WO2014077646A1 - 수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트 - Google Patents

수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트 Download PDF

Info

Publication number
WO2014077646A1
WO2014077646A1 PCT/KR2013/010465 KR2013010465W WO2014077646A1 WO 2014077646 A1 WO2014077646 A1 WO 2014077646A1 KR 2013010465 W KR2013010465 W KR 2013010465W WO 2014077646 A1 WO2014077646 A1 WO 2014077646A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
seq
type
waterborne
symptom
Prior art date
Application number
PCT/KR2013/010465
Other languages
English (en)
French (fr)
Inventor
백순영
오미화
강래형
Original Assignee
가톨릭대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭대학교 산학협력단 filed Critical 가톨릭대학교 산학협력단
Publication of WO2014077646A1 publication Critical patent/WO2014077646A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/706—Specific hybridization probes for hepatitis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a primer for detecting a waterborne virus and a detection kit including the same, more specifically, a norovirus, a Rotavirus, a Coxsackie virus, and a hepatitis A virus. virus) and a primer and probe that can detect the real time polymerase chain reaction (Real time-PCR).
  • a primer for detecting a waterborne virus and a detection kit including the same, more specifically, a norovirus, a Rotavirus, a Coxsackie virus, and a hepatitis A virus. virus
  • Real time-PCR real time polymerase chain reaction
  • Waterborne infection is a disease transmitted by water contaminated with pathogenic microorganisms and refers to an infectious disease caused by humans ingesting water contaminated with pathogenic microorganisms.
  • Water-borne infectious diseases cause causative pathogenic microorganisms to enter the stomach and intestine through the mouth, proliferate in the gastrointestinal tract, inflamed and excreted in the feces (fecal-oral propagation pathway). see.
  • waterborne viruses that are popular in Korea include norovirus, rotavirus, coxsackievirus, hepatitis A virus, and the like.
  • Norovirus is a representative winter food poisoning pathogen, and it has been reported that more than 50% of waterborne and foodborne food poisoning accidents occurred between 2007 and 2009.
  • the main symptoms are nausea, vomiting, abdominal pain, diarrhea, fever, etc.
  • the elderly or patients die from severe dehydration.
  • the path of infection is so diverse that personal contact, feces, oral, aerosol infections and contaminated water and food infections are all possible.
  • Varieties of viruses are also diverse, and simultaneous infection by two or more varieties of noroviruses is common, especially due to shellfish contamination or contaminated water.
  • the reason why the virus spreads well is because small amounts of infection are easily caused by microscopic droplets, clothing or bedding, human-to-human propagation, and environmental pollution, and secondary and tertiary infections caused by family members or by humans. happenss.
  • Rotavirus is a cause of rotavirus enteritis, which causes more than 600,000 deaths per year worldwide, and mainly infects infants under five years of age.
  • the main symptom is dehydration due to acute diarrheal diseases. Patients in developing and developing countries have a high mortality rate because they do not receive adequate water for dehydration symptoms. In Korea, the virus is regularly reported to the surveillance system operated by the Centers for Disease Control and Prevention.
  • Coxsackieviruses are also a common oral infection in the summer and are prevalent among infants. Symptoms include gastrointestinal symptoms such as fever, vomiting and diarrhea, such as airway diseases such as pharyngitis or bronchitis, aseptic meningitis, central nervous system diseases such as encephalitis or paralysis, mucosal or skin rash, myositis or conjunctivitis There is also.
  • Hepatitis A virus is also a waterborne virus that causes mild gastrointestinal symptoms such as jaundice, severe abdominal pain, vomiting and diarrhea. In developed countries with good hygiene, infections are rapidly increasing. In Korea, the number of patients increased 19 times compared to 2005, and the number of patients rapidly increased to 789 in 2005, 2,081 in 2006, 2,233 in 2007, 7,895 in 2008, and 15,041 in 2009. It is increasing. Water-borne viruses usually occur in people with poor immunity, such as infants and the elderly, but hepatitis A virus is the most common in the 20s and 30s age group with 79%.
  • Waterborne epidemics are an important disease in terms of public health, as many patients can develop and explode at the same time. In order to prevent further development and to treat patients early, it is necessary to quickly identify the causative agent. However, the symptoms of water-borne infectious diseases are usually similar, so that the causative agent is difficult to identify. In addition, pathogenic microorganisms that cause water-borne infectious diseases include bacteria, viruses, protozoa, etc. Among these, viruses are difficult to detect due to their small size and severe mutation of genes and antigens. Although primers capable of performing real-time polymerase chain reaction for each waterborne virus have been reported, in order to enable rapid detection of a causative agent, primers of real-time PCR and identification of a variety of causal agents can be identified in one sample. Probes must be developed.
  • the present inventors are studying a method for detecting and identifying a causative agent of water-borne infectious diseases showing gastrointestinal tract symptoms, the present inventors focus on the fact that rapid causative agent detection and differential diagnosis are possible if the representative causal agents can be detected at the same time.
  • the present invention was completed by designing a primer and a probe capable of selecting viruses and detecting them simultaneously.
  • the present invention has been made in view of the above, and an object of the present invention is to provide a composition and kit for identifying waterborne viruses comprising primers and probes for four representative waterborne viruses.
  • the present invention provides polynucleotides set forth in SEQ ID NO: 1 to SEQ ID NO: 8 as intestinal symptom-induced waterborne virus specific primers, and
  • intestinal symptomatic induced waterborne virus specific probes comprising a polynucleotide described in SEQ ID NOs: 9 to 12.
  • the enteric symptom-induced waterborne virus is norovirus type I, norovirus type II, rotavirus G-type, rotavirus P-type, coxsackie virus type I and hepatitis A virus. It is preferably one or more viruses selected from the group consisting of, but is not limited to these.
  • the primers and probes are specific for norovirus type I, norovirus type II, rotavirus G-type, rotavirus P-type, coxsackievirus type I and hepatitis A virus, respectively. It has the following characteristics:
  • Norovirus type I and type II are identified by a primer pair consisting of a polynucleotide described by SEQ ID NO: 1 and SEQ ID NO: 2 and a probe described by SEQ ID NO: 9,
  • rotavirus G- and P-genotypes are identified by primer pairs consisting of polynucleotides set forth in SEQ ID NO: 3 and SEQ ID NO: 4 and probes described in SEQ ID NO: 10,
  • coxsackievirus type I is identified by a primer pair consisting of a polynucleotide described by SEQ ID NO: 5 and SEQ ID NO: 6 and a probe described by SEQ ID NO: 11, and
  • Hepatitis A virus is identified as a primer pair consisting of a polynucleotide described by SEQ ID NO: 7 and SEQ ID NO: 8 and a probe described by SEQ ID NO: 12.
  • the fluorescent material and the quencher are attached to both ends of the base sequence serving as the probe.
  • the fluorescent material may be used FAM, ROX, HEX or TYE705
  • the quencher may be used BHQ1, BHQ2 or IABkFQ, but is not limited thereto.
  • Hepatitis A virus has a variety of types, the most common of which is type IA, IIA, IIIA.
  • the primers and probes of the present invention can detect all types of hepatitis A virus, including these types.
  • the present invention also relates to a norovirus type I, a norovirus type II, a rotavirus G-type, a rotavirus, comprising a primer set forth in SEQ ID NO: 1 to SEQ ID NO: 8 and a probe set forth in SEQ ID NO: 9 to SEQ ID NO: 12
  • enteric symptom-inducing waterborne virus identification kits are selected from the group consisting of P-genic, coxsackievirus type I and hepatitis A viruses.
  • the present invention comprises the step of performing a real-time polymerase chain reaction from the sample taken from the sample using the composition comprising the primer and probe, norovirus type I, norovirus type II, rotavirus G-type
  • a real-time polymerase chain reaction from the sample taken from the sample using the composition comprising the primer and probe, norovirus type I, norovirus type II, rotavirus G-type
  • enteric symptomatic induced waterborne viruses selected from the group consisting of a rotavirus P-genotype, coxsackievirus type I and hepatitis A virus.
