: 2014-06-19
Also published as: CN103860877B; CN103860877A

Abstract

A pharmaceutical composition for treating diabetes, and a preparation method and an application thereof. Active ingredients of the pharmaceutical composition comprise roasted Rhizoma Atractylodis Macrocephalae, rhizoma polygonati, scrophularia ningpoensis, roots of kudzuvine, and Gynostemma pentaphyllum. A pharmaceutical composition for treating diabetes, and a preparation method and an application thereof. The pharmaceutical composition are produced by using the following active ingredients: roasted Rhizoma Atractylodis Macrocephalae, rhizoma polygonati, roots of red salvia, scrophularia ningpoensis, roots of kudzuvine, mulberry leaves, anemarrhena rhizome, winged euony twigs, Gynostemma pentaphyllum, and lychee seed.

Description

Medicinal composition for hypoglycemia and preparation method and use thereof

Technical field

The invention belongs to the field of pharmaceutical technology. In particular, the present invention relates to a medicament for treating diabetes, a preparation method thereof and a pharmaceutical use. Background technique

Diabetes mellitus (diabetes) is an endocrine and metabolic disease characterized by chronic hyperglycemia caused by various causes. It is a common and frequently-occurring disease that seriously endangers human health and has become a global health concern. Among them, type I type I diabetes is also called adult-onset diabetes, and it usually occurs after 35-40 years old, accounting for more than 90% of diabetic patients. According to the 2002 epidemiological survey of diabetes, the prevalence of urban diabetes in China was 4.5%, and that in rural areas was 1.8%. In 2007-2008, the Diabetes Association of China Medical Association was held in nearly 50,000 people in 14 provinces and cities nationwide. According to the epidemiological survey, the prevalence rate of diabetes in China was over 9.7%, and the pre-diabetes prevalence rate was 15.5%. These data show that China has become one of the countries with the most diabetes patients, and the population of diabetes "reserve army" is huge. Although due to the application of antibiotics and the advent of insulin, diabetic patients die from infection and ketoacidosis, but diabetes is prone to cardiovascular and cerebrovascular disease, the incidence of arteriosclerosis can reach 90%, and diabetic neuropathy, Fundus lesions and kidney lesions pose an increasing threat to human health and life. Studies have shown that after 10 years of diabetes, 30%-40% of patients have at least one complication, and clinical statistics show 40%- 50% of diabetic patients develop retinopathy after 10 years of onset; about 2% of patients are completely blind after 15 years of onset; 5%-10% of patients develop end-stage renal disease 20 years after onset. At present, the incidence of diabetes is increasing year by year, which has become a heavy burden for the society and the family economy. It is imperative to actively carry out research on prevention and treatment of diabetes.

Currently, the western medicine hypoglycemic drugs used for the treatment of diabetes mainly include sulfonylureas and glinides which promote insulin secretion, and biguanides, α-glucosidase inhibitors and insulin sensitizers which increase insulin sensitivity, etc. People with diabetes need to take medication for life. Long-term use of the above hypoglycemic agents can cause many side effects and adverse reactions. For example, sulfonylureas and glinides are mainly hypoglycemic. After taking the medicine, there will be palpitation, sweating and hunger. In severe cases, there may even be disturbances of consciousness, and sometimes allergic reactions such as rash and liver and kidney damage may occur. The biguanides are mainly gastrointestinal reactions (nausea, loss of appetite) and lactic acidosis (weakness, disturbance of consciousness, and even coma). Some patients have liver and kidney dysfunction and allergic reactions as well as large cell anemia reactions; the main side effect of α-glycosidase inhibitors is gastrointestinal reactions; the biggest side effect of insulin sensitizers is liver damage and increased blood. Capacity, which increases the burden on the heart. For patients who use insulin, there are also side effects such as hypoglycemia, subcutaneous lipodystrophy, insulin allergy, hyperinsulinemia, insulin resistance, insulin edema, refractive error, and weight gain. Traditional Chinese medicine has accumulated rich theoretical and practical experience in the prevention and treatment of diabetes. Traditional Chinese medicine preparations have comprehensive conditioning advantages, and have a significant role in improving clinical symptoms, lowering blood sugar, urine sugar, improving blood circulation, delaying and reducing chronic complications such as blood vessels and neuropathy, and improving quality of life. highly valued. At present, there are about 50 kinds of proprietary Chinese medicines that have been marketed for the treatment of diabetes or diabetes, and more than 100 kinds of drugs for treatment or adjuvant therapy. For example, Yuquan Pill, Jiangtang Capsule, Diabetes Tablet for Yin Deficiency and Heat Syndrome; Xiaoke Ping Tablet for Yin Deficiency, Qi and Yin Deficiency Syndrome; Jinqi Jiangtang Tablet for Internal Heat Qi Deficiency ; Shenjing Zhike Pills for Qiyin deficiency and internal heat and zinc injury syndrome; Jiangtangshu Capsule, Shenqi Jiangtang Capsule, Maiqi Jiangtang Capsule, Shiwei Yuquan Capsule, Diabetes for Qi and Yin Deficiency Syndrome Le capsule, Xiaokeling tablets, hypoglycemic tablets, thirsty Lening capsules, etc.; Yangyin Jiangtang tablets, Qijiangtang capsules, Yusanxiao capsules for Qi and Yin deficiency and blood stasis syndrome; Xiaoxu An Capsule, Tangmai Kang Granules, etc.

Analysis of the currently marketed diabetes proprietary Chinese medicine products shows that most of these products are located on the yin deficiency heat and qi and yin deficiency syndromes. The vast majority are for heat-clearing and nourishing yin and qi-supplementing products. Attention to the lungs, stomach and kidneys and other organs began to pay attention to the spleen and spleen and spleen and spleen and spleen and transport. The reason is that the disease of thirst is characterized by thirst, polydipsia, hunger, hunger, urinary tract, sweetness, body weight loss, and body fatigue. The pathological mechanism of the disease is discussed in the past. The lungs, stomach, and kidneys are summarized in the "yin deficiency and heat". However, the drinking water of patients with diabetes has not been able to solve their thirst. The water they drink tends to be under the focus and often urinate. The food is not for the skin, the diet is excreted and the body is thin, but the incidence of diabetes is more It is related to physical obesity, fat people are more damp, and the body of phlegm- sulphate is susceptible to yin deficiency and heat. These contradictory pathological phenomena should be mainly due to the disorder and imbalance of water valley fluid metabolism and transmission, and the fine transfer and utilization of diet. Due to the status. Therefore, in this pathological process, the dysfunction of the spleen is crucial, and the pathogenesis and pathological mechanism of diabetes from the spleen cannot be ignored.

Therefore, there is still a need in the art for a traditional Chinese medicine preparation which is effective in efficacy and has no toxic side effects, particularly a traditional Chinese medicine preparation which can be effective against the dysfunction of the spleen. Summary of the invention

In view of the above technical problems, the present inventors have explored the pathogenesis and pathological mechanism of diabetes (diabetes), and after a lot of research and experiments, proposed a new drug, which is a pure Chinese medicine compound preparation, which can restore the spleen. The normal function of the water-feeding solution is to correct the imbalance in the use of the water and the metabolic process of the water, and to eliminate the symptoms of stagnation and thirst.

Specifically, the technical solution of the present invention is as follows:

In one aspect, the present invention provides a pharmaceutical composition for hypoglycemic, the raw material of the pharmaceutical composition comprising, by weight: 4 to 12 parts of Atractylodes Rhizome, 5 to 15 parts of Polygonatum, and 5 to 15 parts of Scrophularia 15 parts, 5 to 15 parts of pueraria, 5 to 15 parts of Gynostemma pentaphyllum; preferably, the drug substance of the pharmaceutical composition of the present invention is in parts by weight from the atractylodes 4 to 12 parts, 5 to 15 parts of Polygonatum, 5 to 15 parts of Scrophularia, 5 to 15 parts of Pueraria, 5 to 15 parts of Gynostemma pentaphyllum; Preferably, the drug substance of the pharmaceutical composition is 4 parts by weight of amaranth 15 parts of Huangjing, 5 parts of Scrophulariae, 15 parts of Radix Puerariae, 5 parts of Gynostemma pentaphyllum, or preferably 12 parts of Atractylodes Rhizome, 5 parts of Polygonatum, 15 parts of Scrophularia, 5 parts of Radix Puerariae, 15 parts of Gynostemma pentaphyllum;

Preferably, the drug substance of the pharmaceutical composition comprises, in parts by weight: 6 to 10 parts of Atractylodes Rhizome, 8 to 12 parts of Polygonatum, 8 to 12 parts of Scrophulariae, 8 to 12 parts of Radix Puerariae, and 8 to 12 parts of Gynostemma pentaphyllum; Preferably, the drug substance of the pharmaceutical composition of the present invention comprises 6 to 10 parts by weight of amaranth, 8 to 12 parts of yellow essence, 8 to 12 parts of scrophularia, 8 to 12 parts of pueraria, and 8 to 12 parts of gynostemma in parts by weight. ;

Preferably, the drug substance of the pharmaceutical composition is composed of 6 parts of fried atractylodes, 12 parts of scutellaria, 8 parts of scrophularia, 12 parts of puerarin, 8 parts of gynostemma, or preferably 10 parts of fried atractylodes, in parts by weight, 8 parts, 12 parts of Scrophularia, 8 parts of Pueraria, 12 parts of Gynostemma.

