WO2014037800A2 - Compositions and methods for increasing the expression and signalling of proteins on cell surfaces - Google Patents

Compositions and methods for increasing the expression and signalling of proteins on cell surfaces Download PDF

Info

Publication number
WO2014037800A2
WO2014037800A2 PCT/IB2013/002242 IB2013002242W WO2014037800A2 WO 2014037800 A2 WO2014037800 A2 WO 2014037800A2 IB 2013002242 W IB2013002242 W IB 2013002242W WO 2014037800 A2 WO2014037800 A2 WO 2014037800A2
Authority
WO
WIPO (PCT)
Prior art keywords
tag
protein
rho
ors
lucy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2013/002242
Other languages
English (en)
French (fr)
Other versions
WO2014037800A3 (en
Inventor
Jennifer PLUZNICK
Niranjana NATARAJAN
Blythe SHEPARD
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Priority to CA2884462A priority Critical patent/CA2884462A1/en
Priority to US14/427,090 priority patent/US9783585B2/en
Priority to EP13836094.6A priority patent/EP2893020B1/en
Priority to AU2013311316A priority patent/AU2013311316A1/en
Priority to JP2015530507A priority patent/JP2015527074A/ja
Publication of WO2014037800A2 publication Critical patent/WO2014037800A2/en
Publication of WO2014037800A3 publication Critical patent/WO2014037800A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4722G-proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/35Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag

