WO2014085596A1 - MONOCLONAL ANTIBODIES AGAISNT ACTIVATED PROTEIN C (aPC) - Google Patents
MONOCLONAL ANTIBODIES AGAISNT ACTIVATED PROTEIN C (aPC) Download PDFInfo
- Publication number
- WO2014085596A1 WO2014085596A1 PCT/US2013/072243 US2013072243W WO2014085596A1 WO 2014085596 A1 WO2014085596 A1 WO 2014085596A1 US 2013072243 W US2013072243 W US 2013072243W WO 2014085596 A1 WO2014085596 A1 WO 2014085596A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- seq
- acid sequence
- antibody
- chain variable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2299/00—Coordinates from 3D structures of peptides, e.g. proteins or enzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- Human Protein C (PC) zymogen is synthesized in the liver as a 461 -amino acid residue precursor and secreted into the blood (as shown in SEQ ID NO: 1). Prior to secretion, the single-chain polypeptide precursor is converted into a heterodimer by removal of a dipeptide (Lys l56-Argl57) and a 42-aa residues preproleader.
- the heterodimeric form (417 residues) consists of the light chain (155aa, 21 kDa) and the heavy chain (262aa, 41 kDa) linked by a disulfide bridge (as shown in SEQ ID NO: 2).
- PC zymogen contains the thrombin cleavage site, leading to removal of the "activation peptide” and activation of PC to activated PC (aPC) form (405 residues) shown in SEQ ID NO: 3.
- Figure 1 provides a cartoon depiction of human PC and its activated form, aPC.
- Human PC contains 9 Gla-residues and 4 potential sites for N-linked glycosylation.
- the light chain contains the Gla domain and 2 EGF-like domains.
- the heavy chain harbors an active serine protease domain.
- PC normally circulates at 3-5ug/ml ( ⁇ 65 nM) in healthy human blood and its half- life is 6-8 hours.
- the predominant form of circulating PC zymogen is the heterodimeric form.
- the light chain of PC contains one gamma-carboxy glutamic acid (Gla) - rich domain (45aa), two EGF-like domains (46aa) and the linker sequences.
- the heavy chain of PC harbors a 12- aa highly polar "activation peptide" and a catalytic domain with a typical serine protease catalytic triad.
- Human PC undergoes extensive post-translational modifications including glycosylation, vitamin K-dependent gamma-carboxylation, and gamma-hydroxylation (1-2). It contains 23% carbohydrate (by weight) and 4 potential N-linked glycosylation sites (one in the light chain Asn97 and three in the heavy chain Asn248/313/329). Its Gla domain contains 9 Gla residues and is responsible for the calcium-dependent binding of PC to negatively- charged phospholipid membranes. The Gla domain can also bind to the endothelial protein C receptor (EPCR), which aligns thrombin and thrombomodulin on the endothelial membrane during PC activation.
- EPCR endothelial protein C receptor
- Protein C zymogen is typically converted to its active enzyme— activated protein C (aPC) to have biological potency.
- aPC activated protein C
- the activity of the PC pathway is controlled by the rate of PC activation and aPC inactivation.
- PC activation occurs on the surface of endothelial cells in a two-step process. It requires binding of PC (via Gla domain) to the EPCR on endothelial cells, followed by proteolytic activation of PC through thrombin/ thrombomodulin complexes.
- a single cleavage at Argl2 of the heavy chain of human PC which is catalyzed by thrombin/thrombomodulin on the endothelial cell surface, liberates the 12-aa AP and converts the zymogen PC into aPC, an active serine protease.
- the primary difference between the amino acid sequences of PC and aPC is the presence of a 12-aa activation peptide in PC that is absent in APC.
- Activation of PC into aPC also induces conformational changes; consequently only aPC, not PC, can be labeled by benzamidine or with chloromethylketone (CMK) peptide inhibitor in its enzymatic active site.
- CCMK chloromethylketone
- the crystal structure of Gla-domainless aPC in complex with CMK-inhibitor was recently resolved.
- the major aPC inactivator in human plasma is the protein C inhibitor (PCI) present at ⁇ in human plasma, a member of the serpin superfamily. Under physiological conditions, aPC circulates at very low concentration (1-2 ng/ml or 40 pM) in human blood with a half-life of 20-30 min.
- PCI protein C inhibitor
- the protein C pathway serves as a natural defense mechanism against thrombosis. It differs from other anticoagulants in that it is an on-demand system that can amplify the
- thrombin Upon injury, thrombin is generated for coagulation. At the same time, thrombin also triggers an anti-coagulant response by binding to thrombomodulin lined on the vascular surface, and this promotes protein C activation. Thus, aPC generation is roughly proportional to thrombin concentration and PC levels.
- aPC functions as an anticoagulant by proteolytic inactivation of two coagulation cofactors, Factor Va and Villa, thereby inhibiting the generation of thrombin.
- Factor Va two coagulation cofactors
- aPC also directly contributes to the enhanced fibrinolytic response by complex formation with plasminogen activator inhibitors (PAI).
- PAI plasminogen activator inhibitors
- aPC In addition to its anti-coagulant functions, aPC induces cytoprotective effects, including anti-inflammatory and anti-apoptotic activities, and protection of endothelial barrier function. These direct cytoprotective effects of aPC on cells require EPCR and the G- protein-coupled receptor, protease activated receptor- 1 (PAR-1). Thus, aPC promotes fibrinolysis and inhibits thrombosis and inflammation. The anti-coagulant and cytoprotective functions of aPC appear to be separable. Most of the cytoprotective effects are primarily independent of the anticoagulant activity of aPC and aPC mutants with minimal anticoagulant activity and normal cytoprotective activity have been generated. Likewise, hyper- anticoagulant but non-cytoprotective aPC mutants have also been reported.
- the C-terminus of aPC light chain is also a highly charged region that comprises residue Glyl42-Leul55 on the opposite side of the active site in the protease domain.
- E149A- aPC had amidolytic activity that is indistinguishable from wild-typeaPC, but had more than a 3 -fold increase in anti-coagulant activity in the activated partial thromboplastin time (aPTT) clotting assays due to increased sensitivity to protein S cofactor activity.
- aPTT activated partial thromboplastin time
- ⁇ 00103959 ⁇ 3 hyperactive anticoagulant activity in plasma-clotting assays as well as hyperactive antithrombotic potency in vivo This mutant also had reduced cytoprotective and mortality reduction activities in a LPS-induced lethal endotoxemia murine model. This suggests that aPC's cytoprotective activity is required to reduce mortality in the murine model. In contrast, aPC's anticoagulant activity is neither necessary nor sufficient for mortality reduction.
- aPC has been used to treat sepsis, a life-threatening condition associated with hypercoagulation and generalized inflammatory reactions. A severe side effect of aPC therapy in sepsis is major bleeding that occurs in 2% of patients. This severe side effect limits its clinical use.
- Monoclonal antibodies to human activated Protein C are provided.
- the anti-aPC monoclonal antibodies exhibit minimal binding to Protein C, which is the zymogen of aPC.
- the monoclonal antibodies to aPC provided have been optimized, for example to increase affinity, to increase functional activity or to reduce divergence from a germline sequence.
- compositions comprising the anti-aPC monoclonal antibodies and methods of treatment of genetic and acquired deficiencies or defects in coagulation such as hemophilia A and B are also provided. Also provided are methods for shortening the bleeding time by administering an anti-aPC monoclonal antibody to a patient in need thereof. Methods for producing a monoclonal antibody that binds human aPC are also provided.
- Figure 1 shows a cartoon drawing of human activated Protein C in its mature heterodimer form.
- Figure 2 shows an amino acid sequence alignment of heavy and light chain CDRs is shown among 10 anti-aPC Fabs identified from the human Fab antibody library.
- FIG. 3 depicts a graph characterizing anti-APC Fabs by direct ELISA.
- An ELISA plate was coated with human PC (hPC), human aPC (hAPC), dog aPC (dAPC), mouse aPC (mAPC) at 100 ng per well.
- Purified Fabs designate on the X-axis were added to the plate at 20 nM (1 ug/ml). Bound Fab was detected by the secondary antibody (anti-human Fab-HRP) followed by HRP substrate AmplexRed.
- the purified Fabs preferentially bind to human aPC and, with the exception of Fab R41C17, show little to no binding to human PC.
- One Fab T46J23 also showed some binding to mouse aPC.
- Figure 4 shows binding selectivity of anti-aPC Fabs by ELISA.
- Figure 5 depicts a graph showing inhibition of clot formation of normal human plasma in a dose-dependent manner by aPTT by spiking in human aPC. 50% pooled human normal plasma formed clots in 52 seconds. Preincubation of human aPC at 100, 200, 400, 800, or 1600 ng/ml with the plasma prolonged the clotting time in a dose-dependent manner. Nearly identical potency for recombinant human aPC (rh-APC) and plasma-derived human aPC (pdh-APC) was observed.
- rh-APC recombinant human aPC
- pdh-APC plasma-derived human aPC
- Figure 6 depicts graphs showing anti-aPC Fabs inhibit human aPC and induce clot formation in human normal plasma.
- Human aPC at 400ng/ml extended the plasma clotting time from 52 seconds to 180 seconds.
- Incubation of control antibody (Control) or its Fab (Control-Fab) or select Fabs at 0, 0.5, 1, 2, 5, 10, or 20ug/ml with aPC reduced the clotting time in a dose-dependent manner (top panel).
- Three Fabs (R41E3, C22J13, Control- Fab) were also tested at 40 ug/ml for a greater effect (bottom panel).
- Figure 7 shows anti-aPC Fabs inhibit dog aPC and induce clot formation in aPTT.
- Figure 8 shows the effect of anti-aPC Fabs on the amido lytic activity of aPC.
- Human aPC protein (20 nM) was first preincubated with an equal volume of anti-aPC Fab (1- 3000 nM) at room temperature for 20 min before the chromogenic substrate SPECTROZYME PCa was added to the reaction mixture up to 1 mM.
