WO2014053650A1 - Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors - Google Patents
Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors Download PDFInfo
- Publication number
- WO2014053650A1 WO2014053650A1 PCT/EP2013/070741 EP2013070741W WO2014053650A1 WO 2014053650 A1 WO2014053650 A1 WO 2014053650A1 EP 2013070741 W EP2013070741 W EP 2013070741W WO 2014053650 A1 WO2014053650 A1 WO 2014053650A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- patient
- pain
- inhibitor
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 CC(*(C)(C)C1=NC=C(CC(CCC*)=CC)*1)C(C)=SC=C(*)*C(C(C)C=C1)*1=CC Chemical compound CC(*(C)(C)C1=NC=C(CC(CCC*)=CC)*1)C(C)=SC=C(*)*C(C(C)C=C1)*1=CC 0.000 description 2
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to a method for treating patients afflicted with cancer, wherein said patients are treated with a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, in particular masitinib, optionally in combination with at least one antineoplastic agent.
- a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and the optional at least one antineoplastic agent are administered in a dosage regimen that comprises a therapeutically effective amount.
- the present invention also relates to methods for predicting therapeutic response to said treatment in a given patient and therefore identification of applicable patient subpopulations based upon these predictor factors; sometimes referred to as predictive biomarkers. One method is based upon the clinical marker of pain intensity.
- the second method is based upon gene expression predictive biomarkers assessed via RNA expression in peripheral blood cell samples collected prior to treatment with a compound of the invention (i.e. a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib).
- a compound of the invention i.e. a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib.
- the present invention relates to a method for treating patients afflicted with pancreatic cancer wherein said patients are treated with a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and in particular masitinib, optionally in combination with at least one antineoplastic agent, and in particular gemcitabine.
- mast cells have been directly linked to the development of pancreatic cancer tumorigenesis in mouse models, showing that high levels of mast cell infiltration into the tumor microenvironment was predictive of poor clinical outcome, although the exact mechanism by which mast cells contribute to pancreatic cancer development was not clear [Chang DZ et al., Clin Cancer Res 201 1 ;17:7015-7023].
- mast cell function may prove to be of therapeutic benefit in restraining the growth of cancers for which there is sufficient mast cell involvement.
- Exactly which cancers would benefit from targeting mast cell activity is however largely unknown or controversial.
- Mast cells are associated with diverse disease related pain and are emerging as having a role in cancer pain. Mast cells have been linked to the pathogenesis of pain in conditions for which pain is a predominant symptom but is considered to be out of proportion to the objective pathological findings, i.e. indicating that anatomical abnormalities cannot alone account for the pain; examples include chronic pancreatitis, interstitial cystitis, and irritable bowel syndrome. Each of these conditions has been associated with an increased number of mast cells in the pancreas, bladder, or colon, respectively, as compared with those patients without disease related pain.
- pancreatic cancer The etiology of cancer pain is complex and remains poorly understood. Cancer pain can be severe and debilitating, drastically reducing quality-of-life in patients who already have an attenuated life expectancy. Considering in particular pancreatic cancer, abdominal and back pain is a significant complication with nearly 75% of unresectable pancreatic cancer patients suffering from pain at the time of diagnosis, increasing to more than 90% of patients in advanced disease [Hameed M, et al., Cancers 201 1 , 3, 43-60]. Pain in pancreatic cancer may be visceral, somatic, or neuropathic in origin and is produced by tissue damage, inflammation, ductal obstruction, and infiltration.
- Visceral nociceptive pain is caused by damage to the upper abdominal viscera, structures that are particularly sensitive to stretch, ischemia and inflammation, which typically produces a poorly localized, diffuse pain. Somatic and neuropathic pain may arise from tumor extension into the surrounding peritoneum, retroperitoneum, bones and in the latter case, nerves such as the lumbosacral plexus.
- Opioid analgesics are commonly used to manage cancer pain, their mechanism of action being to act directly on the central nervous system. However, this can also lead to unwanted side effects, such as constipation, drowsiness, dizziness, breathing problems, and physical or mental dependence.
- the World Health Organization (WHO) has published a standardized approach for analgesic drug regimens administered for the control of chronic cancer pain in the form of an "analgesic ladder" [Available online: www.who.int/cancer/palliative/painladder/en/ (accessed on 13 March 2012)].
- This model recommends that if pain occurs, there should be prompt oral administration of drugs in the following order: "nonopioids such as paracetamol for mild pain; then, as necessary, mild opioids such as codeine for mild to moderate pain; then strong opioids such as morphine for moderate to severe pain, until the patient is free of pain.
- nonopioids such as paracetamol for mild pain
- mild opioids such as codeine for mild to moderate pain
- strong opioids such as morphine for moderate to severe pain
- Pain assessment tools may be unidimensional or multidimensional. Based upon literature reviews and expert working groups' opinions, it is generally agreed that single item unidimensional tools are among the most frequently used pain assessment tools in cancer patients.
- VAS Visual Analogue Scale
- Unidimensional pain assessment tools include the numeric rating scale (0 is “no pain” and 10 is “worst pain imaginable”); a verbal descriptor scale ("no pain,” “mild pain,” “moderate pain,” “severe pain”); or a visual analogue scale (a 100 mm line with anchors such as “no pain” on the left and “worst pain imaginable” on the right) on which the patient indicates the place on the line that best represents the intensity of pain).
- Each scale has its strengths and weaknesses; however, most self-report measures of pain intensity are strongly related to one another and can be used interchangeably in many situations, especially when clear instructions and an opportunity for practice has been given.
- Pain intensity reflects how much a person hurts, and is the most important factor of pain for the purpose of describing the present invention.
- Pain intensity is a magnitude estimation task. Patients are usually able to provide pain intensity estimates relatively quickly, and measures of pain intensity tend to be closely related to one another statistically. Pain intensity can therefore be viewed as a fairly homogeneous dimension that is relatively easy for most people to gauge.
- the three most commonly used methods for assessing pain intensity are the Verbal Rating Scale, the Visual Analogue Scale (VAS), and the Numerical Rating Scale. Less commonly used measures include the Behavior Rating Scale, the Picture Scale, the Box Scale, and the Descriptor Differential nScale [Jensen, MP, et al., In: Chapman CR, Foley KM, eds.: Current and Emerging Issues in Cancer Pain: Research and Practice. New York, NY: Raven Press, 1993, pp. 193-218].
- VASs consist of a line, usually 10 cm long, whose ends are labeled as the extremes of pain (for example, "no pain” to "pain as bad as it could be”). If a VAS has specific points along the line that are labeled with intensity-denoting adjectives or numbers, it is referred to as a Graphic Rating Scale of Pain Intensity. Patients are simply asked to indicate which point along the line best represents their pain intensity. Usually, the pain assessor allows the patient to practice using the measure to be sure that the assessment task is understood. The distance from the no pain end to the mark made by the patient is that patient's pain intensity score.
- VASs are directly correlated with other self-report measures of pain intensity, as well as to observed pain behavior [see Jensen, 1993 and references contained therein]. Because VASs are usually measured in millimeters they have a large number of response categories, i.e. the scale can be considered as having 101 points, making it potentially more sensitive to changes in pain intensity than measures with limited numbers of response categories. Research indicates that VASs of pain intensity are usually (but not always) more sensitive to treatment change than are 4- or 5-point Verbal Rating Scale.
- Multidimensional pain assessment tools provide a measure of clinical pain that captures its sensory, affective and other qualitative components that extends beyond the basic measure of pain intensity. Theoretically, multidimensional tools should be more reliable and therefore potentially more sensitive for detecting changes in pain associated with time or with treatment; however, they are more complex and lengthy to complete than unidimensional tools. Furthermore, because multidimensional pain or quality-of-life (QOL) assessment tools were generally designed to evaluate change of health related QOL in a clinical trial setting, their scores are only informative when used in a comparative setting, i.e. comparing treatment arms, and therefore, a single individual score is not considered to be informative.
- QOL quality-of-life
- the EORTC QLQ C-30 is a 30-item self-reporting questionnaire developed to assess the quality-of-life of cancer patients [Aaronson, NK et al., J Natl Cancer Inst 85(5): 365-76, 1993]. Importantly, it is supplemented by disease specific modules, including a module specific to pancreatic cancer (QLQ-PAN26), which includes 26 items related to disease symptoms, treatment side- effects and emotional issues.
- QLQ-PAN26 a module specific to pancreatic cancer
- the QLQ-C30 questionnaire has been validated but the QLQ- PAN26 module is not yet validated as it still needs to undergo psychometric testing in a large international group of patients.
- Gene expression profiling is the measurement of the expression (i.e. activity) of thousands of genes simultaneously, to create a global picture of cellular function or a genetic 'fingerprint' of a particular physiological/pathological sample. In the context of cancer, gene expression profiling has been used to more accurately classify tumors; furthermore, comparison of expression profiles can identify subpopulations in which genes are consistently up-regulated or down- regulated.
- the information derived from gene expression profiling has the potential to make an objective diagnosis, to identify genes that correlate with survival, to provide risk assessment of premalignant lesions, and to predict responses to certain treatments.
- one can answer questions of direct clinical significance such as the probability of a patient to respond to a drug given said patient's genetic fingerprint.
- pancreatic cancer overview The pancreas contains exocrine cells (involved in the production of enzymes important for food digestion) and endocrine cells (that produce hormones such as insulin). Both exocrine and endocrine cells can form tumors, but those formed by the exocrine pancreas are far more common and are associated with a very poor prognosis. The vast majority of exocrine pancreatic tumors are adenocarcinomas. Tumors of the endocrine pancreas (also known as islet cell tumors) are far less common and mostly benign in nature.
- pancreatic cancer Cancer of the exocrine pancreas (referred to hereafter as pancreatic cancer) is a seriously life threatening condition. In most cases, early stages of the disease are asymptomatic and less than 20% of pancreatic cancers are amenable to surgery. Of those patients undergoing tumor resection, only 20% will survive 5 years. Early diagnosis of pancreatic cancer is difficult because symptoms vary and are nonspecific. Symptoms are primarily caused by mass effect rather than disruption of exocrine or endocrine functions and depend on the tumor's size and location, as well as the presence of metastases. Cancers that begin in the head of the pancreas are near the common bile duct.
- pancreatic cancer Treatment of pancreatic cancer depends on the stage of the cancer, as described in Table 1 .
- the treatment of choice is surgery with postoperative chemotherapy and/or radiation.
- chemotherapy and/or radiation is proposed.
- the tumor may subsequently be surgically resected.
- chemotherapy is proposed. In most cases, these treatments do not represent a cure.
- Table 1 Staging and treatment of pancreatic cancer
- Chemotherapy may be used in patients with advanced unresectable cancer (locally advanced or metastatic) and in patients with localized disease after surgery or even as a neoadjuvant treatment to shrink the tumor before surgery.
- 5-fluorouracil 5-FU
- Gemcitabine a nucleoside analogue of cytidine, is now established as the standard systemic treatment for patients with locally advanced, unresectable, or metastatic pancreatic adenocarcinoma.
- gemcitabine As a single agent remains modest, with a median survival of approximately 6 months in randomized trials and a 12-month survival of approximately 20%.
- the antimetabolite gemcitabine (CAS number 95058-81 -4; (4-amino-1 -[3,3-difluoro-4-hydroxy-5- (hydroxymethyl) tetrahydrofuran-2-yl]- 1 H-pyrimidin- 2-one) replaces cytidine during DNA replication resulting in apoptosis in cancer cells.
- Gemcitabine has the following formula:
- pancreatic cancer Several growth factors and their receptors are overexpressed during the progression of pancreatic cancer, such as epithelial growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), and vascular endothelial growth factor (VEGF).
- EGF epithelial growth factor
- PDGF platelet-derived growth factor
- FGF fibroblast growth factor
- VEGF vascular endothelial growth factor
- cytoplasmic tyrosine kinases have also been associated with poor prognosis and chemoresistance.
- gemcitabine resistance in pancreatic cancer is often associated with high expression of focal adhesion kinase (FAK), a protein involved in metastasis; and elevated expression and activity of Src Family Kinases (SFK), including SRC and Lyn, have also been reported in numerous human cancer cell lines and tumor tissues.
- FAK focal adhesion kinase
- SFK Src Family Kinases
- a phase 2/3 multicenter randomized trial was carried out to determine the efficacy and safety of a four drug combination chemotherapy regimen (FOLFIRINOX) (consisting of leucovorin calcium, fluorouracil, irinotecan hydrochloride and oxaliplatin) compared with gemcitabine as first-line therapy in patients with metastatic pancreatic cancer [Conroy T, et al., N Engl J Med. 201 1 May 12;364(19):1817-25].
- Each of the drugs in this combination is approved by the FDA to treat cancer or conditions related to cancer.
- Patients who received the Folfirinox regimen lived approximately 4 months longer than patients treated with the current standard of care, gemcitabine (1 1 .1 months compared with 6.8 months).
- the objective response rate was 31 .6% in patients treated with Folfirinox versus 9.4% in patients treated with gemcitabine.
- Folfirinox was associated with a survival advantage but also with notable increased toxicity.
- the study design selected only those patients with a good performance status (ECOG status score of 0 or 1 ), and because of an increased risk of irinotecan-induced toxicity those patients with a high bilirubin level (typically manifested as jaundice and a common diagnostic sign in patients with pancreatic cancer in the head of the pancreas) were excluded.
- Folfirinox is appropriate as a first-line option for patients with metastatic pancreatic cancer who are younger than 76 years and who have a good performance status, no cardiac ischemia, and normal or nearly normal bilirubin levels.
- masitinib a nucleoside analog
- the invention aims to solve the technical problem of providing an active ingredient for the treatment of cancer.
- the invention also aims to solve the technical problem of providing an active ingredient that improves prior art methods for the treatment of cancer.
- the invention aims to provide an efficient treatment for cancer at an appropriate dose, route of administration, and daily intake.
- the invention aims to solve the technical problem of how to predict therapeutic response to said treatment in a given patient and therefore identify applicable patient subpopulations based upon these predictor factors.
- the invention aims to solve the technical problem of providing an active ingredient that improves prior art methods for the treatment of cancer that is associated with pain or the requirement of opioid analgesics for the treatment of disease related pain.
- Another predictor factor is based upon gene expression profiling via analysis of RNA expression in peripheral blood cell samples.
- the invention aims to solve the technical problem of providing an active ingredient that improves prior art methods for the treatment of cancer in patients harboring a specific gene or gene expression combinations (i.e. a genetic/transcriptomic fingerprint).
- pancreatic cancer remains a chemoresistant and highly aggressive tumor.
- the treatment of advanced pancreatic cancer continues to be a major challenge in terms of chemotherapy- induced palliative effect on disease related symptoms and survival time.
- the Folfirinox regimen offers an alternative backbone to develop combination therapies but high toxicity will probably limit its use for the majority of patients.