  • the step of performing the real-time polymerase chain reaction is performed by:
  • It may include, but is not limited to, performing 30 to 45 cycles at 95 ° C. for 10 seconds and 55 ° C. to 60 ° C. for 45 seconds.
  • compositions and kits containing the primers of the present invention allow for the detection of four representative waterborne viruses in one sample, which is very effective in terms of time and cost. Therefore, it is expected to be an important application for the rapid and accurate identification of the causative virus in patients with intestinal symptoms.
  • 1 is a diagram comparing the sensitivity with Conventional PCR using Hepatitis A virus, the upper part is confirmed the detection limit by performing real-time PCR, the lower part is confirmed by the electrophoresis by performing the conventional PCR.
  • NV (+), HRV (+), HAV (+) and CVB (+) represents a control
  • NV SAMPLE, HAV SAMPLE, HRV SAMPLE and CVB SAMPLE represent sample samples.
  • fecal suspension 50 mg was suspended in 500 ⁇ l of PBS, and the suspension was vigorously vortexed for 30 minutes and then centrifuged for 10 minutes at 10,000 rpm in a micro-centrifuge. After extracting 140 ⁇ l of the supernatant, viral RNA was extracted with a Qiagen viral RNA mini kit, and finally made into 80 ⁇ l of Viral RNA solution and stored at -70 ° C.
  • Groundwater and river water were used as environmental samples. 500-1,000 L of groundwater and river water were adsorbed on 1 MDS (Cuno) filter, then desorbed using 1.5% Beef extract, and the virus was concentrated by acid concentration. The final concentration of 20 ⁇ 30 ml was filtered by membrane filter and sterilization, 140 ⁇ l viral RNA was extracted with Qiagen viral RNA mini kit as in the clinical sample. Finally, 80 ⁇ l of Viral RNA solution was prepared and stored at -70 ° C.
  • Buffer AVL containing Carrier RNA 560 ⁇ l was added to a 1.5 mL tube, and then 100-140 ⁇ l of the sample was pulse-vortexed for 15 seconds. After standing at room temperature for 10 minutes, spin-down was performed lightly, 560 ⁇ l of ethanol (96-100%) was added, mixed for 15 seconds, and spin-down again. The mixed sample was placed in a QIAamp Mini spin column, followed by an RNA adsorption step of centrifugation at 6,000 xg for 1 minute. 500 ⁇ l of Buffer AW1 was added thereto and centrifuged at 6,000 ⁇ g for 1 minute.
  • Standard RT reactions were performed in a buffer (50 mM Tris-HCl; pH 8.3, 75 mM KCl, 10 mM DTT, 3 mM MgCl 2 , 0.5 mM dNTP) for 42 ° C., 50 minutes.
  • nucleotide sequences of viruses isolated from clinical samples and environmental samples isolated in Examples 1 and 2 were obtained from NCBI, EMBL, and DDBJ. Based on the obtained sequences, primers and probes were selected from the conserved regions of the viral genome using Beacon Designer software version 5.1 (Premier Biosoft International, USA) and PrimerQuest website (Integrated DNA technologies, USA). The information of each primer and probe is as follows.
  • Norovirus is genogroup I (GI-1 to GI-8), Genogroup II, which is infected by humans from the outermost P2 domain of the capsid region constituting ORF2 among the entire genome (7.6 kb) consisting of ORF1, ORF2, and ORF3.
  • Primers and probes capable of detecting both GI and G II were designed with a size of 40-70 bp by analyzing the nucleotide sequence specific for (GII-1 to GII-17).
  • Rotavirus is an 11-segment double-stranded RNA virus.
  • VP4 (P) and VP7 (G) are located at the outermost part of rotavirus and are important sites for genotyping.
  • Rotaviruses reported to date are known to be G-type G1-G16 and P-type P1-P27. Therefore, primers and probes capable of detecting both G- and P-types by analyzing specific sequences of each type were designed with a size of 40 to 70 bp.
  • Coxsackie virus is a nucleotide sequence specific for VP1, and designed primers and probes capable of detecting coxsackie virus type I.
  • Hepatitis A virus is a nucleotide sequence specific for the VP1 / 2A site, and designed primers and probes capable of detecting all types of hepatitis A virus.
  • melting temperature or secondary structure was calculated using Beacon Designer software version 5.1 (Premier Biosoft International, USA) program.
  • the conserved site of each virus was selected as the primer and probe of the present invention by reflecting the calculated Tm value, reaction time, and temperature conditions.
  • a fluorescent substance and a quencher were attached.
  • Table 1 is a table showing the nucleotide sequences of the prepared primers and probes.
  • the detection efficiencies of the forward and reverse primers were both excellent at 750 nM concentration, this concentration was used as the final concentration of the primer, and multiplex real time PCR was optimized at 750 nM.
  • the detection efficiency was optimal at concentrations above 100 nM, so the ideal concentration of each virus was chosen to be above 100 nM.
  • RNA transcript of each virus was produced, and then the RNA transcript was diluted in multiples of 10 times.
  • the virus RNA samples thus prepared were subjected to real-time PCR using the primers and probes of the present invention to confirm detection limits. The results are shown at the top of FIG.
  • RNA transcript was diluted by 10-fold step by step and the detection limit was confirmed by conventional reverse transcription PCR by applying the primer and probe of the present invention. The results are shown at the bottom of FIG. 1.
  • the detection limit of 2.8 ⁇ 10 7 was shown in conventional PCR, but the detection limit of 2.8 ⁇ 10 5 was shown in Multiplex real-time PCR. Therefore, it can be seen that the detection limit is superior to 10 2 by Multiplex real-time PCR.
  • multiplex PCR analysis for simultaneous detection of virus was performed. Multiplex PCR reactions were performed in such a way as to minimize the decrease in sensitivity due to the multiplex procedure.
  • the reaction conditions included 39 cycles of denaturation (10 seconds at 95 ° C.) and annealing / extension (30 seconds at 60 ° C.) after incubation at 95 ° C. for 3 minutes, and the MyiQ and CFX96 real-time detection systems (Bio -Rad).
  • the monoplex method has less inhibitory factors such as dimer formation due to one virus reacting to a pair of primers, whereas the multiplex method tends to be less sensitive due to the introduction of several pairs of primers and various viruses. Since the present invention is characterized by being able to identify several viruses in one sample, the following experiment was performed to confirm whether high sensitivity is maintained even when multiplex real-time PCR is performed.
  • Viral RNA was isolated from positive fecal samples for each target and the cDNA synthesized. The sensitivity of the multiplex assay and the individual PCR reactions were then compared by four replicate analysis of the stepwise 10-fold dilutions of cDNA.
  • the primers and probes of the present invention obtained excellent sensitivity similar to Monoplex PCR even in Multiplex PCR. This means that the primers and probes of the present invention are designed to minimize the inhibitory factors that may occur when performing the Multiplex method. Viruses not listed in Table 3 can also be easily inferred by those skilled in the art because they are designed in the same manner as the viruses identified in Table 3 and have the same effect.
  • a panel of parasitic, bacterial and viral pathogens that could potentially be present in fecal samples was used to assess the specificity of multiplex real-time PCR analysis.
  • the panel is Escherichia coli, Bacillus cereus, Bacillus subtilis, Vibrio parahaemolyticus, Clostridium difficile, Clostridium Clostridium perfringens, Salmonella enteritidis, Listeria monocytogenes, Staphylococcus aureus and enterovirus 71 were included.
  • RT-PCR A retrospective clinical evaluation of conventional RT-PCR analysis was performed using a total of 227 fecal samples from 227 patients.
  • One-step comprising primers (GIFIM, GIRIM), (GIIFIM, GIIRIM) and (ddrv-1, ddrv-2) based on the sequences of the NV ORF2 and HRV VP7 regions to detect NV GI, NV GII and HRV Reverse transcription PCR (RT-PCR) was performed using the RT-PCR kit (Qiagen) (see Table 3). 5 ml of viral RNA was used as template, which was combined with 20 ml of premix kit solution. PCR was performed in a PCR System S1000 TM thermal cycler (Bio-Rad, USA).
  • the PCR protocol was as follows: PCR activation for 15 minutes at 95 ° C. after the initiation RT step for 30 minutes at 50 ° C .; Amplification of 35 cycles of 30 seconds at 94 ° C., 30 seconds at 56 ° C. and 30 seconds at 72 ° C .; Final extension step of 5 minutes at 72 ° C.
  • the PCR product was then electrophoresed on a 1.5% agarose gel and stained with ethidium bromide.
  • NV GI, NVGII, HRV, HAV and CVB were detected in, 46 (20%), 10 (4.5%) and 8 (3.5%) samples (Table 4).
  • the detection efficiencies in Monoplex and Multiplex real-time PCR were nearly identical, and the C T values in the two methods were approximately 1-2.
  • a performs conventional RT-PCR only
  • b performs only Multiplex real-time PCR