Definitions

  • the present invention relates to the field of protein expression. More specifically, the present invention provides compositions and methods for increasing the expression and signaling of proteins on cell surfaces.
  • Olfactory receptors are seven transmembrane domain G protein-coupled receptors (GPCRs) that govern the sense of smell in the olfactory epithelium, and comprise the largest gene family in the genome ( ⁇ 1000 OR genes in mice [1] and -300 [2] in humans). Although this family was first identified over 20 years ago [3], the majority of ORs remain orphan receptors, with no known ligand. This is due, in large part, to the fact that OR deorphanization is typically attempted using in vitro ligand screening assays in heterologous cell systems which require surface expression of the OR as a prerequisite for the assay (i.e., HEK293T cells or Xenopus oocytes) [4-7].
  • GPCRs G protein-coupled receptors
  • ORs do not traffic to the cell surface in heterologous cell systems; rather, they are retained in the ER and degraded [8-10], making ligand assignment impossible.
  • studies have utilized the co-expression of various accessory proteins and/or the addition of N- terminal tags [11-14].
  • the addition of the first 20 amino acids of rhodopsin onto the N-terminus of ORs (Rho tag) enhances OR surface expression for a number of ORs [15].
  • receptor transporting protein originally identified as a potential chaperone for ORs [16,17] also enhances expression of multiple ORs.
  • RTP RTP
  • Ric8b a putative GEF
  • Gaolf the G protein that couples to ORs in the olfactory epithelium
  • ORs enter the biosynthetic pathway upon translocation into the endoplasmic reticulum (ER). Typically, this is accomplished co-translationally where a signal peptide serves to mediate ER translocation through the heterotrimeric Sec61 complex that forms a channel in the ER membrane [25]. While most GPCRs use one of their transmembrane domains (TMD) as a signal anchor sequence, a small subset of GPCRs and other TMD proteins (and all secretory proteins) have cleavable signal peptides which are found at the extreme N-terminus of the immature protein [26,27].
  • TMD transmembrane domains
  • cleavable signal peptides are not incorporated into the mature protein; rather they are cleaved off in the ER membrane upon translocation. While cleavable signal peptides do not have a conserved sequence, they do share characteristic features including a hydrophobic region flanked by polar amino acids [25,26].
  • LRRC32 Leucine Rich Repeat Containing 32
  • MRPQILLLLALLTLGLA leucine-rich 17-amino acid cleavable signal peptide
  • the present invention is based, at least in part, on the discovery of an N-terminal tag sequence which aids in olfactory receptor trafficking.
  • ORs olfactory receptors
  • this novel tag allows all ORs assayed thus far to reach the cell surface.
  • the present invention provides nucleic acid
  • sequences are operably linked to the N-terminal end of the protein of interest.
  • the nucleic acid sequence encoding the sequence tag and the protein comprise part of an expression vector.
  • the protein is expressed with the N-terminal sequence tag.
  • the sequences of the present invention can be used in conjunction with one or more chaperone or accessory proteins.
  • the one or more chaperone/accessory proteins are encoded by the same vector or separate vectors.
  • the one or more chaperone/accessory proteins are encoded by the same vector or separate vectors.
  • chaperone/accessory proteins are encoded the same vector that encodes the protein of interest.
  • Olfactory receptors can include, but are not limited to, Olfr78, Olfr51E2, mOREG (Olfr73), Olfl45, Olfr691, Olfr52B2, Olfr99, Olfr693, Olfr805, Olfrl392, Olfrl393, Olfr90, Olfr545, Olfr985, and Olfr894.
  • the present invention provides composition encoding a cleavable signal peptide linked to the N-terminus of a protein of interest, i.e., a cell surface- expressed protein.
  • the cleavable signal peptide comprises the Lucy tag described herein.
  • the Lucy tag comprises SEQ ID NO:3.
  • the Lucy tag can further comprise a Rho tag.
  • the Lucy tag can further comprise a Flag tag.
  • the Lucy tag further comprises a Rho tag and a Flag tag.
  • the tags (Lucy, Rho, Flag, and/or the like) can be linked (or not) with a linker.
  • composition that is linked to the N-terminus of a protein of interest may comprise SEQ ID NO:l, SEQ ID NO:2 or SEQ ID NO:3.
  • the protein of interest can be any surface expressed protein.
  • the protein of interest is an olfactory receptor.
  • Such a protein can include, but is not limited to, 01fr78, 01fr51E2, mOREG (01fr73), 01fl45, 01fr691, 01fr52B2, 01fr99, 01fr693, Olfr805, 01frl392, 01frl393, Olfr90, 01fr545, 01fr985, and 01fr894.
  • the present invention can be used to increase expression, trafficking, and/or signaling of the protein of interest to the cell surface.
  • the present invention can be utilized with olfactory receptor proteins and used in assays by perfume, fragrance, flavor or food companies.
  • the system or assay can further utilize one or more
  • chaperone/accessory proteins to assist in the expression, trafficking, and/or signaling of the protein of interest to the cell surface.
  • proteins include, but are not limited to, RTPL1, RTPIS, RTP2, REEP, ⁇ -adrenergic receptor, heat shock protein 70, Ric8b, and Gaolf.
  • FIG. 1 The Lucy tag aids in surface expression of some ORs in the absence of accessory proteins or the Rho tag.
  • ORs were cloned and expressed in HEK293T cells without Rho or Lucy tags (OR), with a Rho tag (Rho-OR), with the Lucy tag (Lucy-OR) or with both the Lucy and Rho tags (Lucy-Rho-OR).
  • the cells were then surface labeled with a Flag antibody to detect membrane- associated OR. Images were taken for each OR at equal exposure for all conditions. To assess OR surface expression, the entirety of each coverslip was systematically scanned and scored based on detectable surface immunofluorescence.
  • FIG. 2. The Lucy tag works synergistically with accessory proteins and tags to promote surface expression of ORs.
  • FIG. 3 The Lucy tag is a cleavable signal peptide.
  • HA-Flag-Rho-01fr691 A and B
  • HA-Lucy-Flag-Rho-01fr691 C and D constructs were expressed in HEK293T cells along with RTPIS. Cells were fixed and stained with both an HA and Flag antibody (A and C) to detect total tagged OR or surface labeled with the HA and Flag antibodies (B and D) to detect surface-associated OR. HA surface stain is observed only in the absence of the Lucy tag, indicating a functional Lucy cleavage site.
  • FIG. 4 The Lucy tag increases OR protein levels.
  • Rho-tagged and Lucy-Rho- tagged ORs were immunoprecipitated from HEK293T cells using monoclonal M2 Flag beads.
  • Bound (B) lysates were immunoblotted with the Flag antibody to detect total OR levels. The arrow indicates the mature OR product at 39 kb. The input was also
  • FIG. 5 The Lucy tag does not alter OR signaling.
  • R-691 + RTP1S, L-691, and L-691 + RTP1S P ⁇ 0.05 for 0 mM vs. all doses of isovaleric acid (marked by an *).
  • P ⁇ 0.05 for 5 vs. 0.1, 0.25 and 0.5 for L-691 + RTP1S, P ⁇ 0.05 for 5 vs. 0.5, 0.25 and 0.1, 1 vs. 0.5, 0.25 and 0.1, 0.5 vs. 0.1.
  • HEK293T cells were transfected for 24 h with Rho-tagged or Lucy-Rho-tagged 01fr691 (A) or its human homologue, hOR52B2 (B).
  • Cells were surface labeled with a polyclonal Flag antibody to detect surface-associated OR (a and b) and then fixed, permeabilized and stained with a monoclonal Flag antibody to detect the internal OR population (c and d). Both 01fr691 and hOR52B2 traffic to the surface with but not without the Lucy tag.
  • FIG. 7 The Lucy tag and accessory proteins increase the amount of 01fr691 detected on the cell surface.
  • Surface- labeled 01fr691 was quantitated by measuring the mean fluorescence intensity for each image.
  • This graph represents the mean fluorescence intensity normalized to the corresponding binary nuclear image for the same field of view (surface/nuclear). Error bars represent the SEM, and '+ chaperones' indicates the presence of RTP1S, Ric8b and Gaol Representative images corresponding to each condition are pictured below the graph showing the increased surface expression.
  • FIG. 8 HEK293T cells do not natively express RTP.
  • HEK293T and whole kidney RNA was reverse transcribed with (+) or without (-) reverse transcriptase and PCR was performed using primers for both the long and short form of RTP.
  • Amplified RTP had an expected size of 548 bp.
  • RTP was amplified from kidney cDNA but not from HEK293T cDNA.
  • FIG. 9 shows the nucleotide (SEQ ID NO:l) and amino acid (SEQ ID NO:2) sequence of Lucy tag+Flag tag+Rho tag.
  • nucleic acid or “polynucleotide” refers to a polymeric form of nucleotides of any length, either ribonucleotides and/or deoxyribonucleotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically,
  • the backbone of the nucleic acid can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
  • the backbone of the nucleic acid can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P-NH 2 ) or a mixed phosphoramidate- phosphodiester oligomer.
  • a double-stranded nucleic acid can be obtained from the single stranded nucleic acid product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
  • nucleic acids a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • a nucleic acid may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a nucleic acid may be further modified after polymerization, such as by conjugation with a labeling component.
  • modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the nucleic acid to proteins, metal ions, labeling components, other nucleic acids, or a solid support.
  • isolated refers to material that is free to varying degrees from components which normally accompany it as found in its native state.
