WO2014021682A1 - Cellules cd11b+ cx3cr1+, leur utilisation et leur méthode de prélèvement en masse - Google Patents

Cellules cd11b+ cx3cr1+, leur utilisation et leur méthode de prélèvement en masse Download PDF

Info

Publication number
WO2014021682A1
WO2014021682A1 PCT/KR2013/007002 KR2013007002W WO2014021682A1 WO 2014021682 A1 WO2014021682 A1 WO 2014021682A1 KR 2013007002 W KR2013007002 W KR 2013007002W WO 2014021682 A1 WO2014021682 A1 WO 2014021682A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cdllb
composition
cell
blood
Prior art date
Application number
PCT/KR2013/007002
Other languages
English (en)
Korean (ko)
Inventor
김정아
Original Assignee
가톨릭대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020120085341A external-priority patent/KR101518369B1/ko
Priority claimed from KR1020120085342A external-priority patent/KR101419480B1/ko
Application filed by 가톨릭대학교 산학협력단 filed Critical 가톨릭대학교 산학협력단
Publication of WO2014021682A1 publication Critical patent/WO2014021682A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047—Cells of the immune system
    • G01N33/5052—Cells of the immune system involving B-cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/32—Cardiovascular disorders
    • G01N2800/324—Coronary artery diseases, e.g. angina pectoris, myocardial infarction