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Communicable Diseases (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트에 관한 것으로서, 보다 구체적으로는 노로바이러스, 로타바이러스, 콕사키바이러스, A형 간염 바이러스를 실시간 중합효소 연쇄반응으로 검출할 수 있는 프라이머 및 프로브에 관한 것이다. 본 발명의 프라이머 및 프로브를 함유하는 조성물 및 키트를 이용하면 하나의 샘플에서 4가지의 대표적인 수인성 바이러스를 검출할 수 있게 되므로, 장관 증상을 보이는 환자 발생시에 원인이 되는 바이러스를 신속, 정확하게 동정하는데 유용하게 사용될 수 있다.

Description

수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트
본 발명은 수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트에 관한 것으로, 보다 구체적으로는 노로바이러스(Norovirus), 로타바이러스(Rotavirus), 콕사키바이러스(Coxsackie virus) 및 A형 간염 바이러스(Hepatitis A virus)를 실시간 중합효소 연쇄반응(Real time-PCR)로 검출할 수 있는 프라이머 및 프로브에 관한 것이다.
수인성 전염병(Waterborne infection)은 병원성 미생물이 오염된 물에 의해서 전달되는 질병으로 인간이 병원성 미생물에 오염된 물을 섭취하여 발병하는 감염병을 말한다. 수인성 전염병은 원인 병원성 미생물이 입을 통해 위와 장으로 들어가 주로 위장관에서 증식을 하면서 염증을 일으키며 분변으로 배출되는데(분변-경구 전파경로), 주로 복통, 설사, 오심, 구토 등의 위장관과 관련된 증상을 보인다.
국내에서 유행하는 수인성 바이러스 중 대표적인 것들로서는 노로바이러스, 로타바이러스, 콕사키바이러스, A형 간염 바이러스 등이 있다.
노로바이러스는 대표적인 겨울철 식중독 유발 병원체로서, 2007년에서 2009년 사이에 발생한 수인성 및 식품매개 식중독사고의 50% 이상의 원인이 되었다고 보고되었다. 주요 증세는 오심, 구토, 복통, 설사, 발열 등인데, 드물지만 노인이나 환자 등에서 심한 탈수현상으로 사망하는 경우도 있다. 감염 경로가 매우 다양하여, 개인간의 접촉, 분변, 경구, 에어로졸 감염과 오염된 물 및 음식을 통한 감염 등이 모두 가능하다. 바이러스의 변종 또한 다양하며, 어패류 오염이나 오염된 물로 인한 경우 2가지 이상의 변종 노로바이러스에 의한 동시 감염도 흔하다. 바이러스가 잘 확산되는 이유는 소량으로 감염되기 때문에 미세 물방울, 의복이나 침구, 인간 대 인간의 전파, 그리고 주변 환경오염에 의한 감염이 쉽게 일어나며 가족이나 주변인간에 의한 2차 감염, 3차 감염도 많이 일어난다.
로타바이러스는 전 세계적으로 연 60만명 이상의 사망 원인이 되는 로타바이러스 장염의 원인체로써, 주로 5세 미만의 영아들에게 감염된다. 주요한 증상은 급성설사질환으로 인한 탈수인데, 개발도상국 및 후진국의 환자들은 탈수 증상 시 적절한 수분을 공급받지 못해 치사율이 높다. 우리나라에서도 질병관리본부가 운영중인 감시시스템에 주기적으로 보고되고 있는 바이러스이다.
콕사키바이러스도 여름에 주로 경구감염으로 유유아(乳幼兒) 사이에 만연하는 바이러스이다. 증상은 발열 및 구토, 설사 등 위장관 증세가 대표적인데, 인두염이나 기관지염등의 기도질환, 무균성 수막염, 뇌염이나 마비 등의 중추신경질환, 점막이나 피부의 발진성 질환, 근염이나 결막염으로 진행하는 경우도 있다.
A형 간염바이러스 역시 수인성 바이러스로서, 감염시 가벼운 감기 증세, 황달이나 심한 복통, 구토, 설사와 같은 위장관 증세를 보인다. 위생 상태가 좋은 선진국에서도 감염이 급증하는 추세에 있어 크게 문제가 되고 있다. 우리나라의 경우 2009년에 2005년과 대비하여 19배 증가하였으며, 환자수는 2005년에 789명, 2006년에 2,081명,2007년에 2,233명, 2008년에 7,895명, 2009년에 15,041명으로 급속히 증가하고 있다. 수인성 바이러스는 유아나 노인 등 면역력이 취약한 연령층에서 발병하는 것이 일반적이나, A형 간염바이러스는 특이하게도 20∼30대 연령층이 79%로 가장 많은 발생률을 차지하였다.
수인성 전염병은 같은 시기에 다수의 환자가 발생하여 폭발적으로 유행할 수 있어 공중보건학 측면에서 중요한 질환이다. 추가적인 발생을 막고 환자들을 조기에 치료하기 위해서는 원인체 규명이 신속하게 이루어질 필요가 있는데, 수인성 전염병의 증상이 대개 유사하여 원인체 규명이 쉽지 않다. 또한 수인성 전염병을 일으키는 병원성 미생물들에는 세균, 바이러스, 원충 등이 있는데, 이 중에서 특히 바이러스는 크기가 작고 유전자와 항원의 변이가 심하여 검출이 어렵다. 각각의 수인성 바이러스에 대해 실시간 중합효소 연쇄반응을 수행할 수 있는 프라이머들에 대해서는 보고되어 있으나, 실제로 신속한 원인체 검출이 가능하려면 하나의 샘플에서 여러 종류의 원인체를 동정할 수 있도록 실시간 PCR의 프라이머 및 프로브가 개발되어야 한다.
본 발명자들은 위장관 증세를 보이는 수인성 전염병의 원인체를 검출하고 동정하는 방법에 대해 연구하던 중, 대표적인 원인체들을 동시에 검출할 수 있다면 신속한 원인체 검출 및 감별진단이 가능하다는 것에 착안하여 4가지의 대표적인 수인성 바이러스를 선정하고 이들을 동시에 검출할 수 있는 프라이머와 프로브를 디자인하여 본 발명을 완성하게 되었다.
본 발명은 상기와 같은 배경에서 안출된 것으로, 4가지의 대표적인 수인성 바이러스에 대한 프라이머 및 프로브를 포함하는 수인성 바이러스 동정용 조성물 및 키트를 제공함을 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
본 발명은 장관 증상 유발 수인성 바이러스 특이적 프라이머로서 서열번호 1 내지 서열번호 8로 기재되는 폴리뉴클레오티드, 및
장관 증상 유발 수인성 바이러스 특이적 프로브로서 서열번호 9 내지 서열번호 12로 기재되는 폴리뉴클레오티드를 포함하는 장관 증상 유발 수인성 바이러스 동정용 조성물을 제공한다.
본 발명의 한 구현예에 따르면, 상기 장관 증상 유발 수인성 바이러스는 노로바이러스 type I, 노로바이러스 type Ⅱ, 로타바이러스 G-유전자형, 로타바이러스 P-유전자형, 콕사키바이러스 type I 및 A형 간염 바이러스로 이루어진 군으로부터 선택되는 하나 이상의 바이러스인 것이 바람직하지만 이에 한정되는 것은 아니다.
본 발명의 다른 구현예에 따르면, 상기 프라이머 및 프로브는 각각 노로바이러스 type I, 노로바이러스 type Ⅱ, 로타바이러스 G-유전자형, 로타바이러스 P-유전자형, 콕사키바이러스 type I 및 A형 간염 바이러스에 특이적이며, 다음과 같은 특징을 갖는다:
(1) 노로바이러스 type I 및 type Ⅱ는 서열번호 1 및 서열번호 2로 기재되는 폴리뉴클레오티드로 구성된 프라이머 쌍 및 서열번호 9로 기재되는 프로브로 동정되고,
(2) 로타바이러스 G-유전자형 및 P-유전자형은 서열번호 3 및 서열번호 4로 기재되는 폴리뉴클레오티드로 구성된 프라이머 쌍 및 서열번호 10으로 기재되는 프로브로 동정되고,