- the amidolytic activity of human aPC at a final concentration of 10 nM was measured in the presence of Fabs. Hydrolysis rates were inhibited in the presence of the Fabs, reaching a maximum reduction of 80%.
- Figure 9 shows the effect of anti-aPC Fabs on the Factor Va (FVa) inactivation activity of aPC.
- Figure 10 shows binding specificity of anti-aPC human IgGls and shows species cross-reactivity of anti-aPC human IgGls by ELISA.
- An ELISA plate was coated with human PC (hPC), human aPC (hAPC), dog aPC, mouse aPC, rabbit aPC at 1 ug/ml.
- Purified IgGs (20nM) were added to the plate. Bound IgG was detected by the secondary antibody (anti-human IgG-HRP) followed by HRP substrate AmplexRed. Five anti-aPC human IgGls cross-react with dog and rabbit aPCs and one IgGl also binds mouse aPC.
- Figure 11 shows the effect of anti-aPC IgGs on amidolytic activity of species aPCs - (a) human, (b) rabbit, (c) dog, and (d) mouse.
- aPC protein (20 nM) was first preincubated with an equal volume of anti-aPC-hlgGl (1-1000 nM) at room temperature for 20 min before the chromogenic substrate SPECTROZYME PCa was added to the reaction mixture up to 1 mM.
- the amidolytic activity of aPC at a final concentration of 10 nM was measured in the presence of Fabs. Hydrolysis rates were inhibited in the presence of the IgGs.
- a negative control antibody (anti-CTX-hlgGl) was used.
- Figure 12 shows anti-aPC-hlgGls shorten clotting time and induce coagulation in human plasma clotting assays (aPTT).
- Figure 13 shows the effect of anti-aPC-IgGl on severe hemophilic patient plasma.
- PC is activated to aPC and reduces thrombin generation.
- anti-aPC-antibody rapidly inhibits this newly generated aPC and increase thrombin generation by 5-10x. Enhanced thrombin generation will lead to improved coagulation in patients with coagulopathy.
- Figure 14 shows activity profile of anti-aPC-antibody variants. Similar to the parental antibody, C25K23, such variants (a) bind to aPC with high affinity, (b) potently inhibit aPC activity in purified system, and (c) shorten clotting time leading to coagulation in human plasma clotting assay.
- the left and right panels show the same complex structure with a rotation change of 90°.
- the HCDR3 loop from the Fab C25K23 has extensive interactions with the heavy chain of aPC.
- Figure 16 shows in the left panel shows a zoomed view of interactions around the residue Trpl04 in the CDR3 loop of Fab C25K23 heavy chain. It blocks the accessibility of active site of aPC (catalytically important residues His57, Asp 102, and Serl95).
- ⁇ 00103959 ⁇ 6 panel shows that the Fab C25K23 inhibits the activity of aPC in a way similar to the PPACK inhibitor because Trpl04 and PPACK occupy the same region at the active site.
- Figure 17 shows a graph depicting anti-aPC antibodies, in both Fab and IgG forms, binding or not binding to active-site-blocked aPC by ELISA.
- the present disclosure provides antibodies, including monoclonal antibodies, and other binding proteins that specifically bind to the activated form of human Protein C (aPC), but exhibit comparatively little or no reactivity against the zymogen form of human Protein C (PC).
- Protein C or "PC” as used herein refers to any variant, isoform, and/or species homolog of Protein C in its zymogen form that is naturally expressed by cells and present in plasma and is distinct from the activated form of Protein C.
- activated Protein C or "aPC” as used herein refers to an activated form of Protein C that is characterized by the absence of a 12 amino acid activation peptide present in Protein C.
- an “antibody” refers to a whole antibody and any antigen binding fragment (i.e., “antigen-binding portion") or single chain thereof.
- the term includes a full-
- an antibody fragment binds with the same antigen that is recognized by the full-length antibody.
- an anti-aPC monoclonal antibody fragment binds to an epitope of aPC.
- the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.
- binding fragments encompassed within the term "antigen-binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al, (1989) Nature 341 :544-546), which consists of a VH domain; (vi) an isolated complementarity determining region (CDR); (vii) minibodies, diaboidies, triabodies, tetrabodies, and kappa bodies (see, e.g.
- an antigen binding fragment can be encompassed in an antibody mimetic.
- antibody mimetic or “mimetic” as used herein is meant a protein that exhibits binding similar to an antibody but is a smaller alternative antibody or a non-antibody protein. Such antibody mimetic can be comprised in a scaffold.
- scaffold refers to a polypeptide platform for the engineering of new products with tailored functions and characteristics.
- anti-aPC antibody refers to an antibody that specifically binds to an epitope of aPC.
- the anti- aPC antibodies disclosed herein augment one or more aspects of the blood clotting cascade.
- inhibits binding and “blocks binding” (e.g., referring to inhibition/blocking of binding of aPC substrate to aPC) are used interchangeably and encompass both partial and complete inhibition or blocking of a protein with its substrate, such as an inhibition or blocking by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or aboutl00%.
- “about” means +/- 10% of the numerical value indicated.
- inhibition and blocking also include any measurable decrease in the binding affinity of aPC to a physiological substrate when in contact with an anti-aPC antibody as compared to aPC not in contact with an anti-aPC antibody, e.g., the blocking of the interaction of aPC with its substrates, including Factor Va or with Factor Villa, by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%.
- the terms "monoclonal antibody” or “monoclonal antibody composition” as used herein refer to a preparation of antibody molecules of single molecular composition.
- a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
- the term “human monoclonal antibody” refers to antibodies displaying a single binding specificity that have variable and constant regions derived from human germline immunoglobulin sequences.
- the human antibodies can include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).
- an "isolated antibody,” as used herein, is intended to refer to an antibody which is substantially free of other biological molecules, including antibodies having different antigenic specificities (e.g., an isolated antibody that binds to aPC is substantially free of antibodies that bind antigens other than aPC). .
- the isolated antibody is at least about 75%, about 80%, about 90%, about 95%, about 97%, about 99%, about 99.9% or about 100% pure by dry weight.
- purity can be measured by a method such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
- an isolated antibody that binds to an epitope, isoform or variant of human aPC can, however, have cross-reactivity to other related antigens, e.g., from other species (e.g., aPC species homologs). Moreover, an isolated antibody can be substantially free of other cellular material and/or chemicals. As used herein, "specific binding" refers to antibody binding to a
- an antibody that exhibits "specific binding” binds to an antigen with an affinity of at least about 105 M-l and binds to that antigen with an affinity that is higher, for example at least two-fold greater, than its binding affinity for an irrelevant antigen (e.g., BSA, casein).
- an irrelevant antigen e.g., BSA, casein.
- minimal binding refers to an antibody that does not bind to and/or exhibits low affinity to a specified antigen.
- an antibody having minimal binding to an antigen binds to that antigen with an affinity that is lower than about 102 M-l and does not bind to a predetermined antigen with higher affinity than it binds to an irrelevant antigen.
- the term "high affinity" for an antibody refers to a binding affinity of at least about 107M-1, in at least one embodiment at least about 108M-1, in some embodiments at least about 109M-1, lOlOM-1, lOl lM-1 or greater, e.g., up to 1013M-1 or greater.
- “high affinity” binding can vary for other antibody isotypes.
- “high affinity” binding for an IgM isotype refers to a binding affinity of at least about 107M-1.
- “isotype” refers to the antibody class (e.g., IgM or IgGl) that is encoded by heavy chain constant region genes.
- CDR complementarity-determining region
- CDR1 complementarity-determining region
- CDR2 complementarity-determining region
- CDRs are involved in antigen-antibody binding, and the CDR3 comprises a unique region specific for antigen-antibody binding.
- An antigen-binding site therefore, can include six CDRs, comprising the CDR regions from each of a heavy and a light chain V region.
- epitope refers to the area or region of an antigen to which an antibody specifically binds or interacts, which in some embodiments indicates where the antigen is in physical contact with the antibody.
- epitope refers to the area or
- Epitopes characterized by competition binding are said to be overlapping if the binding of the corresponding antibodies are mutually exclusive, i.e. binding of one antibody excludes simultaneous binding of another antibody.
- the epitopes are said to be separate (unique) if the antigen is able to accommodate binding of both corresponding antibodies simultaneously.
- the term "competing antibodies,” as used herein, refers to antibodies that bind to about, substantially or essentially the same, or even the same, epitope as an antibody against aPC as described herein.
- “Competing antibodies” include antibodies with overlapping epitope specificities. Competing antibodies are thus able to effectively compete with an antibody as described herein for binding to aPC.
- the competing antibody can bind to the same epitope as the antibody described herein. Alternatively viewed, the competing antibody has the same epitope specificity as the antibody described herein.
- “conservative substitutions” refers to modifications of a polypeptide that involve the substitution of one or more amino acids for amino acids having similar biochemical properties that do not result in loss of a biological or biochemical function of the polypeptide.
- a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
- amino acids with basic side chains e.g., lysine, arginine, histidine
- acidic side chains e.g., aspartic acid, glutamic acid
- uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
- nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
- beta-branched side chains e.g., threonine, valine, isoleucine
- aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine.
- Antibodies of the present disclosure can have one or more conservative amino acid substitutions yet retain antigen binding activity.
- nucleic acids and polypeptides the term “substantial homology” indicates that two nucleic acids or two polypeptides, or designated sequences thereof, when optimally aligned and compared, are identical, with appropriate nucleotide or amino acid insertions or deletions, in at least about 80% of the nucleotides or amino acids, usually at least about 85%, in some embodiments about 90%, 91%, 92%, 93%, 94%, or 95%, in at least one embodiment at least about 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, or 99.5% of the nucleotides or amino acids.
- substantial homology for nucleic acids exists when the segments will hybridize under selective hybridization conditions to the complement of the
- nucleic acid sequences and polypeptide sequences having substantial homology to the specific nucleic acid sequences and amino acid sequences recited herein.