Further, the raw material medicine of the pharmaceutical composition further comprises: salvia miltiorrhiza, mulberry leaf, anemarrhena, ghost arrow feather, litchi core. Preferably, the composition of the present invention consists of Atractylodes macrocephala, Rhizoma Polygonati, Radix Salviae Miltiorrhizae, Radix Scrophulariae, Radix Puerariae, Mulberry Leaf, Anemarrhenae, Ghost Arrow, Gynostemma, and Litchi.

Preferably, the pharmaceutical composition is made up of the following bulk drugs in parts by weight:

4 to 12 parts of fried Atractylodes, 5 to 15 parts of Polygonatum, 10 to 30 parts of Salvia miltiorrhiza, 5 to 15 parts of Scrophulariae, 5 to 15 parts of Pueraria, 5 to 15 parts of mulberry leaves, 5 to 15 parts of Zhimu, Ghosts and Arrows 5 Up to 15 parts, 5 to 15 parts of Gynostemma pentaphyllum, 7 to 22 parts of lychee core;

Further, the pharmaceutical composition is prepared from the following raw materials: 12 parts of Atractylodes Rhizome, 5 parts of Polygonatum, 30 parts of Salvia miltiorrhiza, 5 parts of Scrophularia, 15 parts of Pueraria, 5 parts of Mulberry, 15 parts of Anemarrhena, 15 parts of Ghost Arrow 5 servings, 15 parts of Gynostemma pentaphyllum, 7 parts of litchi core;

Alternatively, the pharmaceutical composition is prepared from the following raw materials: 4 parts of Atractylodes Rhizome, 15 parts of Polygonatum, 10 parts of Salvia miltiorrhiza, 15 parts of Scrophularia, 5 parts of Radix Puerariae, 15 parts of Mulberry leaves, 5 parts of Anemarrhenae, and 5 Parts, 5 parts of Gynostemma pentaphyllum, 22 parts of litchi core;

Alternatively, the pharmaceutical composition is prepared from the following raw materials: 12 parts of Atractylodes Rhizome, 15 parts of Polygonatum, 30 parts of Salvia miltiorrhiza, 15 parts of Scrophularia, 15 parts of Pueraria, 15 parts of Mulberry, 15 parts of Anemarrhena, 15 parts of Ghost Arrow 15 Parts, 15 parts of Gynostemma pentaphyllum, 22 parts of litchi core.

Further preferably, the pharmaceutical composition is made of the following drug substance:

6 to 10 parts of fried atractylodes, 8 to 12 parts of Huangjing, 12 to 24 parts of Salvia miltiorrhiza, 8 to 12 parts of Scrophulariae, 8 to 12 parts of Pueraria, 8 to 12 parts of mulberry leaves, 8 to 12 parts of Anemarrhena, 8 Up to 12 parts, 8 to 12 parts of Gynostemma pentaphyllum, 12 to 18 parts of lychee core;

More preferably, the pharmaceutical composition is made of the following bulk drugs: 6 parts of fried atractylodes, 12 parts of yellow essence, salvia miltiorrhiza 12 Serve, 12 parts of Scrophularia, 8 parts of Pueraria, 12 parts of mulberry leaves, 8 parts of Zhimu, 12 pieces of ghost arrow feather, 8 parts of Gynostemma pentaphyllum, 18 parts of lychee core;

Alternatively, the pharmaceutical composition is prepared from the following raw materials: 10 parts of Atractylodes Rhizome, 8 parts of Polygonatum, 24 parts of Salvia miltiorrhiza, 8 parts of Scrophularia, 12 parts of Pueraria, 8 parts of Mulberry, 12 parts of Anemarrhena, 12 parts of Anemarrhena, Ghost Feather 8 Parts, 12 parts of Gynostemma pentaphyllum, 12 parts of litchi core;

Alternatively, the pharmaceutical composition is made from the following bulk drugs:

8 parts of fried atractylodes, 10 parts of Huangjing, 20 parts of Salvia miltiorrhiza, 10 parts of Scrophularia, 10 parts of Pueraria, 10 parts of mulberry leaves, 10 parts of Zhimu, 10 parts of ghost arrow feather, 10 parts of Gynostemma pentaphyllum, and 15 parts of litchi core.

Clinically, the pharmaceutical composition of the present invention can be used as a medicine after being simply processed by a conventional pharmaceutical method in the field of traditional Chinese medicine, and has a good hypoglycemic effect on diabetes, particularly type I diabetes. For example, each of the drug substances of the pharmaceutical composition of the present invention can be directly decocted and used as a decoction. Therefore, the composition of the present invention can be obtained by a method comprising the steps of: weighing the drug substance in proportion, adding water to decoction and filtering, and then taking the boiling solution. Preferably, the method of preparing the pharmaceutical composition comprises the steps of:

1) Weigh the raw materials in proportion, in which the litchi nucleus is broken, then decocted with water for 2-3 times, each time adding 6-15 times of water, and the boiling liquid is filtered and combined;

2) The decoction liquid obtained in the step 1) is concentrated under reduced pressure to a chemical solution having a relative density of 1.05-1.

3) Spray the solution obtained in step 2) to obtain a spray-dried powder.

However, in general, traditional decoctions are relatively cumbersome to fry and are not convenient for patients to carry and take. Therefore, in a preferred embodiment of the present invention, the pharmaceutical composition of the present invention can be treated to obtain its active ingredient in combination with the medicinal properties of the present invention.

Accordingly, in another aspect, the present invention provides a method of preparing an active ingredient of the above pharmaceutical composition, the method comprising:

3) Spray the solution obtained in step 2) to obtain a spray-dried powder.

According to a particular embodiment of the invention, the pharmaceutical composition may also be reprocessed into pharmaceutical preparations such as tablets, capsules, powders or granules for clinical use.

For example, in a preferred embodiment, a tablet may be selected as the dosage form for this formulation. According to a particular embodiment of the invention, the tablet is made by the following steps:

2的溶液液; 2) The liquid of the decoction liquid obtained in step 1) is concentrated to a concentration of 1. 05-1. 3) spray drying the liquid obtained in step 2) to obtain a spray-dried powder;

4) The spray-dried powder obtained in the step 3) is subjected to dry granulation, granulated, added with magnesium stearate, mixed, compressed, and then coated with a film.

Further preferably, according to a specific embodiment of the present invention, the tablet of the present invention is prepared by the following steps: 1) weighing the drug substance in proportion, wherein the litchi core is broken, and then boiling water three times, adding 9 times for the first time Decoction for 2 hours, the second time with 9 times the amount of water to cook for 1.5 hours, the third time with 7 times the amount of water for 1 hour, the decoction is filtered and combined;

2) The decoction liquid obtained in the step 1) is concentrated under reduced pressure to a liquid having a relative density of 1. 15-1.20 at 60 ° C;

3) spray drying the liquid obtained in step 2) to obtain a spray-dried powder;

4) dry-granulating the spray-dried powder obtained in the step 3), and then sizing the granules with a No. 2 sieve;

5) Add dry powder weight 0.4% magnesium stearate, mix, compress, and then film coat.

In still another aspect, the present invention provides the use of the above pharmaceutical composition for the preparation of a medicament for treating diabetes and a related disease thereof; preferably, the diabetes is type I diabetes.

In summary, the present invention provides a pure Chinese medicine preparation which is effective and has no toxic side effects, and the medicine of the present invention has the following advantages as compared with the prior art medicines in the art:

The raw materials for the pharmaceutical composition of the present invention include atractylodes, yellow essence, scrophularia, puerarin, and gynostemma, or the components thereof are composed of fried atractylodes, huangjing, scrophularia, puerarin, and gynostemma. Its prescription has a good hypoglycemic effect on diabetes, especially type I diabetes.

Further, the raw material medicine of the pharmaceutical composition of the present invention may further comprise salvia miltiorrhiza, mulberry leaf, Zhimu, ghost arrow feather, litchi nucleus, or the group thereof consisting of fried atractylodes, huangjing, salvia miltiorrhiza, scrophularia, puerarin, mulberry leaf, and known Mother, ghost arrow feather, Gynostemma pentaphyllum, litchi core. The prescription of these 10 herbs has a better hypoglycemic effect on diabetes, especially type I diabetes.