- the continuing poor prognosis and lack of effective treatments for pancreatic cancer, and especially pancreatic cancer that is associated with pain highlights an unmet medical need for more efficient treatment strategies that improve the clinical management of patients afflicted with pancreatic cancer without significantly increasing toxicity.
- improvements in either survival time or quality-of-life are highly meaningful goals.
- a treatment capable of simultaneously improving both of these aspects would be of particular worth.
- the invention aims to solve the technical problem of providing an active ingredient that improves prior art methods for the treatment of advanced adenocarcinoma pancreatic cancer.
- the invention aims to solve the technical problem of providing an active ingredient that improves prior art methods for the treatment of advanced adenocarcinoma pancreatic cancer that is associated with pain or the requirement of opioid analgesics for the treatment of disease related pain.
- the invention aims to solve the technical problem of providing an active ingredient that improves prior art methods for the treatment of advanced adenocarcinoma pancreatic cancer in patients harboring a specific gene or gene expression predictor factors (i.e. a genetic/transcriptomic fingerprint).
- the present invention relates to a method for the treatment of cancer in a human patient, wherein said method comprises administering to a human patient in need thereof, a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, optionally combined with at least one antineoplastic agent.
- antineoplastic agent it is referred herein to a medicament for the treatment of cancers.
- said antineoplastic agents include, but are not restricted to: abarelix, abiraterone acetate, aldesleukin, altretamine, anastrozole, arsenic trioxide, asparaginase, axitinib, azacitidine, bendamustine hydrochloride, bevacizumab, bexarotene, bicalutamide, leomycin, bortezomib, brentuximab vedotin, busulfan, cabazitaxel, Campath, Camptosar, capecitabine, carboplatin, carfilzomib, carmustine, cetuximab, chlorambucil, cisplatin, cladribine (2CDA), clofarabine, crizotinib, cyclophosphamide, cytarabine (ARA-C), cytosine arabinoside, dacarbazine, dactinomycin
- cancer selected from, but not restricted to: acute lymphocytic leukemia (ALL), acute myelogenous leukemia (AML), adrenocortical carcinoma, anal cancer, B cell lymphoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brainstem glioma, brain tumor, breast cancer, cervical cancer, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), colorectal cancer (CRC), endometrial cancer, esophageal cancer, eye cancer, gallbladder cancer, gastric (stomach) cancer, gastrointestinal stromal tumor (GIST), glioblastoma multiforme (GBM), hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) carcinoma (HCC), Hodgkin's lymphoma and non-Hodgkin's lymphomas, Kaposi
- ALL acute lymphocytic leukemia
- AML acute my
- the present invention relates to the method as defined above wherein a tyrosine kinase inhibitor or a mast cell inhibitor is an inhibitor of kinase activity selected from the tyrosine kinases of: c-Kit, PDGFR, Lyn, Fyn, and DDR1 .
- the tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor is masitinib or a pharmaceutical acceptable salt thereof, in particular the mesilate salt.
- predictor factor or “biomarker”
- predicative biomarker prognostic biomarker
- molecular marker genetic marker
- gene predictor set genetic fingerprint, transcriptional fingerprint, genetic print, genetic signature, tumor marker, cancer marker, biological marker, biochemical marker, and biological indicator.
- the present invention relates to the method as defined above, wherein said patient is initially selected for treatment based upon the predictor factor of pain intensity.
- the present invention relates to a method of treatment of cancer that is associated with pain or that requires administration of opioid analgesics for treatment of disease related pain, in human patient, wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, is administered to patient in need thereof, optionally combined with at least one antineoplastic agent.
- the present invention relates to the method as defined above wherein said patient is afflicted by cancer that is associated with pain or that requires administration of opioid analgesics for treatment of disease related pain, and wherein 'pain' is defined as at least one reported occurrence of a non-zero pain intensity, as determined using an (appropriate) pain intensity assessment tool. It is implicit therefore, that according to the predictor factor of pain intensity, and in the absence of any other independent predictor factor, said treatment of patient afflicted by cancer that is not associated with pain or the requirement of opioid analgesics for the treatment of disease related pain is inadvisable.
- the present invention relates to the method as defined above wherein said patients is afflicted by cancer that is associated with pain or that requires administration of opioid analgesics for treatment of disease related pain, and wherein 'pain' is defined as above according to an (appropriate) pain intensity assessment tool, including but not limited to: the Verbal Rating Scale, the Visual Analogue Scale, the Numerical Rating Scale, the Behavior Rating Scale, the Picture Scale, the Box Scale, the Descriptor Differential nScale, the European Organization for Research and Treatment of Cancer quality-of-life questionnaire for pancreatic cancer (EORTC QLQ-PAN26), the Brief Pain Inventory (BPI), or the McGill Pain Questionnaire.
- an (appropriate) pain intensity assessment tool including but not limited to: the Verbal Rating Scale, the Visual Analogue Scale, the Numerical Rating Scale, the Behavior Rating Scale, the Picture Scale, the Box Scale, the Descriptor Differential nScale, the European Organization for Research and Treatment of Cancer quality-of
- the present invention relates to the method as defined above wherein said patient is afflicted by cancer that is associated with pain that requires administration of opioid analgesics for treatment of disease related pain, and wherein 'pain' is defined as at least one reported occurrence of a Visual Analogue Scale (VAS) pain intensity score of greater than 5 (e.g. VAS >5 mm as measured on a 100 mm scale, or 5%); or a VAS pain intensity score of greater than 10 (e.g. VAS >10 mm as measured on a 100 mm scale, or 10%); or even a VAS pain intensity score of greater than 20 (e.g. VAS >20 mm as measured on a 100 mm scale, or 20%).
- VAS Visual Analogue Scale
- the present invention relates to the method as defined above wherein said patient is afflicted by cancer that is associated with pain or that requires administration of opioid analgesics for treatment of disease related pain, and wherein 'pain' is defined as at least one reported occurrence of an equivalent measure of said VAS pain intensity threshold, or at least one reported occurrence of moderate to intolerable pain according to a multidimensional or categorical pain assessment tool pain intensity rating.
- the present invention relates to the method as defined above wherein said patient is afflicted by pancreatic cancer that is associated with pain or the requires the administration of opioid analgesics for treatment of disease related pain, and wherein pain is defined as at least one reported occurrence of a Visual Analogue Scale (VAS) pain intensity score of greater than 20 (e.g. VAS >20 mm as measured on a 100 mm scale, or 20%).
- VAS Visual Analogue Scale
- the present invention relates to the method as defined above, wherein said patient is initially selected for treatment based upon gene expression predictor factors.
- said gene expression predictor factors are derived from a blood sample of a patient, preferably on a whole peripheral blood sample of said patient.
- Peripheral blood is blood that circulates through the heart, arteries, capillaries and veins.
- the terms "whole blood” are used as opposed to a fraction of blood, obtained through separation of particular components of blood.
- An example of fraction is peripheral blood mononuclear cells.
- said gene expression predictor factors are derived from peripheral blood cell samples collected prior to treatment with said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof.
- the present invention relates to a method of treatment of cancer, wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, optionally combined with at least one antineoplastic agent, is administered to a patient in need thereof, wherein said patient has a peripheral blood up-regulation or down-regulation of at least one of the following genes: ACOX-1 , TNFRSFS10B, RPS23, ABCC3, LYN, HIF1 ALPHA, ABCC1 , IGJ, UBE2H, or PARP-2, or homologous thereof.
- the up-regulation or down-regulation of a given gene in a given patient is quantified in terms of a Delta Cycle Threshold (DCt) value, which is the gene expression level with respect to one or more reference genes.
- DCt Delta Cycle Threshold
- Such reference genes, or housekeeping genes are characterized by a constant level of expression and therefore serve as an internal control.
- DCt values are inversely proportional to the level of gene expression; therefore, in the case of up-regulated genes a lower DCt value indicates a greater level of expression, whilst in the case of down-regulated genes a higher DCt value indicates a lower level of expression.
- homologous is defined as a polynucleotide sequence having a degree of identity of at least 80%, preferably 85%, more preferably 90%, and even more preferably 99% of the gene sequence (full length).
- the degree of identity refers to sequence identity between two sequences. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base, then the molecules are identical at that position.
- Various alignment algorithms and/or programs may be used for determining the homology of two sequences, including FASTA and BLAST.
- the present invention relates to the method as defined above, wherein said patient has a concomitant up-regulation or down-regulation of at least two genes selected from: ACOX-1 , TNFRSFS10B, RPS23, ABCC3, LYN, HIF1 A, ABCC1 , IGJ, UBE2H, and PARP-2.
- dual-gene combinations include, but are not restricted to: the concomitant up-regulation of genes ACOX-1 and TNFRSF10B; the concomitant down-regulation of gene RPS23 and up-regulation of gene ACOX-1 ; the concomitant up- regulation of genes ABCC3 and LYN; the concomitant up-regulation of genes HIF1 A and TNFRSF10B; the concomitant down-regulation of genes ABCC1 and IGJ; the concomitant down-regulation of genes UBE2H and PARP-2.
- these pairs of regulated genes are referred to as 'gene expression predictor factors', and collectively they are referred to as the 'genetic fingerprint' or 'transcriptional fingerprint'.
- the concomitant up-regulation of genes ACOX-1 and TNFRSF10B corresponds to patient Delta Cycle Threshold values of less than or equal to 3.81 for ACOX- 1 and less than or equal to 7.63 for TNFRSF10B; more preferably to patient Delta Cycle Threshold values of less than or equal to 3.36 for ACOX-1 and less than or equal to 6.71 for TNFRSF10B;and even more preferably to patient Delta Cycle Threshold values of less than or equal to 3.05 for ACOX-1 and less than or equal to 6.1 for TNFRSF10B.
- the concomitant down-regulation of gene RPS23 and up-regulation of gene ACOX-1 corresponds to patient Delta Cycle Threshold values of greater than 0.26 for RPS23 and less than or equal to 3.81 for ACOX-1 ; more preferably to patient Delta Cycle Threshold values of greater than 0.32 for RPS23 and less than or equal to 3.36 for ACOX-1 ; and even more preferably to patient Delta Cycle Threshold values of greater than 0.35 for RPS23 and less than or equal to 3.05 for ACOX-1 .
- the concomitant up-regulation of genes ABCC3 and LYN corresponds to patient Delta Cycle Threshold values of less than or equal to 5.38 for ABCC3 and less than or equal to 2.06 for LYN; more preferably to patient Delta Cycle Threshold values of less than or equal to 4.73 for ABCC3 and less than or equal to 1 .82 for LYN; and even more preferably to patient Delta Cycle Threshold values of less than or equal to 4.3 for ABCC3 and less than or equal to 1 .65 for LYN.
- the concomitant up-regulation of genes HIF1 A and TNFRSF10B corresponds to patient Delta Cycle Threshold values of less than or equal to 4.94 for HIF1 A and less than or equal to 7.06 for TNFRSF10B; more preferably to patient Delta Cycle Threshold values of less than or equal to 4.35 for HIF1 A and less than or equal to 6.22 for TNFRSF10B; and even more preferably to patient Delta Cycle Threshold values of less than or equal to 3.95 for HIF1 A and less than or equal to 5.65 for TNFRSF10B.
- the concomitant down-regulation of genes ABCC1 and IGJ corresponds to patient Delta Cycle Threshold values of greater than 2.63 for ABCC1 and less than or equal to 5.29 for IGJ; more preferably to patient Delta Cycle Threshold values of greater than 3.15 for ABCC1 and less than or equal to 6.35 for IGJ; and even more preferably to patient Delta Cycle Threshold values of greater than 3.5 for ABCC1 and less than or equal to 7.05 for IGJ.
- the concomitant down-regulation of genes UBE2H and PARP-2 corresponds to patient Delta Cycle Threshold values of greater than 2.78 for UBE2H and greater than 5.33 for PARP-2; more preferably to patient Delta Cycle Threshold values of greater than 3.33 for UBE2H and greater than 6.39 for PARP-2; and even more preferably to patient Delta Cycle Threshold values of greater than 3.7 for UBE2H and greater than 7.1 for PARP-2.
- the present invention relates to a method of treatment of cancer, wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, optionally combined with at least one antineoplastic agent, is administered to a patient in need thereof, wherein said patient has a peripheral blood up-regulation of the gene ACOX-1 , or homologous thereof.
- the up-regulation of gene ACOX-1 corresponds to patient Delta Cycle Threshold value of less than or equal to 3.81 ; more preferably of less than or equal to 3.36; and even more preferably of less than or equal to 3.05.
- the present invention relates to the method as defined above wherein masitinib is administered at a daily dose of 4.5 to 12.0 mg/kg/day, with the preferred embodiment for patients with cancer being a starting daily dose of 6.0 to 7.5 mg/kg/day.
- the present invention relates to the method as defined above wherein masitinib is dose escalated by increments of 1 .5 mg/kg/day to reach a maximum of 12.0 mg/kg/day.
- the present invention relates to the method as defined above wherein said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, is administered orally.
- the present invention relates to the method as defined above wherein said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, is administered twice a day.
- the present invention relates to the method as defined above comprising a long term administration of an effective amount of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, over more than 3 months.
- the present invention relates to the method as defined above, wherein said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, is administered in combination with the at least one antineoplastic agent, as a neoadjuvant, adjuvant, concomitant, or concurrent regimen.
- the present invention relates to the method as defined above wherein said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, and the at least one antineoplastic agent are administered separately, simultaneously or sequentially in time.
- the present invention relates to the method as defined above, for treatment of pancreatic cancer, wherein said tyrosine kinase inhibitor, mast cell inhibitor or c- Kit inhibitor is administered in combination with at least one antineoplastic agent selected from marketing medicaments for the treatment of cancer.
- the present invention relates to the method as defined above, wherein said patient suffers from unresectable adenocarcinoma pancreatic cancer or metastatic adenocarcinoma pancreatic cancer.
- the present invention relates to the method as defined above, wherein said pancreatic cancer patient is in need thereof, as defined by either the defined gene expression predictor factor or pain intensity predictor factor, and wherein said at least one antineoplastic agent is selected from: gemcitabine (Gemzar®; Lilly), erlotinib (Tarceva®; Roche), paclitaxel (Taxol®, Abraxane®; Bristol-Myers Squibb), Folfirinox, 5-fluorouracil (5- FU), capecitabine, cisplatin, oxaliplatin, irinotecan, leucovorin, and any combination of these antineoplastic agents.
- said at least one antineoplastic agent is gemcitabine.
- the present invention relates to the method as defined above, wherein a product consisting of gemcitabine and masitinib or a pharmaceutically acceptable salt or hydrate thereof is used.
- the present invention relates to the method as defined above, wherein masitinib is administered daily at a starting dose of 6.0 ⁇ 1 .5 mg/kg/day with a maximum allowable dose of 9.0 mg/kg/day, and gemcitabine is administered at a weekly dose of 1000 ⁇ 250 mg/m 2 of patient surface area for up to seven consecutive weeks as a start, followed by a week off-treatment, followed by cycles of weekly dose of 1000 ⁇ 250 mg/m 2 for 3 weeks, every 28 days
- the present invention relates to a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor for use in a method for the treatment of a cancer as defined above, optionally in combination with at least one antineoplastic agent.