Definitions

  • CDllb + CX3CR1 + cells their use and methods for mass collection thereof, [Technical Field]
  • the present invention relates to a CDllb + CX3CR1 + cell having an angiogenic function, an angiogenesis-promoting composition comprising the cell, and a composition for preventing or treating ischemic disease comprising the cell. Also.
  • the present invention relates to a composition for mass collection of CDllb + CX3CR1 + cells having angiogenic function in vitro, and a method for mass collection of CDllb + CX3CR1 + cells using the same.
  • Angiogenesis is the process by which new blood vessels are formed in existing blood vessels, and provides blood vessels that supply nutrients, growth factors and oxygen necessary for hypoxia due to blood circulation disorders or metabolism of ischemic tissues and organs. It is known to functionally improve ischemia-related tissue damage and injury. Excessive angiogenesis is a major cause of disease exacerbation, but blood vessels and aplasia are also a cause of serious disease. E.g,
  • the placenta with poor angiogenesis is a significant cause of miscarriage, and necrosis, ulcers, and ischemia due to the formation of blood vessels can cause tissue or organ dysfunction, or even cause death.
  • diseases such as atherosclerosis, myocardial infarction, ischemic stroke and angina are caused by poor blood supply.
  • attempts have been actively made to apply drugs and techniques for inducing or promoting angiogenesis in the treatment of angiogenesis-dependent diseases such as ischemic diseases.
  • VEGF Endothelial Growth Factor
  • vascular endother ial growth factor has been used to treat a number of diseases such as myocardial infarction, cerebral ischemic injury, limb ischemia and wound healing.
  • VEGF vascular endothelial growth facotr
  • Fibroblast growth factor FGF
  • Del-1 developmental ly regulated endothelial locus ⁇ 1
  • HGF hepathocyte growth factor
  • PD-EGF platelet-derived endothelial eel 1 growth factor
  • angiopoietin mutant growth factor
  • TGF Epidermal growth factor
  • these factors are difficult to isolate and purify as proteins, and are difficult for clinical applications. .
  • CDllb + CX3CR1 + cells isolated from ischemia-induced muscle tissue of mouse induce angiogenesis through interaction with fractalkine (Fkn), the only ligand (ligancl) of CX3CR1, and induce angiogenesis-related vascular endothelial cells. It has been shown that it promotes angiogenesis by activating migration, infiltration and tube formation. . ''
  • CDllb + CX3CR1 + cells can be treated therapeutically.
  • the present invention has been completed by developing a method for collecting a large amount of the cells directly from the body.
  • One object of the present invention is to provide a cell comprising the immune phenotypes of CDllb + and CX3CR1 + .
  • the cells exhibit angiogenic function.
  • Still another object of the present invention is to provide a composition for promoting angiogenesis comprising the cell.
  • Another object of the present invention to provide a pharmaceutical composition for preventing or treating ischemic disease comprising the cells.
  • Another aspect of the present invention is to provide an angiogenic stimulation method comprising administering to the individual an effective amount of the cells.
  • Another object of the present invention is to provide a preventing or treating ischemic diseases, comprising the step of administering an "effective amount of the cells in the object. It is another object of the present invention to provide a composition for mass collection of cells comprising an immune phenotype of CDllb + and CXXR1 + , including a granulocyte colony stimulating factor (G-CSF).
  • G-CSF granulocyte colony stimulating factor
  • Yet another object of the present invention is to provide a method for separating CDNs from the peripheral blood of a subject administered with a composition comprising G-CSF and concentrating the CDNs + CX3CR1 +. It is to provide a method for mass collection of cells comprising an immune phenotype.
  • Another object of the present invention is to provide a cell population which is collected in large quantities using the above method and contains at least 10% of cells comprising the immune phenotypes of CDllb + and CX3CR1 + .
  • Another object of the present invention to provide a pharmaceutical composition for preventing or treating ischemic disease comprising the cell population.
  • the cell of the present invention Since the cell of the present invention has an angiogenic promoting effect, it can be usefully used as an angiogenesis promoter: and furthermore, it can be used for the prevention or treatment of various diseases requiring angiogenesis.
  • the cells of the present invention The bulk collection method uihamyeo to collect easily the amount and concentration, which can be scanned several times directly on the ischemic region of the patient CDllb + CX3CRl + cells in large quantities, and this way the CDllb + CX3CRl + cells collected as is of angiogenesis promoting action Therefore, it could be useful as an angiogenesis promoter. Furthermore, it can be used for the purpose of preventing or treating various diseases requiring angiogenesis.
  • Fig. La shows the results of comparison of intramuscular CDllb + CX3CRl + cell fractions before and after ischemia induction in mice.
  • FIG. Lb is Intramuscular Over Time After Mouse Inferior Ischemia Induction
  • Figure lc shows the intramuscular Fkn expression over time after mouse lower limb ischemia induction.
  • Id is surface antigen of CDllb + CX3CRl + cells isolated from ischemic muscle. The analysis results are shown.
