WO2014059489A1 - Improved human herpesvirus immunotherapy - Google Patents

Improved human herpesvirus immunotherapy Download PDF

Info

Publication number
WO2014059489A1
WO2014059489A1 PCT/AU2013/001216 AU2013001216W WO2014059489A1 WO 2014059489 A1 WO2014059489 A1 WO 2014059489A1 AU 2013001216 W AU2013001216 W AU 2013001216W WO 2014059489 A1 WO2014059489 A1 WO 2014059489A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cmv
cells
seq
isolated protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2013/001216
Other languages
English (en)
French (fr)
Inventor
Rajiv Khanna
Dasari VIJAYENDRA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
QIMR Berghofer Medical Research Institute
Original Assignee
Queensland Institute of Medical Research QIMR
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2012904604A external-priority patent/AU2012904604A0/en
Priority to US14/436,239 priority Critical patent/US9901632B2/en
Priority to JP2015537084A priority patent/JP2015533366A/ja
Priority to EP21157985.9A priority patent/EP3872097A1/en
Priority to AU2013332272A priority patent/AU2013332272B2/en
Priority to CN202410527083.3A priority patent/CN118359733A/zh
Priority to CA2889064A priority patent/CA2889064A1/en
Priority to EP18207655.4A priority patent/EP3466980A3/en
Application filed by Queensland Institute of Medical Research QIMR filed Critical Queensland Institute of Medical Research QIMR
Priority to CN201380065495.XA priority patent/CN104918960B/zh
Priority to EP13847496.0A priority patent/EP2909238A4/en
Publication of WO2014059489A1 publication Critical patent/WO2014059489A1/en
Anticipated expiration legal-status Critical
Priority to US15/860,145 priority patent/US11065329B2/en
Priority to AU2018274961A priority patent/AU2018274961A1/en
Priority to US17/226,929 priority patent/US11896665B2/en
Priority to US18/393,160 priority patent/US20240156953A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/245Herpetoviridae, e.g. herpes simplex virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • C12N5/0638Cytotoxic T lymphocytes [CTL] or lymphokine activated killer cells [LAK]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/57Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/572Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031Proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/70Multivalent vaccine
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/998Proteins not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16211Lymphocryptovirus, e.g. human herpesvirus 4, Epstein-Barr Virus
    • C12N2710/16222New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16211Lymphocryptovirus, e.g. human herpesvirus 4, Epstein-Barr Virus
    • C12N2710/16234Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • IMPROVED HUMAN HERPESVIRUS IMMUNOTHERAPY TECHNICAL FIELD relates to human herpesvirus immunotherapy.
  • the invention relates to a recombinant protein which includes a plurality of cytotoxic T cell epitopes derived from multiple human cytomegalovirus (CMV) or Epstein-Barr virus (EBV) antigens, which, when used in immunotherapy are capable of eliciting a cytotoxic T-lymphocyte immune response, without being limited thereto.
  • CMV cytomegalovirus
  • EBV Epstein-Barr virus
  • Epstein-Barr virus occurs with an extremely high incidence with over 90% of adults showing some sign of exposure. EBV also persists subsists as a lifelong latent infection and may be asymptomatic. However, EBV can result in mononucleosis, also known as glandular fever causing significant morbidity in some individuals. EBV may be associated with several autoimmune diseases such as lupus, rheumatoid arthritis and multiple sclerosis. Importantly, EBV is known to be associated with a number of cancers such as nasopharyngeal carcinoma (NPC), Burkitt's lymphoma and Hodgkin lymphoma. NPC is a cancer that is common in Chinese and South-East Asian populations (rare in most other populations).
  • Stage III mid (Stage III) or advanced stage (Stage IV) disease as symptoms are poorly recognised at earlier stages.
  • the first line of treatment for patients when diagnosed with NPC is radiotherapy and chemotherapy with limited options for surgery. Radio/chemo is effective for many patients but approximately 20% will either respond inadequately or relapse and this group have a poor prognosis.
  • Patients that present with stage III and IV tumours have a 5 year overall survival of only 50 to 60% (lower for stage IV patients alone).
  • the most common forms of NPC are associated with EBV making these tumours amendable to immunotherapy by targeting and killing EBV infected tumour cells.
  • CMV Primary CMV in healthy individuals is generally asymptomatic, establishing a latent state with occasional reactivation and shedding from mucosal surfaces. In some cases primary CMV infection is accompanied with clinical symptoms of a mononucleosis-like illness, similar to that caused by Epstein-Barr virus. There are two important clinical settings where CMV causes significant morbidity and mortality. These include congenital primary infection and primary or reactivation of virus in immunosuppressed adults. In the congenital setting, CMV is the leading cause of mental retardation and other abnormalities such as deafness in children and this impact has been emphasized by its categorization by the Institute of Medicine as a Level I vaccine candidate [i.e.
  • CMV-associated complications in immunocompromised individuals such as HIV-infected individuals is often seen in patients with CD4 + T cell counts below 50/ ⁇ 1 (Palella, Delaney et al. 1998; Salmon-Ceron, Mazeron et al. 2000).
  • CMV in transplant patients including both solid organ transplant and allogeneic hematopoietic stem cell transplant recipients, is well recognized.
  • CMV vaccine strategies have assessed glycoprotein B (gB), pp65 and IE-1 as potential targets and they have been delivered by numerous delivery platforms, including the attenuated CMV Towne strain (Jacobson, Sinclair et al. 2006), recombinant viral vectors encoding full length antigens and epitopes (Bernstein, Reap et al.2009; Zhong and Khanna 2009), DNA (Wloch, Smith et al. 2008), dense body (Frankenberg, Pepperl- Klindworth et al. 2002), and subunit (Drulak, Malinoski et al. 2000) vaccines.
  • gB glycoprotein B
  • IE-1 glycoprotein B
  • the present invention addresses a need for the development of herpesvirus immunotherapy using a safe delivery technology.
  • the invention is directed towards reducing the risk of CMV associated injury to the developing fetus, and immunologically compromised individuals such as recipients of solid organ and hematopoietic stem cell transplants and patients with advanced HIV disease.
  • the invention is also directed toward treating the symptoms of an existing EBV infection, such as in immunologically compromised transplant patients or in the prevention or treatment of EBV-associated cancers such as nasopharyngeal carcinoma (NPC).
  • NPC nasopharyngeal carcinoma
  • the invention has surprisingly arisen from the discovery that contrary to past assumptions, an exogenous & polyepitope protein administered to an individual may elicit a protective, CD8 + cytolytic T cell response.
  • the invention is broadly directed to an isolated polyepitope protein comprising a plurality of human herpesvirus cytotoxic T cell (CTL) epitopes that is capable of eliciting a cytotoxic T cell response.
  • CTL cytotoxic T cell
  • an isolated protein comprises respective amino acid sequences of each of a plurality of CTL epitopes from two or more different herpesvirus antigens and which further comprises an intervening amino acid or amino acid sequence between at least two of said CTL epitopes comprising proteasome liberation amino acids or amino acid sequences and, optionally, Transporter Associated with Antigen Processing (TAP) recognition motifs, wherein the isolated protein is capable of eliciting a cytotoxic T- lymphocyte immune response upon administration to an animal as an exogenous protein.
  • TEP Antigen Processing
  • the isolated protein comprises epitopes are selected to provide broad coverage of the human population.
  • HLA class I specificities HLA-A1, -A2, - A3, -All, -A23, -A24, -A26, -A29, - A30, -B7, -B8, -B27, - B35, -B38, -B40, -B41, -B44, - B51, -B57 and -B58.
  • said plurality of epitopes comprises less than twenty (20) epitopes in total.
  • the herpesvirus is CMV.
  • the CTL epitopes are from CMV antigens selected from the group consisting of: pp50, pp65, ppl50 and IE-1.
  • the isolated protein comprises a plurality of CTL epitopes selected from Table 1 (SEQ ID NOS: 1-21) In a particular embodiment, the isolated protein comprises a plurality of CTL epitopes selected from Table 2 (SEQ ID NOS: 1-13).
  • At least one of the CTL epitopes comprises the amino acid sequence VTEHDTLLY (SEQ ID NO: 11 ).
  • the herpesvirus is EBV.
  • the CTL epitopes are from EBV antigens selected from the group consisting of: BMLFl, LMP2a, BRLFl, LMP2, EBNA3A, BZLFl, EBNA3C, EBNAl andEBNA3B.
  • the isolated protein comprises a plurality of CTL epitopes selected from and Table 3 (SEQ ID NOS:22-41).
  • the isolated protein may comprise CTL epitopes from the same or different herpesvirus (e.g CMV and/or EBV).
  • herpesvirus e.g CMV and/or EBV.
  • the isolated protein may further comprise intervening amino acids or amino acid sequences.
  • the intervening amino acids or amino acid sequences are proteasome liberation amino acids or amino acid sequences.
  • the intervening amino acids or amino acid sequence are Transporter Associated with Antigen Processing (TAP) recognition motifs.
  • TAP Antigen Processing
  • the invention provides an isolated nucleic acid encoding the isolated protein of the first aspect.
  • the invention provides a genetic construct comprising the isolated nucleic acid of the second aspect.
  • the genetic construct is an expression construct wherein said isolated nucleic acid of the second aspect is operably linked to one or more regulatory sequences present in an expression vector.
  • the expression construct comprises an expression vector suitable for production of the isolated protein in vitro as a recombinant protein for subsequent purification.
  • the invention provides a host cell comprising the expression construct of the third aspect.
  • the host cell has been transfected, transformed or otherwise introduced with the expression construct in vitro, for the purpose of subsequent purificiation of the isolated protein of the first aspect.
  • the invention provides a method of producing the isolated protein of the first aspect, said method including the steps of expressing the isolated protein in the host cell of the fourth aspect and at least partly purifying the isolated proteins under conditions that maintain the isolated protein in a substantially non-aggregated form.
  • the invention provides an isolated protein produced according to the method of the fifth aspect.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the isolated protein of the first or sixth aspects or the genetic construct of the third aspect, and a pharmaceutically-acceptable carrier, diluent or excipient.
  • the pharmaceutical composition is an immunogenic composition suitable for use in the prophylactic or therapeutic treatment of a disease or condition associated with CMV and or EBV infection in an animal.
  • the immunotherapeutic composition is a vaccine for eliciting a protective immune response against CMV and/or EBV.
  • the pharmaceutical composition may comprise separate isolated proteins respectively comprising CMV and EBV CTL epitopes or may comprise a single isolated protein comprising both EBV and CMV epitopes.
  • the pharmaceutical composition further comprises one or more immunostimulatory molecules or adjuvants.
  • the immunostimulatory molecule or adjuvant comprises one or more tolllike receptor (TLR) agonists.
  • TLR tolllike receptor
  • the TLR agonists include a TLR4 agonist and/or a TLR9 agonist.
  • Preferred adjuvants include Monophosphoryl lipid (MPL) and/or immunostimulatory D A such as CpG ODN1826, CpG ODN2006, CpG ODN2216 and/or CpG ODN2336, although without limitation thereto.
  • the invention provides a method of prophylactically or therapeutically treating a herpesvirus infection in an animal including the step of administering to the animal the isolated protein of the first or sixth aspects, or the pharmaceutical composition of the seventh aspect, to thereby prophylactically or therapeutically treat the herpesvirus infection in the animal.