(3) 콕사키바이러스 type I은 서열번호 5 및 서열번호 6으로 기재되는 폴리뉴클레오티드로 구성된 프라이머 쌍 및 서열번호 11로 기재되는 프로브로 동정되고, 및
(4) A형 간염 바이러스는 서열번호 7 및 서열번호 8로 기재되는 폴리뉴클레오티드로 구성된 프라이머 쌍 및 서열번호 12로 기재되는 프로브로 동정된다.
또한, 본 발명의 한 구현예에 따르면, 프로브가 되는 염기서열의 양 끝에는 형광물질과 quencher이 각각 부착되어 있는 것이 바람직하다. 본 발명의 바람직한 구현예에 따르면, 상기 형광물질은 FAM, ROX, HEX 또는 TYE705이 사용될 수 있고, 상기 quencher는 BHQ1, BHQ2 또는 IABkFQ이 사용될 수 있으나 이에 한정되는 것은 아니다.
A형 간염 바이러스는 다양한 type이 있으며, 대표적인 것은 type IA, ⅡA, ⅢA에 해당한다. 본 발명의 프라이머 및 프로브는 이들 type을 포함해서 모든 type의 A형 간염 바이러스를 검출할 수 있다.
또한, 본 발명은 서열번호 1 내지 서열번호 8로 기재되는 프라이머 및 서열번호 9 내지 서열번호 12로 기재되는 프로브를 포함하는, 노로바이러스 type I, 노로바이러스 type Ⅱ, 로타바이러스 G-유전자형, 로타바이러스 P-유전자형, 콕사키바이러스 type I 및 A형 간염 바이러스로 이루어진 군으로부터 선택되는 하나 이상의 장관 증상 유발 수인성 바이러스 동정용 키트를 제공한다.
또한, 본 발명은 상기 프라이머 및 프로브를 포함하는 조성물을 이용하여 검체로부터 채취한 시료로부터 실시간 중합효소 연쇄반응을 수행하는 단계를 포함하는, 노로바이러스 type I, 노로바이러스 type Ⅱ, 로타바이러스 G-유전자형, 로타바이러스 P-유전자형, 콕사키바이러스 type I 및 A형 간염 바이러스로 이루어진 군으로부터 선택되는 하나 이상의 장관 증상 유발 수인성 바이러스를 동정하는 방법을 제공한다.
본 발명의 바람직한 구현예에 따르면, 상기 실시간 중합효소 연쇄반응을 수행하는 단계는,
95℃에서 2분 동안 1 cycle을 수행하는 단계; 및
95℃에서 10초간, 55℃ 내지 60℃에서 45초간 30 내지 45 cycle을 수행하는 단계를 포함할 수 있지만 이에 한정되는 것은 아니다.
본 발명의 프라이머를 함유하는 조성물 및 키트를 이용하면 하나의 샘플에서 4가지의 대표적인 수인성 바이러스를 검출할 수 있게 되므로 시간 및 비용적인 측면에서 매우 효과적이다. 따라서 장관 증상을 보이는 환자 발생시에 원인이 되는 바이러스를 신속, 정확하게 동정하는 데 중요하게 응용될 수 있을 것으로 기대된다.
도 1은 Hepatitis A virus를 사용한 Conventional PCR 과의 민감도를 비교한 도면으로서, 상단은 실시간 PCR을 수행하여 검출한계를 확인한 것이고, 하단은 Conventional PCR을 수행하여 전기영동으로 검출한계를 확인한 것이다.
도 2는 본 발명의 조성물을 이용한 Multiple 실시간 PCR의 특이도를 보여주는 그래프로서, NV(+), HRV(+), HAV(+) 및 CVB(+)는 대조군을 나타내고, NV SAMPLE, HAV SAMPLE, HRV SAMPLE 및 CVB SAMPLE은 샘플 시료를 나타낸다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
실시예 1. 양성시료의 수집
2006년 11월부터 2012년 5월까지 118명의 환자 유래의 118개의 분변(stool 샘플을 경기도 보건환경연구원으로부터 입수하였다. 또한, 임상시료로서 분변) 샘플을 2006년 2월에 서울에서 급성 위장염(gastroenteritis)에 걸린 109명의 1살 환자들로부터 채집하였다. 상기 샘플들은 수인성 바이러스 소재 은행(Waterborne Virus Bank, Seoul, Korea)으로부터 입수하였다.
분변 50 ㎎을 PBS 500 ㎕에 현탁시켰고, 이 현탁액을 강하게 30분간 볼텍스(vortex)한 후, micro-centrifuge에서 10,000 rpm에서 10분간 원심분리하였다. 상등액 140 ㎕를 채취하여 Qiagen viral RNA mini kit로 viral RNA를 추출하고, 최종적으로 80㎕의 Viral RNA 용액으로 만들어 -70℃에 보관하였다.
환경시료로는 지하수 및 하천수를 사용하였다. 지하수 및 하천수 500∼1,000 L를 1 MDS(Cuno) 필터에 흡착시킨 후, 1.5% Beef extract를 이용하여 탈리하였고, 산 농축법에 의해 바이러스를 농축하였다. 최종 농축한 20∼30 ㎖을 membrane 필터로 여과하여 제균하였고, 임상시료와 마찬가지로 140 ㎕를 Qiagen viral RNA mini kit로 viral RNA를 추출하였다. 최종적으로 80 ㎕의 Viral RNA 용액으로 만들어 -70℃에 보관하였다.
실시예 2. Viral RNA 단리 및 cDNA 합성
Carrier RNA을 포함한 560 ㎕의 Buffer AVL을 1.5 ㎖ tube에 넣은 후, 시료 100∼140 ㎕을 넣고 15초 동안 pulse-vortex 하였다. 실온에서 10분 동안 정치한 후 가볍게 spin-down 하였고, 에탄올(96-100%) 560 ㎕을 넣고 15초 동안 혼합한 후 다시 spin-down 시켰다. 혼합된 시료를 QIAamp Mini spin column에 넣은 후, 6,000 x g에서 1분 동안 원심분리하는 RNA 흡착 단계를 수행하였다. 여기에 Buffer AW1 500 ㎕을 넣고, 6,000 x g에서 1분 동안 원심분리하였다. QIAamp spin column을 새로운 2 ㎖ 튜브에 옮긴 후 Buffer AW2 500 ㎕을 넣고, 20,000 x g에서 3분 동안 원심분리하였다. 다시 QIAamp spin column을 최대속도로 1분간 원심분리한 후, 1.5 ㎖ 튜브에 QIAamp spin column을 옮겼고, Buffer AVE 약 60 ㎕을 주입하고 1분 동안 정치한 후, 6,000 x g에서 1분 동안 원심분리하여 바이러스 RNA을 얻었다. 얻어진 RNA는 즉시 사용하거나 -70℃에 보관하였다. iScript™ cDNA 합성 키트(Bio-Rad, USA)를 이용하여 상기 추출된 RNA 10 ㎕에 대한 cDNA를 합성하였다. 표준 RT 반응은 버퍼(50 mM Tris-HCl; pH 8.3, 75 mM KCl, 10 mM DTT, 3 mM MgCl2, 0.5 mM dNTP)에서 42℃, 50분 동안 수행하였다.
실시예 3. Primer 및 probe 제작
실시예 1 및 실시예 2에서 분리한 임상시료와 환경시료에서 분리한 바이러스들의 염기서열 외의 국내 분리주 그리고 외국의 분리주의 염기서열은 NCBI, EMBL 그리고 DDBJ 등에서 확보하였다. 확보된 염기서열을 토대로 Beacon Designer 소프트웨어 버전 5.1(Premier Biosoft International, USA) 및 PrimerQuest 웹사이트(Integrated DNA technologies, USA)를 이용하여 바이러스 게놈의 보존 영역으로부터 프라이머 및 프로브를 선정하였다. 각각의 프라이머와 프로브의 정보는 다음과 같다.
노로바이러스는 ORF1, ORF2, ORF3로 이루어진 전체 게놈(7.6 kb) 중에서 ORF2를 구성하고 있는 capsid 부위의 최외각에 위치한 P2 domain 중 인간에게 감염되는 Genogroup I (GI-1∼GI-8), Genogroup Ⅱ (GII-1∼GII-17)에 특이적인 염기서열을 분석하여 G I과 G Ⅱ를 모두 검출할 수 있는 프라이머 및 프로브를 40∼70 bp의 크기로 디자인하였다.