- the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, such as without limitation the AlignXTM module of VectorNTITM (Invitrogen Corp., Carlsbad, CA).
- AlignXTM the default parameters of multiple alignment are: gap opening penalty: 10; gap extension penalty: 0.05; gap separation penalty range: 8; % identity for alignment delay: 40. (further details found at http ://www. invitrogen.conVsite/us/en/home/L ⁇
- Another method for determining the best overall match between a query sequence (a sequence of the present disclosure) and a subject sequence can be determined using the CLUSTALW computer program (Thompson et al, Nucleic Acids Research, 1994, 2(22): 4673-4680), which is based on the algorithm of Higgins et al, (Computer Applications in the Biosciences (CABIOS), 1992, 8(2): 189-191).
- CLUSTALW computer program Thimpson et al, Nucleic Acids Research, 1994, 2(22): 4673-4680
- Higgins et al Computer Applications in the Biosciences (CABIOS), 1992, 8(2): 189-191).
- the query and subject sequences are both DNA sequences.
- the result of said global sequence alignment is in percent identity.
- the nucleic acids can be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form.
- a nucleic acid is "isolated” or “rendered substantially pure” when purified away from other cellular components with which it is normally associated in the natural environment.
- To isolate a nucleic acid standard techniques such as
- ⁇ 00103959 ⁇ 12 the following can be used: alkaline/SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis and others well known in the art.
- aPC is known for its anti-coagulant properties. Bleeding disorders where homeostasis is deregulated in hemophilia or in trauma patients where the wound results in a temporary loss of hemostatsis, can be treated by aPC inhibitors. Antibodies, antigen-binding fragments thereof, and other aPC-specific protein scaffolds can be used to provide targeting specificity to inhibit a subset of aPC protein functions while preserving the rest. Given the at least 1000-fold difference in plasma concentration of aPC ( ⁇ 4 ng/ml) versus PC (4 ug/ml), increased specificity of any potential aPC inhibitor therapeutics is helpful to block aPC function in the presence of a high circulating excess of PC.
- aPC specific antibodies that block the anti-coagulant function of aPC can be used as therapeutics for patients with bleeding disorders, including, for example, hemophilia, hemophilia patients with inhibitors, trauma- induced coagulopathy, severe bleeding patients during sepsis treatment by aPC, bleeding resulting from elective surgery such as transplantation, cardiac surgery, orthopedic surgery, or excessive bleeding from Menorrhagia.
- Anti-aPC antibodies having long circulating half-live can be useful in treating chronic diseases like hemophilia.
- aPC antibody fragments or aPC-binding protein scaffolds with shorter half-lives can be more effective for acute use (e.g. therapeutic use in trauma).
- SAFB selective aPC function blockers
- antibodies, antigen-binding antibody fragments, aPC-specific protein scaffolds with increased affinity and targeting specificity can selectively block only one aPC function without affecting other aPC functions.
- aPC-binding antibodies were identified by panning and screening human antibody libraries against human aPC. The identified antibodies exhibited no or minimal binding to human PC.
- the heavy chain variable region and light chain variable region of each monoclonal antibody isolated was sequenced and its CDR regions were identified.
- the sequence identifier numbers (“SEQ ID NO") that correspond to the heavy and light chain regions of each of the aPC-specific monoclonal antibodies are summarized in Table 1.
- an isolated monoclonal antibody that binds to human activated protein C (aPC) and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein the antibody comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID Nos: 14-23.
- an isolated monoclonal antibody that binds to human activated protein C (aPC) and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein the antibody comprises a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID Nos: 4-13.
- an isolated monoclonal antibody that binds to human activated protein C (aPC) and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein the antibody comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID Nos: 14-23 and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID Nos: 4-13.
- the antibody comprises heavy and light chain variable regions comprising:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 20 and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 10;
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:
- this antibody further comprises (a) a CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 74-83, (b) a CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 84-93, or (c) both a CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 74-83 and a CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 84-93.
- antibodies that share a CDR3 from one of the light chains of the antibodies identified during panning and screening.
- an isolated monoclonal antibody wherein said antibody binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein said antibody comprises a CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 64-73.
- the antibody further comprises (a) a CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 44-53, (b) a CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 54-63, or (c) both a CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 44-53 and a CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 54-63.
- the antibody comprises a CDR3 from a heavy chain and a light chain of the antibodies identified from screening and panning.
- a monoclonal antibody wherein said antibody binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein said antibody comprises a CDR3 comprising an amino acid sequence selected from the group
- the antibody further comprises (a) a CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 74-83, (b) a CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 84-93, (c) a CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 44-53, and/or (d) a CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 54- 63.
- the antibody comprises heavy and light chain variable regions comprising:
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 44, 54, and 64 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 74, 84, and 94;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 45, 55, and 65 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 75, 85, and 95;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 46, 56, and 66 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 76, 86, and 96;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 47, 57, and 67 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 77, 87, and 97;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 48, 58, and 68 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 78, 88, and 98;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 49, 59, and 69 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 79, 89, and 99;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 50, 60, and 70 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 80, 90, and 100;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 51, 61, and 71 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 81, 91, and 101;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 52, 62, and 72 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 82, 92, and 102;
- a light chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 53, 63, and 73 and a heavy chain variable region comprising an amino acid sequence comprising SEQ ID NOs: 83, 93, and 103.
- an isolated monoclonal antibody that binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein said antibody comprises an amino acid sequence having at least 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identity to an amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NO: 4-13.
- an isolated monoclonal antibody that binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein said antibody comprises an amino acid sequence having at least 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identity to an amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NO: 14-23.
- the antibody can be species specific or can cross react with multiple species.
- the antibody can specifically react or cross react with aPC of human, mouse, rat, rabbit, guinea pig, monkey, pig, dog, cat or other mammalian species.
- the antibody can be of any of the various classes of antibodies, such as without limitation an IgGl, an IgG2, an IgG3, an IgG4, an IgM, an IgAl, an IgA2, a secretory IgA, an IgD, and an IgE antibody.
- the antibodies panned and screened can be optimized, for example to increase affinity to aPC, to further decrease any affinity to PC, to improve cross- reactivity to different species, or to improve blocking activity of aPC. Such optimization can
- ⁇ 00103959 ⁇ 19 be performed for example by utilizing site saturation mutagenesis of the CDRs or amino acid residues in close proximity to the CDRs, i.e. about 3 or 4 residues adjacent to the CDRs, of the antibodies.
- the anti-aPC antibodies have a binding affinity of at least about 107M- 1, in some embodiments at least about 108M-1, in some embodiments at least about 109M-1, lOlOM-1, lOl lM-1 or greater, e.g., up to 1013M-1 or greater.
- additional amino acid modifications can be introduced to reduce divergence from the germline sequence.
- amino acid modifications can be introduced to facilitate antibody production for large scale production processes.
- isolated anti-aPC monoclonal antibodies that specifically bind to human activated Protein C, which antibodies comprise one or more amino acid modifications.
- the antibody comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more modifications.
- an isolated monoclonal antibody that binds to human activated Protein C wherein the antibody comprises a light chain comprising the amino acid sequence shown in SEQ ID NO: 8, wherein the amino acid sequence comprises one or more amino acid modifications.
- the modification of the light chain is a substitution, an insertion or a deletion.
- the modifications are located in the CDRs of the light chain. In other embodiments, the modifications are located outside the CDRs of the light chain.
- the modification of the light chain of SEQ ID NO: 8 is at a position selected from G52, N53, N54, R56, P57, S58, Q91, Y93, S95, S96, L97, S98, G99, S100 and V101.
- the modification can be for example one of the following substitutions: G52S, G52Y, G52H, G52F, N53G, N54K, N54R, R56K, P57G, P57W, P57N, S58V, S58F, S58R, Q91R, Q91G, Y93W, S95F, S95Y, S95G, S95W, S95E, S96G, S96A, S96Y, S96W, S96R, L97M, L97G, L97R, L97V, S98L, S98W, S98V, S98R, G99A, G99E, S100A, S100V, V101Y, V101L or V101E.
- the antibody may comprise two or more substitutions from G52S, G52Y, G52H, G52F, N53G, N54K, N54R, R56K, P57G, P57W, P57N, S58V, S58F, S58R, Q91R, Q91G, Y93W, S95F, S95Y, S95G, S95W, S95E,
- the light chain of SEQ ID NO:8 further comprises a modification at one or more of the positions selected from A10, T13, S78, R81 and S82.
- the modification at position A10 in the light chain is A10V.
- the modification at position T13 in the light chain is T13A.
- the modification at position S78 in the light chain is S78T.
- the modification at position R81 in the light chain is R81Q.
- the modification at position S82 in the light chain is S82A.
- the light chain of SEQ ID NO:8 comprises two or more of the modifications A10V, T13A, S78T, R81Q and S82A.
- the light chain of SEQ ID NO:8 comprises all the modifications A10V, T13A, S78T, R81Q and S82A.
- an isolated monoclonal antibody that specifically binds to human activated form of Protein C, wherein the antibody comprises a heavy chain having the amino acid sequence shown in SEQ ID NO: 18, wherein the amino acid sequence comprises one or more amino acid modifications.
- the modification of the light chain is a substitution, an insertion or a deletion.
- the heavy chain of SEQ ID NO: 18 further comprises a modification at positions N54 or S56.
- the modification at position N54 of the heavy chain is N54G, N54Q or N54A.
- modification at position S56 of the heavy chain is S56A or S56G.
- amino acid modifications can be made in order to in order to facilitate antibody production for large scale production processes. For example, in some embodiments, modifications can be made to reduce the hydrophobic surface region of antibodies for improved biophysical properties (e.g. minimal aggregation/stickiness). In some embodiments, additional modifications are made in the light chain of SEQ ID NO: 8.