Clinically, the pharmaceutical composition of the present invention can be used as a medicine after being simply processed by a conventional pharmaceutical method in the field of traditional Chinese medicine, and has a good hypoglycemic effect on diabetes, particularly type I diabetes. For example, clinical use of this group as a decoction can improve clinical symptoms, lower blood sugar, urine sugar, improve blood circulation, delay and reduce chronic complications such as blood vessels and neuropathy, and have no side effects of western medicine commonly used in the field. . In addition, since the traditional decoction is relatively troublesome in frying, it is not convenient for the patient to carry and take. Therefore, in combination with the medicinal properties of the prescription, the pharmaceutical composition of the present invention can be further processed and processed into other dosage forms. For clinical use such as tablets, capsules and the like, for example, the present invention selects a tablet as a preferred dosage form of the pharmaceutical composition. Compared with other dosage forms, the invention provides that the dosage of the auxiliary materials of the tablet is small, and the experiment proves that it is easy to form, the dissolution rate and the bioavailability are good, the volume is small, the dosage is accurate, and the difference in the drug content is small, carrying, It is convenient to transport and take.

In terms of the preparation of the pharmaceutical compositions of the present invention, the present invention also provides methods for their preparation as well as specially optimized preparation steps and conditions. The experiment proves that the preparation method of the invention has a reasonable route and the process parameters are clear, after three batches. Test certificate, the quality of the finished product has been inspected according to the regulations, and the transfer rate of salvianolic acid B is basically stable, indicating that the method is stable and reliable.

The pharmaceutical compositions provided by the present invention are also useful in the preparation of a medicament for the treatment of diabetes, particularly type II diabetes, which composition or medicament can be used to treat diabetes and its related conditions. Diabetes is a lifelong disease, and in order to consolidate the curative effect, the medication is generally longer. Animal model experiments have shown that the pharmaceutical composition of the present invention has significant improvement effects on blood sugar, blood lipids, endothelial function, insulin resistance index and insulin receptor in type II diabetic rats, and acute and long-toxic experiments show that The drug is safe and has no obvious side effects. The experiment also suggests that the drug can regulate the expression of insulin receptors, inhibit oxidative stress caused by high glucose and high fat, and vascular endothelial injury, and play a role in the treatment of type 2 diabetes, concurrent with diabetes and hyperlipidemia. It also has a potential preventive and therapeutic effect, and can be used as a new type of traditional Chinese medicine preparation with clinical curative effect and little toxic side effects. In clinical use, it has been found that the drug of the present invention has a similar or better effect than the positive drug metformin in terms of clinical total efficacy, biochemical indicators, and improvement in clinical symptoms.

Fried atractylodes: It has the functions of strengthening the spleen and replenishing qi, dampness and dampness, antiperspirant, and anti-fetal. It mainly contains polysaccharides and amino acids. Modern pharmacological experiments show that Baizhu extract decoction has hypoglycemic effect, so it is decoction in this side.

Huang Jing: It has the effects of tonifying qi and nourishing yin, strengthening the spleen, moistening the lungs and benefiting the kidney. It mainly contains components such as saponins, starches, polysaccharides and amino acids. Modern pharmacological experimental studies have shown that Polysaccharide from Polygonatum is an effective component in the treatment of diabetes, which can significantly reduce hyperglycemia, so the water is decoction.

Salvia miltiorrhiza: It has the effects of relieving pain, promoting blood circulation and clearing the heart, clearing the heart and removing troubles. The Chinese Danshen takes its role in promoting blood circulation and removing blood stasis. Modern pharmacological research shows that its water-soluble ingredients have the effect of promoting blood circulation and removing blood stasis. Therefore, water is used in this prescription. decoction.

Scrophularia sinensis: It has the effects of cooling blood and nourishing yin, purging fire and detoxification, and mainly contains iridoids. Pharmacological studies have shown that Scrophularia sinensis extract has a mild hypoglycemic effect, so the water is boiled.

Pueraria: It has the effect of raising the spleen and stomach, and the main ingredient is flavonoids such as puerarin. Pharmacological experiments show that puerarin has the effect of lowering blood sugar, and it is proposed to use different solvents to investigate the extraction process of puerarin.

Mulberry leaves: It has the functions of evacuating wind and heat, clearing the lungs and moistening the dryness, clearing the liver and improving eyesight, and mainly contains flavonoids and alkaloids. Pharmacological experiments show that the active components of mulberry blood glucose and anti-diabetes are mainly polysaccharides, total flavonoids and polyhydroxy alkaloids. Since these components are all soluble in hot water, they are decoctioned with water.

Zhimu: It has the functions of clearing heat and purging fire, and moistening and moistening the skin. It mainly contains saponins, flavonoids and dipyridone. Pharmacological experiments show that mangiferin in dipyridone has the effect of lowering blood sugar, and is the main effective component of Zhimu in the treatment of diabetes. Because it is easily soluble in water, it is decoction in this side.

Ghost Arrow Feather: It has the functions of breaking blood, passing through, killing insects and relieving pain. The soil should contain active ingredients such as flavonoids and saponins. Pharmacological experiments have shown that the decoction has the effect of lowering blood sugar and is used for the treatment of diabetes. Therefore, water decoction is used in this prescription. Gynostemma pentaphyllum: It has the effects of clearing away heat and detoxifying, relieving cough, and lowering fat and losing weight. Modern pharmacology shows that the main active ingredient is saponin, which can lower blood sugar. Since Gynostemma pentaphyllum, the main active ingredient of Gynostemma pentaphyllum, is easily soluble in water, it is decoctioned with water.

Litchi core: It has the effect of stagnation. The theory of traditional Chinese medicine believes that the spleen transport is long-lasting, the air machine is unsmooth, and the fluid is difficult to be transported. The nucleus of the medlar is used as a medicine, and the stagnation of the gas, the liver stagnation, and the blood in the blood, make the air flow smooth, the blood flow is smooth, The body fluid is easy to lose. Modern pharmacological studies have shown that the lychee core aqueous solution has a hypoglycemic effect, so the process of water extraction is selected. detailed description

The invention is described below with reference to specific embodiments. Those skilled in the art will appreciate that these examples are only illustrative of the invention and are not intended to limit the scope of the invention in any way.

The experimental methods in the following examples are conventional methods unless otherwise specified. The medicinal materials, reagent materials and the like used in the following examples are commercially available products unless otherwise specified. Example 1

Prescription: Fried Atractylodes 40g, Polygonatum 150g, Scrophulariaceae 50g, Pueraria 150g, Gynostemma 50g;

System of law: Take the above-mentioned prescription Chinese herbal medicines, select them separately, weigh them according to the prescription amount, and add 2 liters of water to each of the two decoctions as decoction, and combine the decoction. Example 2

Prescription: Fried Atractylodes 60g, Polygonatum 120g, Scrophulariaceae 80g, Pueraria 120g, Gynostemma 80g;

Method: Take the above-mentioned prescription Chinese herbal medicines, select them separately, weigh them according to the prescription amount, and add 2 liters of water to each other twice to make soup Qi, and combine the decoction. Example 3

Prescription: Fried Atractylodes 120g, Polygonatum 50g, Scrophularia 150g, Pueraria 50g, Gynostemma 150g

Method: Take the above prescription Chinese herbal medicines, select the net separately, weigh according to the prescription amount, add water to cook twice, first add 15 times the amount of water to cook for 2 hours, the second time add 6 times the amount of water to cook 1. After 5 hours, the decoction was filtered, combined, and concentrated under reduced pressure to give a solution having a relative density of 1.15 at 60 ° C. The solution was spray-dried to obtain a spray-dried powder, which was then filled into capsules. Example 4

Prescription: Fried Atractylodes 100g, Polygonatum 80g, Scrophularia 120g, Pueraria 80g, Gynostemma 120g Method: Take the Chinese herbal medicines in the above prescriptions, select them separately, weigh them according to the prescription amount, add boiling water twice, first add 15 times the amount of water to cook for 2 hours, and add the second time with 6 times the amount of water to cook 1 After 5 hours, the decoction was filtered, combined, and concentrated under reduced pressure to obtain a chemical solution having a relative density of 1.15 at 60 ° C, and the solution was spray-dried to obtain a spray-dried powder, which was then filled into capsules. Example 5

Prescription: Fried Atractylodes 40g, Polygonatum 150g, Salvia miltiorrhiza 100g, Scrophulariaceae 150g, Pueraria 50g, Mulberry Leaf 150g, Zhimu 50g, Ghost Arrow Plume 150g, Gynostemma 50g, Lychee Core 220g

Method: Take the Chinese herbal medicines in the above prescriptions, select them separately, and weigh them according to the prescription amount. Among them, the litchi core is broken, and the water is boiled for 3 times. The first time is added 15 times the amount of water for 2 hours, the second time is added 10 times. The medicinal solution having a relative density of 1.20 was measured at 60 ° C, and the drug was decocted for 1 hour. The solution was spray dried to obtain a spray dried powder. The spray-dried powder was dry-granulated, and the granules were granulated with a No. 2 sieve, and the granules were added with 0.4% magnesium stearate, uniformly mixed, tableted, and coated with a film to obtain 620 tablets. Example 6