  • Figure 2a shows the comparison of the blood flow over time according to the cell injection.
  • Figure 2b shows the comparison of blood flow over time according to the injection of Fractalkine protein.
  • Figure 3 is a neutralizing anti-Fkn antibody and after ischemia induction. Blood flow comparison results according to the injection of anti-CX3CR1 antibody are shown.
  • Figure 4a shows the result of directly observing the effect of inhibiting angiogenesis in the ischemic muscle after ischemia induction after injection of anti-CX3CR1 antibody.
  • Figure 4b shows the results of direct observation of the effect of inhibiting angiogenesis in rat retina after injection of anti-CX3CR1 antibody.
  • FIG. 4C shows that VEGF niRNA and protein expression is increased in CDllb + CX3CRl + cells.
  • Figure 5 shows the result of the G-CSF prior to administration of peripheral blood (A) and G-CSF 5 ilgan a CDllb + CX3CRl + cell fraction measured in the peripheral blood. Solution and was collected and concentrated monocytes (B) after administration of a FACS analysis .
  • Figure 6 shows the results of FACS analysis of CDllb + CX3CRl + cell fractions in peripheral blood and concentrated monocytes after co-administration of G-CSF and AMD3100 ' .
  • FIG. 7 shows the results of comparing the number of CDllb + CXXRl + cells per unit peripheral blood (mL) after G-CSF administration and co-administration of G-CSF with AMD3100.
  • Monocyte / myeloid lineage cells are known to secrete growth factors that promote angiogenesis and to form blood vessels that increase blood flow to damaged tissues. Yet only it has to do no angiogenesis is known clearly about the cell subset or a mechanism of action of certain monocyte / myeloid system to participate in the forming system of the cell, some of the monocyte / myeloid until now, have been proposed as a target.
  • CDllb + Grl dim cells known as myeloid derived suppressor cells
  • CDllb + Grl dim cells were monocyte / macrophage-type cells including CX3CR1 + , CCR2 + , CCR5 + , CXCR4 + monocytes, especially CDllb + CX3CRl in ischemic muscle after femoral artery dissection. It was found that the number of + cells increased significantly.
  • CDllb + CX3CRl + cell number change were analyzed, and the changes in blood flow when CDllb + CXXRl + cells were injected into the ischemic muscle and the changes in blood flow when pretreated with CDllb + CX3CRl + cells were analyzed.
  • CDllb + CX3CRl "had significantly higher cell than the injection group. Furthermore, is verified by the cells increases in a significant level of blood flow in an effective amount range in the group alone introduced into the Fkn protein associated with the movement of, CDllb + CX3CRl + cells It was confirmed that the cells play an important role in the formation of new blood vessels after ischemic injury (FIGS. 2A and 2B).
  • CDllb + CX3CRl + cells in large quantities we found that CDllb + CX3CRl + cells in large quantities.
  • CDllb + CX3CRl + cells are normally blood, do not almost present in, the G-CSF alone, or with G-CSF and AMD3100.
  • Administration separating blood mononuclear cells from the individual When the concentrated, so-called “concentrated monocytes” were made, it was confirmed that a large amount of concentrated CDllb + CX3CRl + cells can be easily obtained in large quantities (Figs. 5 to 7), thereby leading to the present invention.
  • the present invention also provides methods and compositions for use in the mass collection of CDllb + CX3CRl + cells.
  • the present invention relates to cells comprising the immune phenotypes of CDllb + and CX3CR1 + and exhibiting angiogenic function.
  • the present invention relates to a composition for promoting angiogenesis comprising a cell comprising an immune phenotype of CDllb + and CX3CR1 + .
  • the present invention relates to a method for promoting angiogenesis comprising administering to the individual an effective amount of the cells.
  • the present invention relates to a pharmaceutical composition for treating ischemic disease comprising a cell comprising the immune phenotype of the CDllb + and CX3CR1 + .
  • the present invention relates to a method for preventing or treating ischemic disease, comprising administering to a subject an effective amount of said cell.
  • the present invention relates to a composition for mass collection of cells comprising an immune phenotype of CDllb + and CX3CR1 + , which contains a granulocyte colony stimulating factor (G-CSF).
  • the composition may comprise this or a pharmaceutically acceptable salt of AMD3100 further.
  • the present invention also relates to a composition for mass collection of cells comprising an immune phenotype of CDllb + and CX3CR1 + , comprising G ⁇ CSF and AMD3100 or a pharmaceutically acceptable salt thereof.
  • the invention provides a CDllb + and CX3CR1 + comprising the steps of isolating the blood monocyte fraction from the peripheral ' blood of the subject to which the composition comprising G-CSF is administered and concentrating the blood monocyte fraction.
  • a method of mass collection of cells comprising a phenotype comprising a phenotype.
  • the composition may further comprise AMD3100 or a pharmaceutically acceptable salt thereof. Therefore,.
  • the present invention also includes the steps of separating the blood monocyte fraction from the peripheral blood of an individual administered with a composition comprising G-CSF and AMD3100 or a pharmaceutically acceptable salt thereof and concentrating the blood monocyte fraction, Immunity of CDllb + and CX3CR1 +
  • a method of mass collection of cells comprising a phenotype comprising a phenotype.
  • the step of separating the blood monocyte fraction is blood. This can be done using an ingredient collector:
  • the step of concentrating the blood monocyte fraction may be performed using a blood ' centrifuge.
  • the present invention relates to a cell population which is mass collected using the above method and contains at least 10% of cells comprising the immune phenotypes of CDllb + and CXXR1 + .
  • the present inventors dissected the femoral artery of C57BL / 6 mice to develop ischemia . Remove the first CDllb + CX3CRl + cells derived from one leg muscles after, the surface antigens were examined in order to accurately determine the cell whether i than any system cells. As a result, the CDllb + CX3CRl + cells were positive for bone marrow cells (CD45) and macrophages (F4 / 80), but endothelial cells (VEGFR-2).
  • CDllb + CX3CRl + cells migrated into ischemic muscle are cells of the monocyte / macrophage lineage .
  • CDllb + CX3CRl + cells were positive for all of the monocyte surface antigens VEGFRX1, Tie-2 and CX3CR4, which are known to be involved in angiogenesis.
  • VEGFRX1, Tie-2 and CX3CR4 which are known to be involved in angiogenesis.
  • the cells of the invention are cells comprising the immune phenotypes of CDllb + and CX3CR1 + .
  • the cells of the present invention in addition to the immunophenotypes of CDllb + and CX3CR1 + , include CD45 + , F4 / 80 + , Tie2 + , CXCR4 + , VEGFR1 + , VEGFR2 " , ⁇ 1. ⁇ , CDllc " , CD3 " and CD19 - it may be a cell which further comprises one or more "immune phenotype is selected from the eu.
  • cells to which additional additional immune phenotypes or morphological features are added may be included in the scope of the cells of the present invention.
  • the cells of the invention artificially cut the lower limb aorta and isolate muscle cells in mice .
  • the obtained method is not limited thereto, and may be obtained from ischemic tissues or blood of various mammals including mice, and may be obtained in large quantities by in vitro culture, differentiation and / or amplification using knowledge known in the art. You can get it. For example, in ischemic tissue
  • Ficoll-Hypaque separation method Ficoll-Hypaque separation method, nioidfied Ficol 1-Hypaque separation method, 3% gelatin separation method, Per col ⁇ separation method, panning, immunomagnetic field
  • the cell of the present invention has an angiogenic promoting effect, it can be usefully used as an angiogenic promoter, and furthermore, can be used for the prevention or treatment of various diseases requiring angiogenesis.
  • Ischemic disease is a representative disease that requires angiogenesis. .
  • Ischemic disease refers to a disease in which blood is partially deficient due to various causes such as narrowing or contraction of arteries, blood clots or embolism.
  • Examples of the ischemic diseases are heart failure, hypertensive heart disease, arrhythmia, nature seok heart disease, myocardial infarction. Stroke, peripheral vascular disease, angina pectoris, cerebrovascular dementia, coronary artery failure. Brain failure, retinal-ischemia and vascular failure, but is not limited thereto.
  • ischemic diseases requiring angiogenesis can be included in the scope of the present invention.
  • prevention refers to any action that promotes angiogenesis by administration of a composition of the present invention, or any action that causes growth, spread or recurrence of ⁇ angiogenesis-dependent diseases.
  • treatment refers to all actions which improve the angiogenesis dependent disease or advantageously changed to tukkyeo of the compositions of the present invention ".
  • administration means providing a subject with a composition of the present invention in any suitable manner.
  • the term "individual” as used herein refers to an animal suffering from a condition in which angiogenic dependent disease can be improved by administering the composition of the present invention, preferably a vertebrate, more preferably a mammal, such as a human being, a monkey. , dogs, cats ⁇ goats, pigs, and rats. Means all animals such as guinea pig hamsters, chimpanzees or gorillas.
  • the term “effective amount” means an amount sufficient to prevent or treat a disease, which is the type of disease of the individual. Severity, drug activity, drug sensitivity, time of administration, route and route of administration, duration of treatment, used concurrently; depending on factors including drug and other well known factors in the scientific field. Can be determined. There is : ' ⁇
  • composition of the present invention may be administered orally or parenterally as a cell therapy, and may be intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine dural injection, cerebrovascular injection or It can be administered by intrathoracic injection and can be administered directly to the disease site. ' ,
  • the pharmaceutical composition according to the present invention may be administered in the form of an injection to a site intended to induce angiogenesis of a mammal in combination with the composition for injection, and the composition for injection is preferably an isotonic aqueous solution or suspension.
  • Pharmaceutical compositions may be sterile or preservatives, stabilizers, wetting agents, emulsifier solution accelerators, auxiliaries such as salts and / or buffers for osmotic pressure control or other It may contain therapeutically useful substances.
  • composition of the present invention can be administered directly or indirectly with a pharmaceutically acceptable carrier, such as implanted by surgery to a site requiring repair or expansion, or delivered using a catheter, matrix, or needle.
  • a pharmaceutically acceptable carrier such as implanted by surgery to a site requiring repair or expansion, or delivered using a catheter, matrix, or needle.