- the modification of the light chain of SEQ ID NO: 8 is at position Y33.
- the modification and Y33 in the light chain is Y33A, Y33K or Y33D.
- additional modifications are made in the heavy chain of SEQ ID NO: 18.
- the modifications of the heavy chain of SEQ ID NO: 18 are at one or more of the positions Y32, W33, W53 or WHO. In some embodiments, the
- ⁇ 00103959 ⁇ 21 modification in the heavy chain of SEQ ID NO: 18 is selected from Y32A, Y32K, Y32D, W33A, W33K, W33D, W53A, W53K, W53D, Wl 10A, Wl 10K, or Wl 10D.
- an isolated monoclonal antibody that binds to human activated Protein C wherein the antibody comprises a light chain having the amino acid sequence shown in SEQ ID NO: 108.
- an isolated monoclonal antibody that binds to human activated Protein C wherein the antibody comprises a light chain having the amino acid sequence shown in SEQ ID NO: 1 10.
- an isolated monoclonal antibody that binds to human activated Protein C wherein the antibody comprises a light chain having the amino acid sequence shown in SEQ ID NO: 1 12.
- an isolated monoclonal antibody that binds to human activated Protein C wherein the antibody comprises a light chain having the amino acid sequence shown in SEQ ID NO: 12, wherein the amino acid sequence comprises one or more amino acid modifications.
- the modification of the light chain is a substitution, an insertion or a deletion.
- the modifications are located in the CDRs of the light chain. In other embodiments, the modifications are located outside the CDRs of the light chain.
- the modification of the light chain of SEQ ID NO: 12 is at a position selected from T25, D52, N53, N54, N55, D95, N98 or G99.
- the modification can be for example the one of the following substitutions: T25S, D52Y, D52F, D52L, D52G, N53C, N53K, N53G, N54S, N55K, D95G, N98S, G99H, G99L or G99F.
- the antibody may comprise two or more substitutions from T25S, D52Y, D52F, D52L, D52G, N53C, N53K, N53G, N54S, N55K, D95G, N98S, G99H, G99L or G99F.
- an isolated anti-aPC monoclonal antibody that binds to the human activated form of Protein C, wherein the antibody comprises a heavy chain having the amino acid sequence shown in SEQ ID NO: 22, wherein the amino acid sequence comprises one or more amino acid modifications.
- the modification of the light chain is a substitution, an insertion or a deletion.
- an isolated monoclonal antibody that bind to an epitope of human activated Protein C, wherein the epitope comprises one or more of residues from the heavy chain of human aPC shown in SEQ ID NO:3.
- the epitope can include the active site of human aPC.
- the active site can comprise amino acid residue SI 95 of human aPC.
- the epitope can comprises one or more residues selected from D60, K96, S97, T98, T99, E170, V171, M172, S 173, M175, A190, S195, W215, G216, E217, G218, and G218 of human activated Protein C shown in SEQ ID NO:3.
- antibodies which can compete with any of the antibodies described herein for binding to human activated Protein C.
- a competing antibody can bind to one or more epitopes described above.
- nucleic acid molecules encoding any of the monoclonal antibodies described above.
- nucleic acid molecule encoding an antibody that binds to human activated Protein C.
- nucleic acid molecules encoding an antibody that binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein the antibody comprises a heavy chain variable region comprising a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 34-43.
- nucleic acid molecules encoding an antibody that binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein the antibody comprises a light chain variable region comprising a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 24-33.
- nucleic acid molecules encoding an antibody that binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein the antibody comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID Nos: 14-23.
- nucleic acid molecules encoding an antibody that binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein the antibody comprises a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID Nos: 4-13.
- isolated nucleic acid molecules encoding an antibody that binds to activated Protein C and inhibits anticoagulant activity but has minimal binding to unactivated Protein C, wherein the antibody comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID Nos: 14-23 or a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID Nos: 4-13, and one or more amino acid modifications in the heavy chain variable region or light chain variable region.
- vectors comprising the isolated nucleic acid molecules encoding any of the monoclonal antibodies described above and host cells comprising such vectors.
- the monoclonal antibody can be produced recombinantly by expressing a nucleotide sequence encoding the variable regions of the monoclonal antibody according to one of the present embodiments in a host cell. With the aid of an expression vector, a nucleic acid containing the nucleotide sequence can be transfected and expressed in a host cell suitable for the production. Accordingly, also provided is a method for producing a monoclonal antibody that binds with human aPC comprising:
- nucleic acid molecule comprises a nucleotide sequence encoding a monoclonal antibody.
- DNAs encoding partial or full-length light and heavy chains obtained by standard molecular biology techniques are inserted into expression vectors such that the genes are operatively linked to transcriptional and translational control sequences.
- operatively linked is intended to mean that an antibody gene is ligated into a vector such that transcriptional and translational control sequences within the vector serve their intended function of regulating the transcription and translation of the antibody gene.
- the expression vector and expression control sequences are chosen to be compatible with the expression host cell used.
- the antibody light chain gene and the antibody heavy chain gene can be inserted into separate vectors or, more typically, both genes are inserted into the same expression vector.
- the antibody genes are inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the antibody gene fragment and vector, or blunt end ligation if no restriction sites are present).
- the light and heavy chain variable regions of the antibodies described herein can be used to create full-length antibody genes of any antibody isotype by inserting them into expression vectors already encoding heavy chain constant and light chain constant regions of the desired isotype such that the VH segment is
- the recombinant expression vector can encode a signal peptide that facilitates secretion of the antibody chain from a host cell.
- the antibody chain gene can be cloned into the vector such that the signal peptide is linked in-frame to the amino terminus of the antibody chain gene.
- the signal peptide can be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide from a non-immunoglobulin protein).
- the recombinant expression vectors carry regulatory sequences that control the expression of the antibody chain genes in a host cell.
- the term "regulatory sequence” is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of the antibody chain genes.
- Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology. Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). It will be appreciated by those skilled in the art that the design of the expression vector, including the selection of regulatory sequences can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc.
- regulatory sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and/or enhancers derived from cytomegalovirus (CMV), Simian Virus 40 (SV40), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)) and polyoma.
- CMV cytomegalovirus
- SV40 Simian Virus 40
- AdMLP adenovirus major late promoter
- nonviral regulatory sequences can be used, such as the ubiquitin promoter or ⁇ - globin promoter.
- the recombinant expression vectors can carry additional sequences, such as sequences that regulate replication of the vector in host cells (e.g., origins of replication) and selectable marker genes.
- the selectable marker gene facilitates selection of host cells into which the vector has been introduced (see, e.g., U.S. Pat. Nos. 4,399,216, 4,634,665 and 5,179,017, all by Axel et al).
- the selectable marker gene confers resistance to drugs, such as G418, hygromycin or methotrexate, on a host cell into which the vector has been introduced.
- selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in dhfr- host cells with methotrexate selection/amplification) and the neo gene (for G418 selection).
- DHFR dihydrofolate reductase
- neo gene for G418 selection.
- the expression vector(s) encoding the heavy and light chains is transfected into a host cell by standard techniques.
- the various forms of the term "trans fection” are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, calcium-phosphate precipitation, DEAE-dextran transfection and the like.
- Examples of mammalian host cells for expressing the recombinant antibodies include Chinese Hamster Ovary (CHO cells) (including dhfr- CHO cells, described in Urlaub and Chasin, (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220, used with a DHFR selectable marker, e.g., as described in R. J. Kaufman and P. A. Sharp (1982) Mol. Biol. 159:601-621), NSO myeloma cells, COS cells, HKB1 1 cells and SP2 cells.
- Chinese Hamster Ovary CHO cells
- dhfr- CHO cells described in Urlaub and Chasin, (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220, used with a DHFR selectable marker, e.g., as described in R. J. Kaufman and P. A. Sharp (1982) Mol. Biol. 159:601-621
- the antibodies When recombinant expression vectors encoding antibody genes are introduced into mammalian host cells, the antibodies are produced by culturing the host cells for a period of time sufficient to allow for expression of the antibody in the host cells or secretion of the antibody into the culture medium in which the host cells are grown. Antibodies can be recovered from the culture medium using standard protein purification methods, such as ultrafiltration, size exclusion chromatography, ion exchange chromatography and centrifugation.
- Antibodies interact with target antigens predominantly through amino acid residues that are located in the six heavy and light chain CDRs. For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, e.g., Riechmann, L. et al, 1998, Nature 332:323-327; Jones, P. et al, 1986, Nature 321 :522-525; and Queen, C. et al, 1989, Proc. Natl. Acad. Sci. U.S.A. 86: 10029-10033). Such framework sequences can be obtained from public DNA databases that include germline antibody gene sequences. These germline
- ⁇ 00103959 ⁇ 27 sequences will differ from mature antibody gene sequences because they will not include completely assembled variable genes, which are formed by V(D)J joining during B cell maturation. It is not necessary to obtain the entire DNA sequence of a particular antibody in order to recreate an intact recombinant antibody having binding properties similar to those of the original antibody (see WO 99/45962). Partial heavy and light chain sequence spanning the CDR regions is typically sufficient for this purpose. The partial sequence is used to determine which germline variable and joining gene segments contributed to the recombined antibody variable genes. The germline sequence is then used to fill in missing portions of the variable regions. Heavy and light chain leader sequences are cleaved during protein maturation and do not contribute to the properties of the final antibody.
- variable region can be synthesized as a set of short, overlapping, oligonucleotides and combined by PCR amplification to create an entirely synthetic variable region clone. This process has certain advantages such as elimination or inclusion or particular restriction sites, or optimization of particular codons.
- the nucleotide sequences of heavy and light chain transcripts are used to design an overlapping set of synthetic oligonucleotides to create synthetic V sequences with identical amino acid coding capacities as the natural sequences.