- the present invention relates to a pharmaceutical composition or kit comprising a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor for use in a method for the treatment of a cancer as defined above, optionally in combination with at least one antineoplastic agent.
- the present invention relates to the use of a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor for the preparation of a medicament, or a pharmaceutical composition, for the treatment of a cancer as defined above, optionally in combination with at least one antineoplastic agent.
- the invention relates to a therapeutic management plan for the treatment of cancer, in particular of pancreatic cancer in a human patient, wherein said management plan comprises the identification of treatable patients based upon the defined predictor factor of gene expression.
- the gene expression therapeutic management plan mentioned above is applied to patients with pancreatic cancer; wherein, if a patient harbors at least one gene expression predictor factor, and is therefore classified as belonging to the defined 'genetic/ transcriptional fingerprint' subpopulation, then said patient is treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and especially masitinib, optionally in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine.
- a patient does not harbor at least one gene expression predictor factor, and is therefore classified as belonging to the defined 'non genetic/ transcriptional fingerprint' subpopulation, then said patient is treated with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine.
- the gene expression therapeutic management plan mentioned above is applied to patients with cancer other than pancreatic cancer; wherein, if a patient harbors at least one gene expression predictor factor then said patient is treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and especially masitinib, optionally in combination with at least one antineoplastic agent. If a patient does not harbor at least one gene expression predictor factor then said patient is treated with at least one antineoplastic agent.
- the invention relates to a therapeutic management plan for the treatment of cancer, in particular of pancreatic cancer in a human patient, based upon the defined predictor factor of pain intensity, wherein said management plan comprises:
- VAS Visual Analogue Scale
- VAS Visual Analogue Scale
- said predetermined value for said disease related pain is 20 mm on a 100 mm scale.
- the pain intensity therapeutic management plan mentioned above is applied to patients with pancreatic cancer; wherein, if the result of step (a) is negative, then the patient is treated with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine.
- step (a) is positive and the result of step (b) is negative, then the patient is treated with at least one drug targeting epidermal growth factor receptor (EGFR), and particularly erlotinib, in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine; or with at least one mitotic inhibitor, and particularly paclitaxel, in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine; or with at least one combination of drugs including fluorouracil, leucovorin, irinotecan, or oxaliplatin, and particularly Folfirinox.
- EGFR epidermal growth factor receptor
- erlotinib in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine
- mitotic inhibitor, and particularly paclitaxel in combination with at least one nucleoside analogue, in particular
- step (a) If the result of step (a) is positive and the result of step (b) is positive, then the patient is treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c- Kit inhibitor, and especially masitinib, optionally in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine.
- the pain intensity therapeutic management plan mentioned above is applied to patients with cancer other than pancreatic cancer; wherein, if the result of step (a) is negative, then the patient is treated with at least one antineoplastic agent. If the result of step (a) is positive and the result of step (b) is negative, then the patient is treated with at least one antineoplastic agent. If the result of step (a) is positive and the result of step (b) is positive, then the patient is treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and especially masitinib, optionally in combination with at least one antineoplastic agent.
- the invention relates to a global therapeutic management plan for the treatment of cancer, in particular of pancreatic cancer in a human patient, wherein said management plan comprises the identification of treatable patients based upon sequential application of the gene expression therapeutic management plan and pain intensity therapeutic management plan.
- step (a) can be preceded by step (a') consisting in the identification of patients that harbor at least one gene expression predictor factor, as described above.
- the global therapeutic management plan mentioned above is applied to pancreatic cancer, wherein: if the result of step (a') is positive, then the patient is treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and especially masitinib, optionally in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine; if the result of step (a') is negative, then step (a) of the pain intensity therapeutic management plan for pancreatic cancer is invoked.
- said management plan comprises:
- VAS Visual Analogue Scale
- VAS Visual Analogue Scale
- step (a) If the result of step (a) is negative, then the patient is treated with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine.
- nucleoside analogue in particular a cytidine analogue, and especially gemcitabine.
- step (a) is positive and the result of step (b) is negative, then the patient is treated with at least one drug targeting epidermal growth factor receptor (EGFR), and particularly erlotinib, in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine; or with at least one mitotic inhibitor, and particularly paclitaxel, in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine; or with at least one combination of drugs including fluorouracil, leucovorin, irinotecan, or oxaliplatin, and particularly Folfirinox.
- EGFR epidermal growth factor receptor
- erlotinib in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine
- mitotic inhibitor, and particularly paclitaxel in combination with at least one nucleoside analogue, in particular
- step (a) If the result of step (a) is positive and the result of step (b) is positive, then the patient is treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and especially masitinib, optionally in combination with at least one nucleoside analogue, in particular a cytidine analogue, and especially gemcitabine.
- the global therapeutic management plan mentioned above is applied to patients with cancer other than pancreatic cancer; wherein, if the result of step (a') is positive, then the patient is treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and especially masitinib, optionally in combination with at least one antineoplastic agent. If the result of step (a') is negative, then step (a) of the pain intensity therapeutic management plan for cancer is invoked.
- said management plan comprises:
- VAS Visual Analogue Scale
- VAS Visual Analogue Scale
- step (a) If the result of step (a) is negative, then the patient is treated with at least one antineoplastic agent.
- step (a) If the result of step (a) is positive and the result of step (b) is negative, then the patient is treated with at least one antineoplastic agent.
- step (a) If the result of step (a) is positive and the result of step (b) is positive, then the patient is treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and especially masitinib, optionally in combination with at least one antineoplastic agent.
- Figure 3 illustrates the treatment management plans associated with the individual predictor factors of pain intensity and gene expression for pancreatic cancer patients, as well as a global treatment management plan that takes both predictor factors into consideration.
- Tyrosine kinases are receptor type or non-receptor type proteins, which transfer the terminal phosphate of ATP to tyrosine residues of proteins thereby activating or inactivating signal transduction pathways. These proteins are known to be involved in many cellular mechanisms, which in case of disruption, lead to disorders such as abnormal cell proliferation and migration as well as inflammation.
- a tyrosine kinase inhibitor is a drug that inhibits tyrosine kinases, thereby interfering with signaling processes within cells. Blocking such processes can stop the cell growing and dividing.
- the tyrosine kinase inhibitor of the invention has the following formula
- R 2 are selected independently from hydrogen, halogen, a linear or branched alkyl, cycloalkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, alkoxy, cyano, dialkylamino, and a solubilizing group,
- n 0-4;
- an aryl group such as phenyl or a substituted variant thereof bearing any combination, at any one ring position, of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl, cyano and alkoxy;
- a heteroaryl group such as 2, 3, or 4-pyridyl group, which may additionally bear any combination of one or more substituents such as halogen, alkyl groups containing from 1 to 10 carbon atoms, trifluoromethyl and alkoxy;
- a five-membered ring aromatic heterocyclic group such as for example 2-thienyl, 3- thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear any combination of one or more substituents such as halogen, an alkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, and alkoxy; or a pharmaceutically acceptable salt or solvate thereof.
- Tyrosine kinase inhibitors of formula [A] can preferably be used as c-Kit inhibitors.
- an "aryl group” means a monocyclic or polycyclic-aromatic radical comprising carbon and hydrogen atoms.
- suitable aryl groups include, but are not limited to, phenyl, tolyl, anthracenyl, fluorenyl, indenyl, azulenyl, and naphthyl, as well as benzo-fused carbocyclic moieties such as 5,6,7,8-tetrahydronaphthyl.
- An aryl group can be unsubstituted or substituted with one or more substituents.
- the aryl group is a monocyclic ring, wherein the ring comprises 6 carbon atoms, referred to herein as "(Ce)aryl".
- alkyl group means a saturated straight chain or branched non- cyclic hydrocarbon having from 1 to 10 carbon atoms.
- Representative saturated straight chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, n- nonyl and n-decyl; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert- butyl, isopentyl, 2-methylbutyl, 3-methylbutyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 2,3-dimethylbutyl, 2,3- dimethylpentyl, 2,4-dimethylpentyl, 2,
- alkoxy refers to an alkyl group which is attached to another moiety by an oxygen atom.
- alkoxy groups include methoxy, isopropoxy, ethoxy, tert-butoxy, and the like. Alkoxy groups may be optionally substituted with one or more substituents.
- heteroaryl or like terms means a monocyclic or polycyclic heteroaromatic ring comprising carbon atom ring members and one or more heteroatom ring members (such as, for example, oxygen, sulfur or nitrogen).
- a heteroaryl group has from 1 to about 5 heteroatom ring members and from 1 to about 14 carbon atom ring members.
- heteroaryl groups include pyridyl, 1 -oxo-pyridyl, furanyl, benzo[1 ,3]dioxolyl, benzo[1 ,4]dioxinyl, thienyl, pyrrolyl, oxazolyl, imidazolyl, thiazolyl, isoxazolyl, quinolinyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, triazolyl, thiadiazolyl, isoquinolinyl, indazolyl, benzoxazolyl, benzofuryl, indolizinyl, imidazopyridyl, tetrazolyl, benzimidazolyl, benzothiazolyl, benzothiadiazolyl, benzoxadiazolyl, indolyl, tetrahydroind
- a heteroatom may be substituted with a protecting group known to those of ordinary skill in the art, for example, the hydrogen on a nitrogen may be substituted with a tert-butoxycarbonyl group.
- Heteroaryl groups may be optionally substituted with one or more substituents.
- nitrogen or sulfur heteroatom ring members may be oxidized.
- the heteroaromatic ring is selected from 5-8 membered monocyclic heteroaryl rings. The point of attachment of a heteroaromatic or heteroaryl ring to another group may be at either a carbon atom or a heteroatom of the heteroaromatic or heteroaryl rings.
- heterocycle refers collectively to heterocycloalkyl groups and heteroaryl groups.
- heterocycloalkyl means a monocyclic or polycyclic group having at least one heteroatom selected from O, N or S, and which has 2-1 1 carbon atoms, which may be saturated or unsaturated, but is not aromatic.
- heterocycloalkyl groups include (but are not limited to): piperidinyl, piperazinyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2- oxopyrrolidinyl, 4-piperidonyl, pyrrolidinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydropyrindinyl, tetrahydropyrimidinyl, tetrahydrothiopyranyl sulfone, tetrahydrothiopyranyl sulfoxide, morpholinyl, thiomorpholinyl, thiomorpholinyl sulfoxide, thiomorpholinyl sulfone, 1 ,3-dioxolane, tetrahydrofuranyl, dihydrofuranyl,
- monocyclic heterocycloalkyl groups have 3 to 7 members.
- Preferred 3 to 7 membered monocyclic heterocycloalkyl groups are those having 5 or 6 ring atoms.
- a heteroatom may be substituted with a protecting group known to those of ordinary skill in the art, for example, the hydrogen on a nitrogen may be substituted with a tert-butoxycarbonyl group.
- heterocycloalkyl groups may be optionally substituted with one or more substituents.
- the point of attachment of a heterocyclic ring to another group may be at either a carbon atom or a heteroatom of a heterocyclic ring. Only stable isomers of such substituted heterocyclic groups are contemplated in this definition.
- substituted means that a hydrogen radical on a compound or group is replaced with any desired group that is substantially stable to reaction conditions in an unprotected form or when protected using a protecting group.
- substituents are those found in the exemplary compounds and embodiments disclosed herein, as well as halogen (chloro, iodo, bromo, or fluoro); alkyl; alkenyl; alkynyl; hydroxy; alkoxy; nitro; thiol; thioether; imine; cyano; amido; phosphonato; phosphine; carboxyl; thiocarbonyl; sulfonyl; sulfonamide; ketone; aldehyde; ester; oxygen (-0); haloalkyl (e.g., trifluoromethyl); cycloalkyl, which may be monocyclic or fused or non-fused polycyclic (e.
- substituents may optionally be further substituted with a substituent selected from such groups.
- substituted refers to a substituent selected from the group consisting of an alkyl, an alkenyl, an alkynyl, an cycloalkyl, an cycloalkenyl, a heterocycloalkyi, an aryl, a heteroaryl, an aralkyl, a heteraralkyl, a haloalkyl, -C(0)NRnRi 2 , -NRi 3 C(0)Ri 4 , a halo, -ORi 3 , cyano, nitro, a haloalkoxy, -C(0)R 13 , -NRnR 12> -SR 13 , -C(0)OR 13 , -OC(0)R 13 , - NRi 3 C(0)NRiiRi 2> -OC(0)NRnRi 2> -OC(0)NRnRi 2>
- solubilizing group means any group which can be substantially ionized and that enables the compound to be soluble in a desired solvent, such as, for example, water or water-containing solvent. Furthermore, the solubilizing group can be one that increases the compound or complex's lipophilicity. Typically, the solubilizing group is selected from alkyl group substituted with one or more heteroatoms such as N, O, S, each optionally substituted with alkyl group substituted independently with alkoxy, amino, alkylamino, dialkylamino, carboxyl, cyano, or substituted with cycloheteroalkyi or heteroaryl, or a phosphate, or a sulfate, or a carboxylic acid. For example, by “solubilizing group” it is referred herein to one of the following:
- alkyl, cycloalkyl, aryl, heretoaryl group comprising either at least one nitrogen or oxygen heteroatom or which group is substituted by at least one amino group or oxo group;
- an amino group which may be a saturated cyclic amino group which may be substituted by a group consisting of alkyl, alkoxycarbonyl, halogen, haloalkyl, hydroxyalkyl, amino, monoalkylamino, dialkylamino, carbamoyl, monoalkylcarbamoyl and dialkylcarbamoyl;
- cycloalkyl means a saturated cyclic alkyl radical having from 3 to 10 carbon atoms.
- Representative cycloalkyls include cyclopropyl, 1 -methylcyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, and cyclodecyl.
- Cycloalkyl groups can be optionally substituted with one or more substituents.
- halogen means -F, -CI, -Br or -I.
- tyrosine kinase inhibitor of the invention has general formula [B],
- Ri is selected independently from hydrogen, halogen, a linear or branched alkyl, cycloalkyl group containing from 1 to 10 carbon atoms, trifluoromethyl, alkoxy, amino, alkylamino, dialkylamino, solubilizing group, and m is 0-5.
- the tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor is masitinib or a pharmaceutically acceptable salt thereof, more preferably masitinib mesilate.
- Masitinib is a c-Kit / PDGFR inhibitor with a potent anti mast cell action.
- New potent and selective c-Kit, platelet derived growth factor receptor (PDGFR) inhibitors are 2-(3-aminoaryl)amino-4-aryl-thiazoles described in AB Science's PCT application WO 2004/014903.