  • levels of purity may be applied as needed according to this invention in the different methodologies set forth herein; the customary purity standards known in the art may be used if no standard is otherwise specified.
  • isolated nucleic acid (or polynucleotide) molecule is meant a nucleic acid (e.g., a DNA, R A, or analog thereof) that is free of the genes which, in the naturally occurring genome of the organism from which the nucleic acid molecule of the present invention is derived, flank the gene.
  • the term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences.
  • the term includes an RNA molecule which is transcribed from a DNA molecule, as well as a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
  • operably linked means that nucleic acid sequences or proteins are operably linked when placed into a functional relationship with another nucleic acid sequence or protein.
  • a promoter sequence is operably linked to a coding sequence if the promoter promotes transcription of the coding sequence.
  • a repressor protein and a nucleic acid sequence are operably linked if the repressor protein binds to the nucleic acid sequence.
  • a protein may be operably linked to a first and a second nucleic acid sequence if the protein binds to the first nucleic acid sequence and so influences transcription of the second, separate nucleic acid sequence.
  • operably linked means that the DNA sequences being linked are contiguous, although they need not be, and that a gene and a regulatory sequence or sequences (e.g., a promoter) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins—transcription factors—or proteins which include transcriptional activator domains) are bound to the regulatory sequence or sequences.
  • a gene and a regulatory sequence or sequences e.g., a promoter
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, for example,
  • amino acid analog refers to a compound that has the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group (e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium), but that contains some alteration not found in a naturally occurring amino acid (e.g., a modified side chain).
  • amino acid mimetic refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that function in a manner similar to a naturally occurring amino acid.
  • Amino acid analogs may have modified R groups (for example, norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • an amino acid analog is a D-amino acid, a beta- amino acid, or an N-methyl amino acid.
  • Amino acids and analogs are well known in the art. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one- letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single- letter codes.
  • polypeptide polypeptide
  • protein protein
  • peptide polypeptide
  • peptide polypeptide
  • protein protein
  • peptide polypeptide
  • modified forms may be naturally occurring modified forms or chemically modified forms. Examples of modified forms include, but are not limited to, glycosylated forms, phosphorylated forms, myristoylated forms, palmitoylated forms, ribosylated forms, acetylated forms, etc. Modifications also include intra-molecular crosslinking and covalent attachment to various moieties such as lipids, flavin, biotin, polyethylene glycol or derivatives thereof, etc.
  • moieties such as lipids, flavin, biotin, polyethylene glycol or derivatives thereof, etc.
  • modifications may also include cyclization, branching and cross-linking.
  • amino acids other than the conventional twenty amino acids encoded by genes may also be included in a polypeptide.
  • An "expression vector” or “vector” is a nucleic acid construct, generated
  • a vector is typically designed for
  • transduction/transfection of one or more cell types Typically, gene expression is placed under the control of certain regulatory elements, including constitutive or inducible promoters, tissue-preferred regulatory elements, and enhancers.
  • a “host cell” is any prokaryotic or eukaryotic cell that contains either a cloning vector or an expression vector. This term also includes those prokaryotic or eukaryotic cells that have been genetically engineered to contain the cloned gene(s) in the chromosome or genome of the host cell.
  • a "host cell” or “transformed cell” refers to a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a polynucleotide molecule encoding (as used herein) a protein of the present invention.
  • f agment is meant a portion (e.g., at least about 5, 10, 25, 50, 100, 125, 150, 200, 250, 300, 350, 400, or 500 amino acids or nucleic acids) of a protein or nucleic acid molecule that is substantially identical to a reference protein or nucleic acid and retains at least one biological activity of the reference. In some embodiments the portion retains at least 50%, 75%, or 80%, or more preferably 90%, 95%, or even 99% of the biological activity of the reference protein or nucleic acid described herein.
  • substantially identical is meant a protein or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein).
  • a reference amino acid sequence for example, any one of the amino acid sequences described herein
  • nucleic acid sequence for example, any one of the nucleic acid sequences described herein.
  • such a sequence is at least 60%, more preferably 80% or 85%, and most preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
  • Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine;
  • a BLAST program may be used, with a probability score between e "3 and e "100 indicating a closely related sequence.
  • the present invention is based, at least in part, on the discovery of an N-terminal tag sequence which aids in olfactory receptor trafficking.
  • ORs olfactory receptors
  • this tag has never before been used on an OR or any other exogenously expressed receptor construct.
  • This tag either alone (for some ORs) or in combination with previously identified chaperones (for other ORs) is able to successfully traffic all ORs assayed to the cell surface.
  • This tag is cleaved off of the protein during protein processing. Because ORs on the cell surface will then be used to assay function of the OR (to screen for potential ligands), adding an N-terminal tag in many cases is not ideal as it may alter the structure of the protein. However, this tag succeeds in getting the OR out of the endoplasmic reticulum and Golgi, but is cleaved off before the OR reaches the cell surface. This is a unique feature, and this allows scientists to assay a surface-expressed OR that no longer has the tag (and therefore the tag cannot interfere with or modify ligand binding).
  • the present invention greatly speeds the rate at which odorants and ligands are identified. This can help basic science researchers to identify ligands for receptors, and can also help
  • fragrance/flavor companies as they seek to develop new perfumes, etc.
  • the present invention provides nucleic acid
  • sequences are operably linked to the N-terminal end of the protein of interest.
  • the nucleic acid sequence encoding the sequence tag and the protein comprise part of an expression vector.
  • the protein is expressed with the N-terminal sequence tag.
  • the sequences of the present invention can be used in conjunction with one or more chaperone or accessory proteins.
  • the one or more chaperone/accessory proteins are encoded by the same vector or separate vectors.
  • the one or more chaperone/accessory proteins are encoded by the same vector or separate vectors.
  • chaperone/accessory proteins are encoded the same vector that encodes the protein of interest.
  • the receptor proteins are olfactory receptors.
  • Olfactory receptors can include, but are not limited to, 01fr78, 01fr51E2, mOREG (01fr73), 01fl45, 01fr691, 01fr52B2, 01fr99, 01fr693, Olfr805, 01frl392, 01frl393, Olfr90, 01fr545, 01fr985, and 01fr894.
  • the present invention provides the nucleotide sequence set forth in SEQ ID NO: 1.
  • a nucleotide sequence encodes the amino acid sequence of SEQ ID NO:2.
  • the present invention provides an amino acid sequence set forth in SEQ ID NO:2.
  • the present invention also provides an N-terminal amino acid sequence useful in trafficking proteins to the cell surface comprising SEQ ID NO:3.
  • SEQ ID NO:3 can be referred to as the "Lucy tag.”
  • the sequence further comprises a Flag tag.
  • the Flag tag can comprise SEQ ID NO:6.
  • the sequence further comprises a Rho tag.
  • the Rho tag can comprise SEQ ID NO: 10.
  • the sequence further comprises a Flag tag and a Rho tag.
  • the sequence can further comprise a linker between the Flag tag and the Rho tag.
  • the linker can be any linker that allows/promotes/increases surface expression of a protein of interest can include, for example, a 3 amino acid linker.
  • the linker comprises SEQ ID NO:8.
  • the Lucy tag is upstream of the Flag tag, followed by the linker and the Rho tag.
  • the present invention also provides an N-terminal amino acid sequence useful in trafficking proteins to the cell surface comprising an amino acid sequence substantially identical to SEQ ID NO:3.
  • the sequence has at least about 85% identity to SEQ ID NO:3.
  • the sequence has at least about 88%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity to SEQ ID NO:3 (Lucy tag).
  • the present invention contemplates one or more amino acid substitutions to the Lucy tag. Such substitutions can be conservative substitutions.
  • the N-terminal amino acid sequence useful in trafficking proteins to the cell surface further comprises a Flag tag.
  • the sequence further comprises a Rho tag.
  • the sequence further comprises a Flag tag and a Rho tag.
  • the sequence further comprises a linker between the Flag tag and the Rho tag.
  • the present invention provides systems for increasing surface expression of proteins.
  • the system comprises: (a) a vector comprising (i) a nucleotide sequence described herein or (ii) a nucleotide sequence encoding an amino acid sequence described herein; and (b) a vector encoding a chaperone protein that aids in expression, signaling and/or trafficking of the protein to the cell surface.