  • Pharmaceutically acceptable carriers may be any suitable organic or organic carrier material which does not adversely react with the cells, compositions or ingredients of the invention, including water, salt solutions (Ringer's solution), alcohols, oils, gelatin, lactose, Carbohydrates such as amylose or starch; Fatty acid ester ,
  • Hydroxymethyl cellulose polyvinyl pyrrolidone, and the like. These preparations may be sterile and, where appropriate, lubricants, preservatives: stabilizers, wetting agents, emulsifiers. It may be compatible with auxiliaries such as salts, buffers and coloring agents for osmotic pressure.
  • Pharmaceutical carriers suitable for use in the present invention are known in the art.
  • compositions of the present invention may optionally be administered together with other beneficial drugs and biomolecules (growth factors, nutritional factors, etc.).
  • biological molecules that can be administered include anti-cell killing agents, anti-inflammatory agents, immunomodulators, anti-proliferative agents, corticosteroids.
  • Antibody, an anti-oxidant may include, or local anesthetics ⁇ -thrombotic agents, anti. ' '
  • the cells may be used at 1 ⁇ 10 4 to 10 ⁇ 10 10 cells / kg, preferably at 2.5 ⁇ 10 7 to 5 ⁇ 10 7 and more preferably at 2.5 ⁇ 10 7 cells / kg. It is not limited to children and can be used for example, from 2x10 9 to 4x10 9 based on 70 kg of adult. However, the weight, age, sex, health status, diet, duration of administration, method of elimination, disease The severity can change depending on , and so on.
  • the pharmaceutical composition of the present invention can be used several times a day depending on the half-life . To once a week. The dosage does not limit the scope of the invention in any aspect.
  • the present invention is to collect a large amount of the CDllb + CX3CRl + cells in a therapeutically effective amount, it is characterized by using a composition comprising a granulocyte colony stimulating factor (G-CSF) and / or AMD3100.
  • G-CSF granulocyte colony stimulating factor
  • G-CSF is a factor that proliferates or differentiates neutrophil granulocyte progenitor cells and activates mature neutrophils, mainly bone marrow transplantation, neutropenia due to chemotherapy of cancer, myelodysplastic syndrome, aplastic anemia, congenital and idiopathic neutrophils . It has been used to promote neutrophil increase in attenuated, human immunodeficiency virus (HIV) infections, etc.
  • G—CSF is mobilized to CDllb + CX3CRl + cells peripheral blood, and eventually CDllb + CX3CRl + cells are concentrated. To obtain concentrated monocytes.
  • G-CSF to be used in the present invention can be obtained through various routes, such as synthesis through known amino acid sequence information, used separately from an individual, or obtained from commercially available agents.
  • commercially available G-CSF includes narutograss (trade name Neuap, manufactured by Kyowa Fermentation Industry), filgrasteam (trade name Gran, manufactured by Sankyo; trade name Granulokine, manufactured by Hoffman La Roche;
  • the G 'CSF used in the present invention is included in the scope of the present invention as long as it is chemically modified as long as it maintains the equivalent activity.
  • a method of a chemical modification the method of international patent publication WO00 / 51626, etc. are mentioned, for example .
  • Polypeptides having G-CSF activity for example modified with polyalkylene glycols, for example polyethylene glycol (PEG), can be included.
  • the AMD3100 is also called Pier ixafor,
  • AMD3100 used in the present invention is synthesized by chemical synthesis methods known in the art, or that available from commercially available preparations. And so on
  • AMD3100 can also be used in the form of pharmaceutically acceptable salts.
  • suitable acid addition salts are '
  • Biocompatible inorganic acids e.g. HCl, HBr, sulfuric acid, phosphoric acid, etc.
  • organic acids e.g. HCl, HBr, sulfuric acid, phosphoric acid, etc.
  • Acid 10 for example, acetic acid, propionic acid, butyric acid, etc.
  • an acid containing at least one carboxyl group can include salts (such as oxalic acid, glutaric acid, adipic acid, etc.).
  • AMD3100 used in the present invention is in the form of a prodrug, ie.
  • the compound of the invention may also be prepared in a protective form to release the compound of the invention after administration to a subject.
  • the compound when prepared in purified form, the compound may be crystallized in 15 hydrate. .
  • the step. (A) is the peripheral of the subject administered a composition comprising G-CSF and / or AMD3100 or 25 pharmaceutically acceptable salts thereof
  • the object i is mammalian animal may be "including a vertebrate, more preferably a human.
  • Mass Collected cells in the present invention preferably are used as a therapeutic "purpose to promote angiogenesis, to yield the most preferred self-enriched mononuclear cells from 30 patients subject to treatment.
  • G-CSF may be administered alone or in combination with AMD3100, and when G100CSF and AMQ3100 are administered together, AMD3100 may be administered after or concurrently with the G—CSF.
  • the AMD3100 may be administered 10 hours before blood collection after the addition of G-CSF, but this is not limiting.