- Masitinib is a small molecule drug, selectively inhibiting specific tyrosine kinases such as c- Kit, PDGFR, Lyn, Fyn, and DDR1 without inhibiting, at therapeutic doses, kinases associated with known toxicities (i.e. those tyrosine kinases or tyrosine kinase receptors attributed to possible tyrosine kinase inhibitor cardiac toxicity, including ABL, KDR and Src) [Dubreuil et al., 2009, PLoS ONE 2009.4(9):e7258; Davis et al., Nat Biotechnol 201 1 , 29(1 1 ): 1046-51 ].
- toxicities i.e. those tyrosine kinases or tyrosine kinase receptors attributed to possible tyrosine kinase inhibitor cardiac toxicity, including ABL, KDR and Src
- masitinib The chemical name for masitinib is 4-(4-methylpiperazin-1 -ylmethyl)-N-[4-methyl-3-(4- pyridin-3ylthiazol-2-ylamino) phenyl]benzamide - CAS number 790299-79-5, and the structure is shown below. Masitinib was first described in US 7,423,055 and EP1525200B1 . A detailed procedure for the synthesis of masitinib mesilate is given in WO2008/098949.
- Masitinib's main kinase target is c-Kit, for which it has been shown to exert a strong inhibitory effect on wild-type and juxtamembrane-mutated c-Kit receptors, resulting in cell cycle arrest and apoptosis of cell lines dependent on c-Kit signaling [Dubreuil et al., 2009, PLoS ONE, 4(9):e7258].
- masitinib demonstrated high activity and selectivity against c-Kit, inhibiting recombinant human wild-type c-Kit with an half inhibitory concentration (IC50) of 200 ⁇ 40 nM and blocking stem cell factor- induced proliferation and c-Kit tyrosine phosphorylation with an IC50 of 150 ⁇ 80 nM in Ba/F3 cells expressing human or mouse wild-type c-Kit.
- IC50 half inhibitory concentration
- masitinib can also regulate the activation of mast cells through its targeting of Lyn and Fyn, key components of the transduction pathway leading to IgE induced degranulation [(Gilfillan et al., 2006, Nat Rev Immunol, 6:218-230); (Gilfillan et al., 2009, Immunological Reviews, 228:149-169)]. This can be observed in the inhibition of FceRI-mediated degranulation of human cord blood mast cells [Dubreuil et al., 2009, PLoS ONE;4(9):e7258]. Masitinib is also an inhibitor of PDGFR a and ⁇ receptors.
- masitinib inhibits the in vitro protein kinase activity of PDGFR-a and ⁇ with IC50 values of 540 ⁇ 60 nM and 800 ⁇ 120 nM.
- masitinib inhibited PDGF-BB-stimulated proliferation and PDGFR-a tyrosine phosphorylation with an IC50 of 300 ⁇ 5 nM.
- masitinib strongly interacts with the discoidin domain receptor family member 1 (DDR1 ) kinase, leading to a pronounced inhibition of DDR1 autophosphorylation.
- DDR1 discoidin domain receptor family member 1
- DDR1 signaling seems to be involved in cell interactions with the extracellular matrix, and to control adhesion and cell motility, which are both essential characteristics of cancer cells.
- the deregulation of these capabilities is associated with tumor progression and poor prognosis in a number of human cancers.
- Masitinib has been shown to strongly bond to the DDR1 receptor and inhibit its activity [Davis et al., Nat Biotechnol 201 1 , 29(1 1 ): 1046-51 ]. Masitinib could therefore slow down the homing and colonization of tumor cells.
- the present invention relates to a method for the treatment of cancer in a human patient, wherein said method comprises administering to a human patient in need thereof, a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, optionally combined with at least one antineoplastic agent.
- treatment refers to preventing, curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of a disease state, disease progression, disease causative agent (e.g., bacteria or viruses) or other abnormal condition.
- treatment may involve alleviating a symptom (i.e., not necessary all symptoms) of a disease or attenuating the progression of a disease.
- the inventors have surprisingly shown that the combination of masitinib plus gemcitabine provides therapeutic benefit to a highly distinct subpopulation of pancreatic cancer patients with pain intensity serving as an independent predictor factor.
- a randomized placebo-controlled phase 3 study (AB07012) was conducted based on the aforementioned in vitro and preliminary in vivo data to determine the efficacy and safety of a masitinib in combination with gemcitabine compared with gemcitabine alone as first-line therapy in patients with advanced/metastatic pancreatic cancer (see Example 1 ). It was strongly predicted that the principal mechanism of action responsible for any improvement in masitinib treated patient survival would be a masitinib-induced sensitization of pancreatic cancer cells to gemcitabine.
- the patient population to benefit from the masitinib plus gemcitabine combination would closely mirror that for gemcitabine treatment, regardless of subpopulation variables such as patient performance status, age, or tumor localization etc.; i.e. all patients with locally advanced (unresectable Stage II or Stage III) or metastatic (Stage IV) adenocarcinoma of the pancreas.
- results from study AB07012 revealed that in the modified intent to treat (mITT) population there was no survival advantage in patients treated with the masitinib plus gemcitabine combination compared with patients receiving gemcitabine plus placebo, i.e. gemcitabine as a single agent (see Example 1 ).
- secondary exploratory analyses on overall survival, stratified according to pain intensity revealed that the combination of masitinib plus gemcitabine had improved survival compared with gemcitabine as a single agent, in a subpopulation of patients having pancreatic cancer that was associated with pain or the requirement of opioid analgesics for the treatment of disease related pain.
- masitinib optionally administered in combination with at least one antineoplastic agent promotes survival in the subpopulation of patients with cancer that is associated with pain or the requirement of opioid analgesics for the treatment of disease related pain via, but not limited to: controlling tumor proliferation via modulation of the tumor microenvironment and in particular through modulation of mast cell activity; modulation of immunostimulation- mediated anticancer effects; and antimetastatic effects.
- masitinib's effect to each of these secondary mechanisms of action.
- masitinib through its inhibition of c-Kit, exerts a direct anti-proliferative and pro-apoptotic action on mast cells and indirectly therefore, reduces the array of pro-inflammatory and pro-angiogenic cytokines and chemokines that are important in tumor growth and tumor invasiveness.
- masitinib can also regulate the activation of mast cells through its targeting of Lyn and Fyn, key components of the transduction pathway leading to IgE induced mast cell degranulation [Gilfillan, 2006; Gilfillan, 2009]. This can be observed in the inhibition of FceRI-mediated degranulation of human cord blood mast cells [Dubreuil et al., 2009].
- Masitinib also strongly interacts with the DDR1 , a kinase the deregulation capabilities of which are associated with tumor progression and poor prognosis in a number of human cancer [Davis et al., Nat Biotechnol 201 1 , 29(1 1 ): 1046-51 ]. Masitinib could therefore slow down the homing and colonization of tumor cells.
- the microenvironment of the local host tissue is an active participant and determines the extent of cancer cell proliferation, angiogenesis, invasion, and survival.
- the role of mast cells in the tumorigenesis of cancers is not well understood however, and there is conflicting data about their benefit or detriment to tumorigenesis, depending on the local stromal conditions and whether the mediators released facilitate the proliferation of tumor cells or induce the apoptosis of malignant cells [(Theoharides TC, et al., Trends Immunol 2004;25:235 ⁇ 11 ); (Samoszuk M, et al., BMC Cancer 2005;21 :121 ); (Almholt K, et al., Recent Results Cancer Res 2003;162:31 ⁇ 12); (Gooch JL, et al., Cancer Res 1998; 15:4199-205)].
- the onset of disease related pain in pancreatic cancer can serve as a marker of mast cell activity, which in turn signals a more aggressive stage in the cancer's pathogenesis.
- the disease related pain of cancer patients, and in particular pancreatic cancer patients is a cancer-induced neuropathologic by-product of changes in the tumor microenvironment; changes that are responsible for driving disease progression and metastasis, and which involve recruitment of mast cells or an increase in mast cell activation.
- the timing and severity of disease related pain can be considered as a marker of the cancer's pathogenesis, with increased mast cell activity being responsible in part for both tumor progression and disease related pain. Therefore, inhibition of mast cell activity is a plausible therapeutic target for the subpopulation of cancer patients presenting with disease related pain or the requirement of opioid analgesics for treatment of disease related pain.
- masitinib administered in combination with gemcitabine increased overall survival in the subpopulation of pancreatic cancer patients with disease related pain.
- data from study AB07012 showed that masitinib plus gemcitabine decreased overall survival in the subpopulation of pancreatic cancer patients with no disease related pain and no requirement of opioid analgesics for treatment of disease related pain.
- a highly distinct subpopulation from the general pancreatic cancer population has been shown to benefit from the use of at least one compound of the invention (i.e. a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib) administered in combination with at least one antineoplastic agent (especially gemcitabine).
- This subpopulation can be identified via assessment of disease related pain intensity; for example, but not restricted to, at least one occurrence of a non-zero Visual Analogue Scale (VAS) pain intensity score (especially with a cut-off at VAS >20, e.g. higher than 20 mm on a 100 mm scale), or equivalent measure of this pain intensity threshold.
- VAS Visual Analogue Scale
- This subpopulation defines one embodiment of patients relevant to the present invention.
- biochemical markers are associated with pain, one or more of which may serve as surrogate markers to objectively support the pain intensity predictor factor described above.
- biochemical markers include, but are not restricted to, nerve growth factor (NGF), bradykinin, tryptase, histamine, neurotrophin-3 (NT-3), and brain-derived neurotrophic factor (BDNF).
- NGF nerve growth factor
- NT-3 neurotrophin-3
- BDNF brain-derived neurotrophic factor
- biochemical markers of pain are known to be variable and to date there is no conclusive evidence that they can quantitatively identify cancer patients experiencing disease related pain.
- the subpopulation having pancreatic cancer that is associated with 'pain' was defined in this study as those patients with a baseline Visual Analogue Scale (VAS) pain intensity score of greater than 20 (i.e. VAS >20 mm as measured on a 100 mm scale).
- VAS Visual Analogue Scale
- This linear scale provides a visual representation of pain amplitude as perceived by the patient ( Figure 2).
- the amplitude was represented by a 100 mm long line having no reference marks.
- One extremity indicated an absence of pain (0 value) and the other the worst imaginable pain (100 value).
- At baseline each patient was asked to indicate the level of pain intensity they were experiencing by drawing a vertical line on the VAS scale. It was considered that a patient with no pain, or negligible pain, would locate a vertical line between 0 and 5 on the VAS scale.
- VAS score indicated herein refers to the absolute amplitude on a linear scale or equivalently a percentage; for example, a VAS pain intensity score of 20 corresponds to an indicated level of pain at 20 mm on a 100 mm scale, or alternatively at 20% of said scale.
- any equivalent measure of this pain intensity threshold would be valid; for example, but not limited to, a unidimensional pain intensity assessment tool score of >20%, a criteria-based pain categorization of at least moderate pain; or a multidimensional pain assessment tool rating of at least moderate pain.
- this pain intensity threshold is that said cancer patients have a disease related pain of at least moderate intensity.
- the pain intensity predictor factor in the embodiment as described above, was defined based upon the reasons: (1 ) this threshold was approximately (rounding to the nearest ten) the study population's median pain intensity (50% of the population); (2) a VAS pain intensity of 20 mm coincided with the emergence of a plateau (or horizontal asymptote) in the hazard ratio for death (see Figure 1 ); (3) this threshold has been previously cited in the literature as a pain intensity cut-off.
- gemcitabine works best when administered in combination with masitinib.
- a statistically significant benefit in terms of median overall survival and hazard ratio for death, was observed for combination masitinib plus gemcitabine treatment in patients with pancreatic cancer that is associated with pain at VAS >20.
- gemcitabine works best by itself; indicating that in the absence of any other independent predictor factor, treatment of this subpopulation with masitinib plus gemcitabine is inadvisable. Negative therapeutic benefit, in terms of median overall survival and hazard ratio for death, was observed for combination masitinib plus gemcitabine treatment in patients from the 'no pain, no morphine' subpopulation.
- the use of at least one compound of the invention for the treatment of pancreatic cancer would depend upon, although not be restricted to, the following guidelines:
- Treatment is indicated if the patient meets the 'pain' subpopulation criterion of VAS pain intensity >20, or equivalent measure of pain intensity, on at least one occasion. • At least one question could be asked to eliminate pain that is not relevant to pancreatic cancer, for example, the patient might be asked to indicate the localization of their pain.
- the neutral subpopulation of patients ('below median pain', VAS ⁇ 20, or equivalent measure of pain intensity), for whom there was a statistically non-significant benefit in hazard ratio, provides a large buffer between the indicated treatment subpopulation and the subpopulation for whom said treatment is inadvisable.
- the diagnostic decision in terms of harm / no harm due to treatment effectively becomes a 'binary' indicator, with the condition of 'no pain, no morphine' being highly distinguishable from 'pain' (VAS >20).
- VAS >20 the condition of 'no pain, no morphine' being highly distinguishable from 'pain'
- masitinib dose 9 mg/kg/day was not optimal for good patient compliance, in part due to additional toxicity associated with the combination.
- a masitinib dose of 6 mg/kg/day is considered to be the optimal starting dose, with dose escalation permitted in patients with an inadequate response in the absence of limiting toxicities.
- the present invention also relates to a method for the treatment of cancer in a human patient, wherein said method comprises administering to a human patient in need thereof, a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, optionally combined with at least one antineoplastic agent, wherein said patient is initially selected for treatment based upon gene expression predictor factors.
- RNA expression in peripheral blood cell samples collected prior to treatment with masitinib was carried out in parallel to study AB07012 with an aim to identify gene expression patterns predictive for overall survival and treatment efficacy.
- Genomic analyses (carried-out by Skuldtech, adjoin, France) consisted of global transcriptome analysis of RNA expression using the high throughput method of Next Generation Sequencing (performed independently in triplicate). This analysis simultaneously measured the expression level of large numbers of genes in blood samples drawn from a subpopulation of patients randomized to study AB07012. Analyses were first carried out on the study's overall population whatever the treatment administered, followed by an analysis on each treatment arm i.e.
- masitinib or placebo arm to determine possible genetic trends according to the treatment.
- the objectives of this ancillary study were to reveal biomarkers predictive of extended survival (i.e. increased OS) for masitinib treated patients as compared with placebo treated patients.
- RNA blood samples were collected and analyzed, resulting in isolation of a gene expression profile indicative of aggressive disease progression, present in 55% of patients, which was highly predictive for overall survival and furthermore interacted with the treatment.
- This ancillary pharmacogenomic database contained blood RNA samples from 1 19 patients randomized to study AB07012 (1 :1 ratio according to treatment arm) in order to detect gene expressions that correlated with treatment effect.
- the full human genome (27,000 genes) was analyzed in terms of a possible correlation between RNA expression levels and overall survival, with respect to treatment type.