  • the protein is an olfactory receptor.
  • the system can be used to clone in the sequence encoding a protein of interest into the vector of step (a).
  • the chaperone protein is a receptor trafficking protein.
  • the receptor trafficking protein can be selected from the group consisting of RTPL1, RTP1S, and RTP2.
  • the chaperone protein is Receptor Expressing Enhancing Protein (REEP).
  • the chaperone protein is ⁇ -adrenergic receptor.
  • The can also be heat shock protein 70 homo log.
  • the chaperone protein is Resistance to Inhibitors of Cholinesterase 8 homolog B (Ric8b).
  • the chaperone protein can also be Olfactory G-protein (Gaolf).
  • the system can utilize any combination of the foregoing including, but not limited to, RTP1S, Ric8b and Gaolf.
  • a vector can encode one or more chaperon proteins or multiple vectors can be used.
  • the system further comprises a cell line.
  • the cell line may comprise HEK293T cells.
  • the present invention further provides a system for increasing surface expression of proteins comprising: (a) a vector comprising a nucleotide sequence encoding SEQ ID NO:3; (b) a vector encoding RTP1S; (c) a vector encoding Ric8b; and (d) a vector encoding Gaolf.
  • a vector comprising a nucleotide sequence encoding SEQ ID NO:3; (b) a vector encoding RTP1S; (c) a vector encoding Ric8b; and (d) a vector encoding Gaolf.
  • the nucleotide sequence encoding the protein of interest can be cloned into the vector of step (a).
  • the Lucy tag is operably linked to the N-terminal end of the protein of interest.
  • a vector can encode one or more chaperone/accessory proteins.
  • a single vector can be used to encode SEQ ID NO:3, the protein of interest and one or more chaperone/accessory proteins.
  • the vector of step (a) further comprises a nucleotide sequence encoding a Flag tag.
  • the vector of step (a) further comprises a nucleotide sequence encoding Rho tag.
  • the vector of step (a) further comprises a nucleotide sequence encoding a Flag tag and a Rho tag.
  • the vector of step (a) can comprise a linker between the Flag tag and the Rho tag.
  • the present invention also provides a system for increasing surface expression of proteins comprising: (a) a vector comprising a nucleotide sequence encoding SEQ ID NO:2; (b) a vector encoding RTP1S; (c) a vector encoding Ric8b; and (d) a vector encoding Gaolf.
  • the nucleotide sequence encoding the protein of interest can be cloned into the vector of step (a).
  • a system for increasing surface expression of olfactory receptors comprises: (a) a vector comprising a nucleotide sequence encoding SEQ ID NO:2; (b) a vector encoding RTP1S; (c) a vector encoding Ric8b; and (d) a vector encoding Gaolf.
  • the nucleotide sequence encoding the olfactory receptor can be cloned into the vector of step (a).
  • the Lucy tag is operably linked to the N-terminal end of the protein of interest/olfactory receptor.
  • Olfactory receptors are G protein-coupled receptors that detect odorants in the olfactory epithelium, and comprise the largest gene family in the genome. Identification of OR ligands typically requires OR surface expression in heterologous cells; however, ORs rarely traffic to the cell surface when exogenously expressed. Therefore, most ORs are orphan receptors with no known ligands. To date, studies have utilized non-cleavable rhodopsin (Rho) tags and/or chaperones (i.e., Receptor Transporting Protein, RTP1S, Ric8b and Gaolf) to improve surface expression. However, even with these tools, many ORs still fail to reach the cell surface.
  • Rho non-cleavable rhodopsin
  • Polyclonal (F7425) and M2 monoclonal (F1804) Flag antibodies and M2 Flag beads were purchased from Sigma (St. Louis, MO).
  • the monoclonal HA antibody (3F10) was purchased from Roche (Indianapolis, IN) and the ⁇ -actin antibody was purchased from Abeam (Cambridge, MA).
  • Alexa- conjugated fluorescent secondary antibodies were purchased from Invitrogen (Carlsbad, CA).
  • HRP-conjugated secondary antibodies were purchased from Jackson ImmunoResearch Labs (West Grove, PA).
  • the Dual-Luciferase Reporter Assay kit was purchased from Promega (Madison, WI). The odorants used in this study, isovaleric acid and eugenol, were also purchased from Sigma.
  • ORs The other full-length ORs were amplified using primers which added appropriate restriction sites from either mouse genomic DNA or from kidney RNA after performing RT (01frl45 (MOR161-6, K21), 01fr99 (MOR156-1), 01fr394 (MOR135-8), 01fr545 (MOR42-1, S50), 01fr691 (MOR31-6), 01fr693 (MOR283-8), Olfr805 (MORI 10- 4), and 01fr985 (MORI 71-4)). All constructs used in this study contain a Flag tag for detection purposes but will be referenced based on their other N-terminal tags for simplicity. All constructs were sequenced to confirm identity.
  • the Lucy tag (atgagaccccagatcctgctgctcctggccctgctgaccctaggcctggct) (SEQ ID NO:4) was added to the original (Rho-OR) vector for 01fr691 using overlap-extension PCR [32] to obtain a Lucy-Rho-OR. Subsequently, 01fr691 was excised from the Lucy-Rho vector, and the other ORs were excised from the original parent vector (Rho-OR) using the same restriction sites. The other ORs were then subcloned into the Lucy-Rho vector by ligation.
  • Rho tag was deleted from both the Rho-01fr78 and Lucy-Rho-01fr78 constructs to obtain the OR or Lucy- OR constructs using PCR-mediated deletion [33]. Subsequently, 01fr78 was excised from the vectors, and the other ORs were excised from the original parent vector (Rho-OR) using the same restriction sites and then subcloned into the OR and Lucy- OR vectors by ligation.
  • an HA tag was also added to the extreme N- terminus of the Rho construct for 01fr691, yielding an HA-Flag-Rho-01fr691 construct.
  • HEK293T cells were seeded onto 18-mm coverslips coated with poly-L- lysine and transfected with OR constructs with or without accessory proteins (Lipofectamine 2000, Invitrogen). Flag-tagged OR trafficking was assayed using surface immunocytochemistry, as previously described [5]. Briefly, live, non-permeabilized cells at
  • Fluorescent secondary antibodies reported the localization of the polyclonal and monoclonal Flag-tags.
  • Cells were visualized for epifluorescence using a Zeiss Axiophot microscope (Thornwood, NY). Images were taken with a CoolSnap Digita Camera (Photometries, Tuscon, AZ) and IP Labs software
  • FIG.s 1 and 2 the immunofluorescent images shown in each row (OR, Rho-OR, Lucy- OR and Lucy-Rho- OR with and without accessory proteins) were transfected and processed simultaneously and image exposures remained constant for each OR. Images represent representative fields of view from at least 4 independent experiments.
  • OR surface expression the entirety of each coverslip was systematically scanned and scored based on detectable surface immunofluorescence. A '+' was scored for those ORs whose surface expression was detectable in >90% of all fields of view while ORs received an '*' if surface expression was found in ⁇ 50% of all fields of view. A complete lack of detectable surface expression was scored as a To quantitate cell surface expression using Image J (FIG. 7), the background was subtracted from the surface labeled 01fr691 images and the mean fluorescence intensity was measured. The mean intensity was normalized to the mean intensity of the corresponding binary nuclear image, to control for cell number.
  • ORs were cloned and co-expressed in HEK293T cells without Rho or Lucy tags (OR), with a Rho tag (Rho-OR), with the Lucy tag (Lucy-OR) or with both the Lucy and Rho tags (Lucy-Rho-OR) along with (or without) the chaperone proteins, RTP1S, Ric8b and Gaolf
  • the cells were then surface labeled with a Flag antibody to detect membrane- associated OR. Images were taken for each OR at equal exposure for all conditions. To assess OR surface expression, the entirety of each coverslip was systematically scanned and scored based on detectable surface immunofluorescence.
  • Enzyme-Linked Immunosorbent Assay ELISA. ELISA measurements in HEK 293T cells transfected with various constructs were performed as previously described [5,34]. Wells for ELISA were assayed in quadruplicate. Briefly, transfected cells seeded in a 96 well plate were fixed and permeabilized. OR-expressing cells were probed with the polyclonal Flag antibody and detected with anti-rabbit HRP- conjugated secondary antibody. HRP levels were detected with 1-Step Ultra TMB (3,3',5,5'-tetramethylbenzidine) (Thermo Scientific, Rockville, IL).
  • 1-Step Ultra TMB 3-Step Ultra TMB (3,3',5,5'-tetramethylbenzidine) (Thermo Scientific, Rockville, IL).
  • HEK293T cells in 35-mm dishes were transfected for 24 h with either the Rho- OR or Lucy-Rho- OR constructs and lysed in lysis buffer containing 1% NP-40, 150 niM NaCl, 50 mM Tris and 1 mM EDTA on ice for 30 min.
  • the lysate was cleared by centrifugation at 16,000 x g for 30 min at 4°C and 10% of the lysate was collected in Laemmli sample buffer for later analysis.
  • Flag-tagged ORs were then immunoprecipitated from the remaining lysate using M2 monoclonal Flag beads. Both the immunoprecipitated fraction (B) and unbound fractions (UB) were lysed in
  • Luciferase Assay The luciferase assay was performed as previously described [5].
  • ORs were transfected into HEK293T cells along with constructs encoding for CREB-dependent luciferase (Firefly) and a constitutively expressed luciferase (Renilla).
  • OR activation leads to a rise in cAMP which drives an increase in Firefly luciferase expression.
  • Firefly activity is normalized to the activity of the Renilla luciferase to control for variation in cell number and transfection efficiency.
  • Data were collected using a FLUOstar Omega automated platereader (BMG LabTech, Cary, NC). For some experiments, RTP1S was also transfected.
  • Gaolf accessory factors