로타바이러스는 11개의 segment로 이루어진 이중가닥 RNA 바이러스이다. 그 중 VP4(P)와 VP7(G)은 로타바이러스의 최외각에 위치하며 유전자형을 결정하는 중요한 부위이다. 현재까지 보고된 로타바이러스는 G-유전자형이 G1∼G16, P-유전자형이 P1∼P27로 알려져 있다. 따라서 각 type의 특이적인 염기서열을 분석하여 G-유전자형 및 P-유전자형을 모두 검출할 수 있는 프라이머 및 프로브를 40∼70 bp의 크기로 디자인을 하였다.
콕사키 바이러스는 VP1에 특이적인 염기서열로서, 콕사키바이러스 type I을 검출할 수 있는 프라이머 및 프로브를 디자인하였다.
A형 간염 바이러스는 VP1/2A 부위에 특이적인 염기서열로서, 모든 type의 A형 간염 바이러스를 검출할 수 있는 프라이머 및 프로브를 디자인하였다.
상기 제작된 프라이머 및 프로브에 대하여, Beacon Designer 소프트웨어 버전 5.1(Premier Biosoft International, USA) 프로그램을 사용하여 melting temperature 나 2차 구조를 계산하였다. 그리고 계산된 Tm값, 반응시간, 온도조건을 반영하여 각 바이러스의 conserved 부위를 본 발명의 프라이머 및 프로브로 선정하고 제작하였다. 프로브가 되는 염기서열의 양 끝에는 형광물질과 quencher를 각각 붙였다. 하기 표 1은 제작된 프라이머와 프로브의 염기서열을 나타낸 표이다.
표 1
Virus (target) Primer Sequence (5 -> 3) Target Region Refs.
Norovirus NV F CAA GAG TCA ATG TTT AGG TGG ATG AG(서열번호 1) ORF2 This Study
NV R CG ACG CCA TCT TCA TTC ACA(서열번호 2)
NV Probe FAM-TGG GAG GGC GAT CGC AAT CT(서열번호 9)-BHQ1
Rotavirus HRV F ACA GGT TGG TGG CTC AGA TGT ACT(서열번호 3) NSP3 This Study
HRV R GCC ACC ATT TCT TCC AAT TCA CTC GC(서열번호 4)
HRV Probe ROX-ACA GCT GAT CCA ACG ACA ATG CCA CA(서열번호 10)-BHQ2
Coxsackievirus CVB F AAACCCAAACATGTGAAGGCGTGG(서열번호 5) 5' end This Study
CVB R TGGTAATGTTTGAGCGCGTTGTGG(서열번호 6)
CVB Probe HEX-ACC GCC GAG GCT ATG TCA ATA TGA GA(서열번호 11)-BHQ1
Hepatitis A virus HAV F TCTTGCCGTTGATACTCCTTGGGT(서열번호 7) VP1/2A This Study
HAV R ATCCAGTGCTCCAGACACAGCATA(서열번호 8)
HAV Probe TYE705-GCT CTT GGA ACT GTC AGA TTT AAC ACA AGG(서열번호 12)-IABkFQ
실시예 4. 실시간 PCR 조건 확립
NV GI, NV GII, HRV, CVB 및 HAV를 동시에 검출하기 위한 Multiplex 실시간 PCR 분석 조건을 확립하였다. Multiplex 실시간 PCR 용으로 디자인된 프라이머 및 프로브의 변형된 DNA 서열을 이용하여 Tm(melting temperature) 값을 계산하였다. 모든 바이러스를 동시에 검출하기 위하여, NV, HRV, HAV 및 CVB에 대한 프로브는 각각 FAM, ROX, TYE705 및 HEX 염료를 이용하여 조절하였다. 다음으로, 다양한 농도(50, 500 및 750 nM)의 정방향(forward) 및 역방향(reverse) 프라이머를 각각의 프라이머 및 프로브 세트에 기초하여 교차-반응시켰다. 50, 100, 150, 200 및 250 nM의 농도를 사용한 것을 제외하고는 상기와 동일한 방식으로 프로브를 교차-반응시켰다. 정방향 및 역방향 프라이머의 검출 효율은 모두 750 nM 농도에서 뛰어났으므로, 상기 농도를 프라이머의 최종 농도로 사용하였고, multiplex 실시간 PCR을 750 nM에서 최적화하였다. 프로브와 관련하여, 100 nM 이상의 농도에서 검출 효율이 최적이었으므로, 각각의 바이러스의 이상적인 농도는 100 nM 이상으로 선택하였다.
실시예 5. Conventional PCR과의 민감도 비교
각 대상 바이러스의 RNA의 전사체를 대량으로 제작한 다음, 그 RNA 전사체를 10배수씩 단계적으로 희석하였다. 이렇게 제조한 바이러스 RNA 시료를 본 발명의 프라이머 및 프로브를 적용하여 실시간 PCR을 수행하여 검출한계를 확인하였다. 결과는 도 1의 상단에 나타내었다.
상기 실시간 PCR 결과와 비교하기 위해, 동일한 RNA 전사체를 10배수씩 단계적으로 희석한 후 본 발명의 프라이머 및 프로브를 적용하여 conventional 역전사 PCR을 통해 검출한계를 확인하였다. 결과는 도 1의 하단에 나타내었다.
도 1에 나타난 바와 같이, conventional PCR 에서는 2.8×107 까지 검출한계를 보였지만 Multiplex 실시간 PCR 에서는 2.8×105 까지 검출한계를 보였다. 따라서 Multiplex 실시간 PCR에서 102 만큼 더 우수한 검출한계를 보임을 알 수 있었다.
실시예 6. multiplex 실시간 PCR 수행 및 monoplex 실시간 PCR과의 비교
6-1. Multiplex 실시간 PCR 수행
Monoplex PCR 반응에서 각각의 프라이머 및 프로브에 대해 최적화를 한 후, 바이러스의 동시 검출을 위한 multiplex PCR 분석을 수행하였다. Multiplex PCR 반응은 multiplex 절차로 인한 민감도의 감소를 최소화하는 방식으로 이루어졌다.
NV, HRV, HAV 및 CVB에 대한 multiplex 실시간 PCR은 25 ㎕ iQ™ Multiplex Powermix(Bio-Rad)(2x reaction buffer with dNTPs 12 Mm MgCl2 iTaq DNA polymerase, and stabilizers), 0.5 mM MgCl2, 0.75 μM의 각각의 프라이머, 또는 NV의 경우에는 0.1 μM, 0.1 μM HRV, 0.1 μM HAV 및 CVB, 0.1 μM 프로브 및 5 ㎕의 cDNA로 이루어지는 50 ㎕의 반응 혼합물에서 수행하였다. 상기 반응 조건은 95℃에서 3분간 인큐베이션한 후, 변성(95℃에서 10초) 및 어닐링/연장(60℃에서 30초)을 39 사이클 반복하는 과정을 포함하였고, MyiQ 및 CFX96 실시간 검출 시스템(Bio-Rad)을 이용하여 수행하였다.
6-2. Monoplex 실시간 PCR과의 민감도 비교
일반적으로 Monoplex 법으로 했을 경우 한 쌍의 프라이머에 하나의 바이러스가 반응하여 dimer 형성 등의 저해요소들이 적은 반면, multiplex 법은 여러 쌍의 프라이머 및 여러 가지의 바이러스가 들어가는 이유로 민감도가 떨어지는 경향을 보인다. 본 발명은 하나의 샘플에서 여러 종의 바이러스들을 동정해 낼 수 있는 것이 특징이므로, multiplex 실시간 PCR을 수행했을 때에도 높은 민감도를 유지하는지 확인하기 위해 하기의 실험을 수행하였다.