- RNA blood samples were collected using the PAXgene Blood RNA System and three independent Digital Gene Expression (DGE) libraries were constructed for four pooled RNA samples falling into the following patient profiles:
- the resultant genomic database contained 1 19 modified intent-to-treat patients from which 169 genes were identified through differential expression analysis using the edgeR method with a 1 .5-fold change and a false discovery rate adjusted p-value criterion of ⁇ 10%.
- a second step real time quantitative PCR (real time quantitative polymerase chain reaction or qPCR) was performed, which allows one to determine the Cycle threshold (Ct) value of a gene, said value being normalized with respect to the expression level of a housekeeping or reference gene to give a Delta Ct (DCt) value.
- Housekeeping genes are genes that are expressed in all the cells of an organism under normal and pathophysiological conditions. These genes are usually expressed at relatively constant levels.
- the normalization is based on the expression level of two housekeeping genes, and in particular, based on the expression level of genes B2M and GAPDH.
- DCt Ct (gene) - [Ct (B2M) + Ct (GAPDH)]/2.
- High DCt values corresponded to a relatively lower level of gene expression.
- the expression level of a gene is measured as the level of the protein of said gene.
- the level of the protein is preferably measured by employing antibody-based detection methods such as immunochemistry or western-blot analysis.
- the expression level of a gene is measured as the level of the RNA transcript or the cDNA of said genes.
- the level of RNA transcript(s) or the cDNA is measured by employing nucleic acid based detection methods such as microarrays, quantitative PCR, DNA chips, hybridization with labeled probes, or lateral flow immunoassays, in particular lateral flow dipstick tests.
- the expression level of the gene is measured by real time quantitative PCR performed on the RNA transcript or the cDNA of said gene.
- a real time quantitative PCR is a PCR wherein the amplified DNA is detected as the reaction progresses in real time. This detection is made through the accumulation of a fluorescent signal.
- the Ct is defined as the number of PCR cycles required for the fluorescent signal to cross the threshold (i.e. exceed background level).
- a forward and a reverse primer, and a reporter are used in a qPCR.
- primers that are specific for hybridizing within the gene coding regions are used.
- RNA sample was collected a patient's blood sample, and the RNA extracted using PAXgene Blood RNA Kit V.2 (PreAnalitix) according to the manufacturer's recommendations. Control of RNA integrity was performed with the 2100 Bioanalyzer (Agilent Technologies, Palo Alto, USA) using Eukaryotic Total RNA 6000 Nano Chip (Agilent Technologies). RNA quantity was controlled using NanoDrop ND- 1000 spectrophotometer. Purified RNAs were conserved at -80 °C Digital Gene Expression (DGE) experiments were performed to select set of putative biomarkers. Biomarker validation was done using Real-Time PCR on COBAS platform (LC480, ROCHE Diagnostics) and appropriate biostatistical approaches have been used to filter best biomarkers.
- DGE Digital Gene Expression
- RNAs were reverse transcripted according the Roche Diagnostics' protocol. Gene expression levels of putative biomarkers were investigated by Real-Time PCR.
- DGE analysis resulted in the selection of 169 genes, taken from a genomic database of 1 19 modified intent-to-treat patients.
- Multivariate analysis subsequently refined the gene selection down to a total of 64 genes with associated cut-off values.
- Each combination was classified according to the discriminatory power of the combination measured by p-value of the Chi-squared test provided in the Cox model.
- An additional criterion for retaining a given dual-gene combination was that the subpopulation refined should contain at least 40 patients (1 /3 of the total sample).
- the ten individual genes found in the six identified gene expression predictor factors were: ACOX-1 , TNFRSFS10B, RPS23, ABCC3, LYN, HIF1 ALPHA, ABCC1 , IGJ, UBE2H, and PARP-2.
- the expression level of these genes was measured by real time quantitative PCR (real time quantitative polymerase chain reaction or qPCR) using primers that were specific for hybridizing within the gene coding regions.
- the primers amplify a sequence located on chromosome 17 between nucleotide 73,938,893 and nucleotide 73,939,007 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome 8 between nucleotide 22,877,657 and nucleotide 22,877,728 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome 5 between nucleotide 81 ,571 ,951 and nucleotide 81 ,572,049 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome 17 between nucleotide 48,762,132 and nucleotide 48,762,221 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome 8 between nucleotide 56,854,522 and nucleotide 56,860,210 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome chromosome 14 between nucleotide 62,214,901 and nucleotide 62,214,976 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome 16 between the nucleotide 16,177,368 and nucleotide 16,180,772 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome 4 between the nucleotide 71 ,521 ,360 and nucleotide 71 ,521 ,432 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome 7 between the nucleotide 129,470,836 and nucleotide 129,470,925 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the primers amplify a sequence located on chromosome 14 between the nucleotide 20,825,213 and nucleotide 20,825,283 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the following primers can be used to perform the real time quantitative PCR:
- o primer forward ATCCAACGTCCAATAAACAGCA (SEQ ID NO:19)
- o primer reverse AAGGCTACCACAATGTCTCCT (SEQ ID NO:20)
- the two housekeeping genes used were B2M and GAPDH.
- the amplified sequence is located on chromosome 15 between nucleotides 45,010,919 and nucleotides 45,010,990 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- the amplified sequence is located on chromosome 12 between nucleotides 6,643,999 and nucleotides 6,645,738 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
- primers for performing the real-time quantitative PCR, primers, size (preferably between 80 and 150 nucleotides), Tm (melting temperature, preferably 60°C ⁇ 1 °C), GC% (percentage of G or C nucleotide, preferably -60% in 3'), 3' and 5' self-complementarity and stability (preferably inferior to 4 nucleotides), product size ranges and thermodynamic parameters (secondary structure evolution according primer Tm and sodium salt concentration) are selected to allow a simultaneous detection.
- the most significant dual-gene combination was chosen first (and then the following information was recorded: number of patients in the subpopulation, Hazard Ratio (HR); p-value of the Cox model.
- HR Hazard Ratio
- p-value of the Cox model.
- the second most significant dual-gene combination was added in order to increase the sample size and also the power of analyses. The same information as above was recorded. The process of selection was stopped when no (or few) additional patients were added to the sample size following addition of a new combination, with the condition also that Hazard Ratio and/or p-value were maintained (see Example 2, Table 5).
- OS was analyzed in the subpopulation identified as harboring at least one of the gene expression predictor factors, referred to hereafter as the “genetic fingerprint” or “transcriptional fingerprint” subpopulation (65 patients), and in its counterpart, i.e. patients that did not present any of the gene expression predictor factors, referred to hereafter as the “non genetic fingerprint” or “non transcriptional fingerprint” subpopulation (53 patients).
- patients harboring at least one of the aforementioned gene expression predictor factors, and therefore identified as belonging to the defined 'genetic fingerprint' subpopulation have a 83% decrease in risk of death when treated with the combination of masitinib plus gemcitabine as compared with gemcitabine alone.
- the risk of death for patients in the 'genetic fingerprint' subpopulation was still reduced by 66% when treated with masitinib plus gemcitabine.
- the risk of death for patients not harboring at least one of the aforementioned gene expression predictor factors is higher when treated with the combination of masitinib plus gemcitabine as compared with gemcitabine alone. Therefore, said treatment of any patient in the 'non genetic fingerprint' subpopulation, and in the absence of any other positive predictor factor, is inadvisable.
- the treatment management plan is simply a binary choice between administering masitinib, optionally combined with at least one antineoplastic agent, to those patients identified as having the appropriate genetic fingerprint, and not administering masitinib to patients lacking said genetic fingerprint.
- the treatment management plan for the pain intensity predictor factor is more complex and must take into consideration different thresholds for pain intensity and existing treatment regimens.
- the invention relates to a method of treatment of cancer in human patients, wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, is administered in a patient in need thereof, optionally combined with at least one antineoplastic agent.
- a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof is administered in a patient in need thereof, optionally combined with at least one antineoplastic agent.
- the compound of the invention and the at least one optional antineoplastic agent may be administered separately, simultaneously or sequentially in time.
- said tyrosine kinase inhibitor, mast cell inhibitor or c- Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof is administered in combination with at least one antineoplastic agent for the treatment of cancer, wherein said patient is either na ' ive to said at least one antineoplastic agent or responding to treatment with said at least one antineoplastic agent.
- said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof is administered in combination with at least one antineoplastic agent for the treatment of cancer, wherein said patient is refractory or resistant to said at least one antineoplastic agent.
- the invention also relates to a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, notably as defined above, especially masitinib, optionally combined with at least one antineoplastic agent, for use as a medicament or in a pharmaceutical composition for a method as defined in the description.
- the invention also relates to a kit comprising at least a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, notably as defined above, especially masitinib, optionally with at least one antineoplastic agent, for use in a method for the treatment of a cancer as defined in the present description and examples.
- the present invention relates to the method as defined above wherein a tyrosine kinase inhibitor or a mast cell inhibitor is an inhibitor of kinase activity selected from the tyrosine kinases of: c-Kit, PDGFR, Lyn, Fyn and DDR1 .
- the present invention relates to the method as defined above, wherein said patient is initially selected for treatment based upon the predictor factor of pain intensity.
- the present invention relates to a method of treatment of cancer that is associated with pain or that requires administration of opioid analgesics for treatment of disease related pain, in a human patient, wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, is administered to a patient in need thereof, optionally combined with at least one antineoplastic agent.
- said patient is considered to be in the indicated treatment subpopulation if on at least one occasion said patient presents with disease related pain defined as a nonzero Visual Analogue Scale (VAS) pain intensity score, or equivalent measure of pain intensity.
- VAS Visual Analogue Scale
- said patient is considered to be in the indicated treatment subpopulation if on at least one occasion said patient presents with disease related pain defined as a VAS pain intensity score of greater than 5 (e.g. VAS >5 mm as measured on a 100 mm scale, or 5%); or a VAS pain intensity score of greater than 10 (e.g. VAS >10 mm as measured on a 100 mm scale, or 10%); or even a VAS pain intensity score of greater than 20 (e.g. VAS >20 mm as measured on a 100 mm scale, or 20%).
- VAS Visual Analogue Scale
- said patient is considered to be in the indicated treatment subpopulation if on at least one occasion said patient presents with disease related pain defined by an equivalent measure of said VAS >20 pain intensity threshold.
- Said patients is also considered to be in the indicated treatment subpopulation if on at least one occasion said patient presents with disease related pain intensity classified as being moderate to intolerable pain.
- individual disease related pain intensity is defined and assessed as disclosed above.
- the present invention relates to the method as defined above wherein said patient is afflicted by pancreatic cancer that is associated with pain or that requires administration of opioid analgesics for treatment of disease related pain, and wherein 'pain' is defined as at least one reported occurrence of a Visual Analogue Scale (VAS) pain intensity score of greater than 20 (e.g. VAS >20 mm as measured on a 100 mm scale, or 20%).
- VAS Visual Analogue Scale
- treatment of said patient is considered to be inadvisable if, in the absence of any other independent predictor factor, said patient presents no disease related pain and no requirement of opioid analgesics for treatment of disease related pain.
- the present invention relates to the method as defined above, wherein said patient is initially selected for treatment based upon gene expression predictor factors.
- said gene expression predictor factors are derived from analysis of RNA expression in peripheral blood cell samples collected prior to treatment with said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof.
- said patient is considered to be in the indicated treatment subpopulation if the gene expression in peripheral blood cell samples collected prior to administration of the compound of the invention shows a concomitant up-regulation or down- regualtion of at least two genes selected from: ACOX-1 , TNFRSFS-10B, RPS23, ABCC3, LYN, HIF-1 A, ABCC1 , IGJ, UBE-2H, or PARP-2.
- dual-gene combinations include, but are not restricted to: the concomitant up-regulation of genes ACOX-1 and TNFRSF10B; the concomitant down-regulation of gene RPS23 and up-regulation of gene ACOX-1 ; the concomitant up-regulation of genes ABCC3 and LYN; the concomitant up- regulation of genes HIF1 A and TNFRSF10B; the concomitant down-regulation of genes ABCC1 and IGJ; the concomitant down-regulation of genes UBE2H and PARP-2.
- the concomitant up-regulation of genes ACOX-1 and TNFRSF10B corresponds to patient Delta Cycle Threshold values of less than or equal to 3.81 for ACOX- 1 and less than or equal to 7.63 for TNFRSF10B; more preferably to patient Delta Cycle Threshold values of less than or equal to 3.36 for ACOX-1 and less than or equal to 6.71 for TNFRSF10B;and even more preferably to patient Delta Cycle Threshold values of less than or equal to 3.05 for ACOX-1 and less than or equal to 6.1 for TNFRSF1 OB.
- the concomitant down-regulation of gene RPS23 and up-regulation of gene ACOX-1 corresponds to patient Delta Cycle Threshold values of greater than 0.26 for RPS23 and less than or equal to 3.81 for ACOX-1 ; more preferably to patient Delta Cycle Threshold values of greater than 0.32 for RPS23 and less than or equal to 3.36 for ACOX-1 ; and even more preferably to patient Delta Cycle Threshold values of greater than 0.35 for RPS23 and less than or equal to 3.05 for ACOX-1 .
- the concomitant up-regulation of genes ABCC3 and LYN corresponds to patient Delta Cycle Threshold values of less than or equal to 5.38 for ABCC3 and less than or equal to 2.06 for LYN; more preferably to patient Delta Cycle Threshold values of less than or equal to 4.73 for ABCC3 and less than or equal to 1 .82 for LYN; and even more preferably to patient Delta Cycle Threshold values of less than or equal to 4.3 for ABCC3 and less than or equal to 1 .65 for LYN.
- the concomitant up-regulation of genes HIF1 A and TNFRSF10B corresponds to patient Delta Cycle Threshold values of less than or equal to 4.94 for HIF1 A and less than or equal to 7.06 for TNFRSF10B; more preferably to patient Delta Cycle Threshold values of less than or equal to 4.35 for HIF1 A and less than or equal to 6.22 for TNFRSF10B; and even more preferably to patient Delta Cycle Threshold values of less than or equal to 3.95 for HIF1 A and less than or equal to 5.65 for TNFRSF10B.
- the concomitant down-regulation of genes ABCC1 and IGJ corresponds to patient Delta Cycle Threshold values of greater than 2.63 for ABCC1 and less than or equal to 5.29 for IGJ; more preferably to patient Delta Cycle Threshold values of greater than 3.15 for ABCC1 and less than or equal to 6.35 for IGJ; and even more preferably to patient Delta Cycle Threshold values of greater than 3.5 for ABCC1 and less than or equal to 7.05 for IGJ.
- the concomitant down-regulation of genes UBE2H and PARP-2 corresponds to patient Delta Cycle Threshold values of greater than 2.78 for UBE2H and greater than 5.33 for PARP-2; more preferably to patient Delta Cycle Threshold values of greater than 3.33 for UBE2H and greater than 6.39 for PARP-2; and even more preferably to patient Delta Cycle Threshold values of greater than 3.7 for UBE2H and greater than 7.1 for PARP-2.