  • Rho-tagged ORs were co- expressed with accessory proteins (currently the best practice for achieving OR surface expression [18]), 9 ORs were found on the cell surface (Table 1, column 4). When Lucy-tagged ORs were co-expressed with the accessory proteins, 10 ORs were found on the cell surface (Table 1, column 6). These data confirm that the Rho tag can work synergistically with accessory proteins to promote proper expression [18], and demonstrate that the same is true for the Lucy tag (Table 1). Importantly, when we used Lucy-Rho- tagged ORs together with known chaperones (RTPlS/Ric8b/Gaolf), all 15 ORs were detected on the cell surface (Table 1, Column 8).
  • Rho tag the Lucy tag, and OR chaperones all promote surface expression of some (but not all) ORs tested, they seem to promote expression of different populations of ORs.
  • 01fr99 and hOR52B2 require the Lucy tag for surface expression, but not the combination of accessory proteins or the Rho tag (Table 1).
  • 01frl393, 1392 and 90 are found on the cell surface only when co-expressed with RTP1S, Ric8b and Gaolf and one of the N-terminal tags (Lucy or Rho).
  • other ORs i.e., 01fr691 properly traffic with either the Lucy tag or the accessory proteins (but not the Rho tag alone).
  • the Lucy tag contains a putative cleavage site. As such, it is not present on the mature protein which reaches the plasma membrane (as demonstrated below, FIG. 3).
  • the cleavable Lucy tag in the absence of the 22-amino acid Rho tag
  • we are able to achieve surface expression of 10/15 ORs tested Table 1, Column 6
  • the Lucy tag is cleaved.
  • the Lucy tag is a putative cleavable signal peptide found on the N-terminus of LRRC32, and has been previously shown to be cleaved from the mature LRRC32 protein [28].
  • To determine whether the Lucy tag is also cleaved from the olfactory receptor constructs we added an HA tag to the extreme N-terminus of both Rho-01fr691 (FIG. 3A,B) and Lucy-Rho-01fr691 (FIG. 3C,D). These constructs were then expressed in HEK293T cells along with RTP1S, which allows for Rho-tagged 01fr691 surface expression.
  • the cells were stained in parallel with both an HA and Flag antibody to detect either the total OR population for both tags (FIG. 3A, C), or, on a separate coverslip, the cell surface membrane-associated receptor only for both tags (FIG. 3B, D). If the Lucy tag is cleaved, the HA tag should be removed (along with the Lucy tag) early on in the biosynthetic pathway and should not be detectable at the cell surface. When cells expressing HA-Flag-Rho-691 were stained, both Flag and HA antibodies could detect surface- associated (FIG. 3A) and intracellular receptor (FIG. 3B), indicating that both tags were present on the mature protein.
  • the Lucy tag increases total protein levels of all ORs.
  • Rho-ORs or Lucy-Rho-ORs we noted that there was consistently more surface and intracellular Flag staining with the Lucy tagged constructs (FIG. 6). Since Lucy is an ER signal peptide, it is possible that it stabilizes the protein, and thus, increases expression.
  • Rho- OR or Lucy-Rho- OR constructs we transfected HEK293T cells with either Rho- OR or Lucy-Rho- OR constructs, lysed the cells, and immunoprecipitated the OR using M2 Flag beads. An aliquot of the original lysate (input) and the immunoprecipitated ORs were then immunoblotted with a Flag antibody and a subset of ORs are shown in FIG. 4A.
  • ORs are detected as a complex of high- molecular weight bands, likely due to aggregation, degradation and other modifications [8,16], as seen in the whole cell extract (FIG. 4A input); immunoprecipitation (FIG. 4A IP: Flag) allows for improved resolution.
  • Lucy does not alter OR-ligand specificity. OR surface expression in heterologous cell systems is a prerequisite for further functional studies, including OR deorphanization. Since Lucy is a cleaved signal peptide, it is not incorporated into the mature protein and thus, should not interfere with OR-ligand specificity or downstream signaling. However, some data have suggested that ORs require a "co- receptor" (RTPIS) to signal properly [19].
  • RTPIS co- receptor
  • Rho-01fr691 responds to isovaleric acid [16].
  • Rho-01fr691 and Lucy-Rho-01fr691 were expressed in HEK293T cells with or without RTPIS and exposed to 0.1-5 mM isovaleric acid. By itself, Rho-01fr691 was not significantly activated at any concentration (FIG.
  • Rho-01fr691 was co- expressed with RTPIS, we observed a dose-dependent increase in the Firefly: Renilla ratio (P ⁇ 0.002 for all doses compared to 0 mM), confirming the previous findings (FIG. 5A).
  • Lucy- Rho-01fr691 also responded to isovaleric acid in a dose-dependent manner with and without the addition of RTPIS (P ⁇ 0.007 for all doses compared to 0 mM) confirming that the surface expression observed in FIG.s 1 and 2 represents functional protein. As seen in FIG.
  • OR constructs with higher surface expression did not have a higher Firefly/Renilla ratio at baseline (non- treated, NT) in the luciferase reporter assay. This often corresponded to a higher ratio with stimulation as well, implying that the increased baseline may indicate a low level of basal signaling in the absence of ligand.
  • mOREG is a well- characterized OR known to respond to eugenol (hence its name).
  • eugenol the ORs that reach the cell surface under every condition tested.
  • eugenol the ORs that reach the cell surface under every condition tested.
  • eugenol the ORs that reach the cell surface under every condition tested.
  • eugenol the ORs that reach the cell surface under every condition tested.
  • OR deorphanization The limiting factor in OR deorphanization has been the ability-or, often, the inability-to heterologously express ORs on the cell surface.
  • a leucine rich cleavable signal peptide (Lucy tag) onto the N-terminus of ORs significantly improves detectable surface expression, as well as total protein expression.
  • RTP1S, Ric8b and Gaolf we found that all 15 of the Lucy-ORs that we examined successfully trafficked to the surface, providing promise for future deorphanization and other functional studies.
  • SRP Signal Recognition Particle
  • receptors that utilize a signal peptide have long N- terminal tails that can rapidly fold, preventing post- translational translocation across the ER membrane [26].
  • ORs do not have unusually long N- terminal tails, and it is possible that the co- translational ER entry via the Lucy tag helps to stabilize the receptor or prevents misfolding.
  • our preliminary studies showed that mRNA levels of Lucy and non- Lucy- tagged constructs were similar, despite the fact that total protein expression for all ORs was enhanced by the addition of the Lucy tag (FIG. 4). However, in addition to increasing total protein levels, the Lucy tag by itself promoted surface expression of some ORs (FIG. 1).
  • the Lucy tag may be dependent on the immediate upstream sequence of the mature protein. Mutational studies have shown that signal peptides and their adjacent N-terminal sequences act as a "functional unit" and deletion of this upstream domain negatively affects ER translocation [26,35]. As our Lucy-tagged constructs contained a Flag tag (for detection purposes) following the cleavable peptide, the presence of this tag may be required for proper function and cleavage. Preliminary studies found that deletion of the Flag tag from a Lucy-Flag-OR construct prevented the OR from responding to its ligand, suggesting impaired surface expression (without the Flag tag, surface expression could not be assayed independently in this construct). It appears, then, that like other N- terminal sequences [26,35], the 'context' of the Lucy tag may be important for its function.
  • RTP1S is thought to be the most crucial as it can promote OR surface expression even in the absence of the other two compounds for some ORs [5,15,16,22-24]. Indeed, we have found that RTP1S is often required for cell surface expression. By contrast, Gaolf is typically not required, and Ric8b is only occasionally necessary. RTP1S is natively expressed in the olfactory epithelium, and thus, it has been speculated that it is necessary for OR expression in both heterologous cells as well as the OE [16,18].
  • HEK293T cells (a positive control performed simultaneously gave a band of the expected size; Fig. S3).
  • 01fr691 was functionally expressed on the cell surface (with the Lucy tag) in the absence of RTP IS, and retained a normal ligand response (Fig. 5A). While RTP IS is clearly playing important roles in the early trafficking steps and folding of olfactory receptors, it is not required for OR activation or surface expression and therefore is not an obligate co-receptor.
  • Use of the Lucy tag can help shed new light on the functions of RTP1S, as OR function can now be assayed both with and without RTP1S (FIG. 5).
  • OR deorphanization has been greatly hampered by the inability to functionally express ORs in heterologous cell systems.
  • N-terminal tags or the co- expression of chaperone proteins has been crucial for surface expression of many receptors, but has not allowed for widespread OR deorphanization.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/IB2013/002242 2012-09-10 2013-09-26 Compositions and methods for increasing the expression and signalling of proteins on cell surfaces Ceased WO2014037800A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA2884462A CA2884462A1 (en) 2013-09-26 2013-09-26 Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
US14/427,090 US9783585B2 (en) 2012-09-10 2013-09-26 Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
EP13836094.6A EP2893020B1 (en) 2012-09-10 2013-09-26 Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
AU2013311316A AU2013311316A1 (en) 2012-09-10 2013-09-26 Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
JP2015530507A JP2015527074A (ja) 2012-09-10 2013-09-26 細胞表面におけるタンパク質の発現及びシグナル伝達を増大するための組成物及び方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261698930P 2012-09-10 2012-09-10
US61/698,930 2012-09-10