- the synthetic heavy and light chain sequences can differ from the natural sequences. For example: strings of repeated nucleotide bases are interrupted to facilitate oligonucleotide synthesis and PCR amplification; optimal translation initiation sites are incorporated according to Kozak's rules (Kozak, 1991, J. Biol. Chem. 266: 19867-19870); and restriction sites are engineered upstream or downstream of the translation initiation sites.
- the optimized coding, and corresponding non-coding, strand sequences are broken down into 30-50 nucleotide sections at approximately the midpoint of the corresponding non-coding oligonucleotide.
- the oligonucleotides can be assembled into overlapping double stranded sets that span segments of 150-400 nucleotides.
- the pools are then used as templates to produce PCR amplification products of 150-400 nucleotides.
- a single variable region oligonucleotide set will be broken down into two pools which are separately amplified to generate two overlapping PCR products. These overlapping products are then combined by
- PCR amplification to form the complete variable region. It can also be desirable to include an overlapping fragment of the heavy or light chain constant region in the PCR amplification to generate fragments that can easily be cloned into the expression vector constructs.
- the reconstructed heavy and light chain variable regions are then combined with cloned promoter, translation initiation, constant region, 3' untranslated, polyadenylation, and transcription termination sequences to form expression vector constructs.
- the heavy and light chain expression constructs can be combined into a single vector, co-transfected, serially transfected, or separately transfected into host cells which are then fused to form a host cell expressing both chains.
- the structural features of a human anti-aPC antibody are used to create structurally related human anti-aPC antibodies that retain the function of binding to aPC. More specifically, one or more CDRs of the specifically identified heavy and light chain regions of the monoclonal antibodies can be combined recombinantly with known human framework regions and CDRs to create additional, recombinantly-engineered, human anti-aPC antibodies.
- compositions comprising therapeutically effective amounts of anti-aPC monoclonal antibody and a pharmaceutically acceptable carrier.
- “Pharmaceutically acceptable carrier” is a substance that can be added to the active ingredient to help formulate or stabilize the preparation and causes no significant adverse toxicological effects to the patient.
- examples of such carriers are well known to those skilled in the art and include water, sugars such as maltose or sucrose, albumin, salts such as sodium chloride, etc.
- compositions will contain a therapeutically effective amount of at least one anti-TFPI monoclonal antibody.
- compositions include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- the use of such media and agents for pharmaceutically active substances is known in the art.
- the composition is in some embodiments formulated for parenteral injection.
- the composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example,
- glycerol propylene glycol, and liquid polyethylene glycol, and the like
- suitable mixtures thereof it will include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
- Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration.
- dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
- some methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- the monoclonal antibody can be used for therapeutic purposes for treating genetic and acquired deficiencies or defects in coagulation.
- the monoclonal antibodies in the embodiments described above can be used to block the interaction of aPC with its substrate, which can include Factor Va or Factor Villa.
- the monoclonal antibodies have therapeutic use in the treatment of disorders of hemostasis such as thrombocytopenia, platelet disorders and bleeding disorders (e.g., hemophilia A, hemophilia B and hemophilia C). Such disorders can be treated by administering a therapeutically effective amount of the anti-aPC monoclonal antibody to a patient in need thereof.
- the monoclonal antibodies also have therapeutic use in the treatment of uncontrolled bleeds in indications such as trauma and hemorrhagic stroke.
- a method for shortening the bleeding time comprising administering a therapeutically effective amount of an anti-aPC monoclonal antibody to a patient in need thereof.
- the anti-aPC antibody can be useful as an antidote for aPC-treated patients, including for example wherein aPC is used for the treatment of sepsis or bleeding disorder.
- the antibodies can be used as monotherapy or in combination with other therapies to address a hemostatic disorder.
- a clotting factor such as factor Vila, factor VIII or factor IX is believed useful for
- ⁇ 00103959 ⁇ 30 treating hemophilia.
- a method for treating genetic and acquired deficiencies or defects in coagulation comprising administering (a) a first amount of a monoclonal antibody that binds to human tissue factor pathway inhibitor and (b) a second amount of factor VIII or factor IX, wherein said first and second amounts together are effective for treating said deficiencies or defects.
- a method for treating genetic and acquired deficiencies or defects in coagulation comprising administering (a) a first amount of a monoclonal antibody that binds to human tissue factor pathway inhibitor and (b) a second amount of factor VIII or factor IX, wherein said first and second amounts together are effective for treating said deficiencies or defects, and further wherein factor VII is not coadministered.
- a pharmaceutical composition comprising a therapeutically effective amount of the combination of a monoclonal antibody and factor VIII or factor IX, wherein the composition does not contain factor VII.
- Factor VII includes factor VII and factor Vila.
- one or more antibodies described herein can be used in combination to address a hemostatic disorder.
- co-administration of two or more of the antibodies described herein is believed useful for treating hemophilia or other hemostatic disorder.
- compositions can be parenterally administered to subjects suffering from hemophilia A or B at a dosage and frequency that can vary with the severity of the bleeding episode or, in the case of prophylactic therapy, can vary with the severity of the patient's clotting deficiency.
- compositions can be administered to patients in need as a bolus or by continuous infusion.
- a bolus administration of an inventive antibody present as a Fab fragment can be in an amount of from 0.0025 to 100 mg/kg body weight, 0.025 to 0.25 mg/kg, 0.010 to 0.10 mg/kg or 0.10-0.50 mg/kg.
- an inventive antibody present as an Fab fragment can be administered at 0.001 to 100 mg/kg body weight/minute, 0.0125 to 1.25 mg/kg/min., 0.010 to 0.75 mg/kg/min., 0.010 to 1.0 mg/kg/min. or 0.10-0.50 mg/kg/min. for a period of 1-24 hours, 1-12 hours, 2-12 hours, 6-12 hours, 2-8 hours, or 1-2 hours.
- an inventive antibody present as a full-length can be administered at 0.001 to 100 mg/kg body weight/minute, 0.0125 to 1.25 mg/kg/min., 0.010 to 0.75 mg/kg/min., 0.010 to
- dosage amounts can be about 1-10 mg/kg body weight, 2-8 mg kg, or 5-6 mg/kg.
- full-length antibodies would typically be administered by infusion extending for a period of thirty minutes to three hours.
- the frequency of the administration would depend upon the severity of the condition. Frequency could range from three times per week to once every two weeks to six months.
- compositions can be administered to patients via subcutaneous injection.
- a dose of 10 to 100 mg anti-aPC antibody can be administered to patients via subcutaneous injection weekly, biweekly or monthly.
- therapeutically effective amount means an amount of an anti- aPC monoclonal antibody or of a combination of such antibody and factor VIII or factor IX that is needed to effectively increase the clotting time in vivo or otherwise cause a measurable benefit in vivo to a patient in need.
- the precise amount will depend upon numerous factors, including, but not limited to the components and physical characteristics of the therapeutic composition, intended patient population, individual patient considerations, and the like, and can readily be determined by one skilled in the art.
- Master plates were produced by picking 1880 clones per panning strategy into 384 well plates (ThermoFisher Scientific, Weltham, MA USA) containing growth media (2XYT/l%glucose/100 ⁇ g/ml Carbenicillin) using the Qpix2 (Genetix, Boston, MA USA) colony picker. Plates were grown overnight at 37 °C with shaking.
- Anti- hFab-HRP Jackson ImmunoResearch, 1 : 10,000 dilution in DPBST was added to each well and incubated for lhr at room temperature. Plates were then washed 5 times with DPBST. Amplex Red (Invitrogen) substrate was added and plates were read at an excitation of 485 nm and emission of 595 nm.
- biotin-TF non-depletion
- biotin-PC depletion/Streptavidin beads
- the resulting phage supernatants were incubated with 100 nM (first round), 50 nM (second round) or 10 nM (third round) biotin-aPC in 1ml DPBS/3%BSA/0.05% TWEEN 20/lmM CaC12 for 2 hours at RT or 40 °C overnight.
- lOOul of Streptavidin-coupled magnetic beads were added to the phage-aPC solution and incubated for 30 minutes at room temperature.
- the phage-aPC complex beads was captured on magnetic device and washed with various times of DPBS with 3%BSA or 0.05% TWEEN 20
- the bound phage was eluted with lmg/ml trypsin and neutralized with aprotinin. The eluted phage was then used to infect 10 ml exponentially growing E. coli HB101F' and amplified for the next round of selection. The phage stock was also analyzed in a CFU titration (panning output).
- the eluted phage was then used to infect 10 ml exponentially growing E. coli HB101F' and amplified for the next round of selection.
- the phage stock was also analyzed in a CFU titration (panning output).
- a volume of 10ml of exponentially growing HB101F' was infected with eluted phage from each round of selection and incubated at 37 °C for 45 minutes, 50 rpm.
- the bacteria were then resuspended in 2xYT medium and spread on two 15cm agar plates containing 100 ⁇ g/ml carbocinin, 15 ⁇ g/ml tetracycline and 1% glucose followed by overnight incubation at 30 °C.
- the lawn of bacteria from the plates were collected with total of 8 ml 2xYT/carb/tet.
- Plasmid was prepared using standard molecular biology techniques. The following primers were used for DNA sequencing of selected antibody clones.
- Primer A 5 ' GAAACAGCTATGAAATACCTATTGC 3 '
- Primer B 5' GCCTGAGCAGTGGAAGTCC 3'
- One liter of dog or rabbit plasma was purchased as 20x50ml frozen stocks with heparin included as anticoagulant (Bioreclamation, Inc., Westbury, NY). The purification method was described by Esmon's lab (12) with modifications. Plasma was thawed at 4C, and diluted 1 : 1 with 0.02M Tris-HCl, pH7.5, heparin lU/ml final, benzamidine HC1 lOmM final, at RT before loading onto a Q-Sepharose column for capturing protein C and other vitamin K-dependent proteins. The column was washed with buffered 0.15M NaCl, and protein C was eluted with buffered 0.5M NaCl.