각각의 표적에 대해 양성 분변 샘플로부터 바이러스 RNA를 단리하였고, 그 cDNA를 합성하였다. 이어서, multiplex 분석과 개별 PCR 반응의 민감도를 cDNA의 단계적인 10배 희석액의 4회반복 분석에 의해 비교하였다.
또한, 다중 표적의 동시 검출을 위해 유사한 실험을 수행하였다. 이를 위하여, 제2 표적을 일정한 강한-양성의 농도[사이클 역치값(CT)<32]로 하고 제1 표적 cDNA를 단계적으로 희석하였다. 각각의 표적을 multiplex 분석 내에 존재하는 모든 다른 표적에 대해 분석하였다(즉, HAV cDNA의 단계적인 희석은 일정한 농도의 HRV cDNA 또는 NV cDNA를 이용하여 분석함). 그 결과를 하기 표 2에 나타내었다.
표 2
Monoplex 실시간 RT-PCR (Mean C T value(SD)) Multiplex 실시간 PCR (Mean C T value(SD))
Norovirus
10-1 희석 5.51(0.78) 6.06(0.49)
10-2 희석 6.48(0.32) 7.86(0.11)
10-3 희석 11.67(0.40) 12.48(0.41)
10-4 희석 15.30(0.11) 16.40(0.23)
Rotavirus
10-1 희석 6.11(0.50) 7.78(0.25)
10-2 희석 10.70(0.10) 12.27(0.38)
10-3 희석 14.50(0.18) 15.77(0.47)
10-4 희석 18.26(0.18) 19.34(0.45)
Coxsackievirus
10-1 희석 6.86(0.26) 6.93(0.04)
10-2 희석 8.77(0.32) 9.17(0.63)
10-3 희석 13.73(0.11) 13.80(0.32)
10-4 희석 17.57(0.77) 17.95(0.78)
Hepatitis A Virus
10-1 희석 3.32(0.35) 4.77(0.50)
10-2 희석 7.74(0.64) 8.01(0.36)
10-3 희석 11.42(0.26) 11.47(0.49)
10-4 희석 15.07(2.10) 15.88(0.19)
상기 표 2와 같이 본 발명의 프라이머 및 프로브는 Multiplex PCR 에서도 Monoplex PCR과 유사한 정도로 민감도가 우수하다는 결과를 얻었다. 이는 본 발명의 프라이머 및 프로브들이 Multiplex법을 수행할 때에 발생할 수 있는 저해요소를 최소화하도록 디자인되어 있음을 의미한다. 표 3에 기재되지 않은 바이러스의 경우에도 표 3으로 확인한 바이러스들과 동일한 방법으로 디자인하였으므로 동일한 효과를 가질 것을 당업자가 용이하게 유추할 수 있다.
6-3. Monoplex 실시간 PCR과의 특이도 비교
분변 샘플에서 잠재적으로 존재할 수 있는 기생충, 세균 및 바이러스 병원체의 패널(panel)을 사용하여 multiplex 실시간 PCR 분석의 특이도를 평가하였다. 상기 패널은 대장균(Escherichia coli), 바실러스 세레우스(Bacillus cereus), 바실러스 서브틸리스(Bacillus subtilis), 비브리오 파라해몰리티쿠스(Vibrio parahaemolyticus), 클로스트리디움 디피실레(Clostridium difficile), 클로스트리디움 퍼프링겐스(Clostridium perfringens), 살모넬라 엔테리티디스(Salmonella enteritidis), 리스테리아 모노시토게네스(Listeria monocytogenes), 스타필로코커스 아우레우스(Staphylococcus aureus) 및 엔테로바이러스(enterovirus) 71을 포함하였다.
그 결과, 상기 기생충, 세균 및 바이러스 병원체 유래의 핵산을 사용할 때에는 특이적 증폭이 전혀 관찰되지 않았으며(도 2), 이로부터 본 발명의 프라이머 및 프로브는 Multiplex 실시간 PCR에서 특이도를 갖고 있음을 확인하였다.
실시예 7. 후향적(retrospective) 임상 평가
227명의 환자로부터 총 227개의 분변 샘플을 사용하여 conventional RT-PCR 분석에 대한 후향적 임상 평가를 수행하였다. NV GI, NV GII 및 HRV를 검출하기 위하여, NV ORF2 및 HRV VP7 영역의 서열에 기초한 프라이머(GIFIM, GIRIM), (GIIFIM, GIIRIM) 및 (ddrv-1, ddrv-2)를 포함하는 One-step RT-PCR 키트(Qiagen)를 이용하여 역전사 PCR(RT-PCR)을 수행하였다(표 3 참조). 5 ㎖의 바이러스 RNA를 주형으로 사용하였고, 이를 20 ㎖의 프리믹스 키트 용액과 조합하였다. PCR System S1000™ 열 사이클러(Bio-Rad, USA)에서 PCR을 수행하였다. PCR 프로토콜은 다음과 같다: 50℃에서 30분 동안의 개시 RT 단계 후, 95℃에서 15분 동안의 PCR 활성화; 94℃에서 30초, 56℃에서 30초 및 72℃에서 30초의 35 사이클의 증폭; 72℃에서 5분의 최종 연장 단계. 이후, PCR 생성물을 1.5% 아가로즈 겔에서 전기영동하였고, 에티디움 브로마이드로 염색하였다.
표 3
바이러스 프라이머 서열(5'→3') 위치 영역
NoV GI GI-FIM CTGCCCGAATTYGTAAATGATGAT(서열번호 13) 5342-5365a Capsid
GI-RIM CCAACCCARCCATTRTACATYTG(서열번호 14) 5649-5671a
NoV GII GII-FIM GGGAGGGCGATCGCAATCT(서열번호 15) 5049-5067b Capsid
GII-RIM CCRCCIGCATRICCRTTRTACAT(서열번호 16) 5367-5389b
HRV ddrv-1 GGCGCCGCTCYTTTTRATGTATGGTATTGAATTACCAC(서열번호 17) 6-38c VP7
ddrv-2 GGCGCCCTTTAAAATANAYDGADCCWRTYGGCCA(서열번호 18) 346-373c
a: GenBank Accession No. M87661, b: GenBank Accession No. X86557,
c: GenBank Accession No. HQ392461
그 결과, conventional 역전사 PCR 분석에서는 총 66개의 양성 샘플(29%)을 검출하였지만, 본 발명의 수인성 바이러스 동정용 조성물을 이용한 Multiplex 실시간 PCR에서는 각각 6개(2.6%), 53개(23%), 46개(20%), 10개(4.5%) 및 8개(3.5%) 샘플에서 NV GI, NVGII, HRV, HAV 및 CVB를 검출하였다(표 4). Monoplex 및 Multiplex 실시간 PCR에서의 검출 효율은 거의 동일했으며, 상기 2 가지 방법에서의 CT 값은 대략 1-2 였다.
표 4
표적 양성 샘플(%) 혼합 감염 CT 범위
후향적 적용a
NV GI 4(1.8) - -
NV GII 36(16) - -
HRV 26(11) - -
합계 66(29) - -
전향적 적용b
NV GI 6(2.6) HRV-3 15-29
NV GII 53(23) HRV-41 14-28
HRV 46(20) NV-44 18-27
HAV 10(4.5) NV-2 14-28
CVB 8(3.5) - -
합게 123(54) 90
a: conventional RT-PCR만 수행, b: Multiplex 실시간 PCR만 수행
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해되어야 한다.