  • the herpesvirus is CMV or EBV.
  • the invention provides a method of inducing a cytotoxic T- lymphocyte (CTL) immune response in an animal including the step of administering to the animal the isolated protein of the first or sixth aspects or the pharmaceutical composition of the seventh aspect, to thereby induce or elicit a cytotoxic T-lymphocyte (CTL) immune response in said animal.
  • CTL cytotoxic T- lymphocyte
  • the invention provides a method of expanding herpesvirus-specific
  • CTLs for adoptive immunotherapy including the steps of:
  • the herpesvirus is CMV or EBV.
  • the invention provides a method of adoptive immunotherapy including the step of administering said herpesvirus -specific CTLs produced at step (ii) of the tenth aspect to an animal to thereby prophylactically or therapeutically treat a herpesvirus infection of said animal.
  • the herpesvirus is CMV or EBV.
  • the invention provides the isolated protein of the first or sixth aspects, or the genetic construct of the third aspect for use in prophylactically or therapeutically treating a herpesvirus infection in an animal.
  • the herpesvirus is CMV or EBV.
  • the animal is a mammal. More preferably, the animal is a human.
  • FIG. 1 Illustration of the design of the CMV polyepitope and downstream processing.
  • the design of the CMV polyepitope 20mer encoding sequence is shown as an example. Individual epitope amino acid sequences are shown in bold; grey, Italicised letters following the epitope sequence represent the amino acid residues for processing of the CMV polyepitope protein by the proteasome and the underlined amino acid sequences represent the motifs for TAP (referred to as CMVpoly-PTL).
  • the DNA sequence encoding the CMV polyepitope protein was synthetically made, cloned into an E.coli inducible plasmid, pJexpress 404, and transformed into E. coli to carry out protein expression and purification.
  • FIG. 2 Expression and purification of CMVpoly-PTL proteins.
  • the pJexpress 404 plasmids expressing the CMVpoly-PTL proteins which include 13, 14, 15 or 20 CMV CD8 + T cell epitopes were transformed into E.coli BL21 (DE3) pLysS. Protein expression was induced with IPTG and pre and post induction samples were analysed using SDS PAGE.
  • Panel A and B shows expression of CMVpoly-PTL proteins in E. Coli: Lane 1, molecular weight marker (kDa); Lanes 2, 4 and 6 uninduced E. coli cell lysate; Lanes 3, 5 & 7 induced E. coli cell lysate. * indicates the CMVpoly-PTL proteins.
  • FIG. 3 SDS PAGE analysis of purified CMVpoly-PTL proteins Following CMVpoly-PTL purification on Ni NTA column, samples from various stages of purification were analysed by SDSPAGE.
  • Panels A, B, C & D represent the purification of the CMVpoly-PTL proteins (13mer, 14mer, 15mer and 20mer).
  • Lane 1 molecular weight marker.
  • Lane 2 solubilised protein prior to loading.
  • Lane 3 flow through.
  • Lane 4 wash.
  • Lanes 5, 6, 7 & 8 elution fractions. * indicates CMVpoly-PTL proteins.
  • FIG. 4 CMVpoly-PTL protein solubility test and characterisation to determine a compatible buffer system for CMVpoly-PTL storage as a soluble protein, purified protein was diluted with various buffer compositions at different pH ranges, incubated at 4°C O N, centrifuged and supernatant fractions were analysed on SDS PAGE.
  • Panel A Lane 1 : molecular weight marker.
  • Lane 2 diluted with 25 mM 2-(N-morpholino) ethanesulfonic acid (MES) buffer pH 5.6.
  • Lane 3 diluted with 25 mM MES buffer pH 3.2.
  • Lane 4 diluted with 25 mM MES pH 4.5.
  • Lane 5 diluted with 25 mM MES pH 4.5 and 400 mM L arginine.
  • Lane 6 diluted with 10 mM Tris and 100 mM NaH 2 Po 4 pH 4.3.
  • Lane 7 diluted with 10 mM Tris, 100 mM NaH 2 Po 4 and 400 mM L arginine pH 4.3.
  • Lane 8 diluted with PBS, 50 mM L-arginine and 50 mM L-glutamic acid pH7.4.
  • Lane 9 diluted with water.
  • Lane 10 diluted with 100 mM glycine buffer pH 2.
  • Panel B, C & D shows CMVpoly-PTL proteins purity analysis.
  • FIG. 5 Expansion of CMV-specific T cells following stimulation of PBMCs from CMV seropositive donors with the CMVpoly-PTL proteins: PBMC from various healthy CMV-seropositive donors were stimulated ex vivo with recombinant CMVpoly-PTL protein (13, 14 and 15mer) and cultured for 10 days in the presence of recombinant IL 2.
  • Panel A shows the representative FACS plots of in vitro expanded CMV-specific CD8 + T cells following stimulation of PBMC with or without the CMVpoly-PTL proteins.
  • Panel B & C shows overall analysis of expanded CMV specific CD8 + T cells from different individuals following stimulation with CMVpoly-PTL proteins (13, 14 and 15mer).
  • FIG. 6 The magnitude and quality of expanded CMV specific CD8 + T cells following stimulation with CMV polyepitope protein: Following PBMC stimulation with the CMVpoly-PTL protein (13mer), cells were analysed to assess for effector functions by multi parameter flow cytometry. The frequency of CD8 + T cells demonstrating cytolytic function (CD 107a degranulation marker) and intracellular cytokine production (IFN ⁇ , TNF and MIP 1 ⁇ ) were analysed on FIowJo and multifunctional cytokine producers were plotted using the SPICE program. Data in the pie chart is shown for a individual epitope and each slice of the pie chart represents each possible combination of functions.
  • CD 107a degranulation marker CD 107a degranulation marker
  • IFN ⁇ , TNF and MIP 1 ⁇ intracellular cytokine production
  • FIG 7 Schematic design of the CMV polyepitope protein construct with and without linkers and protein purification: Panel A shows the design of CMV polyepitope protein without linkers (SEQ ID NO:46) (referred to as CMVpoly). Panel B shows the design of polyepitope protein with proteasome linkers (SEQ ID NO: 47) (referred to as CMVpoly-PL).
  • SEQ ID NO: 46 CMV polyepitope protein without linkers
  • Panel B shows the design of polyepitope protein with proteasome linkers (SEQ ID NO: 47) (referred to as CMVpoly-PL).
  • the DNA sequence encoding the CMV polyepitope proteins was cloned into an IPTG inducible plasmid, pJexpress 404, and transformed into E. coli for protein expression. Polyepitope protein was purified using Ni-NTA affinity chromatography.
  • FIG. 8 In vitro assessment of processing and presentation of CMVpolyepitope proteins with and without linkers: Panel A shows in vitro cross-presentation of CMVpoly, CMVpoly-PL and CMVpoly-PTL proteins by human cells. EBV transformed LCLs were pulsed with CMVpoly, CMVpoly-PL or CMVpoly-PTL proteins (25 ⁇ g each) for two hours, washed, incubated overnight and then exposed to CMV-specific CD8 + T cells specific for HLA A2-restricted NLV (pp65), HLA Al -restricted VTE (pp50), HLA B8- restricted ELR (IE1), HLA B7-restricted RPH (pp65) and HLA B7-restricted TPR (pp65) epitopes.
  • HLA A2-restricted NLV pp65
  • HLA Al -restricted VTE pp50
  • HLA B8- restricted ELR IE1
  • the FACS plots shows IFN- ⁇ expression by the CMV-specific CD8 + T cells following co-culture with CMVpoly, CMVpolyPL or CMVpoly-PTL proteins pulsed LCLs.
  • Panel B shows the mean ⁇ SEM of IFN- ⁇ producing CMV epitope specific CD8 + T cells following co-culture with LCL pulsed with CMVpoly (empty bars), CMVpoly-PL (black bars) or CMVpoly-PTL (grey bars). Error represent the ⁇ SEM. ** or *** indicates statistically significant (p ⁇ 0.001 or p ⁇ 0.0001), calculated by 2-tailed Student's t test.
  • FIG. 9 Analysis of the cross-presentation of the CMV polyepitope protein by human cells: To identify the role of peptide transporters (TAP-1 and TAP-2) in the cross- presentation of CMV polyepitope protein, TAP 1 &2+ cells (CEM.T 1 ) and TAP 1 &2- cells (CEM.T2 or CEM.T2 HLA B7) were pulsed with CMV-PTL protein for two hours, washed, incubated overnight and exposed to HLA A2 -restricted NLV (pp65) or HLA B7- restricted TPR (pp65) epitope-specific CD8+ T cells.
  • TAP 1 &2+ cells CEM.T 1
  • CEM.T2 or CEM.T2 HLA B7 TAP 1 &2- cells
  • Panel A shows expression of IFN ⁇ by NLV-specific T cells following exposure of CEM.Tl cells pre-sensitized with CMV polyepitope protein.
  • Panel B & C shows the percentage of IFN- ⁇ expressing NLV and TPR- specific CD8 + T cells following exposure to CMV polyepitope protein sensitized CEM.T2 and CEM.T2 HLA B7 cells respectively.
  • the data shown in panels A, B & C is one representative experiment from two independent experiments.
  • FIG. 10 The effect of different chemical inhibitors on the processing and presentation of the polyepitope protein: CEM.Tl and CEM.T2 cells were either untreated or pre treated with inhibitors for autophagy (3- MA), lysosomes/endosome (chloroquine or bafilomycin Al), the recycling pathway (primaquine), cysteine proteases (leupeptin or E64) or acid proteases (pepstatin A) (Panel A), proteasomal inhibitors, lactacystin, epoxomicin and MG132 (Panel B) and ER-resident aminopeptidase inhibitor (leucinethiol + DTT) or its control (DDT alone) or golgj inhibitors (brefeldin A or monensin) (Panel C) prior to incubation with the CMV-PTL protein.
  • inhibitors for autophagy 3- MA
  • lysosomes/endosome chloroquine or bafilomycin
  • FIG. 11 Effect of Sec61 and ATG12 shRNA on the cross-presentation of the polyepitope protein: CEM Tl and CEM T2 cells were transduced with recombinant lenti virus encoding shRNA for Sec6ip subunit or ATG12 or a control vector (pLKO), cultured for two days in R 10 medium, selected in puromycin for seven days and then used as antigen presenting cells. Panel A & D shows western blot analysis of Sec61 and ATG12 protein expression in CEM.T1 and CEM.T2 cells following transduction of shRNA. GAPDH was used as a control for protein loading.
  • Panels B-F shows the expression of IFN- ⁇ by CMV-specific CD8 + T cells following exposure to CMVpoly-PTL sensitized CEM.T1 and CEM.T2 cells transduced with Sec61 and ATG12 shRNA lentivir s or control vector.
  • Figure 12 In vivo assessment of immunogenicity of CMVpoly, CMVpoly-PL and CMVpoly-PTL proteins: To assess the immunogenicity of CMVpoly, CMVpoly-PL or CMVpoly-PTL proteins, 20 ⁇ g of protein was formulated with 25 ⁇ g of MPL (monophosphoryl lipid A) and 50 g of CpG OD 1826 in 1 OOuL volume per dose.
  • MPL monophosphoryl lipid A
  • HLA A2 transgenic mice were immunised subcutaneously and a booster dose was give with an identical formulation on day 21.
  • Mice were sacrificed on day 35, splenocytes were stimulated in vitro with HLA A2-restricted NLV (pp65) and HLA A2- restricted VLE (IE- 1 ) peptide epitopes for 10 days in the presence of IL-2 and then assessed for cytokine expression using ICS assays.
  • Panel A shows the frequencies of CMV-specific CD8 + T cells following immunisation with CMVpoly, CMVpoly-PL or CMVpoly-PTL- based vaccine formulation.
  • Panel B shows the absolute percentage of CMV-specific CD8 + T cells expressing different combination of cytokines (IFN- ⁇ , TNF and/or IL-2) following vaccination with CMVpoly, CMVpoly-PL or CMVpoly-PTL proteins. Error bars represent the mean ⁇ SEM. * indicates statistically significant (p ⁇ 0.05).
  • FIG. 13 Schematic design of the Epstein-Barr virus (EBV) polyepitope construct with proteasome linkers and protein purification.
  • Panel A shows the design of EBV polyepitope protein with proteasome linkers (referred to as EB Vpoly).
  • EB Vpoly EBV polyepitope protein with proteasome linkers
  • Each of the alternate CD8 + T cell epitope sequences are italicised and underlined.
  • each epitope sequence is separated by amino acid residue(s), which are targets for proteasomal degradation (shown in red).
  • Panel B shows the purification of EBVpoly protein.
  • the DNA sequence encoding the EBVpoly protein was cloned into an IPTG inducible plasmid, pJexpress 404, and transformed into E. coli for protein expression.
  • EBVpoly protein was purified using Ni-NTA affinity chromatography and then analysed using SDS-PAGE. Predicted size for the EBVpoly was 25
  • Figure 14 In vitro expansion of EBV-specific CD8 + T cells from healthy sero-positive donors using EBVpoly protein.
  • Bar graphs represent the comparative percentage of expanded EBV-specific CD8 + T cells from each donor following stimulation with EBVpoly protein.
  • Fig. 15 Amino acid sequences of CMV and EBV polyepitope proteins and nucleotide sequences of encoding nucleic acids.