- ⁇ 00103959 ⁇ 35 separate the media from cells. Both supernate and pellet were saved for Fab purification. Fab expression in both supernate and pellet can be confirmed by western blot analysis using anti- His antibody.
- Protein A column (MabSure) was used as recommended by the Biolnvent protocol. Supernate was filtered through a 0.45um filter to remove debris and mixed with a tablet of complete protease inhibitors (Roche 1 1873580001) before loading onto a buffer-equilibrated protein A column. Fab was eluted with pH 2-3 buffer then buffer- exchanged to PBS, pH 7.0. In order to liberate Fab from cell pellets, 1 ml lysis buffer was added to pellet. The mixture was incubated for lh for lysis at 4 °C on a rocking platform then centrifuged at 3,000 g for 30 min at 4 °C.
- Lysis buffer contains freshly prepared 1 mg/ml lysozyme (Sigma L-6876) in cold sucrose solution (20% sucrose (w/v), 30 mM TRIS-HCL, 1 mM EDTA, pH 8.0), 2.5 U/ml benzonase (Sigma E1014) (25 KU/ml, stock solution 1/10.000), and 1 tablet of complete protease inhibitors (Roche 1 1873580001). Purity of the purified Fab was confirmed by SDS-PAGE and analytical size-exclusion chromatography (SEC). Endotoxin levels were also monitored.
- Purified protein (lOOng/lane) was mixed with 4x SDS-PAGE loading dye with DTT (reducing) or without DTT (non-reducing), heated at 95 °C for 5 min then loaded onto 4-12% NuPAGE gels. Proteins were transferred to nitrocellulose membranes by i-Blot (Life technologies, Carlsbad, CA). Probing steps were done with SNAP-id (Millipore). After blocking with 5% milk/PBS for 10 min, the membranes were incubated with various reagents (e.g. Streptavidin-HRP for detection of biotinylated aPC, the mouse anti-human PC monoclonal antibody HCP-4 and anti-PC goat polyclonal antibody for detection of dog aPC).
- various reagents e.g. Streptavidin-HRP for detection of biotinylated aPC, the mouse anti-human PC monoclonal antibody HCP-4 and anti-PC goat polyclonal antibody for detection of dog aPC).
- the probing was followed by incubation with HRP secondary antibody for 10 minutes at room temperature. After washing the blots with PBS with 0.1% TWEEN-20, the signal from HRP was detected using a chemiluminescent substrate (ECL) (Pierce, Rockford, IL) and exposure to x-ray film.
- ECL chemiluminescent substrate
- Antigen proteins human PC, human PC, mouse APC, dog APC
- PBS/Ca buffer Life technologies
- the plate was washed 3x and blocked with 5% PBS/Ca/BSA/Tween20 for lh at RT.
- Soluble Fab was added to each well and incubated for 1 h at RT.
- the plate was incubated at room temperature for 1 hr, washed extensively and then developed using Amplex Red substrate as described by the kit manufacturer.
- the signal was measured as RFU using a fluorescent plate reader (SpectraMax 340pc, Molecular Devices, Sunnyvale, CA).
- the standard curve was fitted to a four-parameter model, and the values of the unknowns were extrapolated from the curve.
- the purified Fabs were characterized by a panel of functional assays to assess: a) their binding specificity (aPC vs. PC); binding affinity (by ELISA and Biacore); and species cross-reactivity (ie. Binding to aPCs of different species origins including human, dog and mouse). Rabbit aPC was also used later for IgG format; b) their binding selectivity against other vitamin K-dependent coagulation factors (e.g.
- Antigen-binding activities of these purified anti-aPC Fabs were determined by direct ELISA as shown in Figure 3. Antigens were coated directly on ELISA plates. Coating
- antigens included human PC (plasma-derived), human aPC (recombinant), dog aPC (plasma- derived), and mouse aPC (recombinant) at lOOng/well in PBS/Ca buffer.
- soluble Fabs (1 ug/ml, 20 nM) were added to the plate and incubated for 1 h at RT with shaking.
- Fab binding was detected with anti-human Fab (lambda) antibody-HRP and Amplex red as substrate.
- ELISA data showed that all Fabs specifically bind to human aPC but not to human PC.
- Anti-aPC Fabs were added to the wells at 20 nM (1 ug/ml). Bound Fabs were detected by the secondary antibody (anti-human Fab-HRP) followed by HRP substrate AmplexRed. As positive control, a control antibody specific for each antigen was used to demonstrate that coating antigen is present.
- Human aPC is a potent anti-coagulant, and this function can be easily demonstrated by the plasma clotting assay (aPTT) as shown in Figure 5.
- aPTT assays 50% normal human pooled plasma formed clots in 52 seconds upon adding CaCls (initiator) to the mixture of plasma and phospholipids.
- Preincubation of human aPC at 100, 200, 400, 800, or 1600 ng/ml with plasma prolonged the clotting time in a dose-dependent manner.
- nearly identical potency was obtained for plasma-derived aPC and the recombinant aPC. Since the maximal setting of clotting time for the Stago instrument was 240 seconds, the anti-coagulant activity of human aPC in this functional assay reached its maximum at 800 ng/ml of aPC.
- Fabs T46P19 and R41E3 had no effect on dog aPC in APTT as expected since they could not bind to dog-aPC by ELISA.
- Activated Protein C is a serine protease. Its catalytic activity can be measured by two methods: a) amidolytic activity assay using a small peptide substrate, and b) FVa degradation assay using a physiological protein substrate FVa.
- Amidolytic activity of human aPC was investigated by using a chromogenic peptide substrate of aPC in buffer. Purified aPC protein at 10 nM was incubated with the chromogenic substrate SPECTROZYME Pea (Lys-Pro-Arg-pNA, MW 773.9 Da) at 1 mM for 30 min. The conversion of substrate to colorimetric product (ie. Enzyme activity of aPC) was monitored by kinetically reading OD450 every 5 minutes. A standard curve was generated with recombinant human aPC.
- IC50 correlated with EC50 in ELISA binding assay, as high-affinity binders (C7I7, C7A23, T46P 19, T46J23, C25K23) showed much faster inhibition in this assay than the rest of weaker binders (R41E3, C22J13, C26B9).
- increasing concentration of Fabs for weaker binders also produced maximal inhibition.
- R41E3 at 3,000 nM produced about 80% inhibition of aPC activity, and the same extent of inhibition was achieved by high affinity binders at 100 nM.
- most binders interacted with the active site of aPC causing the inhibition of its amidolytic activity.
- the control antibody caused partial inhibition of aPC (40%) and reached a plateau at concentrations greater than 100 nM. No inhibitory effect was
- the FVa inactivation activity of human aPC can be measured by incubating human aPC (180 pM) with its physiological protein substrate FVa (1.25 nM), then adding FXa and prothrombin to the reaction mixture to form prothrombinase complex. Chromogenic peptide substrate of thrombin was added to detect the production of thrombin ( Figure 9). The readout is thrombin production (Flla/sec). Purified factors Va (1.25nM) were incubated with aPC (180pM) in the presence of range of concentrations of the Fabs (1-500 nM), and the FVa activities were evaluated in the prothrombinase/tenase assay.
- FVa The influence of the Fabs on the aPC activity toward the biological substrate FVa was measured by an FXa- and a thrombin-generation assay utilizing purified FVa.
- FVa at 0.16 U/ml (1.25 nM) was incubated with aPC 180 pM in assay buffer (20 mM TrisHCl, 137 nM NaCl, 10 ug/ml phospholipids, 5 mM CaC12, 1 mg/ml BSA) in the presence or absence of antibodies. After incubation for 30 min, 25 ul mixture was transferred to wells.
- All 10 anti-aPC Fabs were converted to human IgGl by cloning Fv sequences into human IgGl expression vectors. Plasmids were transfected into HEK293 cells for transient expression. Antibodies were secreted into the culture medium and purified by protein A column. One high-yield antibody T46J23-hIgGl produced 10.3 mg per 200 ml culture. Some antibodies only produced 1 mg per 200 ml. Endotoxin levels were also monitored (less than 0.01 EU/mg).
- ELISA revealed that most IgG antibodies retain their binding specificity like Fabs as they preferentially bind to human aPC over human PC.
- R41C17 and 03E7 bind both human aPC and human PC.
- T46J23 gained human PC binding after its conversion of Fab to IgG.
- Titration experiment by ELISA also revealed that, in general, the binding affinity of these bivalent IgGl was increased 2-50-fold as compared to the corresponding monovalent Fabs as shown in Table 5.
- the low-affinity Fab R41E3 increased binding affinity almost 50-fold after Fab- IgG conversion with EC50 value of 104 nM for Fab vs.
- Example 9 Effect of anti-APC IgGs on the enzymatic activity of species APCs in buffer using amidolytic activity assay
- the 5 species cross-reactive IgGs were then evaluated for their effect on the amidolytic activity of species APCs ( Figure 11).
- the negative control IgG anti-CTX antibody
- the 5 IgGs all inhibited human aPC in a dose-dependent manner.
- Their IC50 values are 18 nM for T46J23- IgG; 27nM for C22J13; 64nM for C7I7; 78 nM for C7A23, and 131 nM for C25K23.
- C25K23 IgGl has a light chain as shown in SEQ ID NO: 108 and heavy chain as shown in SEQ ID NO: 109.
- TPP-2031 is a modified C25K23 IgG with a heavy chain comprising the modification N54G.
- Variant 2310 is a modified C25K23 IgG with a light chain comprising the modifications A10V, T13A, S78T, R81Q and S82A as shown in SEQ ID NO: 1 12 and heavy chain comprising the modification N54Q as shown in SEQ ID NO: 113.
- Variant 2312 is a modified C25K23 IgG with a light chain comprising the modifications A10V, T13A, S78T, R81Q and S82A as shown in SEQ ID NO: 1 16 and heavy chain comprising the modification S56A as shown in SEQ ID NO: 1 17.
- Such variants also display a high affinity to aPC as shown in Figure 14(a).
