WO2014006228A1 - Cellules endothéliales spécifiques du lit vasculaire - Google Patents

Cellules endothéliales spécifiques du lit vasculaire Download PDF

Info

Publication number
WO2014006228A1
WO2014006228A1 PCT/EP2013/064410 EP2013064410W WO2014006228A1 WO 2014006228 A1 WO2014006228 A1 WO 2014006228A1 EP 2013064410 W EP2013064410 W EP 2013064410W WO 2014006228 A1 WO2014006228 A1 WO 2014006228A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
engineered
endothelial
specific
vascular
Prior art date
Application number
PCT/EP2013/064410
Other languages
English (en)
Other versions
WO2014006228A9 (fr
Inventor
Aernout Luttun
Xabier Lopez ARANGUREN
Giulia COPPIELLO
Manu BEERENS
Felipe Prosper
Xabier AGUIRRE
Original Assignee
Katholieke Universiteit Leuven
Foundation For Applied Medical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Katholieke Universiteit Leuven, Foundation For Applied Medical Research filed Critical Katholieke Universiteit Leuven
Publication of WO2014006228A1 publication Critical patent/WO2014006228A1/fr
Publication of WO2014006228A9 publication Critical patent/WO2014006228A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/069—Vascular Endothelial cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60—Transcription factors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • This invention relates to methods for the generation and subsequent validation of vascular bed-specific endothelial cells (ECs) with specific genetic and functional signatures starting from cellular precursors and use thereof.
  • ECs vascular bed-specific endothelial cells
  • vascular bed-specific ECs with specific genetic and functional signatures from cellular precursors of the endothelial lineage of the present invention are in a particular embodiment of present invention used for the generation of in vitro bioengineered tissue culture equivalents.
  • These in vitro bioengineered tissue culture equivalents are in an additional embodiment used for drug toxicity testing or for the generation of bioengineered vessel conduits for in vivo transplantation.
  • these cells generated by present invention are used for treatment of vascular bed-specific diseases affecting the brain ⁇ e.g., stroke), the liver ⁇ e.g., sinusoidal obstruction syndrome), the heart (myocardial ischemia), the extremities ⁇ e.g., peripheral vascular disease), amongst others.
  • EC types are distinguished morphologically: those lacking fenestrations ('continuous ECs'; e.g., in cardiac muscle, brain), those featuring fenestrations sealed by a diaphragm ('fenestrated ECs'; e.g., endocrine glands) and those featuring fenestrations without diaphragm ('discontinuous or sinusoidal ECs'; e.g., liver) (Pries and Kuebler, 2006).
  • EC precursors include unfractionated bone marrow cells, embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), mesenchymal stem cells (MSCs), umbilical cord or peripheral blood mononuclear cells, adipose tissue-derived cells, endothelial progenitor cells (EPCs), blood outgrowth endothelial cells (BOECs), tissue resident progenitor cells, multipotent adult progenitor cells (MAPCs) and mesoangioblasts (MABs).
  • ESCs embryonic stem cells
  • iPSCs induced pluripotent stem cells
  • MSCs mesenchymal stem cells
  • EPCs endothelial progenitor cells
  • BOECs blood outgrowth endothelial cells
  • MABs mesoangioblasts
  • EC heterogeneity has a tremendous clinical impact. It forms the basis of vascular bed-specific diseases (e.g., atherosclerosis, varicosis or lymphedema, restricted to arteries, veins and lymphatics, respectively) and contributes to the disappointing results and side-effects obtained with 'broad spectrum' (anti-)angiogenic treatments in patients. In addition, it determines the vascular tropism of metastasising tumour cells and is the culprit for vascular bed- specific manifestations of acquired immunodeficiency syndrome (Conway and Carmeliet, 2004; Deng et al., 2006; Goerdt and Sorg, 1992; Ribatti et al., 2002).
  • vascular bed-specific factors e.g., endocrine gland vascular endothelial growth factor or EG-VEGF and gonadotropins
  • inhibitors e.g., chondromodulin-l
  • VEGF ubiquitous growth factors
  • EC progenitor-based revascularisation approaches have not asked whether the transplanted cells acquire the desired EC phenotype once engrafted in a diseased tissue where environmental cues are absent.
  • This invention goes beyond the state-of-the-art with an unprecedented and innovative integrated in vitro/in vivo multi-disciplinary approach based on stem/progenitor cells and small animal models to: (/ ' ) expand our knowledge of EC diversity by obtaining EC type and vascular bed-specific gene-profiles ('signatures'); (/ ' / ' ) exploit that knowledge to design protocols to generate specialised ECs by differentiation from (stem/progenitor) cells in order to design specialised vascular therapies for (lymph)vascular disorders, to assay these signatures in pathological conditions or to use them in drug screening systems.