  • the dosage form of G-CSF and / or AMD3100 is not particularly limited and may be preferably administered parenterally subcutaneously by injection or the like. Also. In consideration of the type and condition of administration, ' CDllb + CX3CRl + cells may be administered once or several times in an amount sufficient to be mobilized to peripheral blood, preferably 1 to 100 zg / kg for G—CSF. It may preferably be administered once or several times at a dose of 10 g / kg, and once or several times at a dose of 100 to 500 ⁇ g / k, preferably 250 / jg / kg for AMD3100. May be administered. But the dosage form , the number of doses. And the dosage may be appropriately changed by the judgment of those skilled in the art.
  • Separating the blood monocyte fraction from the peripheral blood in step (a) can be carried out using blood component collection methods known in the art, for example, administering G-CSF to a subject and then dispensing peripheral blood into blood components. It can be collected by passing it through an apheresis machine.
  • blood component collectors used in the art can be exemplified by MCS 3p, CS-3000 plus COB Spectra, but the present invention is not limited thereto.
  • the heart, blood enters the catheter through the venous blood group apheresis blood mononuclear cell fraction to be collected by the machine remaining blood can "back into Nero body through a catheter. This process can take about 4 to 10 hours and is intended for therapeutics ⁇ purposes.
  • step (b) is a step of concentrating the blood monocyte fraction isolated in step (a).
  • concentration of the blood monocyte fraction may be performed using a blood centrifuge.
  • the centrifugation conditions can be properly adjusted by one skilled in the art according to the situation, and it is possible to remove plasma components and obtain a concentrate containing monocyte components. have.
  • the embodiments of the present invention remove plasma components by "centrifugation for 10 minutes at 1200 revolutions per minute to give a concentrated solution containing the components to monocytes, but the invention is not limited to this.
  • the ' concentrated monocytes ' contained CDllb + CXXRl + cells in an amount and concentration sufficient to promote angiogenesis when administered directly to the patient's ischemic site, and in a preferred embodiment, CDlib + CX3CRl + cell.
  • the fraction may preferably be at least 10%, more preferably at least 15%. Assuming a patient weight of 70 kg when injected from 2.5 X 10 7 to 5 X 10 7 per patient body weight 2 . X 10 9 to 4 X 10 cells and cells are required.
  • CDllb + CX3CRl + cell concentrates can be obtained in the amount and concentration which can be injected directly into the ischemic site of the patient from the collected mononuclear cells once collected.
  • the monocytes collected in large amounts by the present invention can be stored and mixed with a cell preservative (eg, 7% DMS0) to be shaken (eg Cryomed), and can be stored for a long time without cell damage caused by silver. It can be used for therapeutic purposes because it can be thawed and used as many cells as needed at any time.
  • a cell preservative eg, 7% DMS0
  • shaken eg Cryomed
  • the viability of cells upon thawing is preferably at least 90%.
  • the cell population obtained in the present invention has an angiogenic promoting effect, it may be usefully used as an angiogenesis promoter, and furthermore, may be used for the purpose of preventing or treating various diseases in which angiogenesis is required.
  • Representative diseases that require angiogenesis include ischemic ⁇ ring.
  • the present invention provides a composition for promoting angiogenesis comprising a cell population comprising the immune phenotype of the CDllb + and CX3CR1 + .
  • the present invention also provides a method for promoting angiogenesis comprising administering to the subject an effective amount of the cell population. " .
  • the present invention provides a pharmaceutical composition for preventing or treating ischemic and hematologic diseases comprising the cytoplasm. "The present invention also provides a prevention or treatment of ischemic disease comprising the step of administering an effective amount of said cell population to an object. [Form for implementation of invention]
  • Example 1 Mouse Ischemia Induction and Muscle Cell Isolation
  • ischemia was induced by removing veins and arteries in the thighs of 1 to 12-week-old C57BL / 6 mice.
  • Single cells were isolated from ischemic muscles using 0.2% collagenase (210 U / mg; Worthi'ngton, Lakewodcl, NJ) and ' dispase (0.95 U / mg; Invitrogen, Grand Island, NY).
  • isolated cells were reacted with APC-bound anti-mouse CDllb, biotinylated anti-mouse CX3CR1 antibody at 4 ° C. for 30 minutes.
  • VEGF expression was analyzed using FACS. Fkn expression in tissues and VEGF expression in CDllb + CX3CRl + cells were investigated using real-time PCR.
  • Fkn expression in tissue was Fkn primer (forward: GGA CAG GAC CTC AGT CCA GA, reverse: TCG GGG ACA GGA GTG ATA AG) and VEGF expression in CDllb + CX3CRl + cells was VEGF primer (forward: CACAGCAGATGTGAATGCAG,. :
  • the mouse recombinant protein Fkn (R & D System, Minneapolis, ⁇ ' ) was dissolved in 500 ul of PBS at 0.5, 1, and 5 ug, and injected into the ischemic muscle every day for 100 days at 100 ul immediately after ischemic induction.
  • Anti-CX3CR1 neutralizing antibody TP501, Torrey Pines Bio labs, San Diego, Calif.
  • Anti-Fkn neutralizing antibodies TP233, Torrey Pines Biolabs
  • LDPI laser Doppler perfusion scanner
  • CX3CR1 function to block shed, wherein the -CX3CR1 neutralizing antibody was injected into each 0.5 ⁇ g per day and, five days ischemic muscle.
  • the same amount of Ig0 was injected in the same manner.
  • the OCT compound Tissue ⁇ Tek, Sakur a Fine tek Japan Co., Tokyo, Japan
  • 4% parapo Fixed for 15 minutes in aldehydes. It was washed with PBS and then rebounded with 10% normal horse serum for 1 hour to prevent nonspecific reaction.