Claims (11)

  1. 장관 증상 유발 수인성 바이러스 특이적 프라이머로서 서열번호 1 내지 서열번호 8로 기재되는 폴리뉴클레오티드, 및
    장관 증상 유발 수인성 바이러스 특이적 프로브로서 서열번호 9 내지 서열번호 12로 기재되는 폴리뉴클레오티드를 포함하는 장관 증상 유발 수인성 바이러스 동정용 조성물.
  2. 청구항 1에 있어서,
    상기 장관 증상 유발 수인성 바이러스는 노로바이러스 type I, 노로바이러스 type Ⅱ, 로타바이러스 G-유전자형, 로타바이러스 P-유전자형, 콕사키바이러스 type I 및 A형 간염 바이러스로 이루어진 군으로부터 선택되는 하나 이상의 바이러스인 장관 증상 유발 수인성 바이러스 동정용 조성물.
  3. 청구항 1에 있어서,
    상기 프라이머 및 프로브는 다음과 같은 특징을 갖는 장관 증상 유발 수인성 바이러스 동정용 조성물:
    (1) 노로바이러스 type I 및 type Ⅱ는 서열번호 1 및 서열번호 2로 기재되는 폴리뉴클레오티드로 구성된 프라이머 쌍 및 서열번호 9로 기재되는 프로브로 동정되고,
    (2) 로타바이러스 G-유전자형 및 P-유전자형은 서열번호 3 및 서열번호 4로 기재되는 폴리뉴클레오티드로 구성된 프라이머 쌍 및 서열번호 10으로 기재되는 프로브로 동정되고,
    (3) 콕사키바이러스 type I은 서열번호 5 및 서열번호 6으로 기재되는 폴리뉴클레오티드로 구성된 프라이머 쌍 및 서열번호 11로 기재되는 프로브로 동정되고, 및
    (4) A형 간염 바이러스는 서열번호 7 및 서열번호 8로 기재되는 폴리뉴클레오티드로 구성된 프라이머 쌍 및 서열번호 12로 기재되는 프로브로 동정된다.
  4. 청구항 1에 있어서,
    상기 프로브의 양 끝에는 형광물질과 quencher가 각각 부착되어 있는 장관 증상 유발 수인성 바이러스 동정용 조성물.
  5. 청구항 4에 있어서,
    상기 형광물질은 FAM, ROX, HEX 및 TYE705로 이루어진 군으로부터 선택되는 장관 증상 유발 수인성 바이러스 동정용 조성물.
  6. 청구항 4에 있어서,
    상기 quencher는 BHQ1, BHQ2 및 IABkFQ로 이루어진 군으로부터 선택되는 장관 증상 유발 수인성 바이러스 동정용 조성물.
  7. 청구항 1 내지 청구항 6 중 어느 한 항에 따른 장관 증상 유발 수인성 바이러스 동정용 조성물을 포함하는 장관 증상 유발 수인성 바이러스 동정용 키트.
  8. 청구항 7에 있어서,
    상기 장관 증상 유발 수인성 바이러스는 노로바이러스 type I, 노로바이러스 type Ⅱ, 로타바이러스 G-유전자형, 로타바이러스 P-유전자형, 콕사키바이러스 type I 및 A형 간염 바이러스로 이루어진 군으로부터 선택되는 하나 이상의 바이러스인 장관 증상 유발 수인성 바이러스 동정용 키트.
  9. 청구항 1 내지 청구항 6 중 어느 한 항에 따른 장관 증상 유발 수인성 바이러스 동정용 조성물을 이용하여 검체로부터 채취한 시료로부터 실시간 중합효소 연쇄반응을 수행하는 단계를 포함하는 장관 증상 유발 수인성 바이러스를 동정하는 방법.
  10. 청구항 9에 있어서,
    상기 장관 증상 유발 수인성 바이러스는 노로바이러스 type I, 노로바이러스 type Ⅱ, 로타바이러스 G-유전자형, 로타바이러스 P-유전자형, 콕사키바이러스 type I 및 A형 간염 바이러스로 이루어진 군으로부터 선택되는 하나 이상의 바이러스인 장관 증상 유발 수인성 바이러스를 동정하는 방법.
  11. 청구항 9에 있어서,
    상기 실시간 중합효소 연쇄반응은
    95℃에서 2분 동안 1 cycle을 수행하는 단계; 및
    95℃에서 10초간, 55℃ 내지 60℃에서 45초간 30 내지 45 cycle을 수행하는 단계를 포함하는 장관 증상 유발 수인성 바이러스를 동정하는 방법.
PCT/KR2013/010465 2012-11-19 2013-11-18 수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트 WO2014077646A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020120131236A KR101377824B1 (ko) 2012-11-19 2012-11-19 수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트
KR10-2012-0131236 2012-11-19