  • the present invention is at least partly predicated on the unexpected discovery that an isolated protein comprising a plurality of herspesvirus epitopes such as CMV and/or EBV epitopes administered to an individual as an exogenous protein may elicit a protective, CD8 + cytotoxic T cell response. It appears that once administered, the exogenous protein is processed by a novel, cellular TAP-independent, proteasome and autophagy dependent pathway which is assisted by the inclusion of proteasome liberation amino acids in the exogenous protein. This results in HLA Class I-dependent presentation of the processed CMVepitopes to CD8 + cytotoxic T cells.
  • This unexpected discovery may also be at least partly related to an improved recombinant protein purification method that avoids or reduces aggregation of the recombinant protein.
  • a difficulty typically encountered with such proteins is that T cell epitopes are hydrophobic and/or contain several hydrophobic amino acids, which means that the protein is susceptible to hydrophobic aggregation, which may compromise the ability to deliver the recombinant protein in a manner which enables the CTL epitopes of the protein to be processed in the manner described above. This is exacerbated by the use of intervening TAP recognition motifs that are typically hydrophobic.
  • the improved recombinant polyepitope protein purification method described herein avoids or at least reduces aggregation of the polytope protein, thereby allowing efficient delivery and processing of the polyepitope protein.
  • the inventors have also discovered that production, purification and immunization with the isolated polyepitope protein is optimized by using less than twenty (20) CTL epitopes in the isolated protein.
  • the invention utilizes particular immunogenic components such as toll-like receptor (TLR) agonists that enhance the immunogenicity of the isolated protein.
  • TLR toll-like receptor
  • an isolated protein comprises respective amino acid sequences of each of a plurality of CTL epitopes from two or more different herpesvirus antigens and which further comprises an intervening amino acid or amino acid sequence between at least two of said CTL epitopes comprising proteasome liberation amino acids or amino acid sequences and, optionally, Transporter Associated with Antigen Processing (TAP) recognition motifs,wherein the isolated protein is capable of eliciting a cytotoxic T- lymphocyte immune response upon administration to an animal as an exogenous protein.
  • isolated is meant material that has been removed from its natural state or otherwise been subjected to human manipulation. Isolated material maybe substantially or essentially free from components that normally accompany it in its natural state, or may be manipulated so as to be in an artificial state together with components that normally accompany it in its natural state.
  • protein is meant an amino acid polymer comprising natural and/or non-natural amino acids, D- or L- amino acids as are well known in the art.
  • a “peptide” is a protein having no more than fifty (50) amino acids.
  • a “polypeptide” is a protein having more than fifty (50) amino acids.
  • the isolated protein may be referred to as an isolated polyepitope or polytope protein.
  • an "exogenous" protein or polyepitope protein is a protein produced externally to the animal to which it is subsequently administered. Effectively, the exogenous protein is administered or administrable to the animal, rather than being produced or expressed by the animal in situ (e.g. by cells or tissues of the animal) following delivery of a nucleic acid or genetic construct encoding the protein to the animal.
  • a preferred exogenous protein is a recombinant protein produced in an isolated host cell ex vivo, such as a bacterial host cell.
  • a "CTL epitope” is a peptide, or an amino acid sequence of the peptide, that is capable of stimulating or activating a cytotoxic T lymphocyte to recognize a target cell presenting the epitope in the context of the appropriate MHC Class I molecule.
  • Recognition of the target cell may include or result in cytokine production (e.g.. IFN- ⁇ , IL-2, MIP- 1 ⁇ and or TNF), changes in cell surface marker expression (e.g. CD 107a) and/or lysis and/or killing of the target cell.
  • a CTL epitope comprises 7, 8, 9, 10, 11 , 12, 13, 14 or 15 contiguous amino acids of, derived from, obtained from or based on a corresponding herpesvirus antigen.
  • the polyepitope protein preferably comprises a plurality of CMV and/or EBV CTL epitopes derived from a plurality of different CMV protein antigens.
  • the epitopes are of CMV antigens selected from the group consisting of: pp50, pp65 , ppl 50 and IE-1 and/or EBV antigens selected from the group consisting of: BMLF1, LMP2a, BRLF1, LMP2, EBNA3A, BZLF1, EBNA3C, EBNA1 andEBNA3B.
  • the CMV and/or EBV polyepitope protein comprises CTL epitopes selected to provide broad coverage of a population.
  • HLA class I specificities HLA-A1, -A2, -A3, -All, -A23, -A24, -A26, -A29, - A30, -B7, -B8, -B27, - B35, -B38, -B40, -B41, -B44, -B51, -B57, -B58 and -cw6.
  • the CTL epitopes are restricted to the HLA class I specificities shown in Table 1 or Table 2.
  • the CMV polyepitope protein comprises a plurality of HLA class I restricted CTL epitopes selected from Table 1 (SEQ ID NOS: 1-21) or Table 3 (SEQ ID NOs: 22-41).
  • the EBV polyepitope protein comprises a plurality of
  • HLA class I restricted CTL epitopes selected from Table 3 (SEQ ED NOs: 22-41).
  • CTL epitopes derived from the same or different herpesvirus e.g CMV and or EBV
  • one embodiment of the isolated protein comprises CTL epitopes from both CMV and EBV antigens.
  • said plurality of epitopes comprises less than twenty (20) epitopes in total.
  • said plurality of epitopes comprises ten (10) to fifteen (15) epitopes in total.
  • One particular embodiment provides an isolated protein comprising thirteen (13) CMV CTL epitopes, such as shown in Table 2.
  • at least one of the epitopes comprises the CMV amino acid sequence VTEHDTLLY (SEQ ID NO: 11).
  • the full length, contiguous polyepitope protein comprises the amino acid sequence set forth in SEQ ID NOs:42-48 and shown in FIG. 15A-G.
  • CMV CTL epitopes may be used, such as described in International Publication WO 03/000720.
  • One particular embodiment provides an isolated protein comprising thirteen (13) EBV CTL epitopes, such as shown in Table 3.
  • the full length, contiguous EBV polyepitope protein comprises the amino acid sequence set forth in SEQ ID NO:49 as shown in FIG. 15H.
  • EBV CTL epitopes may be used such as described in International Publications WO 95/024925; WO 97/45444; WO 99/02550 and WO 04/041849.
  • the isolated polyepitope protein may further comprise one or a plurality of HLA Class II restricted CTL epitopes.
  • epitope selected may be tailored to fit any population, race or other group of individuals.
  • herpesvirus polyepitope include those (i) having minimal or no sequence variants; (ii) selected from HLAs having minimal subtypes; (iii) having a high frequency of CTL responses in healthy seropositives; and (iv) based on epitope hydrophobic properties, wherein the novel sequential order of individual epitopes are arranged such that hydrophobicity is uniform distributed along the length of the polyepitope to assist inter cellular mobility.
  • the isolated protein may further comprise intervening amino acids or amino acid sequences.
  • Intervening amino acids or amino acid sequences may be present between at least two of the CTL epitope amino acid sequences, or between each adjacent CTL epitope amino acid sequence.
  • the intervening amino acids or amino acid sequences are positioned or located relative to the CTL epitope amino acid sequences to enable proteasomal processing and for transporting the proteasome-generated, individual CTL epitope peptides into the endoplasmic reticulum (ER) for subsequent presentation with HLA-I molecules.
  • the intervening amino acids or amino acid sequences are proteasome liberation amino acids or amino acid sequences.
  • Non-limiting examples of proteasome liberation amino acids or amino acid sequences are or comprise AD, or R.
  • the intervening amino acids or amino acid sequence are N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
  • TAP recognition motifs may conform to the following formula: (R/N:I Q:W/Y) n where n is any integer > 1.
  • TAP recognition motifs include RIW, RQW, NIW and
  • CMV and/or EBV CTL epitopes are linked or joined by the proteasome liberation amino acid sequence and, optionally, the TAP recognition motif at the carboxyl terminus of each epitope.
  • TAP recognition motifs Non-limiting examples of TAP recognition motifs, proteasome liberation amino acids and their positioning relative to the CTL epitope amino acid sequences are shown in Table 1 and Table 2 and are also present in the polyepitope amino acid sequences shown in FIG. 1 (SEQ ID NO:58) and FIGS. 15 A-H (SEQ ED NOS.42-49).
  • the exogenous protein comprising the intervening amino acids or amino acid sequences is processed by a novel, cellular TAP-independent, proteasome and autophagy dependent pathway. This results in HLA Class I-dependent presentation of the processed CMVepitopes to CD8 + cytotoxic T cells.
  • the TAP amino acid sequences may be omitted or absent, in which case it is proposed or expected that the TAP-independent pathway could sufficiently process the isolated protein to enable presentation with HLA-I molecules.
  • the isolated polyepitope protein may further comprise one or a plurality of CD4 + helper T cell epitopes.
  • Variations in amino acid sequence may be the result of naturally occurring sequence variation in a herpesvirus polyepitope protein.
  • amino acid properties such as charge, hydrophilicity, hydrophobicity and/or side chain size or "bulkiness" are retained or at least minimally altered.
  • Non-limiting examples of nucleic acid mutagenesis methods are provided in Chapter 9 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel et al, supra, Stemmer, 1994, Proc. Natl. Acad. Sci. USA 91 10747, Shafikhani et al., 1997, Biotechniques 23 304, Jenkins et al., 1995, EMBO J. 14 4276-4287 and Zaccolo et al, 1996, J. Mol. Biol.255 58 and kits such as QuickChangeTM Site-Directed Mutagenesis Kit (Stratagene) and the DiversifyTM random mutagenesis kit (Clontech).
  • the invention contemplates protein variants having at least 75%, preferably at least 80%, more preferably at least 85% or even more preferably at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% amino acid sequence identity with the constituent CTL epitope sequences, individually or in combination. In other embodiments, this may include conservative variations or substitutions of one (1 ), two (2) or three (3) amino acid residues of a CTL epitope.
  • sequence identity is used herein in its broadest sense to include the number of exact amino acid matches having regard to an appropriate alignment using a standard algorithm, having regard to the extent that sequences are identical over a window of comparison. Sequence identity may be determined using computer algorithms such as GAP, BESTFIT, FASTA and the BLAST family of programs as for example disclosed by Altschul et al., 1997, Nucl. Acids Res.253389. A detailed discussion of sequence analysis can be found in Unit 19.3 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds. Ausubel et al. (John Wiley & Sons Inc Y, 1995-1999).
  • derivative proteins of the invention have been altered, for example by conjugation, fusion with additional protein sequences, by complexing with other chemical moieties or by post-translational modification techniques as would be understood in the art.
  • Additional amino acids may include fusion with amino acid sequences of other proteins such as “fusion partners” or “epitope tags” which assist recombinant protein purification and/or identification.
  • fusion partners include, but are not limited to, glutathiones-transferase (GST), Fc portion of human IgG, maltose binding protein (MBP) and hexahistidine ( ⁇ ), which are particularly useful for isolation of the fusion polypeptide by affinity chromatography.
  • GST glutathiones-transferase
  • MBP maltose binding protein
  • hexahistidine