- the present invention relates to a method of treatment of cancer, wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, optionally combined with at least one antineoplastic agent, is administered to a patient in need thereof, wherein said patient has a peripheral blood up-regulation of the gene ACOX-1 , or homologous thereof.
- the up-regulation of gene ACOX-1 corresponds to patient Delta Cycle Threshold value of less than or equal to 3.81 ; more preferably of less than or equal to 3.36; and even more preferably of less than or equal to 3.05.
- a preferred salt of masitinib is masitinib mesilate.
- a compound of the invention is to be administered at a daily dose of 4.5 to 12.0 mg/kg/day, with the preferred starting daily dose of 6.0 to 7.5 mg/kg/day.
- a compound of the invention is dose escalated by increments of 1 .5 mg/kg/day to reach a maximum of 12.0 mg/kg/day.
- a compound of the invention is dose reduced by increments of 1 .5 mg/kg/day to reach a minimum of 4.5 mg/kg/day.
- Dose adjustment can be considered a dynamic process, with a patient undergoing multiple increases and/or decreases to optimize the balance between response and toxicity throughout treatment, both of which are likely to vary over time and duration of drug exposure.
- dose escalation is undertaken, it is suggested that the starting dose of 6.0 mg/kg/day be incremented by 1 to 2 mg/kg/day up to a maximum dose of 12.0 mg/kg/day, over a period which depends upon clinical observations.
- a single dose escalation of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, and preferably masitinib mesilate may take from 1 to 2 months.
- Any dose indicated herein refers to the amount of active ingredient as such, not to its salt form.
- masitinib dose in mg/kg/day used in the described dose regimens refers to the amount of active ingredient masitinib
- compositional variations of a pharmaceutically acceptable salt of masitinib mesilate will not change the said dose regimens.
- Said compound of the invention is preferably administered orally.
- Said compound of the invention is preferably administered twice a day.
- the use or method comprises a long term administration of an effective amount of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, over more than 3 months, preferably more than 6 months.
- the present invention relates to the method as defined above, wherein said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, is administered for the treatment of unresectable advanced or metastatic adenocarcinoma pancreatic cancer, optionally combined with at least one antineoplastic agent, and wherein said patient is in need thereof, as defined by the predictor factor of either gene expression or pain intensity.
- the at least one antineoplastic agent can be a medicament for the treatment of cancers, and is preferably selected from the group consisting of gemcitabine (Gemzar®; Lilly), erlotinib (Tarceva®; Roche), paclitaxel (Taxol®, Abraxane®; Bristol-Myers Squibb), Folfirinox, 5- fluorouracil (5-FU), capecitabine, cisplatin, oxaliplatin, irinotecan, leucovorin, and any combination of these antineoplastic agents.
- the invention also relates to a method of treatment of pancreatic cancer, wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, is administered optionally in combination with gemcitabine.
- effective doses of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, in human patients with pancreatic cancer are 4.5 to 9.0 mg/kg/day per os, preferably in two daily intakes.
- a starting dose of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, of 6.0 to 7.5 mg/kg/day has been found to be the preferred embodiment according to the invention.
- tyrosine kinase inhibitor for patients with an inadequate response after an assessment of response to therapy and in the absence of limiting toxicities, dose escalation of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, to a maximum of 9.0 mg/kg/day can be safely considered and patients may be treated as long as they benefit from treatment and in the absence of limiting toxicities.
- dose of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof can be reduced by increments of 1 .5 mg/kg/day to reach a minimum of 4.5 mg/kg/day in intolerant patients, as long as they benefit from treatment and in the absence of limiting toxicities at said dose.
- said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof is administered at a starting daily dose of 6.0 to 7.5 mg/kg/day, and gemcitabine is administered at a weekly dose of 1000 ⁇ 250 mg/m2 of patient surface area for up to seven consecutive weeks as a start (from 3 to 7 weeks), followed by a week off-treatment, followed by cycles of weekly dose of 1000 ⁇ 250 mg/m2 for 3 weeks, every 28 days.
- gemcitabine it shall be understood that slight modification of the above dosage regimen is encompassed herein. For example, every 28 days means that one cycle is 3 weeks under treatment and 1 week off- treatment.
- the composition of the invention is an oral composition.
- excipients can be used adapted to the mode of administration and some of them can promote the effectiveness of the active molecule, e.g. by promoting a release profile rendering this active molecule overall more effective for the treatment desired.
- compositions of the invention are thus able to be administered in various forms, more specially for example in an injectable, pulverizable or ingestible form, for example via the intramuscular, intravenous, subcutaneous, intradermal, oral, topical, rectal, vaginal, ophthalmic, nasal, transdermal or parenteral route.
- a preferred route is oral administration.
- the present invention notably covers the use of a compound according to the present invention for the manufacture of pharmaceutical composition.
- Such medicament can take the form of a pharmaceutical composition adapted for oral administration, which can be formulated using pharmaceutically acceptable carriers well known in the art in suitable dosages.
- pharmaceutically acceptable carriers well known in the art in suitable dosages.
- Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
- these pharmaceutical compositions may contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.).
- Figure 1 Hazard ratio for death versus VAS score in the multivariate analysis
- Figure 2 Example of VAS scale and user instructions.
- Figure 3 Treatment management plan based upon predictor factors of pain intensity and gene expression
- Figure 5 Survival probability for 'no pain, no morphine' subpopulation (multivariate analysis)
- EXAMPLE 1 Randomized, placebo controlled, phase 3 study to evaluate efficacy and safety of masitinib in combination with gemcitabine for treatment of patients with advanced/metastatic pancreatic cancer
- the intent-to-treat (ITT) population was defined as all randomized patients whether they had received the study treatment or not.
- the mITT (modified Intent-To-Treat) population included all ITT patients except for patients withdrawn prematurely from the study for a well- documented non treatment-related cause.
- the ITT population of study AB07012 consisted of 353 patients, enrolled from 1 1 November 2008 to 6 July 2010 (last patient included): 175 patients in the masitinib plus gemcitabine treatment arm and 178 patients in the placebo plus gemcitabine treatment arm. Clinical efficacy was analyzed on the mITT population, defined as the ITT population excluding five patients.
- VAS visual analogue scale
- VAS pain intensity of 20 mm coincided with the emergence of a plateau (or horizontal asymptote) in the hazard ratio for death.
- OS was measured from the date of randomization to the date of documented death. If death was not observed, data on OS were censored at the last date the patient was known to be alive. OS was investigated at each baseline characteristic through a univariate analysis in patients having received the placebo plus gemcitabine treatment, to determine variables that may impact overall survival independently from the treatment. The main differences in OS results (statistical significance at 5%, data not shown) were observed in the baseline characteristics of: VAS scale for pain intensity; locally advanced/metastatic cancer; albumin level (normal / abnormal); and localization of primary tumor in the body of the pancreas. The parameter with the greatest impact on overall survival was pain intensity.
- Factors selected with the "stepwise" multivariate model locally advanced/metastatic cancer, localization of primary tumor in the body of the pancreas, albumin level (normal/ abnormal), and VAS pain assessment assigned to three VAS pain intensity subpopulations (as defined above).
- Table 2 summarizes the statistically significant variables identified by the multivariate analysis Cox model for the overall population. Table 2: Analysis and development of a multivariate Cox model including treatment arm in the overall population
- results from the multivariate analysis confirmed that patients treated with masitinib plus gemcitabine had no statistically significant survival advantage over the placebo plus gemcitabine treatment arm for the overall population.
- this parameter was further investigated to determine whether there existed any interaction between this variable, the combination treatment type, and overall survival; i.e. OS as a function of VAS pain intensity score was analyzed for both treatment arms (masitinib versus placebo). Similar curves would correspond to no interaction between the two variables, whereas separated curves would indicate an interaction.
- Table 3 Results on overall survival after multivariate analysis in the overall population and in each VAS pain intensity subpopulation
- M+G masitinib plus gemcitabine
- P+G placebo plus gemcitabine. * Log-rank p-value.
- the masitinib plus gemcitabine combination significantly increased overall survival of patients with pancreatic cancer and with a pain intensity VAS score >20 compared with placebo plus gemcitabine, as evidenced by a p-value of 0.01.
- the hazard ratio for death (defined as the probability of death under masitinib plus gemcitabine over the probability of death under placebo plus gemcitabine) was 0.61 (95%CI [0.42; 0.88]), meaning that the risk for death in patients treated with masitinib plus gemcitabine was significantly decreased by 39% compared with patients treated with placebo plus gemcitabine.
- a worst case scenario of the higher confidence interval boundary i.e.
- the exposure to gemcitabine in the masitinib plus gemcitabine treatment arm as compared with the placebo plus gemcitabine treatment arm was decreased by approximately: 35% in the overall population; 30% in the 'pain' subpopulation; 30% in the 'below median pain' subpopulation; and 45% in the 'no pain, no morphine' subpopulation.
- masitinib dose 9 mg/kg/day is not optimal for patient compliance, in part due to additional toxicity associated with the combination.
- a masitinib dose of 6 mg/kg/day is considered to be the optimal starting dose, with dose escalation permitted in patients with inadequate response and in the absence of limiting toxicities.
- masitinib plus gemcitabine One objective of study AB07012 was to compare the efficacy of masitinib plus gemcitabine, with that of placebo plus gemcitabine in treatment of patients with unresectable locally advanced and/or metastatic pancreatic cancer.
- masitinib plus gemcitabine treatment did not show statistically significant improvements in the median overall survival of patients.
- multivariate analysis on different baseline characteristics identified pain intensity as the single most important factor with predictive power for overall survival. Three subpopulations have emerged according to the following criteria:
- the hazard ratio was inverted in the 'no pain, no morphine' subpopulation, being 1 .63 (95%CI [0.94; 2.85]) with a p-value of 0.041 . Therefore, according to the predictor factor of pain intensity, and in the absence of any other independent predictor factor, said treatment of patients in the 'no pain, no morphine' subpopulation is inadvisable.
- VAS Visual Analogue Scale
- EXAMPLE 2 Genomic analyses of study AB07012 to investigate predictive criteria of efficacy
- Genomic analyses consisting of global transcriptome analysis of peripheral blood cell samples collected prior to treatment with masitinib using high throughput method and Next Generation Sequencing (performed independently in triplicate) was performed by Skuldtech (Montpellier, France). The identification of genes whose expression correlated with overall survival and treatment type relied on a multistep process. Presented below are extracts taken from the Skuldtech protocol (steps 1 to 7), followed by general discussion on certain methodological aspects for differential gene expression.
- DGE Digital Gene Expression
- Biomarker validation was done using Real-Time PCR on COBAS platform (LC480, ROCHE Diagnostics) and appropriate biostatistical approaches have been used to filter for best biomarkers.
- RNA integrity was performed with the 2100 Bioanalyzer (Agilent Technologies, Palo Alto, USA) using Eukaryotic Total RNA 6000 Nano Chip (Agilent Technologies). RNA quantity was controlled using NanoDrop ND-1000 spectrophotometer. Purified RNAs were conserved at -80 °C
- DGE libraries Twelve Digital Gene Expression (DGE) libraries were constructed from pooled blood RNA samples of patients. For each of the four treatment groups (i.e. Placebo/Gemcitabine P or Masitinib + Gemcitabine M & dead before month 4, M4, or alive after month 15, M15), three DGE libraries were constructed using the same pooled blood RNA samples (three technical replicates). The libraries were constructed with lllumina's DGE Tag Profiling kit according to the manufacturer's protocol (version 2.1 B), using 5 ⁇ g of total RNA (equal amounts of RNA in the pool between each RNA sample). Sequencing analysis and base calling were carried out using the lllumina Pipeline, and sequence tags were obtained after purity filtering. The platform used is MGX (Montpellier, France).
- a local database compiling homo sapiens sequences and related information from well- annotated sequences of UniGene clusters (Built#232, March 2012, NCBI) was generated.
- the expected DGE tag canonical tag located upstream the 3'-nearest Nlalll restriction site (CATG) of the sequence (R1 ), as well as putative tags located in inner positions (labeled as R2, R3 and R4 starting from the 3' end of the transcript), were extracted (Piquemal D, et al., Genomics. 2002 Sep;80(3):361 -71 ).
- Experimental tags obtained from DGE libraries were matched and annotated (exact matches for the 17bp) using this collection of virtual tags.
- Reverse transcriptions were carried out for each of the 1 19 RNA in 20 ⁇ final reaction volume with 300 ng of total RNA using 200 units of Superscript II enzyme (M-MLV RT Type, Invitrogen) and 250 ng of random primers according to manufacturer's instructions (25 °C for 10 min, 42 °C for 50 min, 70°C for 15 min), the sameday with the same pipettor set and the same manipulator.
- M-MLV RT Type Invitrogen
- the reaction mixture was prepared in a final volume of 2 ⁇ as follows: 0.4 ⁇ of LightCycler 1536 DNA Green Master 5X (Roche), 0.1 ⁇ of Bright Green 20X (Roche), 0.1 ⁇ of Setup Control 20X (Roche), 0.04 ⁇ of 50 ⁇ primers couple (Eurogentec), 0.36 ⁇ _ of DNAse RNAse free water and 1 ⁇ of cDNA matrix (1/50 final dilution).
- the reaction mixture was prepared in a final volume of 2 ⁇ as follows: 0.4 ⁇ of Real Time Ready DNA Probe Master 5X (Roche), 0.1 ⁇ of Control Setup 20X, 0.1 ⁇ of 4 ⁇ Forward primer (Eurogentec), 0.1 ⁇ of 4 ⁇ Reverse primer (Eurogentec), 0.1 ⁇ of 4 ⁇ FAM/TAMRA Probe (Eurogentec), 0.2 ⁇ of DNAse RNAse free water and 1 ⁇ of cDNA matrix (1 /50 final dilution). All pipetting steps were carried out with Agilent Bravo Automated Liquid Handling Platform.
- PCR program consists in a first preincubation step at 95 °C for 1 min following by 50 PCR cycles (95 °C for 2 sec, 60 °C for 30 sec). To discriminate specific from non-specific products and primer dimers, a melting curve was obtained by gradual increase in temperature from 60 to 95°C.
- the qPCR data were analyzed using the Delta.Ct (DCt) method (Livak KJ and Schmittgen TD. Methods. 2001 Dec;25(4):402-8).
- the DCt values were determined for all target genes by subtracting the Ct values from the mean of the Ct values of the two reference genes (housekeeping).
- the two housekeeping genes were B2M (NM 009735, Mus musculus beta-2 microglobulin, mRNA) and GAPDH (NM 002046, glyceraldehyde-3-phosphate dehydrogenase, transcript variant 1 , mRNA + NM 001256799 Homo sapiens glyceraldehyde-3-phosphate dehydrogenase, transcript variant 2, mRNA).
- DGE Digital Gene Expression
- biomarkers predictive of extended survival i.e. increased OS
- biomarkers predictive of early death i.e. decreased OS
- differential gene expression presents several challenges in terms of reproducibility and detection of truly novel gene expression patterns.