  • a comparative transcriptomic screen on two categories of ECs microvascular ECs (those from capillaries or 'microvessels' in three different murine/human organs) and macrovascular ECs (those from large vessels such as arteries or veins; we used arteries and veins from human umbilical cord and from adult mouse vena cava and thoracic aorta) delivered relevant information to develop such a method.
  • microvascular ECs to capillaries or 'microvessels' in three different murine/human organs
  • macrovascular ECs those from large vessels such as arteries or veins; we used arteries and veins from human umbilical cord and from adult mouse vena cava and thoracic aorta
  • delivered relevant information to develop such a method Importantly, we used freshly isolated cells for the screen and not cultured cells (like the majority of existing screens), as the former are representative for vascular bed-specific ECs in their in vivo tissue context.
  • An engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell, the cell being genetically altered by transduction or transfection of a source ceil with a transcription factor of the group consisting of Meox2, Tcf 15, Ppary, Wt1 , Ebf3, Zic3, Left , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthoiogue thereof, having the same biological function, or a combination thereof.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the ceil being genetically altered by transduction or transfection of a source cell with a transcription factor of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , and Zeb2; and/or with a transcription factor of the group consisting of Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof.
  • the first group is associated with differentiation into arterial endothelial cells
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source ceil to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source ceil with a transcription factor of the group consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof; in particular said source cell is transduced or transfected with the group of transcription factors consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3, eventually including human homologues or variants, member of the same family, or orthologues thereof.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target ceil of embodiment 1 , the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 , the cell being genetically altered by transduction or transfection of a source cell with the transcription factor Prdm16 and one or more transcription factors selected of the group consisting of Emx2, Msx1 , Nkx2-3, Tox2, and Aff3; or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • Meox2 in combination with one ore more transcription factors selected from the group consisting of Tcf15, Pparv, Wt1 , Ebf3, Zic3, Lett , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twist 1 , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16: more in particular Meox2 in combination with one ore more transcription factors selected from the group consisting of Tcf15, Pparv, Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl and Zeb2; even more in particular
  • the engineered vascular bed-specific endothelial cell (the 'target ceil') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 , the cell being genetically altered by transduction or transfection of a source cell a transcription factor with Tcf15 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular TcF15 in combination with one ore more transcription factors selected from the group consisting of Meox2, Pparv, Wt1 , Ebf3, Zic3, Lett , Foxf2, Foxfl a, Foxd , Tcfec, Hoxb5, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16: more in particular TcF15 in combination with one ore more transcription factors selected from the group consisting of Meox2, Pparv, Wt1
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the ceil being genetically altered by transduction or transfection of a source ceil with a transcription factor with Ppary or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Ppary in combination with one ore more transcription factors selected from the group consisting of eox2, TcF15, Wt1 , Ebf3, Zic3, Left , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16: more in particular Ppary in combination with one ore more transcription factors selected from the group consisting of Meox2, TcF15, Wt1
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target ceil of embodiment 1 , the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Wt1 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Wt1 in combination with one ore more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16: more in particular Wt1 in combination with one ore more transcription factors selected from the group consisting of Meox2, Ppary, TcF15,
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target ceil of embodiment 1 , the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Zic3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Zic3 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Leff , Foxf2, Foxfl a, Foxd , Tcfec, Hoxb5, af, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Zic3 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary,
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Lef1 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Lef1 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Lef1 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3,
  • the engineered vascular bed-specific endothelial ceil (the 'target cell') or the engineered source ceil to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Foxf2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Foxf2 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lef1 , Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Foxf2 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15,
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the ceil being genetically altered by transduction or transfection of a source cell with a transcription factor Foxfl a or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Foxfl a in combination with one or more transcription factors selected from the group consisting of Meox2, Ppar , TcF15, Ebf3, Wt1 , Zic3, Left , Foxf2, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Foxfl a in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source ceil to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Foxd or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Foxd in combination with one or more transcription factors selected from the group consisting of Meox2, Pparv, TcF1 5, Ebf3, Wt1 , Zic3, Lef1 , Foxf2, Foxfl a, Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm 16; more in particular Foxd in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3,
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Tcfec or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Tcfec in combination with one or more transcription factors selected from the group consisting of Meox2, Pparv, TcF15, Ebf3, Wt1 , Zic3, Lef1 , Foxf2, Foxfl a, Tcfec, Hoxb5,