  • relevant matrices for affinity chromatography are glutathione-, amylose-, and nickel- or cobalt-conjugated resins respectively.
  • Many such matrices are available in "kit” form, such as the QIAexpressTM system (Qiagen) useful with (HIS 6 ) fusion partners and the Pharmacia GST purification system.
  • GFP green fluorescent protein
  • This fusion partner serves as a fluorescent "tag" which allows the fusion protein of the invention to be identified by fluorescence microscopy or by flow cytometry.
  • the GFP tag is useful when assessing subcellular localization of the fusion polypeptide of the invention, or for isolating cells which express the fusion polypeptide of the invention.
  • Flow cytometric methods such as fluorescence activated cell sorting (FACS) are particularly useful in this latter application.
  • the fusion partners also have protease cleavage sites, such as for Factor
  • X a or Thrombin which allow the relevant protease to partially digest the fusion protein of the invention and thereby liberate the recombinant protein of the invention therefrom.
  • the liberated protein can then be isolated from the fusion partner by subsequent chromatographic separation.
  • Fusion partners according to the invention also include within their scope "epitope tags", which are usually short sequences for which a specific antibody is available.
  • epitope tags for which specific monoclonal antibodies are readily available include c-myc, influenza virus haemagglutinin and FLAG tags.
  • derivatives contemplated by the invention include, but are not limited to, modification to side chains, biotinylation, modification with fluorochromes, incorporation of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis, the use of crosslinkers and other methods which impose conformational constraints on the isolated protein of the invention.
  • side chain modifications contemplated by the present invention include: modifications of amino groups such as by acylation; modification of carboxyl groups by carbodiimide activation via O-acylisourea formation followed by subsequent derivitization; sulfydryl group modification by methods such as performic acid oxidation to cysteic acid; formation of mercurial derivatives; formation of a mixed disulfides; alkylation of tryptophan residues; nitration of tyrosine residues; and modification of the imidazole ring of a histidine residue by alkylation; although without limitation thereto.
  • non-natural amino acids include but are not limited to, use of 4-amino butyric acid, 6-aminohexanoic acid, 4-amino-3-hydroxy-5-phenylpentanoic acid, 4-amino-
  • the invention provides an isolated nucleic acid encoding the aforementioned isolated protein of the invention.
  • the isolated nucleic acid of the invention may be useful for recombinant protein expression in vivo in an animal, or in a host cell for the purposes of subsequent recombinant protein purification. It will be appreciated by persons skilled in the art that advantage may be taken of degeneracy in the genetic code to alter an encoding nucleotide sequence of an amino acid sequence.
  • a nucleotide sequence may be engineered according to codon preference or usage in an organism or cell type to thereby optimize encoded protein translation and expression in that organism or cell type.
  • nucleic acid designates single-or double-stranded mR A, RNA, cRNA and DNA, said DNA inclusive of cDNA and genomic DNA.
  • Nucleic acids may comprise genetically-encoded bases such as adenine, guanine, cytosine, thymine and uracil, or modified bases such as inosine, methylinosine and methyladenosine, thiouridine and methylcytosine, although without limitation thereto.
  • bases such as adenine, guanine, cytosine, thymine and uracil, or modified bases such as inosine, methylinosine and methyladenosine, thiouridine and methylcytosine, although without limitation thereto.
  • a "polynucleotide” is a nucleic acid having eighty (80) or more contiguous nucleotides, while an “oligonucleotide” has less than eighty (80) contiguous nucleotides.
  • a “probe” may be a single or double-stranded oligonucleotide or polynucleotide, suitably labelled for the purpose of detecting complementary sequences in Northern or Southern blotting, for example.
  • a “primer” is usually a single-stranded oligonucleotide, preferably having 15-50 contiguous nucleotides, which is capable of annealing to a complementary nucleic acid "template” and being extended in a template-dependent fashion by the action of a DNA polymerase such as Taq polymerase, RNA-dependent DNA polymerase or SequenaseTM.
  • a DNA polymerase such as Taq polymerase, RNA-dependent DNA polymerase or SequenaseTM.
  • amplification product refers to a nucleic acid product generated by nucleic acid amplification techniques.
  • An embodiment of an isolated nucleic acid comprises a nucleotide sequence set forth in any one of SEQ ID NOS: 50-57 and as shown in FIG. 15.
  • isolated nucleic acids that encode variants and/or derivatives of the isolated protein as hereinbefore described.
  • nucleic acid variants encode isolated protein variants as hereinbefore described.
  • nucleic acid variants encode isolated proteins disclosed herein, or variants thereof, said nucleic acid variants adopting nucleotide sequence changes due to redundancy in the genetic code.
  • such variants are "codon optimized" for expression in a particular organism or cell type.
  • Isolated nucleic acid variants may hybridize with an isolated nucleic acid encoding an isolated polyepitope protein under high stringency wash conditions.
  • High stringency conditions include and encompass:-
  • isolated nucleic acid variants may have at least 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a reference nucleic acid.
  • reference nucleic acids comprise a nucleotide sequence set forth in any one ofSEQ ED NO:50-57.
  • Another aspect of the invention provides a genetic construct comprising an isolated nucleic acid of the invention, or a variant thereof.
  • the genetic construct may facilitate propagation, cloning and/or expression of the isolated nucleic acid.
  • the genetic construct is an expression construct comprising an isolated nucleic acid of the invention operably linked to one or more regulatory sequences present in an expression vector.
  • an “expression vector” may be either a self-replicating extra-chromosomal vector such as a plasmid, or a vector that integrates into a host genome.
  • the expression vector provides said one or more regulatory nucleotide sequences.
  • operably linked is meant that said regulatory nucleotide sequence(s) is/are positioned relative to the recombinant nucleic acid of the invention to initiate, regulate or otherwise control transcription.
  • Regulatory nucleotide sequences will generally be appropriate for the host cell used for expression. Numerous types of appropriate expression vectors and suitable regulatory sequences are known in the art for a variety of host cells.
  • said one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader or signal sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and silencer, enhancer or activator sequences.
  • constitutive promoters such as CMV, SV40, vaccinia, HTLV 1 and human elongation factor promoters
  • inducible/repressible promoters such as tei-repressible promoters and 1PTG-, metallothionin- or ecdysone-inducible promoters
  • promoters may be hybrid promoters that combine elements of more than one promoter, such as but not limited to the SRa promoter which is a hybrid between elements of HTLV1 and SV40 promoters.
  • said expression construct also includes one or more selectable markers suitable for the purposes of selection of transformed bacteria (such as bla, kanR and tetR) or transformed mammalian cells (such as hygromycin, G418 and puromycin).
  • selectable markers suitable for the purposes of selection of transformed bacteria (such as bla, kanR and tetR) or transformed mammalian cells (such as hygromycin, G418 and puromycin).
  • Expression constructs may be transfected, transformed or otherwise introduced into host cells by any of a number of well known techniques including, but not limited to, transformation by heat shock, electroporation, DEAE-Dextran transfection, microinjection, liposome-mediated transfection, calcium phosphate precipitation, protoplast fusion, microparticle bombardment, viral transformation and the like.
  • Suitable host cells for expression may be prokaryotic or eukaryotic, such as bacterial cells inclusive of Escherichia coli (DH5aiox example,), yeast cells such as Pichia pastoris, Sf9 cells utilized with a baculovirus expression system, mammalian cell lines such as human embryonic kidney (HEK) 293 cells, CHO cells, COS cells, CVl cells, Jurkat and NIH3T3 cells although without limitation thereto.
  • prokaryotic or eukaryotic such as bacterial cells inclusive of Escherichia coli (DH5aiox example,), yeast cells such as Pichia pastoris, Sf9 cells utilized with a baculovirus expression system, mammalian cell lines such as human embryonic kidney (HEK) 293 cells, CHO cells, COS cells, CVl cells, Jurkat and NIH3T3 cells although without limitation thereto.
  • HEK human embryonic kidney
  • Another aspect of the invention provides a method of producing the isolated protein disclosed herein in recombinant form, said method including the steps of expressing the isolated protein in a host cell as hereinbefore described and at least partly purifying the isolated protein under conditions that maintain the isolated protein in a substantially non- aggregated form.
  • non-aggregated in this context is meant that a substantial portion of the isolated protein is in a soluble form in aqueous solution, typically in the absence of denaturing agents such as urea, SDS or guanidinium chloride.
  • IBs inclusion bodies
  • IBs may be solubilised and the recombinant protein purified using an affinity matrix (such as a Ni-NTA matrix)
  • isolated proteins comprising twenty (20) CMV CTL epitopes were resistant to this treatment.
  • a preferred form of the invention provides an isolated protein comprising less than twenty (20) CMV and/or EBV CTL epitopes. Given that each CMV CTL epitope in Tables 1 and 2 comprises 8-13 amino acids, less than twenty (20) CMV CTL epitopes is equivalent to less than 160-240 constituent, epitope amino acids.
  • one embodiment of the invention provides a method of producing the isolated protein disclosed herein in recombinant form, said isolated protein having fewer than twenty (20) CMVCTL epitopes or 160-240 constituent epitope amino acids, said method including the steps of expressing the isolated protein in a bacterial host cell as hereinbefore described and at least partly purifying the isolated protein under conditions that maintain the isolated protein in a substantially non-aggregated form, wherein the conditions include maintaining the isolated recombinant protein in an MES buffer or a glycine buffer under acidic conditions.
  • Acidic conditions may be any pH below 7, preferably in the range pH 2-6 or more preferably in the range of about pH 2.5 to about pH 5.6.
  • the expression construct of the invention is suitable for use as a DNA vaccine.
  • the expression construct of the invention may be a construct that utilizes an expression and delivery vector of viral origin, such as pox viruses and adenoviruses or a DNA plasmid vector.
  • expression constructs of viral origin may be administered to an animal in the form of VLPs or as a "naked" nucleic acid construct.
  • the expression construct according to this embodiment comprises a vaccinia virus promoter, such as the p7.5 promoter present in a plasmid vector.
  • a vaccinia virus promoter such as the p7.5 promoter present in a plasmid vector.
  • the invention provides an adenovirus-based expression construct for use in a vaccine delivery system.
  • Adenovirus-based constructs are capable of infecting a broad spectrum of mammalian and human cells, including both quiescent and proliferating cell types.
  • Such adenovirus-based expression constructs may comprise a constitutive or inducible/repressible promoter such as by way of a tetracycline inducible/repressible system.
  • adenovirus-based expression construct is derived from a replication-incompetent A5 adenovirus lacking at least an El gene.