Prescription: Fried Atractylodes 120g, Polygonatum 50g, Salvia miltiorrhiza 300g, Scrophulariaceae 50g, Puerariae 150g, Mulberry Leaf 50g, Zhimu 150g, Ghost Arrow 50g, Gynostemma 150g, Lychee Core 70g

Method: Take the Chinese herbal medicines in the above prescriptions, select them separately, and weigh them according to the prescription amount. Among them, the litchi core is broken, and the water is boiled for 3 times. The first time, the water is boiled for 6 times for 1 hour, and the second time is 10 times. The medicinal solution with a relative density of 1.05 was measured at 60 ° C, and the drug was concentrated at a temperature of 60 ° C. The solution was spray dried to obtain a spray dried powder. The spray-dried powder was granulated by dry granulation, and the granules were granulated with No. 2 sieve, and the granules were added with 0.5% magnesium stearate, uniformly mixed, tableted, and coated with a film to obtain 680 tablets. Example 7

Prescription: Fried Atractylodes 80g, Polygonatum 100g, Salvia miltiorrhiza 200g, Scrophulariaceae 100g, Pueraria 100g, Mulberry Leaf 100g, Zhimu 100g, Ghost Arrow 100g, Gynostemma 100g, Lychee Core 150g

Method: Take the Chinese herbal medicines in the above prescriptions, select them separately, and weigh them according to the prescription amount. Among them, the litchi core is broken, and the water is boiled three times. The first time, the water is boiled for 9 hours, and the second time is increased by 9 times. The liquid is decocted for 1. 5 hours, the third time is added with 7 times the amount of water for 1 hour, and the decoction is filtered, and the mixture is concentrated under reduced pressure to a liquid having a relative density of 1.18 at 60 ° C. The spray-dried powder is spray-dried, and the spray-dried powder is dry-granulated. The granules are granulated with a No. 2 sieve, and 0.4% of magnesium stearate is added, uniformly mixed, tableted, and coated with a film. 654 tablets were prepared according to this prescription. Example 8

Prescription: Fried Atractylodes 60g, Polygonatum 120g, Salvia Miltiorrhiza 120g, Scrophulariaceae 120g, Pueraria 80g, Mulberry Leaf 120g, Zhimu 80g, Ghost Arrow Feather 120g, Gynostemma 80g, Lychee Core 180g

Method: Take the Chinese herbal medicines in the above prescriptions, select them separately, and weigh them according to the prescription amount. The lychee core is broken, and the water is boiled for 3 times. The first time is added with 10 times the amount of water to cook for 1.5 hours. 10的量液1。 The water is decocted at a temperature of 60 ° C, the relative density of 1. 25 liquid was measured at 60 ° C. The liquid is spray-dried to obtain a spray-dried powder. The spray-dried powder was added to 1200 g of sucrose, granulated, dried, and divided to prepare 210 bags of granules. Example 9

Prescription: Fried Atractylodes 100g, Polygonatum 80g, Salvia Miltiorrhiza 180g, Scrophulariaceae 80g, Pueraria Lolium 120g, Mulberry Leaf 80g, Zhimu 120g, Ghost Arrow Feather 80g, Gynostemma 120g, Litchi Core 120g

Method: Take the Chinese herbal medicines in the above prescriptions, select them separately, and weigh them according to the prescription. Among them, the litchi core is broken, and the water is boiled 3 times. The first time adding 15 times the amount of water for 2 hours, the second time is 10 times. The medicinal solution having a relative density of 1.15 is measured at 60 ° C, and the drug is diluted to a concentration of 1.15 at 60 ° C, and the drug is decocted for 1 hour. The solution was spray-dried to obtain a spray-dried powder, dried, and pelletized to obtain 330 g of a pellet. Example 10

Prescription: Fried Atractylodes 120g, Polygonatum 150g, Salvia miltiorrhiza 300g, Scrophularia 150g, Pueraria 150g, Mulberry 150g, Zhimu 150g, Ghost Arrow 150g, Gynostemma 150g, Lychee Core 220g

Method: Take the Chinese herbal medicines in the above prescriptions, select them separately, and weigh them according to the prescription. Among them, the litchi core is broken, and the water is boiled 3 times. The first time adding 15 times the amount of water for 2 hours, the second time is 10 times. The liquid is decoctioned for 1.5 hours, and the third time is added with 6 times of water for 1 hour. The decoction is filtered, combined, and concentrated under reduced pressure to determine a relative density of 1.20 at 60 ° C. The solution was spray-dried to obtain a spray-dried powder, dried, and pulverized into a fine powder to obtain 510 g of a powder. Example 11

Prescription: Atractylodes Rhizome 116g, Polygonatum 145g, Salvia miltiorrhiza 290g, Scrophulariaceae 145g, Pueraria 145g, Mulberry leaf 145g, Zhimu 145g, Ghost arrow feather 145g, Gynostemma 145g, Litchi core 217. 5g

Method: Take the Chinese herbal medicines in the above prescriptions, select them separately, and weigh them according to the prescription amount. Among them, the litchi core is broken, and the water is boiled three times. The first time, the water is boiled for 9 hours, and the second time is increased by 9 times. The liquid is decocted for 1. 5 hours, and the third time is added with 7 times the amount of water for 1 hour, and the decoction is filtered, and the mixture is concentrated under reduced pressure to a liquid having a relative density of 1.18 at 60 ° C. Spray drying is carried out to obtain a spray-dried powder. The spray-dried powder is granulated by dry granulation, and the granules are sieved with No. 2 Granules, added 0.4% magnesium stearate, mixed evenly, compressed, coated with film, that is. 687 tablets were prepared according to this prescription. Example 12

The stability of the pharmaceutical composition of the present invention was examined in accordance with the provisions of the Drug Registration Regulations. I. Test sample: A tablet prepared according to the method of Example 5, batch number 071101, specification 0.53 g/tablet.

Second, packaging and placement conditions: The inner packaging is medicinal PVC hard sheet and PTP aluminum foil blister, the outer packaging is aluminum-plastic composite film. The accelerated test is carried out at a temperature of 40 ° C ± 2 ° C and a relative humidity of 75% ± 5%, and the long-term test is carried out under normal temperature conditions.

Third, the test items and limit requirements: See Table 1.

Fourth, the test basis: the relevant provisions of the General Rules for the Preparation of Chinese Pharmacopoeia.

V. Test results: See Tables 2 to 7.

Table 1 Inspection project and limit requirements

Accelerated test results (batch number: 071101)

Date Project 2007. 11. 14 2007. 12. 17 2008. 1. 14 2008. 2. 18 2008. 5. 12 This product is a film This product is a film This product is a film This product is a film clothing This product is a film clothing

The tablets are removed, the coated tablets are removed, the coated tablets are removed, the coated tablets are removed, the coated tablets are removed, and the coating is removed.

The traits are brown after the clothes, and the brown color after the clothes is brownish yellow after the clothes. It is brownish yellow after the clothes;

Color; gas, taste; gas micro, taste; gas, taste, gas, bitter taste. Weiqi, bitter taste.

bitter. bitter. bitter.

Display 1) Detection of Atractylodes sinensis, Atractylodes sinensis, Atractylodes, Atractylodes, Atractylodes, Atractylodes, Astragalus, Detective, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Danshen, Salvia Out of the genus Pueraria lobata detected 4) detected the Scrophularia sinensis detected Scrophulariaceae detected Scrophulariaceae detected Scrophulariaceae detected Scrophulariaceae 5) detected mulberry leaves detected mulberry leaves detected mulberry leaves detected mulberry leaves detected mulberry Ye Xian 6) When the detective mother is detected, the mother is detected, and the mother is detected, and the mother is detected.

28 30 31 33 35 Limit (min)

Number of bacteria

< 10 < 10 < 10 (pieces / g)

Mold and

Yeast

< 10 < 10 < 10

/g)

Large intestine

Not detected, not detected, not detected, no bacteria (g)

Mildew and

Not detected, not detected, not detected, active

Content measurement

6.6 6. 3 6. 2 5. 9 6. 1 (mg/piece) Long-term normal temperature test result (batch number: 071101)

Date of inspection

Project 2007. 11. 14 2008. 2. 18 2008. 5. 12 2008. 8. 14 2008. 11. 17 This product is a film garment. This product is a film. This product is a film. This product is a film. This product is a film-like film. , removing the coated tablets, removing the coated tablets, removing the coated tablets, removing the tablets, removing the coating and then displaying a brownish yellow color; after coating, the brown coating is brown after coating and then brownish and then brownish yellow; Weiqi, bitter taste. Yellow; gas slightly, yellow; gas micro, yellow; gas micro, gas micro, bitter taste.