- TPP-2309 is a modified C25K23 IgGl with a light chain comprising the modifications A10V, T13A, S78T, R81Q and S82A as shown in SEQ ID NO: 1 10 and heavy chain comprising the modification N54G as shown in SEQ ID NO: 11 1.
- human plasma had a baseline clotting time of 50-52 sec in the absence of aPC.
- Addition of human aPC to plasma increased clotting time to 190 sec as expected, since aPC is a well- known anti-coagulant.
- Pre-incubation of aPC with the negative control IgGl (anti-CTX antibody) did not change clotting time.
- pre-incubation of aPC with anti-aPC specific IgG significantly shortened the clotting time in a dose-dependent manner.
- both T46J23-IgG and C7I7-IgG at 1 ug/ml inhibited -50% activity of aPC (at 400ng/ml) and shortened the clotting time from 190 to 1 14 sec.
- all three antibodies T46J23, C7I7, C26B9 completely reverse the anti-coagulant activity of aPC and restored the clotting to normal.
- R41E3-IgG was less potent than these 3 IgGs in inhibiting aPC.
- R41E3 partially restored the clotting time to 75 sec and inhibited -80% activity of aPC at 163 -fold molar excess.
- Example 11 Anti-aPC IgGs inhibit aPC and induce clot formation in severe hemophilic patient plasma.
- the effect of anti-APC IgGs on aPC's anti-coagulant activity was further investigated using Hemophilic patient plasma in thrombin generation assay (TGA) as shown in Figure 13. Damages on the cells lining blood vessel (endothelial cells) results in exposure of tissue factor leading to limited amount of thrombin generation, known as extrinsic coagulation pathway. Thrombomodulin on the endothelial cells contribute to generation of aPC and its anti-coagulant activity. Severe hemophilic plasma generated only -50 nM total thrombin. Adding anti-aPC-antibody to the hemophilic plasma increased thrombin generation in dose dependent manner.
- Recombinant anti-aPC human Fabs (C25K23 and T46J23) were expressed in E.coli and purified to homogeneity by Protein A chromatography. Purified Fabs were showed to have a >90% purity and are lack of aggregation by SDS-PAGE and by analytical size exclusion chromatography. Their functions were characterized by aPC-binding assay
- Plasma-derived human aPC-Gla-domain-less (aPC-GD) was purchased from Enzyme Research Lab and characterized by ELISA to confirm that it can be recognized by both C25K23Fab and T46J23Fab.
- aPC-GD was mixed with 1.05 mg C25K23Fab and the reaction mixture was incubated at 4 °C for 5 hours. The mixture was loaded onto a gel filtration column to separate free Fab or free aPC-GD from the aPC-GD-Fab complex. Each fraction was collected and analyzed by SDS-PAGE under a non-reducing condition. This process was repeated three times, and the fractions containing the aPC-GD-Fab complex were pooled and concentrated to 10 mg/ml.
- the paratope comprises residues S31, Y32, W53, R57, R101, W104, R106, F107, WHO of the heavy chain shown in SEQ ID NO: 18 and K55 of the light chain shown in SEQ ID NO:8.
- Biotin-PPACK-hAPC or human aPC was coated onto a maxisorp 96-well plate.
- Anti-aPC antibodies Fab and IgG
- HRP-conjugated anti-human or anti- mouse Fab antibody followed by incubation with fluorogenic substrates (amplex red and H202) to produce fluorescent signals (RFU).
- the plate was read by Gemini EM fluorescence microplate reader (Molecular Devices, Sunnyvale, CA). The RFUs at 20 nM antibody concentration were presented as mean of triplicate wells (+/-SD) in the bar graph.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Endocrinology (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020157017008A KR20150088869A (ko) | 2012-11-29 | 2013-11-27 | 활성화 단백질 C(aPC)에 대한 모노클로날 항체 |
| MX2015006424A MX2015006424A (es) | 2012-11-29 | 2013-11-27 | Anticuerpos monoclonales contra una proteina activada c (apc). |
| SG11201503719WA SG11201503719WA (en) | 2012-11-29 | 2013-11-27 | MONOCLONAL ANTIBODIES AGAISNT ACTIVATED PROTEIN C (aPC) |
| RU2015125349A RU2015125349A (ru) | 2012-11-29 | 2013-11-27 | МОНОКЛОНАЛЬНЫЕ АНТИТЕЛА ПРОТИВ АКТИВИРОВАННОГО БЕЛКА С (аРС) |
| EP13857869.5A EP2925351A4 (en) | 2012-11-29 | 2013-11-27 | MONOCLONAL ANTIBODIES DIRECTED AGAINST ACTIVATED PROTEIN C (APC) |
| AU2013352159A AU2013352159A1 (en) | 2012-11-29 | 2013-11-27 | Monoclonal antibodies agaisnt activated Protein C (aPC) |
| JP2015545438A JP2016501230A (ja) | 2012-11-29 | 2013-11-27 | 活性化プロテインC(aPC)に対するモノクローナル抗体 |
| HK16100878.9A HK1212896A1 (zh) | 2012-11-29 | 2013-11-27 | 針對活化蛋白c(apc)的單克隆抗體 |
| CA2892750A CA2892750A1 (en) | 2012-11-29 | 2013-11-27 | Monoclonal antibodies agaisnt activated protein c (apc) |
| CN201380062159.XA CN104812402A (zh) | 2012-11-29 | 2013-11-27 | 针对活化蛋白C (aPC)的单克隆抗体 |
| US14/443,710 US20150307625A1 (en) | 2012-11-29 | 2013-11-27 | MONOCLONAL ANTIBODIES AGAINST ACTIVATED PROTEIN C (aPC) |
| BR112015012414A BR112015012414A2 (pt) | 2012-11-29 | 2013-11-27 | anticorpos monoclonais contra proteína c ativada (apc) |
| IL238658A IL238658A0 (en) | 2012-11-29 | 2015-05-06 | Monoclonal antibodies against activated protein c |
| ZA2015/04659A ZA201504659B (en) | 2012-11-29 | 2015-06-26 | Monoclonal antibodies against activated protein c (apc) |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261731294P | 2012-11-29 | 2012-11-29 | |
| US61/731,294 | 2012-11-29 | ||
| US201361786472P | 2013-03-15 | 2013-03-15 | |
| US61/786,472 | 2013-03-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014085596A1 true WO2014085596A1 (en) | 2014-06-05 |
Family
ID=50828462
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/072243 Ceased WO2014085596A1 (en) | 2012-11-29 | 2013-11-27 | MONOCLONAL ANTIBODIES AGAISNT ACTIVATED PROTEIN C (aPC) |
Country Status (18)
| Country | Link |
|---|---|
| US (1) | US20150307625A1 (https=) |
| EP (1) | EP2925351A4 (https=) |
| JP (1) | JP2016501230A (https=) |
| KR (1) | KR20150088869A (https=) |
| CN (1) | CN104812402A (https=) |
| AR (1) | AR093671A1 (https=) |
| AU (1) | AU2013352159A1 (https=) |
| BR (1) | BR112015012414A2 (https=) |
| CA (1) | CA2892750A1 (https=) |
| HK (1) | HK1212896A1 (https=) |
| IL (1) | IL238658A0 (https=) |
| MX (1) | MX2015006424A (https=) |
| RU (1) | RU2015125349A (https=) |
| SG (1) | SG11201503719WA (https=) |
| TW (1) | TW201429992A (https=) |
| UY (1) | UY35154A (https=) |
| WO (1) | WO2014085596A1 (https=) |
| ZA (1) | ZA201504659B (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180326053A1 (en) * | 2015-11-17 | 2018-11-15 | Bayer Healthcare, Llc | Epitope of optimized humanized monoclonal antibodies against activated protein c and uses thereof |
| EP3831843A1 (en) * | 2019-12-08 | 2021-06-09 | Royal College Of Surgeons In Ireland | A hemostatic agent and uses thereof |
| CN115611986A (zh) * | 2021-07-13 | 2023-01-17 | 上海莱士血液制品股份有限公司 | 针对人活化蛋白c的单克隆抗体及其制备和应用 |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116496394B (zh) * | 2022-01-26 | 2024-07-23 | 东莞市朋志生物科技有限公司 | 抗s100蛋白的抗体、检测s100蛋白的试剂和试剂盒 |
| JP2025509184A (ja) * | 2022-03-04 | 2025-04-11 | コアグラント・セラピューティクス・コーポレイション | 活性化されたタンパク質cに対するラクダ科抗体及びその使用 |
| CN118370814A (zh) * | 2023-01-20 | 2024-07-23 | 上海莱士血液制品股份有限公司 | 一种抗aPC单克隆抗体的制剂及其应用 |
| US20250002588A1 (en) | 2023-04-07 | 2025-01-02 | Diagonal Therapeutics Inc. | Bispecific agonistic antibodies to activin a receptor like type 1 (alk1) |
| WO2025149667A1 (en) | 2024-01-12 | 2025-07-17 | Pheon Therapeutics Ltd | Antibody drug conjugates and uses thereof |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003091415A2 (en) * | 2002-04-24 | 2003-11-06 | The Regents Of The University Of California | Fluorobodies and chromobodies: binding ligands with intrinsic fluorescence and color |
| US6838437B2 (en) * | 1996-04-24 | 2005-01-04 | University Of Michigan | Inactivation resistant factor VIII |
| US6989241B2 (en) * | 2000-10-02 | 2006-01-24 | Oklahoma Medical Research Foundation | Assay for rapid detection of human activated protein C and highly specific monoclonal antibody therefor |
| US7244430B2 (en) * | 2004-12-20 | 2007-07-17 | Crucell Holland B.V. | Binding molecules capable of neutralizing West Nile virus and uses thereof |
| US20090110683A1 (en) * | 2007-10-26 | 2009-04-30 | Oklahoma Medical Research Foundation | Monoclonal antibodies against activated protein c |
| US7879322B2 (en) * | 2007-10-12 | 2011-02-01 | Novartis Ag | Compositions and methods for use for antibodies against sclerostin |
| US8039597B2 (en) * | 2007-09-07 | 2011-10-18 | Agensys, Inc. | Antibodies and related molecules that bind to 24P4C12 proteins |