  • Ad5/F35 adenovirus-based expression construct and vaccine delivery system is provided in detail hereinafter. Reference is also made to Yotdna et ah, 2001, Gene Therapy 8 930, in relation to the Ad5/F35 embodiment of adenovirus expression vectors.
  • the isolated protein of the invention isolated nucleic acids and expression constructs encoding same may be useful in therapeutic and/or prophylactic treatment of a herpesevirus-associated disease or condition such as a Cytomegalovirus- associated or Epstein-Barr-associated disease and/or condition in animals, preferably humans.
  • a herpesevirus-associated disease or condition such as a Cytomegalovirus- associated or Epstein-Barr-associated disease and/or condition in animals, preferably humans.
  • CMV infection can cause a mononucleosis-like syndrome with prolonged fever, and/or a mild hepatitis.
  • disease can be more severe, such as during infection of the unborn baby during pregnancy, in people who work with children, and in immunocompromised persons, such as the aged, organ transplant recipients and persons infected with human immunodeficiency virus (HIV).
  • CMV may also be associated with some cancers such as glioma.
  • the invention therefore provides pharmaceutical compositions and or methods of prophylactic or
  • EB V infection can cause serious mononucleosis and is also associated with a variety of cancers and possibly autoimmune disorders.
  • the invention therefore provides pharmaceutical compositions and/or methods of prophylactic or therapeutic treatment of CMV infection, preferably in humans.
  • compositions and methods are suitable for delivery of the isolated protein in recombinant form, or encoded by an expression construct such as in a viral delivery vector.
  • the pharmaceutical composition may comprise separate isolated proteins respectively comprising CMV and EBV CTL epitopes or may comprise a single isolated protein comprising both EBV and CMV epitopes.
  • compositions further comprise a pharmaceutically- acceptable carrier, diluent or excipient.
  • pharmaceutically-acceptable carrier diluent or excipienf is meant a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic administration.
  • a variety of carriers well known in the art maybe used.
  • These carriers maybe selected from a group including sugars, starches, cellulose and its derivatives, malt, gelatine, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline and salts such as mineral acid salts including hydrochlorides, bromides and sulfates, organic acids such as acetates, propionates and malonates and pyrogen- free water.
  • any safe route of administration may be employed for providing a patient with the composition of the invention.
  • oral, rectal, parenteral, sublingual, buccal, intravenous, intra-articular, intra-muscular, intra-dermal, subcutaneous, inhalational, intraocular, intraperitoneal, intracerebro ventricular and transdermal administration maybe employed.
  • Dosage forms include tablets, dispersions, suspensions, injections, solutions, syrups, troches, capsules, suppositories, aerosols, transdermal patches and the like. These dosage forms may also include injecting or implanting controlled releasing devices designed specifically for this purpose or other forms of implants modified to act additionally in this fashion. Controlled release of the therapeutic agent may be effected by coating the same, for example, with hydrophobic polymers including acrylic resins, waxes, higher aliphatic alcohols, polylactic and polyglycolic acids and certain cellulose derivatives such as hydroxypropylmethyl cellulose. In addition, the controlled release maybe effected by using other polymer matrices, liposomes and/or microspheres.
  • Preferred pharmaceutical compositions are "immunogenic compositions" that elicit a CT: response to thereby provide prophylactic and/or therapeutic treatment of herpesvirus (e.g CMV and/or EBV) responsive to such immunotherapy, without necessarily eliciting a protective immune response.
  • herpesvirus e.g CMV and/or EBV
  • the immunogenic composition may be a vaccine for eliciting a protective CD8 + CTL-based immune response in a human subject that protects against CMV infection, or treats an existing herpesvirus (e.g CMV and/or EBV) infection.
  • a protective CD8 + CTL-based immune response in a human subject that protects against CMV infection, or treats an existing herpesvirus (e.g CMV and/or EBV) infection.
  • the pharmaceutical composition inclusive of immunogenic compositions and vaccines, comprises the isolated protein disclosed herein and said pharmaceutically-acceptable carrier, diluent or excipient.
  • the isolated protein comprising a plurality of CMV and/or EBV CTL epitopes are highly efficient in generating CMV- specific CD8 + T cell responses in virus healthy carriers.
  • expanded CD8 + T cells demonstrated strong expression of IFN- ⁇ , TNF, MIP- ⁇ and CD 107a following stimulation with the protein. It is proposed that these functional characteristics of the CD8 + T cells are important for predicting the efficacy of CTL- mediated immune responses and virus clearance.
  • a pharmaceutical composition inclusive of immunogenic compositions and vaccines, comprising a nucleic acid expression construct, inclusive of DNA vaccines, encoding the isolated protein disclosed herein and said pharmaceutically-acceptable carrier, diluent or excipient.
  • the pharmaceutical composition, inclusive of immunogenic compositions and vaccines may comprise an expression construct that utilizes a viral vector such as an adenoviral vector or pox virus-derived vector as hereinbefore described.
  • Any suitable procedure is contemplated for producing such vaccines.
  • Exemplary procedures include, eg. , those described in New Generation Vaccines ( 1997, Levine etal. Marcel Dekker, Inc. New York, Basel, Hong Kong) which is incorporated herein by reference.
  • compositions, immunogenic compositions, vaccines and/or methods of prophylactic or therapeutic treatment may include one or more immunostimulatory molecules or adjuvants for administration to the animal.
  • Suitable immunostimulatory molecules and adjuvants include, but are not limited to: TLR agonists, lipopolysaccharide and derivatives thereof such as MPL, Freund's complete or incomplete adjuvant, hexadecylamine, octadecylamine, octadecyl amino acid esters, lysolecithin, dimethyldioctadecylammonium bromide, N,N-dicoctadecyl-N', ⁇ 3 ⁇ 4 ⁇ 8(2- hydroxyethyl-propanediamine), methoxyhexadecylglycerol, and pluronic polyols; polyamines such as pyran, dextransulfate, poly IC carbopol; peptides such as muramyl dipeptide and derivatives, dimethylglycine, tuftsin; oil emulsions; and mineral gels such as aluminum phosphate, aluminum hydroxide or alum;
  • compositions, immunogenic compositions, vaccines and/or methods of prophylactic or therapeutic treatment may include one or more other TLR agonists for administration to the animal.
  • the one or more TLR agonists include a TLR4 agonist and/or a TLR9 agonist.
  • TLR4 agonists are lipolopysacchardides (LPS) or derivatives or components of LPS. These include Monophosphoryl lipid A (MPL ® ) derived from Salmonella minnesota and synthetic TLR4 agonists such as aminoalkyl glucosaminide phosphates (AGPs). A preferred TLR4 agonist is MPL.
  • LPS lipolopysacchardides
  • MPL ® Monophosphoryl lipid A
  • AGPs aminoalkyl glucosaminide phosphates
  • TLR9 recognizes specific unmethylated CpG oligonucleotides (ODN) sequences that distinguish microbial DNA from mammalian DNA.
  • CpG ODNs oligonucleotides contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs). These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian D A.
  • type A, B and C Three types of stimulatory ODNs have been described: type A, B and C.
  • Non-limiting examples of TLR9 agonists include CpG ODN1826, CpG ODN2006, CpG ODN2216 and CpG ODN2336, although without limitation thereto.
  • compositions, immunogenic compositions, vaccines and/or methods of prophylactic or therapeutic treatment may employ any safe route of administration may be employed for providing a patient with the composition of the invention.
  • oral, rectal, parenteral, sublingual, buccal, intravenous, intraarticular, intra-muscular, intra-dermal, subcutaneous, inhalational, intraocular, intraperitoneal, intracerebroventricular, transdermal and the like may be employed.
  • Intramuscular and subcutaneous injection is appropriate, for example, for administration of immunogenic compositions, proteinacious vaccines and DNA vaccines.
  • the invention contemplates adoptive immunotherapy.
  • the invention contemplates adoptive immunotherapy using autologous CTLs produced in vitro.
  • the isolated protein of the invention is expected to be more advantageous than either of these prior art approaches by facilitating expansion of broadly focussed T cell responses.
  • a method of expanding herpesvirus-specific CTLs for adoptive immunotherapy includes the steps of:
  • a method of adoptive immunotherapy includes the step of administering said herpesvirus-specific CTLs produced at step (b) to an animal to thereby prophylactically or therapeutically treat a herpesvirus infection of said animal.
  • the animal is a mammal, such as a human.
  • the invention provides a method of autologous adoptive immunotherapy in a human including the steps of: (A) contacting one or more cells isolated from a human with an isolated protein disclosed herein;
  • the herpesvirus is CMV or EBV.
  • CMV polyepitope inserts were designed to encode multiple HLA class I restricted T-cell epitopes from five different antigens (pp65, IE-1, pp50, ppl50 and gB). These polyepitope sequences encoded 13, 14, 15 or 20 different HLA class I-restricted CD8 + epitopes (see Table 1).
  • the polyepitope sequences were designed in such a way that each epitope sequence was preceded by a proteasome liberation amino acid sequence (AD or K or R) and a TAP recognition motif (RIW, ROW, NIW or NQY).
  • a hexa-histidine tag was inserted at the c-terminus of each polyepitope protein to allow purification using a nickel- nitrilotriacetic acid (Ni-NTA) column.
  • Ni-NTA nickel- nitrilotriacetic acid
  • coli codon utilisation and inserts were synthetically constructed (DNA2.0, California, USA) and cloned into an expression plasmid (pJexpress 404) under an isopropyl - ⁇ -D-thiogalactopyraniside (IPTG) inducible promoter.
  • IPTG isopropyl - ⁇ -D-thiogalactopyraniside
  • These synthetically designed polyepitope constructs were transformed into chemically competent E. coli DH5a (Invitrogen, Carlsbad, CA, USA) and plasmids were purified using a QIAGEN maxi prep kit (QIAGEN, Hilden, Germany). Protein expression
  • CMV polyepitope protein induction was carried out by adding 1 mM/mL of IPTG. These cells were allowed to grow for an additional 4 hours and protein expression levels were determined by analysing un-induced and induced samples on 12-15% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS- PAGE).
  • E. coli cultures were harvested by centrifugation at 10,000 rpm for 15 minutes, the cell pellet was resuspended in 80 mL of lysis buffer (25 mM Tris pH 7.4, 0.5% TritonXlOO, 150 mM NaCl, 0.5 mg mL lysozyme) supplemented with a protease inhibitor cocktail (Roche, Mannheim, Germany) and incubated on the ice for 30 minutes. Cell lysis was carried out by sonication on ice for 4 x 5 minutes cycles with a 10 minute break between each cycle. The lysate was centrifuged at 13,000 rpm for 30 minutes and supernatant and pellet fractions were analysed using SDS-PAGE.
  • lysis buffer 25 mM Tris pH 7.4, 0.5% TritonXlOO, 150 mM NaCl, 0.5 mg mL lysozyme
  • IBs inclusion bodies
  • the bound protein was eluted with elution buffer (100 mM NaH 2 P0 4 , 10 mM Tris, 8 M urea pH 4.3) and the eluted fractions were analysed using SDS-PAGE.
  • the positive fractions were pooled together and CMV polyepitope protein estimation was carried out using a Bradford assay kit (Bio-Rad, Hercules, California, USA) following the manufacturer's instructions.
  • Purified protein was subjected to a solubility test (to identify the right buffer composition for storing the protein in the soluble form) in which 80 ⁇ , ⁇ purified protein was diluted into 800 ⁇ , of various compositions of buffers with different pH ranges.