- analysis from Blood RNA samples is subject to various errors due to experimental and interindividual variability.
- pre-selection of genes of interest could be hampered by the need of pre- existing knowledge of the transcriptome. The following measures were adopted by Skuldtech to address these problems and to ensure optimal reproducibility:
- PAXgeneTM Blood RNA collection system avoids degradation of the RNA and differences in sample quality due to different collection standards among sites.
- the DGE methodology does not rely on a pre-existing knowledge of the transcriptome of interest and can therefore be applied to any patient group of interest.
- the first analytical step involved a complete DGE analysis, performed using the methodology of edgeR [http://www.bioconductor.Org/packages/2.9/bioc/html/edgeR.html].
- a 2 "ddCt (2exp - Delta Delta Cycle Threshold) analysis was performed using R package ddCt on the Real-Time PCR experiment, [www.bioconductor.org/packages/2.9/bioc/html/ddCt.html]. This analysis was used to set the differential cut-off to assess if a selected gene will fulfill the classic clinical and technical properties.
- each gene of interest was amplified by qPCR and a resulting parameter named the Delta Cycle Threshold (DCt) was assessed after individual normalization for each gene and for each patient, thereby providing the expression level of a given gene in a given patient.
- DCt Delta Cycle Threshold
- Normalizing of Ct values was achieved using two reference (housekeeping) genes (B2M, GAPDH), which showed stable expression in the DGE analysis throughout the blood RNA samples.
- DCt are defined for each gene under investigation by subtracting the Cycle Threshold (Ct) values from the geometric mean of the Ct values of the reference genes.
- DCt values are inversely proportional to the level of gene expression; therefore, in the case of up-regulated genes a lower DCt value indicates a greater level of expression, whilst in the case of down-regulated genes a higher DCt value indicates a lower level of expression.
- the DGE (Digital Gene Expression) method used in this study is a high throughput sequencing approach for transcriptomic analysis.
- This approach provides a digital measure of RNA abundance represented by the sequence read counts in a region of interest as opposed to an indirect, analog signal from microarrays.
- This approach has a broader dynamic range, and is not dependent on having pre-existing knowledge about the transcriptome under study.
- This approach therefore has the ability to comprehensively detect novel transcripts and mRNA variants resulting from alternative promoter usages, splice sites, and polyadenylation.
- DGE libraries were generated with mRNA isolated using poly-A selection from total RNA.
- RNAs were randomly primed for reverse transcription followed by second-strand synthesis to create double-stranded cDNA fragments. Specific 21 bp-tags for each of the RNAs were then extracted. The tags were isolated, specific adaptors were ligated and then followed by PCR amplification. Libraries were sequenced by lllumina's DNA sequencing platform (San Diego, USA). Because DGE provides absolute values and does not require any calibration with arbitrary standards, results can be compared with other data generated by independent laboratories.
- RNAs were reverse transcribed according to the Roche Diagnostics' protocol. Gene expression levels of putative biomarkers were investigated by Real-Time PCR, using the LightCycler 480. Expression of reference genes was quantified in each Real-Time PCR plate in order to assess the technical efficiency of the Real-Time PCR experiments. Variations in Ct values associated to each Real-Time PCR experiment were evaluated among the reference genes. The DCt values were determined for all target genes by subtracting the Ct values from the geometric mean of the Ct values of the reference genes. Thus, a data matrix was constructed based upon the DCt values obtained from all Real-Time PCR dynamic arrays, which was subsequently used for all hypothesis tests.
- DGE analysis resulted in the selection of 169 genes, taken from a genomic database of 1 19 modified intent-to-treat patients.
- the selection of these genes was based on the impact of genes on overall survival, e.g. genes associated with a correlation of overall survival with masitinib plus gemcitabine treatment.
- Each of the selected genes was amplified by quantitative Polymerase Chain Reaction (qPCR) and the expression level of a given gene in a given patient was evaluated after individual normalization. Analysis was based upon variations in Ct values associated to each qPCR experiment with respect to a set of reference genes (B2M, GAPDH). Delta Ct values (DCt) were defined for each gene under investigation by subtracting the Ct values from the geometric mean of the Ct values of these reference genes.
- qPCR quantitative Polymerase Chain Reaction
- the multivariate model used for primary criteria calculated Hazard-Ratio, Chi-squared statistic and p-value of the Cox model (one per gene) in order to explain OS, used the factors of: treatment arm, tumor status, tumor localization, and albumin level at baseline.
- the most significant dual- gene combination was chosen first and then the following information was recorded: number of patients in the subpopulation, Hazard Ratio; p-value of the Cox model. Next, another dual- gene combination was added in order to increase the sample size and also the power of analyses. The same information as above was recorded. The process of selection was stopped when no (or few) additional patients were added to the sample size following addition of a new combination, with the precondition that Hazard Ratio and/or p-value were maintained. Table 5 summarizes the selection process.
- the final selection of dual-gene combinations constituting a set of "gene expression predictor factors" (collectively referred to as the "genetic fingerprint").
- these six gene expression predictor factors define a patient subpopulation that has a higher probability of positive therapeutic response to masitinib treatment in terms of extended survival.
- This subpopulation can be generally interpreted as the 'genetic fingerprint' subpopulation for masitinib treatment in cancer.
- all analyses baseline, efficacy and safety
- efficacy analysis was also performed on the subpopulation that was negative for gene expression predictor factors (i.e. the 'non genetic fingerprint' subpopulation).
- OS was analyzed in the subpopulation identified as harboring at least one of the gene expression predictor factors, referred to hereafter as the "genetic fingerprint” or “transcriptional fingerprint” subpopulation (66 patients), and in its counterpart, i.e. patients that do not present any of the gene expression predictor factors, referred to hereafter as the “non genetic fingerprint” or “non transcriptional fingerprint” subpopulation (53 patients).
- Table 6 shows the median OS and survival rate estimates as calculated via univariate and multivariate analyses for the 'genetic fingerprint' subpopulation according to treatment arm.
- M+G masitinib plus gemcitabine
- P+G placebo plus gemcitabine
- NR not reached;
- M+G masitinib plus gemcitabine
- P+G placebo plus gemcitabine
- NR not reached;
- the above defined predictor factors of pain intensity and gene expression were shown to be independent factors for poor overall survival in cancer patients, and in particular pancreatic cancer in human patients, underscoring the high unmet medical need in the patient subpopulations of 'pain' and 'genetic fingerprint', as defined above.
- These two predictor factors identify patients who are suitable for treatment with the combination of at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt thereof, optionally combined with at least one antineoplastic agent.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oncology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (21)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES13773731.8T ES2656640T3 (es) | 2012-10-04 | 2013-10-04 | Uso de masitinib en combinación con gemcitabina para tratamiento de un subgrupo de pacientes que sufren de cáncer pancreático |
| JP2015535036A JP6234466B2 (ja) | 2012-10-04 | 2013-10-04 | 予測因子を用いて同定された患者サブ集団における癌の処置のためのマシチニブの使用 |
| AU2013326463A AU2013326463B2 (en) | 2012-10-04 | 2013-10-04 | Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors |
| US14/433,198 US10238649B2 (en) | 2012-10-04 | 2013-10-04 | Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors |
| SI201330891T SI2903616T1 (en) | 2012-10-04 | 2013-10-04 | The use of masitinib in combination with gemcitabine for the treatment of a subgroup of patients suffering from foot-and-mouth disease |
| MX2015004264A MX369999B (es) | 2012-10-04 | 2013-10-04 | Uso de masitinib en combinación con gemcitabina para el tratamiento de cáncer pancreatico en subpoblaciones de pacientes identificados en base al factor predictor de la intensidad de dolor. |
| EA201500373A EA037368B1 (ru) | 2012-10-04 | 2013-10-04 | Способ лечения рака поджелудочной железы у пациента, страдающего от связанной с болезнью интенсивной боли, и применение набора, содержащего маситиниб или его фармацевтически приемлемую соль и гемцитаниб, для лечения рака поджелудочной железы |
| CA2886979A CA2886979C (en) | 2012-10-04 | 2013-10-04 | Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors |
| EP13773731.8A EP2903616B8 (en) | 2012-10-04 | 2013-10-04 | Use of masitinib in combination with gemcitabine for treating a subgroup of patients suffering from pancreatic cancer |
| NZ706420A NZ706420A (en) | 2012-10-04 | 2013-10-04 | Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors |
| DK13773731.8T DK2903616T3 (da) | 2012-10-04 | 2013-10-04 | Anvendelse af masitinib i kombination med gemcitabin til behandling af en undergruppe af patienter, der lider af pankreascancer |
| SG11201502626PA SG11201502626PA (en) | 2012-10-04 | 2013-10-04 | Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors |
| CN201380063241.4A CN104968347A (zh) | 2012-10-04 | 2013-10-04 | 马赛替尼用于治疗使用预测因素鉴别的患者亚群的癌症的用途 |
| BR112015007144A BR112015007144A2 (pt) | 2012-10-04 | 2013-10-04 | uso de masitinib para o tratamento de câncer em subpopulações de paciente identificadas usando fatores prognosticadores |
| KR1020157011764A KR102149483B1 (ko) | 2012-10-04 | 2013-10-04 | 예측변수 인자들을 이용하여 동정된 환자 부분 모집단에서 암 치료를 위한 마시티닙의 용도 |
| TW103134650A TW201514311A (zh) | 2013-10-04 | 2014-10-03 | 用於判定胰臟癌預後之方法 |
| EP14780847.1A EP3052103A1 (en) | 2013-10-04 | 2014-10-03 | Method for determining the prognosis of pancreatic cancer |
| US15/027,121 US20160244845A1 (en) | 2013-10-04 | 2014-10-03 | Method for determining the prognosis of pancreatic cancer |
| PCT/EP2014/071251 WO2015049377A1 (en) | 2013-10-04 | 2014-10-03 | Method for determining the prognosis of pancreatic cancer |
| IL238107A IL238107B (en) | 2012-10-04 | 2015-04-01 | Compositions comprising masitinib for use in treatment of cancer in patient subpopulations identified using predictor factors |
| ZA2015/03054A ZA201503054B (en) | 2012-10-04 | 2015-04-08 | Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP12306214.3 | 2012-10-04 | ||
| EP12306214 | 2012-10-04 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014053650A1 true WO2014053650A1 (en) | 2014-04-10 |
Family
ID=47073382
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/070741 Ceased WO2014053650A1 (en) | 2012-10-04 | 2013-10-04 | Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors |
Country Status (20)
| Country | Link |
|---|---|
| US (1) | US10238649B2 (https=) |
| EP (1) | EP2903616B8 (https=) |
| JP (1) | JP6234466B2 (https=) |
| KR (1) | KR102149483B1 (https=) |
| CN (1) | CN104968347A (https=) |
| AR (1) | AR092899A1 (https=) |
| AU (1) | AU2013326463B2 (https=) |
| BR (1) | BR112015007144A2 (https=) |
| CA (1) | CA2886979C (https=) |
| DK (1) | DK2903616T3 (https=) |
| EA (1) | EA037368B1 (https=) |
| ES (1) | ES2656640T3 (https=) |
| IL (1) | IL238107B (https=) |
| MX (1) | MX369999B (https=) |
| NZ (1) | NZ706420A (https=) |
| SG (1) | SG11201502626PA (https=) |
| SI (1) | SI2903616T1 (https=) |
| TW (1) | TWI609686B (https=) |
| WO (1) | WO2014053650A1 (https=) |
| ZA (1) | ZA201503054B (https=) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015049377A1 (en) * | 2013-10-04 | 2015-04-09 | Ab Science | Method for determining the prognosis of pancreatic cancer |
| WO2016062270A1 (zh) * | 2014-10-24 | 2016-04-28 | 朗齐生物医学股份有限公司 | 呼吸系统疾病用药用于制备抗癌医药组合物的用途 |
| JP2017519727A (ja) * | 2014-05-08 | 2017-07-20 | オンコエシックス ゲーエムベーハー | チエノトリアゾロジアゼピン化合物を用いる三種陰性乳癌の治療方法 |
| WO2017173696A1 (zh) * | 2016-04-07 | 2017-10-12 | 北京京蒙高科干细胞技术有限公司 | 脐血nk细胞的体外扩增方法及其试剂盒与应用 |
| US10322192B2 (en) | 2016-03-02 | 2019-06-18 | Eisai R&D Management Co., Ltd. | Eribulin-based antibody-drug conjugates and methods of use |
| WO2020115108A1 (en) * | 2018-12-06 | 2020-06-11 | Sørlandet Sykehus Hf | Egfr inhibitors and their use in the treatment of neuroathic pain |
| WO2020115261A1 (en) * | 2018-12-07 | 2020-06-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating melanoma |
| US10722527B2 (en) | 2015-04-10 | 2020-07-28 | Capsugel Belgium Nv | Abiraterone acetate lipid formulations |
| US11040027B2 (en) | 2017-01-17 | 2021-06-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SG11201808106YA (en) * | 2016-03-25 | 2018-10-30 | Ab Science | Use of masitinib for treatment of an amyotrophic lateral sclerosis patient subpopulation |