  • Tcfec in combination with one or more transcription factors selected from Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lef1 , Foxf2, Foxfl a, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , and Zeb2; even more in particular Tcfec in combination with one or more transcription factors selected from HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , and Zeb2.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target ceil of embodiment 1 , the cell being genetically altered by transduction or transfection of a source cell with a transcription factor HoxbS or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular HoxbS in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lef1 , Foxf2, Foxfl a, Tcfec, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and
  • Prdm16 more in particular HoxbS in combination with one or more transcription factors selected from Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lef1 , Foxf2, Foxfl a, Tcfec, Maf, Cux2, Gata4, Meis2, Twistl , and Zeb2; even more in particular HoxbS in combination with one or more transcription factors selected from Tcfec, Maf, Cux2, Gata4, Meis2, Twistl , and Zeb2.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Maf or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Maf in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lef1 , Foxf2, Foxfl a, Tcfec, HoxbS, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Maf in combination with one or more transcription factors selected from Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lef
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target ceil of embodiment 1 the ceil being genetically altered by transduction or transfection of a source cell with a transcription factor Cux2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Cux2 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lefl , Foxf2, Foxfl a, Tcfec, HoxbS, Maf, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Cux2 in combination with one or more transcription factors selected from Meox2, Ppary, TcF15, Ebf3, Wt1 ,
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Gata4 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Gata4 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lefl , Foxf2, Foxfl a, Tcfec, HoxbS, Maf, Cux2, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Gata4 in combination with one or more transcription factors selected from Meox2, Ppary, TcF15, Ebf3, Wt1 ,
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Meis2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Meis2 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Leff , Foxf2, Foxfl a, Tcfec, HoxbS, Maf, Cux2, Gata4, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Meis2 in combination with one or more transcription factors selected from Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Zeb2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function; in particular Zeb2 in combination with one or more transcription factors selected from the group consisting of Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic3, Lef1 , Foxf2, Foxfl a, Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16; more in particular Zeb2 in combination with one or more transcription factors selected from Meox2, Ppary, TcF15, Ebf3, Wt1 , Zic
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target ceil of embodiment 1 , the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Emx2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source ceil to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Nkx2-3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Msx1 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the cell being genetically altered by transduction or transfection of a source cell with a transcription factor Tox2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 whereby the cell is being genetically altered by transduction or transfection of a source cell with a transcription factor of the group consisting of eox2, Tcf15, Ppary, WT1 , Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, Hoxb5, Maf, Cux2, Gata4, Meis2, Twistl and Zeb2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an organ-specific microvascular endothelial cell.
  • the engineered vascular bed-specific endothelial cell (the 'target ceil') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 , whereby the cell is being engineered by transduction or transfection of a source cell with a transcription factor of the group consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an arterial endothelial cell; in particular said source cell is transduced or transfected with the group of transcription factors consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3, eventually including human homologues or variants, member of the same family, or orthologues thereof.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 whereby the cell is being engineered by transduction or transfection of a source cell with the transcription factor Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into an arterial endothelial cell.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 whereby the is the cell is being engineered by transduction or transfection of a source cell with a transcription factor of the group consisting of Meox2, Tcf15, Ppary, Wt1 and Ebf3 or a human homoiog or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source ceil into a cardiac microvascular endothelial cell; in particular said source cell is transduced or transfected with the group of transcription factors consisting of eox2, Tcf15, Ppary, Wt1 and Ebf3, eventually including human homologues or variants, member of the same family, or orthologues thereof.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source ceil to differentiate into a vascular endothelial target ceil of embodiment 1 whereby the cell is being engineered by transduction or transfection of a source cell with a transcription factor of the group consisting of Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl and Zeb2 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a liver microvascular endothelial ceil; in particular said source cell is transduced or transfected with the group of transcription factors consisting of Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl and Zeb2, eventually including human homologues or variants, member of the same family, or orthologues thereof.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 whereby the cell is being engineered by transduction or transfection of a source cell with a transcription factor of the group consisting of Emx2, Nkx2-3, Msx1 , Tox2, Aff3 and Prdm16 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an arterial endothelial cell; in particular said source cell being engineered by transduction or transfection of a source cell with the transcription factor Prdm16 in combination with one or more transcription factors selected from the group consisting of Emx2, Nkx2-3, Msx1 , Tox2, and Aff3; more in particular said source cell is transduced or transfected with the group of transcription factors consisting of Emx2, Nkx2-3, Msx1 , Tox2,
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to any one of the previous embodiments, whereby the transcription factors are overexpressed.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to any one of the previous embodiments, whereby the source cell is a blood outgrowth endothelial cell (BOEC).