  • CMV polyepitope protein was dialysed against 25 mM MES buffer at pH 5.6. The CMV polyepitope protein was concentrated using Ultracel-IOK spin columns (Millipore, County Cork, Ireland) followed by sterile filtration using 0.22 ⁇ membrane filter, total protein was estimated using BIO- RAD Bradford protein assay kit and various concentrations of CMV polyepitope protein was analysed using SDS-PAGE to determine the final purity of polyepitope protein. The purified protein was stored in 1 ml aliquots at -70°C. In vitro stimulation and expansion of CMV specific T-cells from healthy donors using polyepitope proteins
  • PBMC Peripheral blood mononuclear cells
  • RPMI 1640 medium supplemented with 10% FCS (referred to as growth medium).
  • FCS referred to as growth medium
  • T cell specificity of these in vitro expanded cells was assessed using a standard ICS assay.
  • T cells in these cultures were also assessed for polyfunctional capacity using multi-parameter flow cytometry.
  • Epstein-Barr virus (EBV) transformed LCLs and HEK 293 cells were used as antigen presenting cells in these assays. These cells were pulsed with 25-100 ⁇ g of CMV polyepitope protein for two hours at 37°C, 6.5% C0 2 and then washed twice with RPMI 1640 medium, resuspended in growth medium and incubated overnight at 37°C, 6.5% C0 2 . After overnight incubation, antigen presenting cells were exposed to CMV-specific T cells at a responder to stimulator ratio of 4:1 for four hours at 37°C, 6.5% C0 2 and T cells assessed for cytokine expression using ICS assays.
  • EBV Epstein-Barr virus
  • LCLs were pre-treated with different inhibitors and then used as antigen presenting cells. These inhibitors were specifically targeted to inhibit lysosomes/endosome acidification(80 ⁇ chloroquine and 10 mM Bafilomycin Al), the recycling pathway (200 ⁇ primaquine), cysteine proteases (100 ⁇ leupeptin and 100 ⁇ E64), acid proteases (pepstatin A), autophagy mediators ( 10 mM 3-methyladenine(3 - MA)), the proteasome complex (10 ⁇ lactacystine, 1 ⁇ epoxomicin and MG132), golgi transport (1 ⁇ g/mL brefeldin A and 0.7 ⁇ g mL monensin) or aminopeptidase enzymes (30 ⁇ leucinethiol with 0.5mM dithiothreitol (DTT)).
  • DTT dithiothreitol
  • cells were incubated with 25 g of CMV polyepitope protein for two hours at 37°C, 6.5% C0 2> washed twice with RPMI 1640 medium, resuspended in growth medium and incubated overnight at 37°C, 6.5% C0 2 . After overnight incubation, cells were exposed to CMV-specific T cells at a responder to stimulator ratio of 4:1 for four hours at 37°C, 6.5% C0 2 and T cells assessed for cytokine expression using ICS assays.
  • Lentivirus based vectors encoding ATG12 shRNA (clone ID NM_004707.2- 485slcl, (CCGGTGTTGCAGCTTCCTACTTCAACTCGAGTTGAAGTAGGAAGCTGCAACAT
  • TTTT SEQ ID NO:59
  • Sec61 shRNA clone ID NM_006808.2-410slcl, CCGGCCCAACATTTCTTGGACCAAACTCGAGTTTGGTCCAAGAAATGTTGGGTT TTTTG; SEQ ID NO:60
  • Plasmid 5 encoding shRNA was purified using the large scale plasmid purification kit (Qiagen, Hilden, Germany). Lentivirus was produced in HEK293T cells by cotransfecting the shRNA vector or control vector (pLKO.
  • lpuro with a packaging vector, pHR8.2AR, and an envelope vector, pCMV-VSV-G (vesicular stomatitis virus glycoprotein G).
  • pCMV-VSV-G vesicular stomatitis virus glycoprotein G.
  • Lentivirus containing supernatant was harvested, 0.45 ⁇ 10 filtered, and stored at -80°C.
  • Transduction was performed by resuspending 3x10 5 CEM.T1 , CEM.T2 cells or LCLs in lmL of lentivirus containing supernatant and centrifuging for 30 minutes at 800g and32°C.
  • Puromycin (1 ⁇ g ⁇ lL) was added 48 hours after transduction. To generate complete knock down cells were reinfected with the identical lentivirus vector on day 10 and cells were used for downstream assays after 5-7 days of transduction.
  • Protein was quantified using a DC protein assay kit (Bio-Rad laboratories, Hercules, CA, USA). Lysate was mixed with SDS-PAGE loading buffer and resolved on 12-15% SDS-PAGE gels, then transferred to a nitrocellulose membrane (using a Mini Trans-Blot apparatus (Bio-Rad, CA, USA) in pre-chilled transfer buffer (IX Tris-glycine buffer containing 20% methanol) at 100V for 1 hour. Following transfer the nitrocellulose
  • CMV poiyepitope inserts encoding 13, 14, 15 or 20 minimal CD8 + T cell epitopes were designed as outlined in Figure 1.
  • a comprehensive list of CMV epitopes included in each of these poiyepitope sequences are presented in Table 1.
  • These CMV poiyepitope constructs were transformed into E. coli, protein expression conditions were optimised and analysed on SDS-PAGE. Results obtained from these experiments showed that CMV poiyepitope protein ( 13, 14, 15 and 20mer) can be successfully expressed using a bacterial expression system under an IPTG inducible promoter at 37° C (Fig. 2A & B).
  • the CMV poiyepitope protein was aggregated in the form of inclusion bodies (IBs, data not shown). These IBs were solubilised and CMV poiyepitope proteins from constructs encoding 13 , 14 or 15 epitopes were purified using Ni-NTA matrix. This one step purification process allowed us to purify these CMV poiyepitope proteins to homogeneity (Fig. 3A-C). However, purification of CMV poiyepitope 20mer was not successful, despite using two different denaturing agents, 8M urea and 6M guanadine hydrochloride, to solubilise the IBs.
  • CD8 + T cells expanded following stimulation with polyepitope proteins display polyfunctional profile
  • FIG. 8A Representative FACS plots presented in Figure 8A shows that HLA A2 -restricted NLV (pp65), HLA Al- restricted VTE (pp50), HLA B7-restricted RPH and TPR (pp65) epitopes from CMVpoly- PL or PTL were more efficiently processed and presented to CMV-specific T cells compared to LCLs pulsed with CMVpoly. More importantly, the activation of CMV- specific T cells were significantly higher following stimulation with LCL pulsed with CMVpoly-PL or CMVpoly-PTL compared to CMVpoly ( Figure 8B). Collectively, these data indicate that to enhance the processing and presentation of the exogenously delivered polyepitope proteins to the antigen-specific CD8 + T cells requires proteasome and/or TAP linkers between the epitopes
  • CD8 + T cell epitopes from the polyepitope protein are cross-presented through a TAP- independent pathway but involves proteasome and the autophagy dependent pathway
  • bafilomycin Al is also a potent and specific inhibitor of vacuolar H+ ATPase and prevents maturation of autophagic vacuoles by inhibiting fusion between autophagosomes and lysosomes.
  • antigen presenting cells with the PI3K inhibitor, 3-methyladenine (3 -MA) and then exposed to CMV-specific T cells.
  • 3-MA treatment also effected the presentation of CD8 + T cell epitopes from the polyepitope protein.
  • CEM.T 1 and CEM.T2 cells were pre-treated with the proteasome inhibitors lactacystin, epoxomicin and MG132 and then pulsed with polyepitope protein. These cells were then assessed for the presentation of CD8 + T cell epitopes. Data presented in Figure 10B shows that all three proteasome inhibitors completely blocked the presentation of CD8 + T cell epitopes from the polyepitope proteins.
  • CD8 + T cell epitopes does not depend on the expression of immunoproteasomes since CEM.T2 cells, which don't express these components of the proteolytic complex, can efficiently process CD8 + epitopes from the polyepitope protein.
  • CEM.T2 cells which don't express these components of the proteolytic complex, can efficiently process CD8 + epitopes from the polyepitope protein.
  • Data presented in Figure IOC shows that pre- treatment with brefeldin-A and monensin significantly blocked presentation to CD8 + T cells, while leucinethiol treatment had minimal effect on the T cell recognition of CEM.T1 and CEM.T2 cells.
  • the CMV polyepitope vaccine was formulated by mixing 20 g of CMVpoly, CMVpoly-PL or CMVpoly-PTL with 25 ⁇ g of MPL (TLR4 agonist) and 50 ⁇ g of CpG ODN1826 (TLR9 agonist) per dose in a 100 ⁇ ⁇ volume.
  • TLR agonists were purchased from InvivoGen (San Diego, CA, USA).
  • mice containing human HLA-A*0201 with a disrupted murine MHC class I were bred and maintained under specific pathogen-free conditions at the QIMR. All protocols were followed in compliance with the QIMR animal ethics committee.
  • mice were immunised subcutaneously (s.c.) at the base of the tail with the CMV polyepitope vaccine formulated with the above specified adjuvant combinations.
  • Mice were boosted with an identical vaccine formulation on day 21 and mice were sacrified on day35 to determine the polyepitope specific CD8 + T cell responses using intracellular cytokine staining (ICS) assay.
  • ICS cytokine staining
  • mice were sacrificed by C0 2 asphyxiation and spleens were collected in 3 mL of mouse T cell culture medium (DMEM supplemented with 10% FBS, 100 IU/mL penicillin, 200 ⁇ g mL streptomycin sulphate, ⁇ -mercaptoethanol, non-essential amino acids and sodium pyruvate).
  • Single cell suspensions were prepared by gently mashing the spleen with a plunger of a syringe.
  • Cells were centrifuged at 1200 rpm for 5 minutes, resuspended in 3 mL of ammonium chloride and Tris buffer (0.017M Tris base in 0.89% ammonium chloride, pH7.4) then incubated for five minutes at room temperature to deplete red blood cells. Cells were centrifuged, washed twice with PBS containing 2% FBS and resuspended in 5 mL of mouse T cell culture medium. To remove excess tissue and cellular debris, the final cell suspension was filtered through a 70 ⁇ cell strainer (Becton Dickinson, San Diego, USA). Cell viability was then determined using the Trypan Blue exclusion method.
  • Tris buffer 0.017M Tris base in 0.89% ammonium chloride, pH7.4
  • mice In vitro stimulation and expansion of CMV specific T-cells from immunised mice Approximately 5x 10 6 splenocytes from vaccinated mice were stimulated with 1 ⁇ g of HLA A2 restricted NLV and VLE peptides in 100 ⁇ of mouse T cell culture medium at 37°C, 6.5% C0 2 for 2 hours. After incubation, 1 mL of mouse T cell culture medium was added, cells were transferred to 24 well plate and cultured for 10 days at 37°C, 6.5% C0 2 . On days 3 and 6, cultures were supplemented with 1 mL of T cell culture medium containing 100 U of recombinant IL-2. The T cell specificity of these in vitro expanded cells was assessed using a standard IFN- ⁇ ICS assay. In addition, T cells in these cultures were also assessed for polyfunctional capacity using multi-parameter flow cytometery.
  • mice splenocytes were added to the required wells.
  • 0.2 ⁇ g of NLV and VLE peptides were added and then 150 ⁇ , of DMEM containing 0.3 ⁇ , of Brefeldin A (BD Pharmingen, San Diego, CA) was added to each well and incubated for four hours at 37°C, 10% C0 2 .
  • Cells were washed twice with PBS containing 2% FCS (wash buffer), surface stained with APC-conjugated anti-CD3, FITC-conjugated anti-CD4 and PerCP-Cy5.5 conjugated anti-CD8 monoclonal antibodies resuspended in wash buffer and incubated at 4°C for 30 minutes. Cells were washed twice with wash buffer, fixed with 100 well of Cytofix/Cytoperm and washed twice with Perm/Wash buffer. Cells were then intracellularly stained with PE conjugated anti-IFN- ⁇ monoclonal antibody at 4°C for 30 minutes, cells were washed twice Perm/W ash buffer and acquired on a BD FACSCanto II.
  • Multi-parametric flow cytometry to assess the immune responses in vaccinated mice Following vaccination splenocytes were stimulated ex vivo as mentioned above. Cells were surface stained with FITC conjugated anti-CD4 and PerCP-Cy5.5 conjugated anti-CD8 for 30mins at 4° C. After washing, fixing and permeabilising, cells were stained intracellularly with PE-conjugated anti-IFN- ⁇ , PE-Cy7 conjugated anti-TNF and APC conjugated anti-IL2 antibodies. Cells were acquired on a BD FACSCanto II and data was analysed using FlowJo software and Boolean gate analysis. Results
  • a subunit vaccine formulation based on CMV-encoded glycoprotein B (gB) and polyepitope proteins was tested in combination with human compatible TLR agonists.
  • the polyepitope protein included multiple minimal HLA class I- restricted CD8 + T cell epitopes from different antigens of CMV.
  • This subunit vaccine generated durable anti-viral antibody, Thl CD4 + and CD8 + T cell responses.
  • the humoral immune response induced by the vaccine displayed strong neutralisation capacity and the antigen-specific T cells expressed multiple cytokines with long-term memory maintenance.