| WO2012007516A1 (en) * | 2010-07-13 | 2012-01-19 | Bioinvent International Ab | Use of antibodies against icam-1 in the treatment of patients with relapsed cancer |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1993009804A1 (en) * | 1991-11-18 | 1993-05-27 | The Scripps Research Institute | Serine protease derived-polypeptides and anti-peptide antibodies, systems and therapeutic methods for inhibiting coagulation |
| US20030226155A1 (en) * | 2001-08-30 | 2003-12-04 | Biorexis Pharmaceutical Corporation | Modified transferrin-antibody fusion proteins |
| GB0309126D0 (en) * | 2003-04-17 | 2003-05-28 | Neutec Pharma Plc | Clostridium difficile focussed antibodies |
| CA2575791A1 (en) * | 2004-08-03 | 2006-02-16 | Dyax Corp. | Hk1-binding proteins |
| DK1979001T3 (da) * | 2005-12-13 | 2012-07-16 | Medimmune Ltd | Bindingsproteiner, der er specifikke for insulinlignende vækstfaktorer og anvendelser deraf |
| GB0903151D0 (en) * | 2009-02-25 | 2009-04-08 | Bioinvent Int Ab | Antibody uses and methods |
| US8926976B2 (en) * | 2009-09-25 | 2015-01-06 | Xoma Technology Ltd. | Modulators |
| GB201013989D0 (en) * | 2010-08-20 | 2010-10-06 | Univ Southampton | Biological materials and methods of using the same |
| EP2640421A4 (en) * | 2010-11-16 | 2014-05-28 | Medimmune Llc | THERAPIES FOR TREATMENTS WITH ANTI-IGF ANTIBODIES |
| US8440797B2 (en) * | 2010-12-06 | 2013-05-14 | Dainippon Sumitomo Pharma Co., Ltd. | Human monoclonal antibody |
| GB201020995D0 (en) * | 2010-12-10 | 2011-01-26 | Bioinvent Int Ab | Biological materials and uses thereof |
-
2013
- 2013-11-27 WO PCT/US2013/072243 patent/WO2014085596A1/en not_active Ceased
- 2013-11-27 RU RU2015125349A patent/RU2015125349A/ru not_active Application Discontinuation
- 2013-11-27 HK HK16100878.9A patent/HK1212896A1/zh unknown
- 2013-11-27 US US14/443,710 patent/US20150307625A1/en not_active Abandoned
- 2013-11-27 KR KR1020157017008A patent/KR20150088869A/ko not_active Withdrawn
- 2013-11-27 CN CN201380062159.XA patent/CN104812402A/zh active Pending
- 2013-11-27 SG SG11201503719WA patent/SG11201503719WA/en unknown
- 2013-11-27 BR BR112015012414A patent/BR112015012414A2/pt not_active IP Right Cessation
- 2013-11-27 EP EP13857869.5A patent/EP2925351A4/en not_active Withdrawn
- 2013-11-27 AU AU2013352159A patent/AU2013352159A1/en not_active Abandoned
- 2013-11-27 CA CA2892750A patent/CA2892750A1/en not_active Abandoned
- 2013-11-27 JP JP2015545438A patent/JP2016501230A/ja active Pending
- 2013-11-27 MX MX2015006424A patent/MX2015006424A/es unknown
- 2013-11-28 UY UY0001035154A patent/UY35154A/es not_active Application Discontinuation
- 2013-11-28 TW TW102143366A patent/TW201429992A/zh unknown
- 2013-11-29 AR ARP130104417A patent/AR093671A1/es unknown
-
2015
- 2015-05-06 IL IL238658A patent/IL238658A0/en unknown
- 2015-06-26 ZA ZA2015/04659A patent/ZA201504659B/en unknown
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6838437B2 (en) * | 1996-04-24 | 2005-01-04 | University Of Michigan | Inactivation resistant factor VIII |
| US6989241B2 (en) * | 2000-10-02 | 2006-01-24 | Oklahoma Medical Research Foundation | Assay for rapid detection of human activated protein C and highly specific monoclonal antibody therefor |
| WO2003091415A2 (en) * | 2002-04-24 | 2003-11-06 | The Regents Of The University Of California | Fluorobodies and chromobodies: binding ligands with intrinsic fluorescence and color |
| US7244430B2 (en) * | 2004-12-20 | 2007-07-17 | Crucell Holland B.V. | Binding molecules capable of neutralizing West Nile virus and uses thereof |
| US8039597B2 (en) * | 2007-09-07 | 2011-10-18 | Agensys, Inc. | Antibodies and related molecules that bind to 24P4C12 proteins |
| US7879322B2 (en) * | 2007-10-12 | 2011-02-01 | Novartis Ag | Compositions and methods for use for antibodies against sclerostin |
| US20090110683A1 (en) * | 2007-10-26 | 2009-04-30 | Oklahoma Medical Research Foundation | Monoclonal antibodies against activated protein c |
| WO2012007516A1 (en) * | 2010-07-13 | 2012-01-19 | Bioinvent International Ab | Use of antibodies against icam-1 in the treatment of patients with relapsed cancer |
Non-Patent Citations (3)
| Title |
|---|
| GALE, AJ ET AL.: "Nonenzymatic Anticoagulant Activity Of The Mutant Serine Protease Ser360Ala-Activated Protein C Mediated By Factor Va.", PROTEIN SCIENCE, vol. 6, 1997, pages 132 - 140, XP002902362 * |
| PRESTON, RJ ET AL.: "Multifunctional Specificity of the Protein C/Activated Protein C Gla Domain", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 281, 25 July 2006 (2006-07-25), pages 28850 - 28857, XP002509048, DOI: doi:10.1074/jbc.m604966200 * |
| See also references of EP2925351A4 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180326053A1 (en) * | 2015-11-17 | 2018-11-15 | Bayer Healthcare, Llc | Epitope of optimized humanized monoclonal antibodies against activated protein c and uses thereof |
| US11077187B2 (en) * | 2015-11-17 | 2021-08-03 | Oklahoma Medical Research Foundation | Epitope of optimized humanized monoclonal antibodies against activated protein C and uses thereof |
| EP3831843A1 (en) * | 2019-12-08 | 2021-06-09 | Royal College Of Surgeons In Ireland | A hemostatic agent and uses thereof |
| WO2021115886A1 (en) | 2019-12-08 | 2021-06-17 | Royal College Of Surgeons In Ireland | A hemostatic agent and uses thereof |
| CN115611986A (zh) * | 2021-07-13 | 2023-01-17 | 上海莱士血液制品股份有限公司 | 针对人活化蛋白c的单克隆抗体及其制备和应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| TW201429992A (zh) | 2014-08-01 |
| HK1212896A1 (zh) | 2016-06-24 |
| CA2892750A1 (en) | 2014-06-05 |
| US20150307625A1 (en) | 2015-10-29 |
| AR093671A1 (es) | 2015-06-17 |
| BR112015012414A2 (pt) | 2017-09-12 |
| CN104812402A (zh) | 2015-07-29 |
| EP2925351A4 (en) | 2016-08-24 |
| EP2925351A1 (en) | 2015-10-07 |
| JP2016501230A (ja) | 2016-01-18 |
| AU2013352159A1 (en) | 2015-06-04 |
| UY35154A (es) | 2014-06-30 |
| KR20150088869A (ko) | 2015-08-03 |
| ZA201504659B (en) | 2017-11-29 |
| IL238658A0 (en) | 2015-06-30 |
| RU2015125349A (ru) | 2017-01-10 |
| MX2015006424A (es) | 2015-08-14 |
| SG11201503719WA (en) | 2015-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2733075C (en) | Monoclonal antibodies against tissue factor pathway inhibitor (tfpi) | |
| US20150307625A1 (en) | MONOCLONAL ANTIBODIES AGAINST ACTIVATED PROTEIN C (aPC) | |
| JP6559188B2 (ja) | 組織因子経路インヒビター(tfpi)に対するモノクローナル抗体 | |
| JP2018038398A (ja) | 組織因子経路インヒビター(tfpi)に対するモノクローナル抗体 | |
| JP6848016B2 (ja) | 組織因子経路インヒビター(tfpi)に対するモノクローナル抗体 | |
| AU2013202752B2 (en) | Monoclonal antibodies against tissue factor pathway inhibitor (TFPI) | |
| JP6419664B2 (ja) | 組織因子経路インヒビター(tfpi)に対するモノクローナル抗体 | |
| AU2016269554B2 (en) | Optimized monoclonal antibodies against tissue factor pathway inhibitor (TFPI) | |
| HK40017507A (en) | Monoclonal antibodies against tissue factor pathway inhibitor (tfpi) | |
| HK40017438A (en) | Monoclonal antibodies against tissue factor pathway inhibitor (tfpi) | |
| JP2018108089A (ja) | 組織因子経路インヒビター(tfpi)に対するモノクローナル抗体 | |
| HK1156635A (en) | Monoclonal antibodies against tissue factor pathway inhibitor (tfpi) | |
| HK1226645A (en) | Monoclonal antibodies against tissue factor pathway inhibitor (tfpi) | |
| HK1226645A1 (en) | Monoclonal antibodies against tissue factor pathway inhibitor (tfpi) | |
| HK1156635B (en) | Monoclonal antibodies against tissue factor pathway inhibitor (tfpi) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13857869 Country of ref document: EP Kind code of ref document: A1 |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013857869 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013857869 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 238658 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14443710 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2015/006424 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2892750 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2015545438 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2013352159 Country of ref document: AU Date of ref document: 20131127 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015012414 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20157017008 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2015125349 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112015012414 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150528 |