  • BOEC blood outgrowth endothelial cell
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to any one of the previous embodiments, whereby the source cell is a dedifferentiated cultured human umbilical vein endothelial cell (HUVEC) or a dedifferentiated HUAEC.
  • the source cell is a dedifferentiated cultured human umbilical vein endothelial cell (HUVEC) or a dedifferentiated HUAEC.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to any one of the previous embodiments, whereby the source cell is a mammalian eel! of embryonic or non-embryonic origin.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell whereby the source ceil is a source cell of the group consisting of endothelial progenitor cells (EPCs), mesenchymal stem cells (MSCs), embryonic stem cells (ESCs), induced pluripotency stem ceils (iPSCs), mesoangioblasts (MABs), multipotent adult progenitor cells (MAPCs), blood outgrowth endothelial cells (BOECs), induced endothelial cells (iECs), unfractionated bone marrow cells, umbilical cord or peripheral blood-derived mononuclear cells, adipose tissue-derived cells, tissue resident progenitor ceils, human umbilical vein endothelial cells (HUVECs), human umbilical artery endothelial cells (HUAECs), human dermal
  • EPCs endotheli
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to any one of the previous embodiments, whereby the transduction or transfection is lentiviral.
  • An engineered vascular bed-specific endothelial cell characterized in that the ceil is engineered by induced differentiation of a source cell by transferring directly to source cells the expression product of a transcription factor of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof the expression product being linked to a protein transduction domain (PTD), such as poly-arginine and HIV-derived Tat, or to small cationic peptide domains to enhance its cell membrane crossing capacity.
  • PTD protein transduction domain
  • An engineered vascular bed-specific endothelial cell characterized in that the cell is engineered by induced differentiation of a source cell by transferring directly to source cells the expression product of a transcription factor of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Lefl , Foxf2, Foxfl a, Foxd , Tcfec, Hoxb5, Maf, Cux2, Gata4, Meis2, Twistl , and Zeb2; and/or by induced differentiation of a source cell by transferring directly to source cells the expression product of a transcription factor of the group consisting of Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof the expression product being linked to a protein transduction domain (PTD), such as poly-arginine and HIV-derived Tat, or to small
  • the engineered vascular bed-specific endothelial cell of embodiment 40 whereby the expression product is of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Left , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate said source ceil into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of embodiment 41 whereby the expression product is of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Left , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , and Zeb2; and/or of the group consisting of Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate said source cell into a vascular endothelial target cell.
  • the expression product is of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Left , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS,
  • the engineered vascular bed-specific endothelial cell of embodiments 40 or 41 whereby the expression product is of the group consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a vascular endothelial target cell.
  • the expression product is of Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial ceil of any one of the previous embodiments whereby the expression product is of Tcfec or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source ceil into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell according to any one of the previous embodiments, whereby the transcription factors are overexpressed.
  • the engineered vascular bed-specific endothelial cell according to any one of the previous embodiments, whereby the source cell is a blood outgrowth endothelial cell (BOEC).
  • BOEC blood outgrowth endothelial cell
  • the engineered vascular bed-specific endothelial cell according to any one of the previous embodiments, whereby the source cell is a dedifferentiated cultured human umbilical vein endothelial cell (HUVEC) or a dedifferentiated HUAEC.
  • the source cell is a dedifferentiated cultured human umbilical vein endothelial cell (HUVEC) or a dedifferentiated HUAEC.
  • the engineered vascular bed-specific endothelial cell according to any one of the previous embodiments, whereby the source ceil is a mammalian cell of embryonic or non-embryonic origin.
  • the engineered vascular bed-specific endothelial cell according to any one of the previous embodiments, whereby the source cell is a source cell of the group consisting of endothelial progenitor cells (EPCs), mesenchymal stem cells (MSCs), embryonic stem cells (ESCs), induced pluripotency stem cells (iPSCs), mesoangiobiasts (MABs), multipotent adult progenitor cells (MAPCs), blood outgrowth endothelial cells (BOECs), induced endothelial cells (iECs), unfractionated bone marrow cells, umbilical cord or peripheral blood-derived mononuclear cells, adipose tissue-derived cells, tissue resident progenitor cells, human umbilical vein endothelial cells (HUVECs), human umbilical artery endothelial cells (HUAECs), human dermal microvascular endothelial ceils (HDMECs), cultured endothelial cell lines from EPC
  • the engineered ceil according to any one of the previous embodiments for use in a treatment of vascular bed-specific disorder.