Bitter. Bitter. Bitter.

Identification (1) Detection of Atractylodes sinensis, Atractylodes sinensis, Atractylodes sinensis, Atractylodes sinensis, sinensis Pueraria lobata detected genus Pueraria lobata identification (4) detected Scrophularia sinensis detected Scrophulariaceae detected Scrophularia sinensis detected Scrophulariaceae detected Scrophulariaceae identification (5) Detected mulberry leaves detected mulberry leaves detected mulberry leaves detected mulberry Leaf detection of mulberry leaf identification (6) detection of the mother-in-law detected the mother-in-law detected the mother-in-law detected the mother-in-law detected the mother-in-law disintegration time limit

28 30 30 31 32 (min)

Number of bacteria

<10 <10 <10 <10

/g)

Mold and leaven

Number of mother bacteria (<10 <10 <10 <10 /g)

Escherichia

Not detected Not detected Not detected Undetected bacteria (g)

Mildew and live

Not detected Not detected Not detected Not detected Not detected 螨

Content determination

6.1 6.2 6.1 6.1 6.1 (mg/piece)

After a 6-month accelerated test and a 24-month normal temperature long-term test on the pharmaceutical composition of the present invention, the results were all in compliance with the regulations during the inspection period, and the quality was stable. Example 13 Therapeutic effect of the pharmaceutical composition of the present invention on diabetes

1 Materials and methods

1.1 General information All cases were selected from the ward of Hebei Yiling Hospital, a total of 80 cases, were randomly divided into treatment group and control group. There were 40 patients in the treatment group, 21 males and 19 females, with an average age of (42.5±9.5) years, with an average duration of (21 ± 27) months. There were 40 patients in the control group, 23 males and 17 females. The average age was (44.9 ± 10.1) years old, with an average duration of (22 ± 28) months. According to statistics, there was no significant difference in gender, age, and duration of disease between the two groups (0.05), which was comparable. 1.2 Case selection criteria: In line with the diagnostic criteria for type 2 diabetes in Internal Medicine. Exclusion criteria: (1) patients with type 1 diabetes; (2) patients with severe heart, liver, renal insufficiency and acute infection; (3) lactating, pregnant women; (4) under 18 years old and >65 years old Patient.

1.3 Treatment The control group used metformin tablets 0.25 g / time, 3 times / day. The treatment group was administered with the test drug (prepared according to the method of Example 1), 500 ml/time, 2 times/day. The course of treatment is 2 months.

1.4 Observation indicators: (1) Check FPG (fasting blood glucose) and P2hPG (2 hours postprandial blood glucose) before and after treatment; (2) Relevant clinical symptoms (including thirst, polydipsia, hunger, five upset fever, fatigue and fatigue) ) Points comparison.

1.5 Efficacy criteria: Refer to the “Guidelines for Clinical Research of New Drugs in Traditional Chinese Medicine” in 1993 for efficacy judgment. Significant effect: Symptoms disappeared after treatment, fasting blood glucose <7.2 mmol/L, postprandial 2 h blood glucose <8.3 mmol/L; effective: fasting blood glucose <8.0 mmol/L, postprandial 2 h blood glucose <10.0 mmol/L; Symptoms did not improve after treatment, and fasting blood glucose and postprandial blood glucose did not meet the above criteria. Symptoms were assessed by a four-point scale: 0 (no symptoms), 1 (with symptoms when prompted), 2 (sometimes with symptoms), 3 (significant symptoms), and symptom scores and scores.

1.6 Statistical processing Data were processed using SPSS 13.0 statistical software. The measurement data were expressed as mean ± standard deviation (± s), using ί test, and counting data were tested.

2 results

2. 1 Comparison of clinical efficacy According to statistics, the total effective rate of patients in the treatment group was similar to that of the control group (0.05). The results are shown in Table 4.

Table 4 Comparison of clinical efficacy between the two groups (%)

The number of group cases was markedly effective and invalid. Total effective treatment group 40 15 (37.50) 17 (42.50) 8 (20.00) 32 (80.00) Control group 40 17 (42.50) 18 (45.00) 5 (12.50) 35 (87.50) Note: *Compared with #=3.41, Ρ>0.05ο

2.2 Changes in blood glucose before and after treatment According to statistics, the FPG and P2hPG were similar in the treatment group compared with the control group (P <0.05). The two groups had a certain decrease before and after treatment. After statistical analysis, there were significant differences (/ ). .05). The results are shown in Table 5.

Table 5 Comparison of blood glucose between the two groups (Shishi

₊ ^ Treatment group (n=40) Control group (n=40) Indicator

Pre-treatment treatment before treatment before treatment FPG (mmol/L) 10·66±1·43 6·07±1·03* 10·65±2·38 8.37 + 1.38* P2hPG (mmol/L) 11.54±2.16 7.25±1.91* 11.88±1.44 9.07± 2.01*

Note: * Compared with before treatment, <0.05.

2.3 Changes in clinical symptoms before and after treatment According to statistics, the clinical symptoms of the treatment group and the control group were significantly improved, that is, the scores of the symptoms before and after treatment were significantly decreased (<0.05). There was no significant difference between the treatment group and the control group. (P>0.05), indicating that the test drug can significantly improve the clinical symptoms of patients. The results are shown in Table 6.

Table 6 Comparison of clinical symptom scores between the two groups (±s)

Control group (n=40)

Before treatment, after treatment, before treatment, after treatment

Thirst and drink 2.85±0.49 1.01±0.32* 2.71±0.61 1.21±0.51* Eat more than hunger 2.92±0.78 0.93 + 0.42* 2.97±0.83 1.31±0.44* Five upset heat 1.75±0.33 0.69±0.24* 1.72±0.39 1.01 ±0.27* fatigue fatigue 1.88±0.51 0.59±0.21* 1.89±0.44 1.02±0.33*

Note: *Compared with before treatment / ^<0.05.

3 Conclusions From the above experiments, it can be seen that the drug decoction prepared according to the method of Example 1 has similar effects to the positive drug metformin in terms of clinical total effective rate, biochemical index and improvement of clinical symptoms. Even better than metformin, the composition of the five-flavored medicament of the present invention has a significant clinical effect on diabetes. Example 14 Effect of the pharmaceutical composition of the present invention on type II diabetic rats

The effect of the pharmaceutical composition of the present invention on type II diabetic rats and the improvement of insulin resistance were observed experimentally.

(1) Experimental conditions

1. Test drug

The pharmaceutical composition prepared in Example 11 of the present invention (hereinafter referred to as the drug of the present invention)

Physical and chemical properties: brownish yellow powder, mild gas, bitter taste.

Storage conditions: sealed, cool, dry, protected from light.

Preparation method: In the experiment, use purified water to prepare the required concentration for use.

2, experimental animals

Clean grade, male Wistar rats, weighing 18 (T200g, purchased from Hebei Experimental Animal Center, Certificate No. 807009). Feeding conditions: Animal use permit SYXK (冀) 2006-0047, animal room environment is room temperature (20-23 °C), relative humidity 45-60%, light 12 hours / day.

Animal feed: The full-price pellet feed of experimental animals was purchased from the Experimental Animal Center of Hebei Province.

Animal drinking water: Sterilize and purify water, animals are free to drink.

3, control drugs

Rosiglitazone tablets (each containing rosiglitazone 4 mg), Chengdu Hengrui Pharmaceutical Co., Ltd., batch number 080301.

4, the main reagent

Streptozotocin (STZ), Sigma, USA; Cholate, Beijing Dingguo Biotechnology Co., Ltd.; Cholesterol, Beijing Dingguo Biotechnology Co., Ltd.; GLUC0CARD II Blood Glucose Test Strip, Japan ARKRAY, Inc Glycosylated hemoglobin kit (GHb), product of Nanjing Bioengineering Research Institute; Nitric Oxide (NO) kit, Nanjing Bioengineering Research Institute product; Superoxide dismutase (SOD) kit, Nanjing built bioengineering Research Institute Products; Malondialdehyde (MDA) Kit, Products of Nanjing Jiancheng Bioengineering Research Institute; Total Cholesterol (CH0) Kit, Zhongsheng Beikong Biotechnology Co., Ltd.; Triglyceride (TG) Kit, Medium Shengbei Control Biotechnology Co., Ltd.; iodine [ ¹²⁵ ι] insulin radioimmunoassay kit, Beijing Puer Weiye Biotechnology Co., Ltd.; iodine [ ¹²⁵ 1 ] tumor necrosis factor-α radioimmunoassay kit, Beijing Puer Weiye Biotechnology Co., Ltd. products; iodine [ ¹²⁵ ι] endothelin radioimmunoassay kit, Beijing Puer Weiye Biotechnology Co., Ltd. products; iodine [ ¹²⁵ 1 ] thrombus 垸Β ₂ radioimmunoassay kit, Beijing Puer Weiye Biotechnology Co., Ltd.; iodine [ ¹²⁵ 1 ] 6-keto-prostaglandin F _ia radioimmunoassay kit, Beijing Puer Weiye Biotechnology Co., Ltd.; RT-PCR Kit, Bio-Engineering (Dalian) Co., Ltd.; Ethyl Pyrophosphate (DEPC), Beijing Solarbio Technology Co., Ltd.; Trizol, US Invitrogen; Goldview Nucleic Acid Stain, Beijing Solarbio Technology Co., Ltd.; 100bp DNA Ladder, Jerry Biotech (Shanghai) Co., Ltd.; Primer, Shanghai Shenggong Biotech Co., Ltd., InsR Upstream Primer: GGACCTATGATGAACACATCC ₀ InsR Downstream Primer: CAACACACACGCAAATGC. Amplified fragment 795 bp β-act in upstream primer: GAGGGAAATCGTGCGTGAC. Β-actin downstream primer: CTGGAAGGTGGACAGTGAG. The amplified fragment was 445 bp.