  • this subunit CMV vaccine through the activation of TLR4 and TLR9, activated different dendritic cell (DC) subsets expressing IL12p70, IFN-a, IL-6 and TNF-a, which play a crucial role in the activation of antigen-specific T cells.
  • DC dendritic cell
  • mice immunised with CMVpoly-PL or CMVpoly- PTL vaccine formulation induced significantly higher frequencies of CMVpolyepitope- specific CD8 + T cells compared to mice immunised with CMVpoly vaccine formulation (Figure 12A).
  • the protective efficacy of T cell- based vaccines correlates with the frequencies of multifunctional effectors.
  • CMV-specific CD8 + T cells responses in healthy CMV-seropositive individuals are directed towards multiple CMV antigens, predominantly pp65 and IE 1, but also other structural, early/late antigens and immunomodulators (pp28, pp50, ppl50, IE2 gH, gB, US2, US3, US6 and UL18) (Elkington, Walker et al. 2003; Elkington, Shoukry et al. 2004; Manley, Luy et al. 2004; Khan, Bruton et al. 2005; Sylwester, Mitchell et al. 2005).
  • CD8 + T cell responses play a critical role in immunity to CMV, controlling viral replication and preventing the clinical manifestations of progressive infection in both animal models as well as in humans (Quinnan, Kirmani et al. 1982; Rook, Quinnan et al. 1984; Reddehase, Weiland et al. 1985).
  • a vaccine against CMV that can induce T cells responses against multiple antigens will likely strengthen protection against CMV-associated disease. Therefore to target multiple antigens, especially to induce CD8 + T cell responses, in this study we have proposed a novel recombinant based polyepitope vaccine technology.
  • Polyepitope based vaccines provide a powerful approach to induce immune responses against a variety of conserved epitopes from a number of antigens without the use of full length antigens which may comprise unknown or pathogenic properties.
  • CMV polyepitope proteins 13mer, 14mer, 15mer and 20mer were designed by covalently linking multiple HLA class I restricted T-cell epitopes to potentiate CMV-specific CD8 + T cell responses against a number of antigens in different ethnic populations.
  • Selected epitopes in the CMV polyepitope constructs were derived from highly conserved multiple antigens of CMV, including pp65, pp50, ppl50, DNAse, and IE- 1 (Brytting, Wahlberg et al. 1992; Retiere, Imbert et al. 1998; Solache, Morgan et al. 1999).
  • the selected CD8 + T cell epitopes were linked together with a linker sequence consisting of a proteasome liberation amino acid sequence (AD or K or R) and a TAP (transporter associated with antigen processing) recognition motif (RIW, ROW. N1W or NQY) at the carboxyl terminus of each epitope.
  • a linker sequence consisting of a proteasome liberation amino acid sequence (AD or K or R) and a TAP (transporter associated with antigen processing) recognition motif (RIW, ROW. N1W or NQY) at the carboxyl terminus of each epitope.
  • T cells are highly important for predicting the efficacy of T cell mediated immune responses and virus clearance [reviewed in (Seder, Darrah et al. 2008)].
  • LCLs human B cells
  • HE 293 epithelial cells
  • the majority of the HLA restricted epitopes encoded by the CMV polyepitope were processed and presented efficiently to antigen-specific T cells, confirming the propensity of the polyepitope protein to deliver epitopes for presentation via the MHC class I pathway.
  • exogenous proteins are internalised, processed and presented by MHC class I molecules on antigen presenting cells
  • exogenously loaded polyepitope protein processing and presentation by antigen presenting cells has never been reported.
  • cross-presentation of exogenous antigens by dendritic cells has been shown to operate using three different pathways.
  • the first proposed model uses an indirect pathway of transferring exogenous antigens from phago-endosomes to the cytosol for proteasome dependent processing. Processed peptides are then loaded in the endoplasmic reticulum by the classical MHC class I machinery (Huang, Bruce et al. 1996).
  • the second model is a direct, proteasome independent pathway whereby antigens are processed and loaded on MHC class I entirely in endosomal compartments (Shen, Sigal et al. 2004).
  • the third proposed model utilises the delivery of endoplasmic reticulum components to endocytic organelles or the transport of incoming antigen to the endoplasmic reticulum (Guermonprez, Saveanu et al.2003; Houde, Bertholet et al.2003).
  • Immunotherapies against cancers as well as in immune tolerance to self antigens to prevent autoimmunity cross-presentation of exogenous antigens to naive CD8 + T cells is the prerequisite for the induction of cytotoxic T cell responses (Rock and Shen 2005).
  • CEM.Tl and CEM.T2 cells in the presence of various chemical inhibitors involved in different stages of antigen presentation.
  • CD8 + T cell epitope presentation was mediated via a retrotranslocation pathway whereby exogenously antigens are internalised into phagosomes, then delivered into cytosol through a Sec61 channel and degraded by proteasome into oligopeptides before being transferred to MHC class I molecules in the ER (Ackerman, Giodini et al. 2006; Rock 2006).
  • ATG12 is an ubiquitin-like modifier and its covalent conjugation with another autophagy regulator, ATG5, and plays an essential role in autophagy formation and elongation (Mizushima, Noda et al. 1998; Mizushima, Sugita et al. 1998). Therefore, we conclude that CD8 + T cell epitopes from the polyepitope protein are processed and presented by CEM.T1 and CEM.T2 cells through a novel TAP- independent, proteasome and autophagy dependent pathways.
  • polyepitope proteins can be expressed as a recombinant proteins using prokaryotic expression system in a stable form. These polyepitope proteins are highly immunogenic and may have the preferential access to proteasome and autophagosome dependent pathway while cross-presentation by antigen presenting cells.
  • An EBV polyepitope was designed to encode multiple HLA class I restricted T-cell epitopes from 9 different antigens (BMLF1, BRLF1, BZLF1, LMP2, LMP2a, EBNA1, EBNA3A, EBNA3B and EBNA3C).
  • the epitope HLA restriction, amino acid sequences and amino acid locations of these epitopes are shown in Table 3 and illustrated schemtically in Figure 13A.
  • the polyepitope sequence was designed in such a way that each epitope sequence was preceded by a proteasome liberation amino acid sequence (AD or K or R) and a hexa- histidine tag was inserted at the c-terminus of each polyepitope protein to allow purification using a nickel-nitrilotriacetic acid (Ni-NTA) column.
  • the amino acid sequence of each construct was translated into DNA sequence based on E. coli codon utilisation and inserts were synthetically constructed (DNA2.0, California, USA) and cloned into an expression plasmid (pJexpress 404) under an isopropyl - ⁇ -D-thiogalactopyraniside (IPTG) inducible promoter.
  • EBV polyepitope was transformed into chemically competent E. coli DH5a (Invitrogen, Carlsbad, CA, USA) and plasmids were purified using a QIAGEN maxi prep kit (QIAGEN, Hilden, Germany).
  • E. coli BL21 (DE3) pLysS (Invitrogen, California, USA) was transformed with the EBV polyepitope expression vector.
  • Transformed cells were plated on Luria Bertani (LB) agar supplemented with 100 ⁇ g mL of ampicillin (LB- Amp) and plates were incubated overnight at 37°C.
  • An isolated colony was picked and inoculated into 10 ml of LB- Amp broth and grown in a shaker at 37°C and 200 rpm overnight.
  • a small amount of overnight culture was inoculated into 50 mL of LB- Amp broth and grown for 12 hours, then 1 % of culture was transferred into 2 L of LB- Amp broth that was then was grown until the O.D.
  • EBV polyepitope protein induction was carried out by adding 1 mM mL of EPTG. These cells were allowed to grow for an additional 4 hours and ⁇ protein expression levels were determined by analysing un-induced and induced samples on 15% SDS-PAGE.
  • E. coli culture was harvested by centrifugation at 10,000 rpm for 15 minutes, the cell pellet was resuspended in 80 mL of lysis buffer (25 mM Tris pH 7.4, 0.5% TritonXl 00, 150 mM NaCl, 0.5 mg/mL lysozyme) supplemented with a protease inhibitor cocktail (Roche, Mannheim, Germany) and incubated on the ice for 30 minutes. Cell lysis was carried out by sonication on ice for 4 x 5 minutes cycles with a 10 minute break between each cycle. The lysate was centrifuged at 13,000 rpm for 30 minutes and supernatant and pellet fractions were analysed using SDS-PAGE.
  • lysis buffer 25 mM Tris pH 7.4, 0.5% TritonXl 00, 150 mM NaCl, 0.5 mg/mL lysozyme
  • IBs inclusion bodies
  • the bound protein was eluted with elution buffer ( 100 mM NaH2P04, 10 mM Tris, 8 M urea pH 4.3) and the eluted fractions were analysed using SDS-PAGE as shown in Figure 13B.
  • the positive fractions were pooled together and purified EBV polyepitope protein was dialysed against 25 mM MES buffer at pH 3.5. Following dialysis, the EBV polyepitope protein was concentrated using Ultracel- 1 OK spin columns (Millipore, County Cork, Ireland) followed by sterile filtration using 0.22 ⁇ membrane filter. Final EBV polyepitope protein estimation was carried out using a Bradford assay kit (Bio-Rad, Hercules, California, USA).
  • PBMC Peripheral blood mononuclear cells
  • RPMI 1640 medium supplemented with 10% FCS (referred to as growth medium). These cells were cultured in a 24 well plate for 14 days at 37°C, 6.5% C0 2 . On days 3, 6 and 9 cultures were supplemented with 1 mL of growth medium containing 100 U of recombinant
  • EBV-specific CD8 + T cells are considered to be more effective.
  • generation of EBV-specific CD8 + T cells is restricted by a number of limitations, such as complex manufacturing process and most often such process requires infectious clinical grade virus material, for instance, recombinant adenovirus vectors for delivering the antigens to antigen-presenting cells.
  • EBV polyepitope which can be expressed using a bacterial expression system.
  • An EBV polyepitope encoding 20 minimal CD8 + T cell epitopes from 9 different antigens (BMLF1, LMP2a, BRLF1, LMP2, EBNA3A, BZLF1, EBNA3C, EBNA1 andEBNA3B) was designed as outlined in Figure 13A and each epitope in the polyepitope sequence was separated by a proteasome linker.
  • a comprehensive list of EBV epitopes included in each of these polyepitope sequences are presented in Table 3, The EBV polyepitope construct was transformed into E. coli.
  • Multifunctional TH1 cells define a correlate of vaccine-mediated protection against Leishmania major.” Nat Med 13(7): 843-850.
  • CMV cytomegalovirus
  • Ad-gBCMVpoly A novel chimeric vaccine strategy for human cytomegalo virus-associated diseases. J Clin Virol.
  • ⁇ CTL epitope sequence is in bold, TAP sequence is in italics and proteasome processing sequence is underlined.
  • SEQ DD NOS refer to bolded epitope sequence.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/AU2013/001216 2012-10-19 2013-10-21 Improved human herpesvirus immunotherapy Ceased WO2014059489A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
EP13847496.0A EP2909238A4 (en) 2012-10-19 2013-10-21 IMPROVED IMMUNOTHERAPY AGAINST HUMAN HERPESVIRUS
CN201380065495.XA CN104918960B (zh) 2012-10-19 2013-10-21 改进的人类疱疹病毒免疫疗法
EP21157985.9A EP3872097A1 (en) 2012-10-19 2013-10-21 Improved human herpesvirus immunotherapy
AU2013332272A AU2013332272B2 (en) 2012-10-19 2013-10-21 Improved human herpesvirus immunotherapy
CN202410527083.3A CN118359733A (zh) 2012-10-19 2013-10-21 改进的人类疱疹病毒免疫疗法
CA2889064A CA2889064A1 (en) 2012-10-19 2013-10-21 Improved human herpesvirus immunotherapy
EP18207655.4A EP3466980A3 (en) 2012-10-19 2013-10-21 Improved human herpesvirus immunotherapy
US14/436,239 US9901632B2 (en) 2012-10-19 2013-10-21 Human herpesvirus immunotherapy
JP2015537084A JP2015533366A (ja) 2012-10-19 2013-10-21 改良されたヒトヘルペスウイルス免疫療法
US15/860,145 US11065329B2 (en) 2012-10-19 2018-01-02 Human herpesvirus immunotherapy
AU2018274961A AU2018274961A1 (en) 2012-10-19 2018-12-06 Improved human herpesvirus immunotherapy
US17/226,929 US11896665B2 (en) 2012-10-19 2021-04-09 Human herpesvirus immunotherapy
US18/393,160 US20240156953A1 (en) 2012-10-19 2023-12-21 Human herpesvirus immunotherapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2012904604A AU2012904604A0 (en) 2012-10-19 Improved human cytomegalovirus immunotherapy protein
AU2012904604 2012-10-19