Publications (2)

Publication Number Publication Date
WO2014037800A2 true WO2014037800A2 (en) 2014-03-13
WO2014037800A3 WO2014037800A3 (en) 2014-05-01

Family

ID=50237708

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2013/002242 Ceased WO2014037800A2 (en) 2012-09-10 2013-09-26 Compositions and methods for increasing the expression and signalling of proteins on cell surfaces

Country Status (5)

Country Link
US (1) US9783585B2 (https=)
EP (1) EP2893020B1 (https=)
JP (1) JP2015527074A (https=)
AU (1) AU2013311316A1 (https=)
WO (1) WO2014037800A2 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB202108867D0 (en) 2021-06-21 2021-08-04 Givaudan Sa Screening system
WO2024126820A1 (en) 2022-12-15 2024-06-20 Givaudan Sa Modified olfactory receptors
EP4664463A1 (en) 2024-06-14 2025-12-17 Givaudan SA Computer-implemented method for olfactory property prediction
WO2025257381A1 (en) 2024-06-14 2025-12-18 Givaudan Sa Modified olfactory receptors

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015116771A1 (en) * 2014-01-29 2015-08-06 The Johns Hopkins University Compositions and methods for increasing the expression and signalling of proteins on cell surfaces

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5993778A (en) 1997-05-07 1999-11-30 Firestein; Stuart J. Functional expression of, and assay for, functional cellular receptors in vivo
US20020164617A1 (en) * 2000-12-29 2002-11-07 Neogenesis Pharmaceuticals, Inc. Affinity selection-based screening of hydrophobic proteins
US20040142325A1 (en) * 2001-09-14 2004-07-22 Liat Mintz Methods and systems for annotating biomolecular sequences
DK2031063T3 (da) * 2004-06-18 2014-01-27 Univ Duke Modulatorer af duftreceptorer
US20090155267A1 (en) * 2005-02-09 2009-06-18 Apollo Life Sciences Limited Molecule and chimeric molecules thereof
WO2011069156A2 (en) * 2009-12-04 2011-06-09 Duke University Compositions and methods for enhancing odorant receptor activity
JP5697383B2 (ja) * 2010-09-03 2015-04-08 花王株式会社 悪臭抑制剤の探索方法