5, soil equipment

SUPER GLUC0CARD II Kyoto Blood Glucose Meter, Japan ARKRAY, Inc; γ-Counter, State-owned 262 Factory; 722 Grating Spectrophotometer, Shanghai Third Analytical Instrument Factory; Eppendorf mini spin centrifuge, Pendorf, Germany; Eppendorf 5417 Centrifuge, Pendorf, Germany; Low Temperature Refrigerator, Sanyo, Japan; Protein Nucleic Acid Quantitative Instrument, Pendorf, Germany; Eppendorf PCR, eppe eppendorf; Biorad Gel Imager, Biorad, USA; DYY-8C Electrophoresis , Beijing Liuyi Instrument Factory; DYCP-31D horizontal electrophoresis tank, Beijing Liuyi Instrument Factory.

(2) Experimental methods

90 rats were randomly divided into normal control group (n=10) and high-sugar-high-fat group (n=80). The normal control group was fed with conventional diet, and the high-glycemic and high-fat group was given high-sugar and high-fat diet (10%). Lard, 20% sucrose, 1% cholate, 2. 5% cholesterol, 66.5% regular feed) Feed for 4 weeks. After 4 weeks, fasting (not allowed water) for 12 hours, rats in the high-sugar and high-fat group were injected intraperitoneally with streptozotocin (25 mg/kg, 0. lmmol · L- ¹ sterile citrate with PH=4.4 The buffer was mixed with 0.25% concentration), and the normal control group was intraperitoneally injected with citrate buffer (pH = 4.4, 0.1 mmol, L- ¹ sterile citrate buffer), and blood glucose was detected after 72 hours ( Fasting before the test (not allowed for water) 16 hours), 50 rats with blood glucose > 7. 7 mmol · L - ¹ and urine glucose test above +++ were used for the experiment, and 50 rats were divided according to blood glucose levels. The layers were randomly divided into 5 groups, each group of 10, respectively, the model control group, the low-dose group of the present invention (0. 35g / kg, equivalent to the crude drug 1. 2g / kg, equivalent to 3.5 times the clinical drug), The drug dosage group (0. 7g / kg, equivalent to the crude drug 2. 4g / kg, equivalent to 7 times the clinical drug), the drug high dose group (1. 4g / kg, equivalent to the crude drug 4. 8g / kg , equivalent to 14 times the clinical use of drugs and the positive drug rosiglitazone group (1.8 mg / kg, equivalent to 14 times the clinical use of drugs). The drug-administered group was intragastrically administered once a day, and the volume was 1 ml/lOOg body weight. The normal control group and the model control group were given an equal volume of purified water for 8 weeks. All diabetic rats continued to be fed with high-sugar and high-fat diet during the experiment, and the normal control group continued to be fed with conventional feed.

Observation indicators and detection methods

1. General status: General status observation, weight, urine volume and water intake. Rats in each group were weighed once a week. The rats in each group were collected for 24 hours before the experiment, before the administration, 4 weeks after the administration, and 8 weeks after the administration, and the amount of drinking water was recorded at the same time.

2. Dynamic blood glucose: The blood glucose of each group was measured by Kyoto blood glucose meter before the experiment, before the administration, 4 weeks after the administration, and 8 weeks after the administration.

3. Determination of glucose tolerance: 2 hours after the last administration, intraperitoneal injection of glucose 2g/kg, blood glucose levels of 0, 0.5, 1, 2 hours were measured, and the area under the blood glucose curve (AUC) was calculated according to the following formula. AUCCmmol · h · L— =丄A+B+C+丄D

twenty two

(A, B, C, and D are 0, 0.5, 1, and 2 hours of blood glucose, respectively).

4. Determination of insulin: After the end of the experiment, blood was taken from the common carotid artery, and serum was separated. Serum insulin (INS) was measured by radioimmunoassay according to the kit instructions, and the insulin resistance index (H0MA-IR=(FBGX INS) / 22.5) was calculated. , insulin sensitivity index (ISI = [1/ (FBG X INS) ]).

5. Biochemical indicators: Serum total cholesterol (TC), triglyceride (TG), tumor necrosis factor-a (TNF-α), glycosylated hemoglobin (GHb), 6-keto-prostaglandin F1 (6) were measured according to the kit instructions. - Keto- PGF1 α ), thromboxane (ΤΧΒ ₂ ), nitric oxide (Ν0), endothelin (ΕΤ), superoxide dismutase (S0D), malondialdehyde (MDA)

6. Quantitative analysis of insulin membrane receptor (InsR) in liver cell membrane: Total RNA was extracted by liver tissue using Trizol method, reverse transcription reaction was performed with total RNA l as template, reverse transcriptase ΑΜνΐμΙ total reaction system 20μ1 42 °C water bath for 30 min, cDNA synthesis a chain. The PCR reaction parameters were set at 94 ° C for 3 min pre-denaturation. Denaturation at 94 ° C for 50 sec, 54. 8 ° C annealing for 50 sec, 72 ° C extension for 70 sec, a total of 31 cycles. The same method amplifies β-actin as an internal reference. 5 l PCR products were electrophoresed on a 1% agarose gel, and the relative molecular mass was determined by marker. After electrophoresis, the gel imaging system was used to photograph, and finally the quantitative target image analysis system was used to detect the target genes and β- The gray value of the actin gene, the ratio of the two represents the relative expression of InsR mRNA.

(3) Experimental results

1. Effect of the pharmaceutical composition of the present invention on the general state of sputum type diabetic rats During the experiment, the rats in the normal control group had good mental state, quick response, free movement and shiny skin. The model control rats were more wilting, unresponsive, slow-moving, vertical hair and less luster. Both were better than the model control rats. The results of drinking water and urine output of rats in each group are shown in Table 7 and Table 8. From the results, there was no significant difference between the drinking water volume and urine volume of each group before the experiment (p>0.05). The water consumption and urine volume of the rats in the drug group were increased compared with the normal control group (p<0.05 or p<0.01); the drug of the invention (0.35g/kg, 0.7g/kg, 1.4) was administered 4 weeks after administration and 8 weeks after administration. The water consumption and urine volume of the rats in the g/kg group were lower than those in the model control group (p<0.05 or ρ<0· 01).

Effect of the pharmaceutical composition of the present invention on the amount of drinking water in a diabetic rat (±S, n=10)

Note: Before administration: Compared with the normal control group ^<0.05 <0.01; After administration: Compared with the model control group <0.05; **ρ<0· 01 Table 8 The pharmaceutical composition of the present invention is a type II diabetic rat The effect of urine volume (±S, n=10)

Note: Before administration: Compared with the normal control group ^<0.05 <0.01; After administration: Compared with the model control group <0.05; **ρ<0· 01

2. Effect of the pharmaceutical composition of the present invention on blood glucose of type II diabetic rats

The results are shown in Table 9. From the results, there was no significant difference in blood glucose between the groups before the experiment (p>0.05). The blood glucose of the model control group and the drug-administered group were higher than those of the normal control group before administration (P<0.01). ), the drug of the invention 4 weeks after administration The blood glucose of the rats in the group (1.4g/kg) was lower than that in the model control group (p<0.05). The blood glucose of the rats of the present invention (0.35 g/kg, 0.7 g/kg, 1.4 g/kg) was lower than that of the model control group at 8 weeks after administration (p<0.05 or p<0.01).