  • G- CSF Choongwae (trade name: Neutrogen) and Dong-A (trade name: Leucost iin) '10 g / kg was the dose five days of subcutaneous injections purchased from.
  • G-CSF was injected subcutaneously for 5 days at the dose of, and once subcutaneously at AMD3100 240 / g / kg for 4 days.
  • Blood sampler (Cobe® spectra apheresis system, GAMBRO.BCT, Lakewood, USA) at least 10 hours after the last dose of G-CSF or AMD3100 Blood mononuclear fractions were collected continuously for 4 hours, and concentrated monocytes were collected by concentrating the collected blood monocyte fractions using a blood centrifuge (Cobe®2991 cell processor, GAMBRO.BCT, Lakewood, USA).
  • Ischemia damage significantly increases CDllb + CX3CRl + cell count in ischemic muscle.
  • Fkn which affects CDllb + CX3CRl + cell migration
  • Fkn mRNA expression was highest at 4 days after arterial incision (FIG. Lc), indicating that increased Fkn expression in ischemic muscle was associated with an increase in CDllb + CX3CRl + cell number.
  • CX3CR1 surface antigens are macrophages, monocytes. Endothelial cells, dendritic cells, natural killer cells (NK cell) and a "cell surface antigens that are variously expressed in T cells, CDllb + CX3CRl + cells ischemia intramuscular and CDllb + to see what i types of cells CX3CRl + After the cells were separated, the surface antigen was examined.
  • CDllb + CX3CRl + cells were positive for bone marrow cells (CD45) and macrophages (F4 / 80), Surface antigens for endothelial cells (VEGFR-2), dendritic cells (CDllc), NK cells (NK1.1) and T cells (CD3) were not expressed (Fig. 1 [1]).
  • CDllb + CX3CRl + cells were found to be cells of the monocyte / macrophage lineage.
  • CDllb + CX3CRl + cells of VEGFR-1, Tie-2 specific, the surface of the monocyte antigen known to be involved in angiogenesis and to this antigen were positive CX3CR4.
  • CDllb + CX3CRl + , CDllb + CX3CRl " , and CDilbXX3CRl " cells were isolated from ischemic muscles on day 4 after ischemic induction and injected into ischemic muscles. Changes in blood flow at each time were measured using LDPI (Laser Doppler Perfusion Image). As a result, blood flow in mice injected with CDllb + CXXRl + cells .
  • the present inventors measured the blood flow of the ischemic leg by directly injecting Fkn to the ischemic site.
  • Fkn protein infusion group at 0.5 days on ischemia did not increase blood flow compared to control group injected with PBS (40.54 ⁇ 2.34%, day 28; 37.69 ⁇ 4.85% .28 days, respectively), but injected Fkn of 1 / jg and 5
  • Blocking CX3CR1 function inhibits normal angiogenesis in ischemic muscle and retina.
  • CDllb + CX3CRl + cells were not observed in normal tissues ( Figure A, Figure 4a), but a large number of cells migrated into the ischemic muscle at day 7 of ischemia, many of which were CDllb + CX3CRl + cells (arrow; yellow; Gram B, Fig. 4a). On day 14 of the ischemia, a cell cluster consisting of CDllb + CX3CRl + cells was formed inside the ischemic muscle.
  • Anti-CX3CR1 antibody was injected into the rat retina at day 2 to block the function of CX3CR1 at the ischemic site.
  • Administration of anti-CX3CR1 antibodies in the rat retina Normal retinal vessel formation was confirmed to be aberrant ( Figure C and Figure 4b),
  • CDllb + CX3CRl + cells promote the formation of blood vessels at the ischemic site and directly improve blood flow.
  • CDllb + CX3CRl + cells ⁇ can express VEGFR mRNA and protein in the cell itself.
  • CDllb + CX3CRl + cells are rarely normally present in the blood cells.
  • FIG. 5A To be. Appeared (FIG. 5A).
  • CDllb + CX3CRl + peripheral blood mobilization G-GSF (10 / ig / kg) to the cells from the bone marrow by CDllb + CX3CRl + cells are 2.8 ⁇ 0.9% of the total white blood cells within 5 days following the injection of peripheral blood obtained. Slightly less than about 1.3% before G-CSF
  • the fraction was 16.2 ⁇ 7.2%.
  • Cells Total 9.2 ⁇ 1.2X10 9 gae (16 ⁇ 2 ⁇ 7.2 ⁇ 3 ⁇ 4 ⁇
  • CDllb + CX3CRl ⁇ Cell number increases.
  • CDllb + CX3CRl + cell fraction was approximately 1.1% of the total white blood cell, CDllb + + Three CX3CRl be i was 600 X 10 3 seeds / mL (ll% X54,550 / mm 3).
  • CDllb + CX3CRl + cell fraction in the concentrated monocytes was about 12% and the amount collected was 198 mL.
  • To calculate the total CDllb + CX3CRl + cell number was 6.3X10 9 (12% X 2.67 X lOVml X 198 ml) (CDllb + CX3CRl + (%) X leukocyte count / ml X vol (ml)). therefore .
  • G-CSF and AMD3100 were co-administered, CDllb + CX3CRl + cell concentrates were obtained in the amount and concentration that can be directly injected into the ischemic site of the patient (FIG. 6).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Developmental Biology & Embryology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Cette invention concerne des cellules CD11b+ CX3CR1+ dotées d'une fonction de facilitation de l'angiogenèse, une composition comprenant lesdites cellules, et une composition comprenant lesdites cellules pour prévenir ou traiter les maladies d'origine ischémique. L'invention concerne par ailleurs une composition pour le prélèvement ex vivo en masse des cellules CD11b+ CX3CR1+ dotées d'une fonction de facilitation de l'angiogenèse, et une méthode de prélèvement en masse des cellules CD11b+ CX3CR1+ utilisant la composition.
PCT/KR2013/007002 2012-08-03 2013-08-02 Cellules cd11b+ cx3cr1+, leur utilisation et leur méthode de prélèvement en masse WO2014021682A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR1020120085341A KR101518369B1 (ko) 2012-08-03 2012-08-03 ＣＤ11ｂ＋ＣＸ3ＣＲ1＋ 세포 및 이를 포함하는 허혈성 질환의 예방 또는 치료용 조성물
KR10-2012-0085341 2012-08-03
KR1020120085342A KR101419480B1 (ko) 2012-08-03 2012-08-03 ＣＤ11ｂ＋ＣＸ3ＣＲ1＋ 세포의 대량 수집 방법
KR10-2012-0085342 2012-08-03