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
AIKEN M; SCHMIDT A; RUTZ C; FURKERT J; KLEINAU G ET AL.: "The sequence after the signal peptide of the G protein-coupled endothelin B receptor is required for efficient translocon gating at the endoplasmic reticulum membrane", MOL PHARMACOL, vol. 75, 2009, pages 801 - 811
BELLUSCIO L; GOLD GH; NEMES A; AXEL R: "Mice deficient in G(olf) are anosmic", NEURON, vol. 20, 1998, pages 69 - 81, XP002523014, DOI: doi:10.1016/S0896-6273(00)80435-3
BRYKSIN AV; MATSUMURA I: "Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids", BIOTECHNIQUES, vol. 48, 2010, pages 463 - 465
BUCK L; AXEL R: "A novel multigene family may encode odorant receptors: a molecular basis for odor recognition", CELL, vol. 65, 1991, pages 175 - 187, XP023913184, DOI: doi:10.1016/0092-8674(91)90418-X
BUSH CF; HALL RA: "Olfactory receptor trafficking to the plasma membrane", CELL MOL LIFE SCI, vol. 65, 2008, pages 2289 - 2295, XP019619961
CHAN DV; SOMANI AK; YOUNG AB; MASSARI JV; OHTOLA J ET AL.: "Signal peptide cleavage is essential for surface expression of a regulatory T cell surface protein, leucine rich repeat containing 32 (LRRC32", BMC BIOCHEM, vol. 12, no. 27, 2011, pages 1471 - 2091
CHAPIN HC; RAJENDRAN V; CAPASSO A; CAPLAN MJ: "Detecting the surface localization and cytoplasmic cleavage of membrane-bound proteins", METHODS CELL BIOL, vol. 94, 2009, pages 223 - 239
DUNHAM JH; HALL RA: "Enhancement of the surface expression of G protein-coupled receptors", TRENDS BIOTECHNOL, vol. 27, 2009, pages 541 - 545, XP026495545, DOI: doi:10.1016/j.tibtech.2009.06.005
GAILLARD I; ROUQUIER S; PIN JP; MOLLARD P; RICHARD S ET AL.: "A single olfactory receptor specifically binds a set of odorant molecules", EUR J NEUROSCI, vol. 15, 2002, pages 409 - 418
GODFREY PA; MALNIC B; BUCK LB: "The mouse olfactory receptor gene family", PROC NATL ACAD SCI USA, vol. 101, 2004, pages 2156 - 2161
GRIFFIN CA; KAFADAR KA; PAVLATH GK: "MOR23 promotes muscle regeneration and regulates cell adhesion and migration", DEV CELL, vol. 17, 2009, pages 649 - 661
GUAN XM; KOBILKA TS; KOBILKA BK: "Enhancement of membrane insertion and function in a type IIIb membrane protein following introduction of a cleavable signal peptide", J BIOL CHEM, vol. 267, 1992, pages 21995 - 21998
HAGUE C; UBERTI MA; CHEN Z; BUSH CF; JONES SV ET AL.: "Olfactory receptor surface expression is driven by association with the beta2-adrenergic receptor", PROC NATL ACAD SCI USA, vol. 101, 2004, pages 13672 - 13676
HALL RA: "Olfactory receptor interactions with other receptors", ANN. N Y ACAD SCI, vol. 1170, 2009, pages 147 - 149
HANSSON MD; RZEZNICKA K; ROSENBACK M; HANSSON M; SIRIJOVSKI N: "PCR-mediated deletion of plasmid DNA", ANAL BIOCHEM, vol. 375, 2008, pages 373 - 375, XP029159990, DOI: doi:10.1016/j.ab.2007.12.005
JACQUIER V; PRUMMER M; SEGURA JM; PICK H; VOGEL H: "Visualizing odorant receptor trafficking in living cells down to the single-molecule level", PROC NATL ACAD SCI USA, vol. 103, 2006, pages 14325 - 14330, XP003019211, DOI: doi:10.1073/pnas.0603942103
KAJIYA K; INAKI K; TANAKA M; HAGA T; KATAOKA H ET AL.: "Molecular bases of odor discrimination: Reconstitution of olfactory receptors that recognize overlapping sets of odorants", J NEUROSCI, vol. 21, 2001, pages 6018 - 6025, XP002315705
KATADA S; NAKAGAWA T; KATAOKA H; TOUHARA K: "Odorant response assays for a heterologously expressed olfactory receptor", BIOCHEM BIOPHYS RES COMMUN, vol. 305, 2003, pages 964 - 969, XP002341567, DOI: doi:10.1016/S0006-291X(03)00863-5
KRAUTWURST D; YAU KW; REED RR: "Identification of ligands for olfactory receptors by functional expression of a receptor library", CELL, vol. 95, 1998, pages 917 - 926, XP002926739, DOI: doi:10.1016/S0092-8674(00)81716-X
LU M; ECHEVERRI F; MOYER BD: "Endoplasmic reticulum retention, degradation, and aggregation of olfactory G-protein coupled receptors", TRAFFIC, vol. 4, 2003, pages 416 - 433
LU M; STASZEWSKI L; ECHEVERRI F; XU H; MOYER BD: "Endoplasmic reticulum degradation impedes olfactory G-protein coupled receptor functional expression", BMC CELL BIOL, vol. 5, 2004, pages 34, XP021001222, DOI: doi:10.1186/1471-2121-5-34
MALNIC; GODFREY PA; BUCK LB: "The human olfactory receptor gene family", PROC NATL ACAD SCI USA, vol. 101, 2004, pages 2584 - 2589, XP002999106, DOI: doi:10.1073/pnas.0307882100
MATSUNAMI H; MAINLAND JD; DEY S: "Trafficking of mammalian chemosensory receptors by receptor-transporting proteins", ANN N Y ACAD SCI, vol. 1170, 2009, pages 153 - 156
MCCLINTOCK TS; SAMMETA N: "Trafficking prerogatives of olfactory receptors", NEUROREPORT, vol. 14, 2003, pages 1547 - 1552
MOMBAERTS P: "Genes and ligands for odorant, vomeronasal and taste receptors", NAT REV NEUROSCI, vol. 5, 2004, pages 263 - 278, XP009096796, DOI: doi:10.1038/nrn1365
NARA K; SARAIVA LR; YE X; BUCK LB: "A large-scale analysis of odor coding in the olfactory epithelium", J NEUROSCI, vol. 31, 2011, pages 9179 - 9191
PAVLATH GK: "A new function for odorant receptors: MOR23 is necessary for normal tissue repair in skeletal muscle", CELL ADH MIGR, vol. 4, 2010, pages 502 - 506
PLUZNICK JL; ZOU DJ; ZHANG X; YAN Q; RODRIGUEZ-GIL DJ ET AL.: "Functional expression of the olfactory signaling system in the kidney", PROC NATL ACAD SCI USA, vol. 106, 2009, pages 2059 - 2064
SAITO H; CHI Q; ZHUANG H; MATSUNAMI H; MAINLAND JD: "Odor coding by a Mammalian receptor repertoire", SCI SIGNAL, vol. 2, 2009, pages RA9, XP008164266, DOI: doi:10.1126/scisignal.2000016
SAITO H; KUBOTA M; ROBERTS RW; CHI Q; MATSUNAMI H: "RTP family members induce functional expression of mammalian odorant receptors", CELL, vol. 119, 2004, pages 679 - 691
SCHULEIN R; WESTENDORF C; KRAUSE G; ROSENTHAL W: "Functional significance of cleavable signal peptides of G protein-coupled receptors", EUR J CELL BIOL, vol. 91, 2012, pages 294 - 299
See also references of EP2893020A4
SPEHR M; GISSELMANN G; POPLAWSKI A; RIFFELL JA; WETZEL CH ET AL.: "Identification of a testicular odorant receptor mediating human sperm chemotaxis", SCIENCE, vol. 299, 2003, pages 2054 - 2058, XP002268735, DOI: doi:10.1126/science.1080376
SPEHR M; SCHWANE K; RIFFELL JA; ZIMMER RK; HATT H: "Odorant receptors and olfactory-like signaling mechanisms in mammalian sperm", MOL CELL ENDOCRINOL, vol. 250, 2006, pages 128 - 136, XP025020447, DOI: doi:10.1016/j.mce.2005.12.035
TOUHARA K: "Deorphanizing vertebrate olfactory receptors: recent advances in odorant-response assays", NEUROCHEM INT, vol. 51, 2007, pages 132 - 139, XP022183620, DOI: doi:10.1016/j.neuint.2007.05.020
VON DANNECKER LE; MERCADANTE AF; MALNIC B: "Ric-8B promotes functional expression of odorant receptors", PROC NATL ACAD SCI USA, vol. 103, 2006, pages 9310 - 9314
WETZEL CH; OLES M; WELLERDIECK C; KUCZKOWIAK M; GISSELMANN G ET AL.: "Specificity and sensitivity of a human olfactory receptor functionally expressed in human embryonic kidney 293 cells and Xenopus Laevis oocytes", J NEUROSCI, vol. 19, 1999, pages 7426 - 7433
WU L; PAN Y; CHEN GQ; MATSUNAMI H; ZHUANG H: "Receptor-transporting protein 1 short (RTP IS) mediates translocation and activation of odorant receptors by acting through multiple steps.", J BIOL CHEM, vol. 287, 2012, pages 22287 - 22294
ZAMPATIS DE; RUTZ C; FURKERT J; SCHMIDT A; WUSTENHAGEN D ET AL.: "The protease-activated receptor 1 possesses a functional and cleavable signal peptide which is necessary for receptor expression", FEBS LETT, vol. 586, 2012, pages 2351 - 2359, XP028449769, DOI: doi:10.1016/j.febslet.2012.05.042
ZHANG X; DE LA CRUZ O; PINTO JM; NICOLAE D; FIRESTEIN S ET AL.: "Characterizing the expression of the human olfactory receptor gene family using a novel DNA microarray", GENOME BIOL, vol. 8, 2007, pages R86, XP021031222, DOI: doi:10.1186/gb-2007-8-5-r86
ZHANG X; ROGERS M; TIAN H; ZHANG X; ZOU DJ ET AL.: "High-throughput microarray detection of olfactory receptor gene expression in the mouse", PROC NATL ACAD SCI USA, vol. 101, 2004, pages 14168 - 14173
ZHUANG H; MATSUNAMI H: "Evaluating cell-surface expression and measuring activation of mammalian odorant receptors in heterologous cells", NAT PROTOC, vol. 3, 2008, pages 1402 - 1413
ZHUANG H; MATSUNAMI H: "Synergism of accessory factors in functional expression of mammalian odorant receptors", J BIOL CHEM, vol. 282, 2007, pages 15284 - 15293, XP055036876, DOI: doi:10.1074/jbc.M700386200
ZIMMERMANN R; EYRISCH S; AHMAD M; HELMS V: "Protein translocation across the ER membrane", BIOCHIM BIOPHYS ACTA, vol. 1808, 2011, pages 912 - 924, XP028359007, DOI: doi:10.1016/j.bbamem.2010.06.015