Effect of the pharmaceutical composition of the present invention on blood glucose of type II diabetic rats (±S, n=10)

Note: Before administration: ^Δ Ρ<0.05 ^ΔΔ Ρ<0.01 compared with the normal control group; after administration: Compared with the model control group<0.05;**ρ<0· 01

3. Effect of the pharmaceutical composition of the invention on glucose tolerance in type II diabetic rats

The results are shown in Table 10. From the results, it can be seen that the blood glucose level of the rats in the normal control group and the model control group reached the peak after 0.5 hr of intraperitoneal injection of glucose, and then gradually decreased, showing the characteristics of glucose absorption and metabolism. The positive drug rosiglitazone group was The increase of blood glucose level at 0.5hr, lhr and 2hr was lower than that of the model control group (p<0.01). The increase of blood glucose level in the rats of the present invention (1.4g/kg) was lower than that at 0.5hr, lhr and 2hr. In the model control group (p<0.01), the AUC was lower than the model control group (P<0.01). The rats in the present invention (0.35g/kg, 0.7g/kg) had low blood glucose levels at lhr and 2hr 〇. In the model control group (p<0.05), AUC was lower than the model control group ( _P <0.05 or p<0.01).

Table 10 Effect of the pharmaceutical composition of the present invention on glucose tolerance in type II diabetic rats (±S, n=10) Dose Blood sugar level (mmol/1) AUC group

(g/kg) Ohr 0.5hr lhr 2hr

Normal

Control ― 4.5±1· 01** 5.8±0.86** 5.4±0· 87** 4.9±0.83** 15.9±2· 41** Group

Model

Control ― 11.8±3· 13 16.6±5· 19 14.6±2· 90 13.1±2· 82 43.6±10· 62 Group

The present invention 0.35 8.8±2· 16* 13.0±4· 52 11.3±3.94* 9.7 ±2.64* 33.5±10.53* The drug 0.7 8· 5±1· 59** 12.7±3· 69 11.1±1.96** 9.4± 1.88** 32.8 ±6.83** Group 1.4 7.1±1· 46** 10.3 ±2· 05** 9· 5±1· 80** 8.0±1.38** 27.3±4·6 Guangrogg 1.8 mg 6.3 ±1.50** 8.9 ±2.45** 7· 9±1· 58** 6.8±1.48** 23.3 ±5.38** Ketone

Group

Note: Compared with the model control group: <0.05; <0.01

4. Effect of the pharmaceutical composition of the present invention on INS, HOMA-IR, ISI in type II diabetic rats

The results are shown in Table 11. From the results, the serum INS and H0MA-IR levels in the model control group were higher than those in the normal control group (P<0.01), and the ISI was lower than that in the normal control group (P<0.01). The INS and H0MA-IR of the drugs of the present invention (0.35g/kg, 0.7g/kg, 1.4g/kg) were lower than those of the model control group (P<0.01), and the ISI was higher than that of the model control group (P<0.01). .

Table 11 Effect of the pharmaceutical composition of the present invention on INS, HOMA-IR, ISI in type 2 diabetic rats (±S)

Note: Compared with the model control group: <0.05; <0.01

The results of the study indicate that the pharmaceutical composition of the present invention can reduce the amount of urine and water, and lower the blood sugar (FPG) by administering the high-fat diet plus low-dose streptozotocin-induced sputum-type diabetic rats for 4 weeks. Glycated hemoglobin (GHb); can reduce serum insulin (FSI) levels, reduce insulin resistance index (H0MA-IR), increase insulin sensitivity index (ISI), and improve glucose tolerance in diabetic rats. Example 15 Effect of the pharmaceutical composition of the present invention on alloxan-induced diabetes in mice

(1) Experimental conditions

1. Test drug

Same as Example 14.

2, experimental animals

Clean grade, male Kunming mice, weighing 17~18g, purchased from Hebei Experimental Animal Center, certificate number: 806153.

Feeding conditions, animal feed, and animal drinking water were the same as in Example 14.

3, control drugs

Metformin Hydrochloride Tablets (0.25g), Tianjin Feiying Pharmaceutical Co., Ltd., batch number 0802007. 4, the main reagent

Alloxan (ALX), American Sigma product; GLUC0CARD II blood glucose test paper, Japan ARKRAY, Inc.

5, the main instrument

SUPER GLUC0CARD II Kyoto Blood Glucose Meter, Japan ARKRAY, Inc.

(2) Experimental methods

The mice were fasted for 24 hr, intraperitoneally injected with freshly prepared 1.4% tetrahydropyrimidine physiological saline solution, and administered at a dose of 280 mg/kg twice at 0 ml/lOg body weight. Blood glucose was measured on the third day, and blood glucose levels were selected. > 11. 50 mice of lmmol *L- ¹ were used for the experiment. The mice were randomly divided into 5 groups according to the blood glucose level, 10 rats in each group, which were model control group and low-dose group of the present invention (0.45g/kg, equivalent to crude drug 1.5g/kg, equivalent to clinical medication. 4.5 times), the medium dose group of the present invention (0.9 g/kg, equivalent to 3.0 g/kg of crude drug, equivalent to 9 times of clinical drug), and the high dose group of the drug of the present invention (1.8 g/kg, equivalent to crude drug 6.0 g/k) _g , which is equivalent to 18 times of clinical use) and the positive drug metformin group (0.36 g/kg, which is equivalent to 18 times of clinical use). Another 10 were taken as normal control group. The mice in the administration group were intragastrically administered once a day, and the volume was 10 ml/kg. The normal control group and the model control group were given an equal volume of purified water for 28 consecutive days. Blood glucose was measured 2 hours after the last administration.

Statistical analysis: Inter-group t-test (SPSS 12.0).

(3) Experimental results

The results are shown in Table 12. From the results, it can be seen that after 28 days of administration, the blood glucose level of the model control group was still higher than that of the normal control group (P<0.01), and the medicament of the present invention (0.45 g/kg, 0.9 g/kg, 1.8 g). There was no significant difference in blood glucose level between the mice in the group/kg group (p>0.05), but the blood glucose level in the mice of the drug (1.8g/kg) of the invention decreased.

Effect of the pharmaceutical composition of the present invention on blood glucose of alloxan diabetic mice (±S)

Note: Compared with the model control group: <0.05; <0.01

The results showed that the administration of the medicament of the present invention (0.45 g/kg, 0.9 g/kg, 1.8 g/kg) for 28 consecutive days had a significant hypoglycemic effect on diabetic mice induced by alloxan. Example 16 Effect of the pharmaceutical composition of the present invention on the tolerance of sugar in normal rats

(1) Experimental conditions

1. Test drug

Same as Example 14.

2, experimental animals

Clean grade, male rats, weight 18 (T2 (K) g, purchased from Hebei Experimental Animal Center, certificate number: 808080. Feeding conditions, animal feed, animal drinking water are the same as in Example 14.

3, control drugs

Glibenclamide (each tablet containing glibenclamide 2.5 mg), Tianjin Lisheng Pharmaceutical Co., Ltd., batch number 0801004. 4, the main reagent

GLUC0CARD II blood glucose test strip, Japan ARKRAY, Inc.

5, the main instrument

SUPER GLUC0CARD II Kyoto Blood Glucose Meter, Japan ARKRAY, Inc.

(2) Experimental methods

50 rats were randomly divided into 5 groups, 10 in each group, which were blank control group and low dose group of the present invention (0.35 g/kg, equivalent to crude drug 1.2 g/kg, equivalent to 3.5 times of clinical drug). The drug dosage group of the invention (0.7 g/kg, equivalent to 2.4 g/kg of crude drug, which is equivalent to 7 times of clinical drug), and the high dose group of the drug of the invention (1.4 g/kg, equivalent to 4.8 g/kg of crude drug, equivalent to clinical 14 times the drug) and the positive drug glibenclamide group (2.3 mg/kg, which is equivalent to 14 times the clinical drug). The drug-administered group was intragastrically administered once a day, and the volume was 1 ml/lOOg body weight. The blank control group was given an equal volume of purified water for 28 consecutive days. After the 27th day of administration, each group of animals was fasted for 12 hr, the second Ο8 2 hours after the day of administration, 2 g/kg of glucose was intraperitoneally injected, and the blood glucose level of 0, 0.5, 1, and 2 hours was measured using a blood glucose meter, and the area under the blood glucose curve (AUC), AUC (mmol · h) was calculated by the following formula. · U ¹ ) =1A+B+C+-D (A, B, C, D respectively

twenty two

The blood glucose level is 0, 0.5, 1, 2 hours).

Statistical processing: inter-group t test (SPSS12.0 for windows) ₀

(3) Experimental results

The results are shown in Table 13. From the results, it can be seen that the blood glucose level of the rats in the normal control group reached the peak after 0.5 hours of intraperitoneal injection of glucose. The blood glucose levels of the positive drug glibenclamide rats at 0 hr, 0.5 hr, and lhr were lower than the blank. In the control group (p<0.01), the AUC was lower than that in the blank control group (p<0.01); the rats of the present invention (0.35g/kg, 0.7g/kg, 1.4g/kg) were at 0hr, 0.5hr, lhr. There was no significant difference between the blood glucose level and AUC at 2 hr and the control group (p>0.05).