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/436,239 A-371-Of-International US9901632B2 (en) 2012-10-19 2013-10-21 Human herpesvirus immunotherapy
US15/860,145 Continuation US11065329B2 (en) 2012-10-19 2018-01-02 Human herpesvirus immunotherapy

Publications (1)

Publication Number Publication Date
WO2014059489A1 true WO2014059489A1 (en) 2014-04-24

Family

ID=50487350

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2013/001216 Ceased WO2014059489A1 (en) 2012-10-19 2013-10-21 Improved human herpesvirus immunotherapy

Country Status (7)

Country Link
US (4) US9901632B2 (OSRAM)
EP (3) EP2909238A4 (OSRAM)
JP (4) JP2015533366A (OSRAM)
CN (2) CN104918960B (OSRAM)
AU (2) AU2013332272B2 (OSRAM)
CA (1) CA2889064A1 (OSRAM)
WO (1) WO2014059489A1 (OSRAM)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019123169A1 (en) * 2017-12-20 2019-06-27 Glaxosmithkline Biologicals Sa Epstein-barr virus antigen constructs
CN111394376A (zh) * 2020-03-30 2020-07-10 济宁医学院 一种融合基因bfna、重组腺病毒及其制备方法和应用
WO2021217206A1 (en) * 2020-04-28 2021-11-04 The Council Of The Queensland Institute Of Medical Research Human cytomegalovirus polyepitope vaccine composition
WO2022074455A1 (en) * 2020-10-07 2022-04-14 The Council Of The Queensland Institute Of Medical Research Herpesvirus polyepitope vaccines
EP4458419A2 (en) 2018-09-10 2024-11-06 Atara Biotherapeutics, Inc. Methods for expanding antigen-specific car-t cells, compositions and uses related thereto
US12583910B2 (en) 2020-05-06 2026-03-24 Tsinghua University T cell antigen receptor, multimeric complex thereof, and preparation method therefor and use thereof

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2909238A4 (en) 2012-10-19 2016-11-30 Queensland Inst Med Res IMPROVED IMMUNOTHERAPY AGAINST HUMAN HERPESVIRUS
NZ736675A (en) * 2015-05-12 2023-03-31 Memorial Sloan Kettering Cancer Center Methods of treating epstein-barr virus-associated lymphoproliferative disorders by t cell therapy
CN105030047A (zh) * 2015-08-31 2015-11-11 捷赛厨电(北京)科技有限公司 可控制油烟的炒锅
CN110234358A (zh) * 2016-07-18 2019-09-13 昆士兰医学研究所理事会 多病毒特异性的t细胞免疫疗法
AU2019268545A1 (en) * 2018-05-18 2020-12-10 The Council Of The Queensland Institute Of Medical Research Adoptive T-cell therapy for CMV infection and CMV-associated diseases
US11810904B2 (en) 2020-02-24 2023-11-07 PlayNitride Display Co., Ltd. Micro light emitting diode structure and manufacturing method thereof and micro light emitting diode device

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004007556A1 (en) * 2002-07-12 2004-01-22 Csl Limited Expression of hydrophobic proteins
WO2005007689A1 (en) * 2003-07-11 2005-01-27 Alphavax, Inc. Alphavirus-based cytomegalovirus vaccines
WO2006056027A1 (en) * 2004-11-29 2006-06-01 The Council Of The Queensland Institute Of Medical Research Human cytomegalovirus immunotherapy
WO2010014567A2 (en) * 2008-08-01 2010-02-04 Merck & Co., Inc. Variant hcmv pp65, ie1, and ie2 polynucleotides and uses thereof

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPM446594A0 (en) 1994-03-16 1994-04-14 Csl Limited Cytotoxic t-cell epitopes identified within epstein-barr virus
US6703024B2 (en) * 1996-05-24 2004-03-09 The Council Of The Queensland Institute Of Medical Research EBV CTL epitopes
AUPO007396A0 (en) 1996-05-24 1996-06-20 Csl Limited Ebv ctl epitopes
AUPO784197A0 (en) 1997-07-10 1997-08-07 Csl Limited Treatment of nasopharyngeal carcinoma
US7005131B1 (en) * 1999-08-13 2006-02-28 The Rockefeller University Protective antigen of Epstein Barr Virus
EP1242108B1 (en) 1999-12-28 2007-07-11 Pharmexa Inc. Optimized minigenes and peptides encoded thereby
AUPR593101A0 (en) * 2001-06-26 2001-07-19 Council Of The Queensland Institute Of Medical Research, The Cytomegalovirus t cell epitopes
CA2500955A1 (en) 2002-10-03 2004-04-15 Genencor International, Inc. Optimized multi-epitope constructs and uses thereof
US20070048329A1 (en) 2002-11-07 2007-03-01 Rajiv Khanna Epstein barr virus peptide epitopes, polyepitopes and delivery system therefor
CA2611721C (en) 2005-06-30 2014-04-22 Eisai Co., Ltd. Compounds for preparing immunological adjuvant
WO2010114628A2 (en) * 2009-04-03 2010-10-07 Duke University Formulation for inducing broadly reactive neutralizing anti-hiv antibodies
US20120052088A1 (en) * 2009-04-30 2012-03-01 Coley Pharmaceutical Group, Inc. Pneumococcal vaccine and uses thereof
JP6294076B2 (ja) * 2011-01-06 2018-03-14 ビオノール イミュノ エーエスBionor Immuno As 多量体ペプチド
EP2909238A4 (en) 2012-10-19 2016-11-30 Queensland Inst Med Res IMPROVED IMMUNOTHERAPY AGAINST HUMAN HERPESVIRUS

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004007556A1 (en) * 2002-07-12 2004-01-22 Csl Limited Expression of hydrophobic proteins
WO2005007689A1 (en) * 2003-07-11 2005-01-27 Alphavax, Inc. Alphavirus-based cytomegalovirus vaccines
WO2006056027A1 (en) * 2004-11-29 2006-06-01 The Council Of The Queensland Institute Of Medical Research Human cytomegalovirus immunotherapy
WO2010014567A2 (en) * 2008-08-01 2010-02-04 Merck & Co., Inc. Variant hcmv pp65, ie1, and ie2 polynucleotides and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP2909238A4 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019123169A1 (en) * 2017-12-20 2019-06-27 Glaxosmithkline Biologicals Sa Epstein-barr virus antigen constructs
AU2018392884B2 (en) * 2017-12-20 2021-11-11 Glaxosmithkline Biologicals Sa Epstein-Barr Virus antigen constructs
US11773139B2 (en) 2017-12-20 2023-10-03 Glaxosmithkline Biologicals Sa Epstein-barr virus antigen constructs
US12264179B2 (en) 2017-12-20 2025-04-01 Glaxosmithkline Biologicals Sa Epstein-Barr Virus antigen constructs
EP4458419A2 (en) 2018-09-10 2024-11-06 Atara Biotherapeutics, Inc. Methods for expanding antigen-specific car-t cells, compositions and uses related thereto
CN111394376A (zh) * 2020-03-30 2020-07-10 济宁医学院 一种融合基因bfna、重组腺病毒及其制备方法和应用
CN111394376B (zh) * 2020-03-30 2023-04-28 济宁医学院 一种融合基因bfna、重组腺病毒及其制备方法和应用
WO2021217206A1 (en) * 2020-04-28 2021-11-04 The Council Of The Queensland Institute Of Medical Research Human cytomegalovirus polyepitope vaccine composition
US12583910B2 (en) 2020-05-06 2026-03-24 Tsinghua University T cell antigen receptor, multimeric complex thereof, and preparation method therefor and use thereof
WO2022074455A1 (en) * 2020-10-07 2022-04-14 The Council Of The Queensland Institute Of Medical Research Herpesvirus polyepitope vaccines
EP4225363A4 (en) * 2020-10-07 2024-11-13 The Council of the Queensland Institute of Medical Research VACCINES BASED ON POLYEPITOPES OF THE HERPES VIRUS

Also Published As

Publication number Publication date
JP2021036882A (ja) 2021-03-11
JP7110302B2 (ja) 2022-08-01
US9901632B2 (en) 2018-02-27
EP2909238A4 (en) 2016-11-30
US11896665B2 (en) 2024-02-13
JP2018075034A (ja) 2018-05-17
CA2889064A1 (en) 2014-04-24
JP2019030331A (ja) 2019-02-28
US20210299248A1 (en) 2021-09-30
US20240156953A1 (en) 2024-05-16
CN104918960A (zh) 2015-09-16
CN118359733A (zh) 2024-07-19
US20180207261A1 (en) 2018-07-26
EP2909238A1 (en) 2015-08-26
US11065329B2 (en) 2021-07-20
CN104918960B (zh) 2024-06-14
US20150273051A1 (en) 2015-10-01
EP3872097A1 (en) 2021-09-01
JP6846396B2 (ja) 2021-03-24
AU2013332272A1 (en) 2015-05-14
JP2015533366A (ja) 2015-11-24
EP3466980A3 (en) 2019-05-01
EP3466980A2 (en) 2019-04-10
AU2013332272B2 (en) 2018-12-20
AU2018274961A1 (en) 2019-01-03

Similar Documents

Publication Publication Date Title
US20240156953A1 (en) Human herpesvirus immunotherapy
JP4574166B2 (ja) 新規なヒトサイトメガロウイルス(hcmv)細胞傷害性t細胞エピトープ、ポリエピトープ、それを含む組成物、ならびにその診断、予防および治療上の使用
AU2001249243B2 (en) Immuno-reactive peptide CTL epitopes of human cytomegalovirus
US7976845B2 (en) Human cytomegalovirus immunotherapy
US20070048329A1 (en) Epstein barr virus peptide epitopes, polyepitopes and delivery system therefor
Liu et al. Immunotherapy of Epstein-Barr virus associated malignancies using mycobacterial HSP70 and LMP2A356–364 epitope fusion protein
JP5731952B2 (ja) ヒトサイトメガロウイルスの免疫ー反応性ペプチドctlエピトープ
HK40057947A (en) Improved human herpesvirus immunotherapy
HK40006634A (en) Improved human herpesvirus immunotherapy
Bharadwaj et al. Epstein-Barr virus vaccine: a cytotoxic T-cell-based approach
US20230173061A1 (en) Human cytomegalovirus polyepitope vaccine composition

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13847496

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14436239

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2889064

Country of ref document: CA

Ref document number: 2015537084

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013847496

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013332272

Country of ref document: AU

Date of ref document: 20131021

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201380065495.X

Country of ref document: CN