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB202108867D0 (en) 2021-06-21 2021-08-04 Givaudan Sa Screening system
WO2022268745A1 (en) 2021-06-21 2022-12-29 Givaudan Sa Screening system
WO2024126820A1 (en) 2022-12-15 2024-06-20 Givaudan Sa Modified olfactory receptors
EP4664463A1 (en) 2024-06-14 2025-12-17 Givaudan SA Computer-implemented method for olfactory property prediction
WO2025257382A1 (en) 2024-06-14 2025-12-18 Givaudan Sa Computer-implemented method for olfactory property prediction
WO2025257381A1 (en) 2024-06-14 2025-12-18 Givaudan Sa Modified olfactory receptors

Also Published As

Publication number Publication date
JP2015527074A (ja) 2015-09-17
EP2893020B1 (en) 2018-02-28
US9783585B2 (en) 2017-10-10
US20150239945A1 (en) 2015-08-27
WO2014037800A3 (en) 2014-05-01
EP2893020A4 (en) 2016-09-21
AU2013311316A1 (en) 2015-03-26
EP2893020A2 (en) 2015-07-15

Similar Documents

Publication Publication Date Title
Shepard et al. A cleavable N-terminal signal peptide promotes widespread olfactory receptor surface expression in HEK293T cells
JP7085841B2 (ja) ムスク化合物の同定方法
Gravante et al. Interaction of the pacemaker channel HCN1 with filamin A
EP2073013B1 (en) Method of identifying transmembrane protein-interacting compounds
JP2025106387A (ja) 悪臭調節化合物の同定方法
EP2247951B1 (en) Mutant proteins and methods for selecting them
Cheng et al. A jack of all trades: the RNA‐binding protein vigilin
EP2893020B1 (en) Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
Caspary et al. The yeast U2A′/U2B ″complex is required for pre‐spliceosome formation
WO2012098413A1 (en) Mutant g-protein coupled receptor proteins and methods for producing them
Noe et al. IL-6–HaloTag® enables live-cell plasma membrane staining, flow cytometry, functional expression, and de-orphaning of recombinant odorant receptors
Schicker et al. A membrane network of receptors and enzymes for adenine nucleotides and nucleosides
WO2009094218A2 (en) Novel cell lines expressing nav and methods using them
Schell et al. Complexes between the nonsense-mediated mRNA decay pathway factor human upf1 (up-frameshift protein 1) and essential nonsense-mediated mRNA decay factors in HeLa cells
AU2015252840B2 (en) Compositions and methods for modulating mTORC1
Kotthoff et al. Conserved C‐terminal motifs in odorant receptors instruct their cell surface expression and cAMP signaling
US20150087053A1 (en) Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
Hofmann et al. Regulation and functional consequences of mGlu4 RNA editing
US10435456B2 (en) Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
WO2012120315A2 (en) Mutant proteins and methods for producing them
CA2884462A1 (en) Compositions and methods for increasing the expression and signalling of proteins on cell surfaces
JP2019039711A (ja) 嗅覚受容体の応答測定方法
JP2023172979A (ja) ポリペプチド
WO2020225677A2 (en) Par2 modulation and methods thereof
Taufique Investigating the Neurobiologic Function of Tubby Identification of a novel role for Tubby in RNA Biology

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13836094

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2884462

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2015530507

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 14427090

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2013311316

Country of ref document: AU

Date of ref document: 20130926

Kind code of ref document: A