Table 13 Effect of the pharmaceutical composition of the present invention on the tolerance of sugar in normal rats (JT ± S, n = 10) Dose Blood glucose (mmol / 1)

Group

(g/kg) Ohr 0.5hr lhr 2hr

Blank control group ― 4.7±0· 59 9.0±0· 71 7.4±1· 15 5.3±0· 43 21.4±1· 58

0.35 4.6±0· 56 8.0±0· 60 6.8±0· 68 5.8±0· 64 20.0 + 1.52 The medicine of the present invention

0.7 4.8±0· 66 8.3±1· 36 6.8±1· 75 5.5±0· 58 20.2±2· 57

1.4 5.0±0· 68 8.6±1· 24 7.0±1· 46 5.6±0· 52 20.8±1· 48 Glibenclamide group 2.3mg 3.5±0.49** 6.9±0.64** 6.0±0.57** 5.2±0.41 17.8±1· 08** Note: Compared with the blank control group: <0.05;<0.01

The experimental results showed that the administration of the medicament of the present invention (0.35 g/kg, 0.7 g/kg, 1.4 g/kg) for 28 consecutive days had no significant effect on the tolerance of sugar in normal rats. Example 17 Effect of the pharmaceutical composition of the present invention on blood glucose of normal mice

(1) Experimental conditions

1. Test drug

Same as Example 14.

2, experimental animals

Clean grade, male Kunming mice, body weight 2 (T22g, purchased from Hebei Experimental Animal Center, certificate number:

805086.

3, control drugs

Glyburide (each tablet containing glibenclamide 2.5 mg), Tianjin Lisheng Pharmaceutical Co., Ltd., batch number 0801004. 4, the main reagent

GLUC0CARD II blood glucose test strip, Japan ARKRAY, Inc.

5, the main instrument

SUPER GLUC0CARD II Kyoto Blood Glucose Meter, Japan ARKRAY, Inc.

(2) Experimental methods

The mice were divided into 5 groups, 10 in each group, which were blank control group and low-dose group of the present invention (0.45 g/kg, equivalent to crude drug 1.5 g/kg, equivalent to 4.5 times of clinical drug), in the medicament of the present invention. The dosage group (0.9g/kg, equivalent to 3.0g/kg of crude drug, equivalent to 9 times of clinical drug), the high-dose group of the drug of the invention (1.8g/kg, equivalent to 6. Og/kg of crude drug, equivalent to 18 for clinical use) Double) and the positive drug glibenclamide group (3 mg/kg, which is equivalent to 18 times of clinical use). The mice in the administration group were intragastrically administered once a day, and the volume was 0.2 ml/10 g body weight. The blank control group was given an equal volume of purified water for 28 consecutive days, and blood glucose was measured 2 hours after the second administration.

Statistical processing: inter-group t test (SPSS12.0 for windows) ₀

(3) Experimental results

The results are shown in Table 14. From the results, it was found that there was no significant difference in blood glucose between the groups before the experiment (p>0.05); the drug of the present invention (0.35 g/kg, 0.7 g/kg, 1.4 g/kg) 4 weeks after the administration. There was no significant difference in blood glucose between the group and the model control group (ρ>0.05).

Effect of the pharmaceutical composition of the invention on blood glucose of normal mice (±s)

Group blood glucose values (mmoL/L) (g/kg) (only) blank control after the experiment

a group of 10 5.3 ± 0.52 5.9 ± 1.10

0.45 10 5.4±0.57 6.2±0.57 The drug of the present invention

0.9 10 4.8±0.45 5.8±1.02 group

1.8 10 5.4±0.73 5.7±0.72 diaper diaper 3mg 10 5.6±0.71 3· 8±0· 54**

Note: Compared with the blank control group: <0.05; <0.01

The results showed that the administration of the drug of the present invention (0.45 g/kg, 0.9 g/kg, 1.8 g/kg) for 28 consecutive days had no significant effect on the blood glucose of normal mice.

Claims

claims

1. A pharmaceutical composition for treating diabetes, characterized in that the raw materials of the pharmaceutical composition include: 4 to 12 parts of fried Atractylodes rhizome, 5 to 15 parts of Polygonatum sibiricum, 5 to 15 parts of Scrophulariaceae, and 5 to 15 parts of Pueraria lobata. , 5 to 15 parts of Gynostemma pentaphyllum.

2. The pharmaceutical composition according to claim 1, characterized in that, in parts by weight, the pharmaceutical composition is made of the following raw materials:

Stir-fried Atractylodes 4 to 12 parts, Polygonatum 5 to 15 parts, Salvia miltiorrhiza 10 to 30 parts, Scrophulariaceae 5 to 15 parts, Pueraria lobata 5 to 15 parts, Mulberry leaves 5 to 15 parts, Anemarrhena 5 to 15 parts, Ghost Arrow Feather 5 to 15 parts, Gynostemma pentaphyllum 5 to 15 parts, lychee core 7 to 22 parts.

3. The pharmaceutical composition according to claim 1 or 2, characterized in that, in parts by weight, the pharmaceutical composition is made of the following raw materials:

Stir-fried Atractylodes 6 to 10 parts, Polygonatum japonica 8 to 12 parts, Salvia miltiorrhiza 12 to 24 parts, Scrophulariaceae 8 to 12 parts, Pueraria lobata 8 to 12 parts

12 parts, 8 to 12 parts of mulberry leaves, 8 to 12 parts of Anemarrhena, 8 to 12 parts of Ghost Arrow Feather, 8 to 12 parts of Gynostemma pentaphyllum, 12 to 18 parts of litchi core.

4. The pharmaceutical composition according to claim 3, characterized in that, in parts by weight, the pharmaceutical composition is made of the following raw materials:

8 portions of fried Atractylodes, 10 portions of Polygonatum, 20 portions of Salvia miltiorrhiza, 10 portions of Scrophulariaceae, 10 portions of Pueraria lobata, 10 portions of mulberry leaves, 10 portions of Anemarrhena, 10 portions of Ghost Arrow Feather, 10 portions of Gynostemma pentaphyllum, and 15 portions of litchi core.

5. The pharmaceutical composition according to claim 2, characterized in that, in parts by weight, the pharmaceutical composition is made of the following raw materials:

Stir-fried Atractylodes 12 parts, Polygonatum 15 parts, Salvia miltiorrhiza 30 parts, Scrophulariaceae 15 parts, Pueraria lobata 15 parts, Mulberry leaves 15 parts, Anemarrhena 15 parts, Ghost Arrow Feather 15 parts, Gynostemma pentaphyllum 15 parts, Litchi core 22 parts.

6. The active ingredient of the pharmaceutical composition according to any one of claims 1 to 5, characterized in that the active ingredient is prepared by a method including the following steps:

Weigh the raw materials according to the proportion, add water to decoct and filter, and then take the decoction liquid;

Preferably, the preparation method of the active ingredient includes the following steps:

1) Weigh the raw materials according to the proportion, then add water to decoct 2-3 times, add 6-15 times the amount of water each time, and filter the decoction liquid later merge;

2) Concentrate the decoction liquid obtained in step 1) under reduced pressure into a medicinal liquid with a relative density of 1.05-1.25 measured at 60°C; and

3) Spray-dry the liquid obtained in step 2) to obtain spray-dried powder.

7. The pharmaceutical preparation of the pharmaceutical composition according to any one of claims 1 to 5, characterized in that the pharmaceutical preparation is a tablet, capsule, powder or granule.

8. The preparation method of pharmaceutical preparations according to claim 7, characterized in that the tablet is made by the following steps:

1) Weigh the raw materials in proportion, then add water to decoct 2-3 times, add 6-15 times the amount of water each time, filter the decoction liquid and combine;

2) Concentrate the decoction liquid obtained in step 1) under reduced pressure into a medicinal liquid with a relative density of 1.05-1.25 measured at 60°C;

3) Spray dry the medicinal liquid obtained in step 2) to obtain spray drying powder; and

4) Dry granulate the spray-dried powder obtained in step 3), granulate, add magnesium stearate, mix, tablet, and then film-coat.

9. The preparation method according to claim 8, characterized in that the tablet is made by the following steps:

1) Weigh the raw materials in proportion, then add water and boil three times. The first time, add 9 times the amount of water and boil for 2 hours. The second time, add 9 times the amount of water and boil it for 1.5 hours. The third time, add 7 times the amount of water. Decoct in water for 1 hour, filter and combine the decoction liquid;

2) Concentrate the decoction liquid obtained in step 1) under reduced pressure into a medicinal liquid with a relative density of 1.15-1.20 when measured at 60°C;

3) Spray-dry the liquid obtained in step 2) to obtain spray-dried powder;

4) Dry granulate the spray-dried powder obtained in step 3), and then use a No. 2 sieve to granulate; and

5) Add 0.4% magnesium stearate by weight of dry granules, mix well, press into tablets, and then film-coat.

10. Use of the pharmaceutical composition according to any one of claims 1 to 5 in the preparation of drugs for treating diabetes, characterized in that the diabetes is type II diabetes.