| BR112019015974A2 (pt) * | 2017-02-01 | 2020-03-31 | Beyondspring Pharmaceuticals, Inc. | Método para reduzir neutropenia |
| IL276398B2 (en) * | 2018-01-31 | 2026-03-01 | Deciphera Pharmaceuticals Llc | Combination therapy for mastocytosis |
| US20210398672A1 (en) * | 2018-10-29 | 2021-12-23 | Northwestern University | Big Data-Driven Personalized Management of Chronic Pain |
| WO2020185812A1 (en) | 2019-03-11 | 2020-09-17 | Teva Pharmaceuticals International Gmbh | Solid state forms of ripretinib |
| EP4013412B1 (en) | 2019-08-12 | 2026-01-28 | Deciphera Pharmaceuticals, LLC | Ripretinib for treating gastrointestinal stromal tumors |
| EP4084779B1 (en) | 2019-12-30 | 2024-10-09 | Deciphera Pharmaceuticals, LLC | Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluorophenyl)-3-phenylurea |
| CN111759857A (zh) * | 2020-06-30 | 2020-10-13 | 宁波市微循环与莨菪类药研究所 | Gabrd甲基化靶点在制备抗海洛因复吸药物中的应用 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004014903A1 (en) | 2002-08-02 | 2004-02-19 | Ab Science | 2-(3-aminoaryl)amino-4-aryl-thiazoles and their use as c-kit inhibitors |
| WO2007015935A2 (en) * | 2005-07-29 | 2007-02-08 | Bayer Healthcare Llc | Diagnostic methods for the prediction of therapeutic success, recurrence free and overall survival in cancer therapy |
| WO2008098949A2 (en) | 2007-02-13 | 2008-08-21 | Ab Science | Process for the synthesis of 2-aminothiazole compounds as kinase inhibitors |
| WO2011092338A1 (en) * | 2010-02-01 | 2011-08-04 | Ab Science | Combined treatment of pancreatic cancer with gemcitabine and masitinib |
| WO2012170640A1 (en) * | 2011-06-07 | 2012-12-13 | The Trustees Of Columbia University In The City Of New York | Methods and compositions for trail-drug combination therapy |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8450302B2 (en) * | 2002-08-02 | 2013-05-28 | Ab Science | 2-(3-aminoaryl) amino-4-aryl-thiazoles and their use as c-kit inhibitors |
| US20100143935A1 (en) * | 2006-12-01 | 2010-06-10 | Apocell, Inc. | c-KIT Phosphorylation in Cancer |
| ES2606505T3 (es) | 2007-01-12 | 2017-03-24 | Ab Science | Tratamiento de combinación de cánceres sólidos con antimetabolitos e inhibidores de tirosina quinasa |
| US20120264639A1 (en) | 2009-11-04 | 2012-10-18 | Jen Jen Yeh | Methods and compositions for predicting survival in subjects with cancer |
-
2013
- 2013-10-04 US US14/433,198 patent/US10238649B2/en active Active
- 2013-10-04 SI SI201330891T patent/SI2903616T1/en unknown
- 2013-10-04 CN CN201380063241.4A patent/CN104968347A/zh active Pending
- 2013-10-04 EP EP13773731.8A patent/EP2903616B8/en active Active
- 2013-10-04 CA CA2886979A patent/CA2886979C/en active Active
- 2013-10-04 MX MX2015004264A patent/MX369999B/es active IP Right Grant
- 2013-10-04 DK DK13773731.8T patent/DK2903616T3/da active
- 2013-10-04 AR ARP130103596A patent/AR092899A1/es unknown
- 2013-10-04 KR KR1020157011764A patent/KR102149483B1/ko active Active
- 2013-10-04 JP JP2015535036A patent/JP6234466B2/ja active Active
- 2013-10-04 SG SG11201502626PA patent/SG11201502626PA/en unknown
- 2013-10-04 AU AU2013326463A patent/AU2013326463B2/en not_active Ceased
- 2013-10-04 WO PCT/EP2013/070741 patent/WO2014053650A1/en not_active Ceased
- 2013-10-04 NZ NZ706420A patent/NZ706420A/en not_active IP Right Cessation
- 2013-10-04 EA EA201500373A patent/EA037368B1/ru unknown
- 2013-10-04 BR BR112015007144A patent/BR112015007144A2/pt not_active Application Discontinuation
- 2013-10-04 TW TW102136110A patent/TWI609686B/zh not_active IP Right Cessation
- 2013-10-04 ES ES13773731.8T patent/ES2656640T3/es active Active
-
2015
- 2015-04-01 IL IL238107A patent/IL238107B/en active IP Right Grant
- 2015-04-08 ZA ZA2015/03054A patent/ZA201503054B/en unknown
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004014903A1 (en) | 2002-08-02 | 2004-02-19 | Ab Science | 2-(3-aminoaryl)amino-4-aryl-thiazoles and their use as c-kit inhibitors |
| EP1525200B1 (en) | 2002-08-02 | 2007-10-10 | AB Science | 2-(3-aminoaryl)amino-4-aryl-thiazoles and their use as c-kit inhibitors |
| US7423055B2 (en) | 2002-08-02 | 2008-09-09 | Ab Science | 2-(3-Aminoaryl)amino-4-aryl-thiazoles for the treatment of diseases |
| WO2007015935A2 (en) * | 2005-07-29 | 2007-02-08 | Bayer Healthcare Llc | Diagnostic methods for the prediction of therapeutic success, recurrence free and overall survival in cancer therapy |
| WO2008098949A2 (en) | 2007-02-13 | 2008-08-21 | Ab Science | Process for the synthesis of 2-aminothiazole compounds as kinase inhibitors |
| WO2011092338A1 (en) * | 2010-02-01 | 2011-08-04 | Ab Science | Combined treatment of pancreatic cancer with gemcitabine and masitinib |
| WO2012170640A1 (en) * | 2011-06-07 | 2012-12-13 | The Trustees Of Columbia University In The City Of New York | Methods and compositions for trail-drug combination therapy |
Non-Patent Citations (33)
| Title |
|---|
| AARONSON, NK ET AL., J NATL CANCER INST, vol. 85, no. 5, 1993, pages 365 - 76 |
| ACTUALITE PHARMACEUTIQUES N°302, October 1992 (1992-10-01), pages 38 - 39,41-43 |
| ALMHOLT K ET AL., RECENT RESULTS CANCER RES, vol. 162, 2003, pages 31 - 42 |
| BUSINESS WIRE: "AB Science reports phase 3 study results of masitinib in combination with Gemzar® for treatment of pancreatic cancer.", 30 October 2012 (2012-10-30), XP002718427, Retrieved from the Internet <URL:http://www.businesswire.com/news/home/20121030006279/en/AB-Science-reports-phase-3-study-results#.Us5dA1O198E> [retrieved on 20140108] * |
| CHANG DZ ET AL., CLIN CANCER RES, vol. 17, 2011, pages 7015 - 7023 |
| CONROY T ET AL., N ENGL J MED., vol. 364, no. 19, 12 May 2011 (2011-05-12), pages 1817 - 25 |
| DAVIS ET AL., NAT BIOTECHNOL, vol. 29, no. 11, 2011, pages 1046 - 51 |
| DUBREUIL ET AL., PLOS ONE, vol. 4, no. 9, 2009, pages E7258 |
| GALINSKY DS ET AL., CRIT REV ONCOL HEMATOL, vol. 68, 2008, pages 115 - 30 |
| GANG ZHOU ET AL: "Detection and Clinical Significance of CD44v6 and Integrin-Î1 in Pancreatic Cancer Patients using a Triplex Real-Time RT-PCR Assay", APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY ; PART A: ENZYME ENGINEERING AND BIOTECHNOLOGY, HUMANA PRESS INC, NEW YORK, vol. 167, no. 8, 14 June 2012 (2012-06-14), pages 2257 - 2268, XP035098339, ISSN: 1559-0291, DOI: 10.1007/S12010-012-9752-2 * |
| GILFILLAN ET AL., IMMUNOLOGICAL REVIEWS, vol. 228, 2009, pages 149 - 169 |
| GILFILLAN ET AL., NAT REV IMMUNOL, vol. 6, 2006, pages 218 - 230 |
| GOOCH JL ET AL., CANCER RES, vol. 15, 1998, pages 4199 - 205 |
| GRIMBALDESTON MA ET AL., BR J DERMATOL, vol. 150, 2004, pages 895 - 903 |
| GRIMBALDESTON MA ET AL., J INVEST DERMATOL, vol. 115, 2000, pages 317 - 20 |
| HAMEED M ET AL., CANCERS, vol. 3, 2011, pages 43 - 60 |
| HERMINE O ET AL., PLOS ONE, vol. 3, 2008, pages E2266 |
| HERMINE O ET AL., PLOS ONE., vol. 3, 2008, pages E2266 |
| HUMBERT M ET AL., PLOS ONE, vol. 5, no. 3, 2010, pages E9430 |
| HUMBERT MARTINE ET AL: "Masitinib combined with standard gemcitabine chemotherapy: in vitro and in vivo studies in human pancreatic tumour cell lines and ectopic mouse model", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, US, vol. 5, no. 3, 1 January 2010 (2010-01-01), pages e9430 - 1, XP009146696, ISSN: 1932-6203, DOI: 10.1371/JOURNAL.PONE.0009430 * |
| JENSEN, MP ET AL., J PAIN, vol. 4, no. 1, 2003, pages 2E21 |
| JENSEN, MP ET AL.: "Current and Emerging Issues in Cancer Pain: Research and Practice", 1993, NY: RAVEN PRESS, pages: 193 - 218 |
| LIVAK KJ; SCHMITTGEN TD, METHODS, vol. 25, no. 4, December 2001 (2001-12-01), pages 402 - 8 |
| MARINEO G., J PANCREAS, vol. 4, no. 1, 2003, pages 1 - 10 |
| MITRY E ET AL., CANCER CHEMOTHERAPY AND PHARMACOLOGY, vol. 66, 2010, pages 395 |
| MOORE MJ ET AL., J CLIN ONCOL., vol. 25, no. 15, 20 May 2007 (2007-05-20), pages 1960 - 6 |
| PIQUEMAL D ET AL., GENOMICS, vol. 80, no. 3, September 2002 (2002-09-01), pages 361 - 71 |
| RIBATTI D ET AL., INT REV CELL MOL BIOL, vol. 275, 2009, pages 89 - 131 |
| SAMOSZUK M ET AL., BMC CANCER, vol. 21, 2005, pages 121 |
| SCHMIDT BL ET AL., MOL INTERV., vol. 10, no. 3, June 2010 (2010-06-01), pages 164 - 78 |
| THAMM DH ET AL., THE VETERINARY JOURNAL, 2011 |
| THEOHARIDES TC ET AL., TRENDS IMMUNOL, vol. 25, 2004, pages 235 - 41 |
| ZAZA C ET AL., J PAIN SYMPTOM MANAGE, vol. 24, 2002, pages 526 - 542 |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015049377A1 (en) * | 2013-10-04 | 2015-04-09 | Ab Science | Method for determining the prognosis of pancreatic cancer |
| JP2017519727A (ja) * | 2014-05-08 | 2017-07-20 | オンコエシックス ゲーエムベーハー | チエノトリアゾロジアゼピン化合物を用いる三種陰性乳癌の治療方法 |
| WO2016062270A1 (zh) * | 2014-10-24 | 2016-04-28 | 朗齐生物医学股份有限公司 | 呼吸系统疾病用药用于制备抗癌医药组合物的用途 |
| US10722527B2 (en) | 2015-04-10 | 2020-07-28 | Capsugel Belgium Nv | Abiraterone acetate lipid formulations |
| US10322192B2 (en) | 2016-03-02 | 2019-06-18 | Eisai R&D Management Co., Ltd. | Eribulin-based antibody-drug conjugates and methods of use |
| US10548986B2 (en) | 2016-03-02 | 2020-02-04 | Eisai R&D Management Co., Ltd. | Eribulin-based antibody-drug conjugates and methods of use |
| WO2017173696A1 (zh) * | 2016-04-07 | 2017-10-12 | 北京京蒙高科干细胞技术有限公司 | 脐血nk细胞的体外扩增方法及其试剂盒与应用 |
| US11040027B2 (en) | 2017-01-17 | 2021-06-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
| WO2020115108A1 (en) * | 2018-12-06 | 2020-06-11 | Sørlandet Sykehus Hf | Egfr inhibitors and their use in the treatment of neuroathic pain |
| WO2020115261A1 (en) * | 2018-12-07 | 2020-06-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treating melanoma |
Also Published As
| Publication number | Publication date |
|---|---|
| EA037368B1 (ru) | 2021-03-19 |
| TWI609686B (zh) | 2018-01-01 |
| JP6234466B2 (ja) | 2017-11-22 |
| KR20150092739A (ko) | 2015-08-13 |
| NZ706420A (en) | 2018-08-31 |
| CN104968347A (zh) | 2015-10-07 |
| MX2015004264A (es) | 2015-10-12 |
| KR102149483B1 (ko) | 2020-08-28 |
| EP2903616A1 (en) | 2015-08-12 |
| SG11201502626PA (en) | 2015-05-28 |
| BR112015007144A2 (pt) | 2017-12-12 |
| MX369999B (es) | 2019-11-28 |
| ES2656640T3 (es) | 2018-02-27 |
| AU2013326463A1 (en) | 2015-04-16 |
| DK2903616T3 (da) | 2018-01-29 |
| EP2903616B1 (en) | 2017-12-13 |
| AR092899A1 (es) | 2015-05-06 |
| CA2886979C (en) | 2021-01-05 |
| JP2015532296A (ja) | 2015-11-09 |
| CA2886979A1 (en) | 2014-04-10 |
| US10238649B2 (en) | 2019-03-26 |
| IL238107B (en) | 2018-03-29 |
| AU2013326463B2 (en) | 2018-01-18 |
| ZA201503054B (en) | 2016-11-30 |
| TW201414475A (zh) | 2014-04-16 |
| US20150272945A1 (en) | 2015-10-01 |
| EA201500373A1 (ru) | 2016-02-29 |
| SI2903616T1 (en) | 2018-02-28 |
| EP2903616B8 (en) | 2018-02-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2903616B1 (en) | Use of masitinib for treatment of cancer in patient subpopulations identified using predictor factors | |
| Schuler et al. | Afatinib beyond progression in patients with non-small-cell lung cancer following chemotherapy, erlotinib/gefitinib and afatinib: phase III randomized LUX-Lung 5 trial | |
| Hata et al. | Erlotinib after gefitinib failure in relapsed non-small cell lung cancer: clinical benefit with optimal patient selection | |
| WO2020037203A2 (en) | Diagnostic and therapeutic methods for the treatment of breast cancer | |
| IL273071B1 (en) | Cancer treatment and diagnosis methods | |
| US20160199399A1 (en) | Methods for predicting drug responsiveness in cancer patients | |
| KR20150131312A (ko) | 마이크로rna 및 egfr-tki 억제제를 이용한 조합 암 치료 | |
| AU2021249111A1 (en) | Methods and compositions for treating cancer | |
| US20210047695A1 (en) | Cancer treatments and methods of selecting same | |
| US9334500B2 (en) | Methods and pharmaceutical compositions for treating cancer | |
| EP3039424A1 (en) | Gene expression signatures predictive of subject response to a multi-kinase inhibitor and methods of using the same | |
| WO2021099558A1 (en) | Combination therapies | |
| JP2017511341A (ja) | Nras変異癌の処置における使用のためのegfr阻害剤とmek阻害剤の組合せ | |
| WO2021013794A1 (en) | Transcriptomics for selecting druggable targets for combination therapy in cancer | |
| Nazarov et al. | Effects of n-Myc and c-Myc on the expression of p53 family members and their transcriptional targets in human neuroblastoma cells | |
| US20250179584A1 (en) | Precision therapy for the treatment of cancer | |
| US20260115209A1 (en) | Combination therapy including cox-2 inhibitor for the treatment of cancer | |
| US20190117652A1 (en) | Combination of raf inhibitors and taxanes | |
| Zhang et al. | Analysis of an unselected patient cohort with advanced colorectal carcinoma from a maximum care center | |
| Haegebarth et al. | Synergistic Activity of IDH1 Inhibitor BAY1436032 with Azacitidine in |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13773731 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2015535036 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 238107 Country of ref document: IL Ref document number: MX/A/2015/004264 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2886979 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14433198 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015007144 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2013326463 Country of ref document: AU Date of ref document: 20131004 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201500373 Country of ref document: EA |
|
| ENP | Entry into the national phase |
Ref document number: 20157011764 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013773731 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112015007144 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112015007144 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150330 |