Publications (1)

Publication Number Publication Date
WO2014077646A1 true WO2014077646A1 (ko) 2014-05-22

Family

ID=50656036

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/010465 WO2014077646A1 (ko) 2012-11-19 2013-11-18 수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트

Country Status (2)

Country Link
KR (1) KR101377824B1 (ko)
WO (1) WO2014077646A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114292956A (zh) * 2021-12-17 2022-04-08 江苏汇先医药技术有限公司 联合检测多种肠道病毒的试剂盒、引物探针组合物及方法

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101856097B1 (ko) * 2014-11-28 2018-05-10 가톨릭대학교 산학협력단 바이러스 검출용 프로브
KR20170036980A (ko) 2015-09-25 2017-04-04 윤현규 리얼타임 ｐｃｒ을 이용한 로타바이러스 및 아스트로바이러스 검사 키트 및 방법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003014397A1 (en) * 2001-08-09 2003-02-20 Biomedlab Corporation Probe for detection of enteric virus detection kit and method for enteric virus with the same
WO2004074447A2 (en) * 2003-02-18 2004-09-02 Applera Corporation Compositions and methods for multiplex analysis of polynucleotides
US7348164B2 (en) * 2001-04-17 2008-03-25 The New York Blood Center, Inc. Universal multi-variant detection system
KR20100116954A (ko) * 2009-04-23 2010-11-02 주식회사 엘지생명과학 실시간 중합효소 연쇄반응을 통한 ｈｂｖ 검출 방법
US20120045747A1 (en) * 2010-08-23 2012-02-23 Samsung Techwin Co., Ltd. Kit for detecting hepatitis b virus and method for detecting hepatitis b virus using the same

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060110724A1 (en) 2004-11-19 2006-05-25 Burkhardt William Iii Quantitative real-time assay for noroviruses and enteroviruses with built in quality control standard
US8715935B2 (en) 2007-06-01 2014-05-06 Universidad De Barcelona Standardized method and kit for the quantification of hepatitis A virus
KR20080111785A (ko) * 2007-06-19 2008-12-24 (주)바이오니아 수인성 바이러스를 검출하기 위한 중합효소연쇄반응의프라이머 및 프로브, 및 이를 이용한 검출키트 및 방법
KR101009321B1 (ko) * 2008-03-06 2011-01-18 (주)바이오니아 미지시료 내 감염성 미생물을 신속하게 검출하는 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7348164B2 (en) * 2001-04-17 2008-03-25 The New York Blood Center, Inc. Universal multi-variant detection system
WO2003014397A1 (en) * 2001-08-09 2003-02-20 Biomedlab Corporation Probe for detection of enteric virus detection kit and method for enteric virus with the same
WO2004074447A2 (en) * 2003-02-18 2004-09-02 Applera Corporation Compositions and methods for multiplex analysis of polynucleotides
KR20100116954A (ko) * 2009-04-23 2010-11-02 주식회사 엘지생명과학 실시간 중합효소 연쇄반응을 통한 ｈｂｖ 검출 방법
US20120045747A1 (en) * 2010-08-23 2012-02-23 Samsung Techwin Co., Ltd. Kit for detecting hepatitis b virus and method for detecting hepatitis b virus using the same

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114292956A (zh) * 2021-12-17 2022-04-08 江苏汇先医药技术有限公司 联合检测多种肠道病毒的试剂盒、引物探针组合物及方法

Also Published As

Publication number Publication date
KR101377824B1 (ko) 2014-04-01

Similar Documents

Publication Publication Date Title
Li et al. A newly developed PCR assay of H. pylori in gastric biopsy, saliva, and feces: evidence of high prevalence of H. pylori in saliva supports oral transmission
Song et al. Helicobacterpylori in Dental Plaque (A Comparison of Different PCR Primer Sets)
Keramas et al. Use of culture, PCR analysis, and DNA microarrays for detection of Campylobacter jejuni and Campylobacter coli from chicken feces
Kim et al. Rapid detection of Salmonella Enterica serovar enteritidis from eggs and chicken meat by real‐time recombinase polymerase amplification in comparison with the two‐step real‐time PCR
Lee Testing for SARS-CoV-2 in cellular components by routine nested RT-PCR followed by DNA sequencing
WO2018012896A1 (ko) 결핵균 및 비결핵균 동시 진단용 멀티플렉스 pcr 프라이머 세트, 프라이머 세트를 포함하는 조성물 및 키트
Huang et al. Molecular and epidemiological study of enterovirus D68 in Taiwan
Chutinimitkul et al. Dengue typing assay based on real-time PCR using SYBR Green I
WO2019151764A1 (ko) 구제역 바이러스 7가지 혈청형 진단용 프라이머 세트 및 이의 용도
Engberg Contributions to the epidemiology of
CA3174251A1 (en) Assays for the detection of sars-cov-2
Liu et al. Study on the relationship between Helicobacter pylori in the dental plaque and the occurrence of dental caries or oral hygiene index
WO2014077646A1 (ko) 수인성 바이러스 검출용 프라이머 및 이를 포함하는 검출 키트
CN113249522B (zh) 一种检测SARS-CoV-2变异毒株核酸的方法及其应用
US20200291460A1 (en) Compositions and Methods for Detecting Gastrointestinal Pathogen Nucleic Acid
Vora et al. Co-infections of adenovirus species in previously vaccinated patients
Prager et al. Clonal diversity of Shiga toxin-producing Escherichia coli O103: H2/H− in Germany
WO2016085267A1 (ko) 바이러스 검출용 프로브
KR102435209B1 (ko) 인플루엔자 a형 및 b형 바이러스와 제2형 중증급성호흡기증후군 코로나바이러스를 구별하여 동시에 검출하기 위한 조성물 및 이를 이용한 검출 방법
US20160201116A1 (en) Sequences and their use for detection of salmonella enteritidis and/or salmonella typhimurium
Cao et al. Genotyping of human adenoviruses using a PCR-based reverse line blot hybridisation assay
CN113684311A (zh) 一种特异性快速检测gii型诺如病毒的引物、探针和方法
US20060051751A1 (en) Major virulence factor detection and verocytontoxin type 2 subtype from clinical e. coli isolates using a one-step multiplex pcr
US11384387B2 (en) Compositions, methods and kits to detect adenovirus nucleic acid
Cocolin et al. A PCR-microplate capture hybridization method to detectListeria monocytogenesin blood

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13855668

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13855668

Country of ref document: EP

Kind code of ref document: A1