Publications (1)

Publication Number Publication Date
WO2014021682A1 true WO2014021682A1 (fr) 2014-02-06

Family

ID=50028278

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/007002 WO2014021682A1 (fr) 2012-08-03 2013-08-02 Cellules cd11b+ cx3cr1+, leur utilisation et leur méthode de prélèvement en masse

Country Status (1)

Country Link
WO (1) WO2014021682A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100166715A1 (en) * 2006-12-21 2010-07-01 Amnon Peled T-140 peptide analogs having cxcr4 super-agonist activity for bone marrow recovery
US20120107898A1 (en) * 2009-04-28 2012-05-03 Harald Neumann Method for obtaining human microglial precursor cells from pluripotent stem cells

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100166715A1 (en) * 2006-12-21 2010-07-01 Amnon Peled T-140 peptide analogs having cxcr4 super-agonist activity for bone marrow recovery
US20120107898A1 (en) * 2009-04-28 2012-05-03 Harald Neumann Method for obtaining human microglial precursor cells from pluripotent stem cells

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HARTUNG, T. ET AL.: "Growth Factors G-CSF and GM-CSF: Clinical Options.", MULTIPLE ORGAN FAILURE., 2000, pages 621 - 629 *
LOGES, S. ET AL.: "Mechanisms of resistance to anti-angiogenic therapy and development of third-generation anti-angiogenic drug candidates.", GENES CANCER., vol. 1, no. 1, January 2010 (2010-01-01), pages 12 - 25 *
ROSINBERG, A. ET AL.: "Therapeutic angiogenesis for myocardial ischemia.", EXPERT REVIEW OF CARDIOVASCULAR THERAPY., vol. 2, no. 2, March 2004 (2004-03-01), pages 271 - 283 *
VOLIN, M. V. ET AL.: "Fractalkine: a novel angiogenic chemokine in rheumatoid arthritis.", AMERICAN JOURNAL OF PATHOLOGY., vol. 159, no. 4, October 2001 (2001-10-01), pages 1521 - 1530 *

Similar Documents

Publication Publication Date Title
US20200268850A1 (en) Methods and compositions for mobilizing stem cells
Al-Kharboosh et al. Inflammatory mediators in glioma microenvironment play a dual role in gliomagenesis and mesenchymal stem cell homing: implication for cellular therapy
US7514261B2 (en) Platelet-derived growth factor protection of cardiac myocardium
KR102146815B1 (ko) Hmgb1 단편을 이용한 신규 심근경색의 치료법
US7833789B2 (en) Monocyte cell
US20070258943A1 (en) Genetically engineered cells for therapeutic applications
Zhu et al. Enhanced angiogenesis promoted by human umbilical mesenchymal stem cell transplantation in stroked mouse is Notch1 signaling associated
EP0703784B1 (fr) Liberation et mobilisation de cellules hematopoietiques
Perrucci et al. Cyclophilin A modulates bone marrow-derived CD117+ cells and enhances ischemia-induced angiogenesis via the SDF-1/CXCR4 axis
US20210023219A1 (en) Cell assembly-mediated delivery of checkpoint inhibitors for cancer immunotherapy
US20230285507A1 (en) Compositions and methods for cardiac tissue repair
JP5895278B2 (ja) Ｇ−ｃｓｆを含む線維芽細胞動員剤及び創傷治療剤
US20150050259A1 (en) Nutraceutical modulators of stem cell activity
CN106470676A (zh) 用于非细胞毒性干细胞移植的方法和组合物
Ieda et al. G-CSF and HGF: combination of vasculogenesis and angiogenesis synergistically improves recovery in murine hind limb ischemia
US20070172447A1 (en) Agent for preventing and/or treating tissue disruption-accompanied diseases
KR101419480B1 (ko) ＣＤ11ｂ＋ＣＸ3ＣＲ1＋ 세포의 대량 수집 방법
WO2014021682A1 (fr) Cellules cd11b+ cx3cr1+, leur utilisation et leur méthode de prélèvement en masse
US9750767B2 (en) IL-18 inhibition for promotion of early hematopoietic progenitor expansion
KR101518369B1 (ko) ＣＤ11ｂ＋ＣＸ3ＣＲ1＋ 세포 및 이를 포함하는 허혈성 질환의 예방 또는 치료용 조성물
KR20150009655A (ko) Gcp-2 유전자를 과발현하는 지방 간엽줄기세포를 포함하는 허혈성 질환 치료용 조성물
US20190382728A1 (en) Menstrual Blood Derived Angiogenesis Stimulatory Cells
WO2005097170A1 (fr) Promoteur d’angiogenie et therapie angiogene
CN116056696A (zh) 物质p组合疗法用于动员造血干细胞
Macklin The Role of Resident Embryonic-Derived Cardiac Macrophages in Ischemic Injury

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13826277

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13826277

Country of ref document: EP

Kind code of ref document: A1