  • 81 The engineered cell according to any one of the previous embodiments, for use in a treatment of a disorder of vascular bed-specific haemostasis or for a disorder of generating and/or maintaining vascular bed-specific phenotypes.
  • the engineered cell according to any one of the previous embodiments for use in a treatment of microvascular complications evoked by a vascular bed- specific (haemostasis) disorder.
  • the engineered cell according to any one of the previous embodiments for use in a treatment of for decreasing severity of vascular bed-specific disorder in a subject, the method comprising autologous, allogeneic or xenogeneic cell transplantation; in a subject in need of treatment with the engineered cell, thereby decreasing severity of disorder in the subject.
  • the engineered ceil according to any one of the previous embodiments, for use in a treatment of for decreasing severity of vascular bed-specific disorder or diseases or circulatory or hypoxic conditions comprise but are not limited to: atherosclerosis, preeclampsia, erectile dysfunction, renal failure, transplant accelerated arteriosclerosis, deep vein thrombosis, sleep apnea, hypoxia during sleep, fetal hypoxia, smoking, anemia, endothelial dysfunction, sinusoidal obstruction syndrome, regional perfusion deficits (e.g., limb, gut, renal ischemia), congestic heart failure, peripheral vascular disease, frost bite, decubitus ulcers, asphyxiation, poisoning (e.g., carbon monoxide, heavy metal), altitude sickness, pulmonary hypertension, sudden infant death syndrome, asthma, chronic obstructive pulmonary disease, congenital circulatory anomalities (e.g., Tetralogy of Fallot), erythroblast
  • the engineered cell for use in a treatment for decreasing seventy of vascular bed-specific diseases affecting the brain (e.g., stroke), the liver (e.g., sinusoidal obstruction syndrome), the heart (myocardial ischemia) or the extremities (e.g., peripheral vascular disease) in a subject, the method comprising autologous, allogeneic or xenogeneic cell transplantation; in a subject in need of treatment the engineered cell, thereby decreasing severity of disorder in the subject.
  • vascular bed-specific diseases affecting the brain e.g., stroke
  • the liver e.g., sinusoidal obstruction syndrome
  • the heart myocardial ischemia
  • extremities e.g., peripheral vascular disease
  • a site of interest e.g., on or around the surface of an acceptable matrix, or systemicaily
  • a pharmaceutically acceptable carrier so as to repair, replace or promote the growth of existing and/or new blood vessels.
  • the engineered cell to any one of the previous embodiments, whereby said cell is administered in the treatment by any one of the following methods: localised injection, catheter administration, systemic injection, intraperitoneal injection, parenteral administration, oral administration, intracranial injection, intra-arterial injection, intra-venous injection, intra-ventricular infusion, intra- placental injection, intra-uterine injection, surgical intra-myocardial injection, transendocardial injection, transvascular injection, intra-coronary injection, intra-muscuiar injection, surgical injection into a tissue of interest or via direct application to tissue surfaces (e.g., during surgery or on a wound).
  • localised injection localised injection, catheter administration, systemic injection, intraperitoneal injection, parenteral administration, oral administration, intracranial injection, intra-arterial injection, intra-venous injection, intra-ventricular infusion, intra- placental injection, intra-uterine injection, surgical intra-myocardial injection, transendocardial injection, transvascular injection, intra-coronary injection, intra-muscu
  • a pharmaceutical composition comprising an engineered ceil according to any one of the previous embodiments.
  • an engineered cell according to any one of the previous embodiments as a (or one of the) cellular component(s) of tissue engineered constructs for implantation in patients (for example to coat the inside of artificial arterial conduits or as the intimal cellular component of a fully biological tissue-engineered vascular graft or to coat cardiac valves).
  • An in vitro method of diagnosing a vascular bed-specific disorder phenotype in a subject comprising (a) analysing the level of expression or activity of expression product of at least 5 genes of the '(differential) reference signatures' of table 4 (brain ECs), of table 5 (liver ECs), of table 6 (heart ECs) and/or tables 12/16/18 (arterial or venous ECs) in a sample isolated from said subject, and (b) compare said level of expression or activity with the level of expression or activity in '(differential) reference signatures' of table 4 (brain ECs), of table 5 (liver ECs), of table 6 (heart ECs) and/or tables 12/16/18 (arterial or venous ECs); whereby a deviated level of expression or activity relative to such '(differential) reference signature' is an indication of such disorder phenotype or a propensity thereto.
  • An in vitro method of diagnosing a vascular bed-specific disorder phenotype in a subject comprising: (a) genotyping one or more genes in the '(differential) reference signatures' of table 4 (brain ECs), of table 5 (liver ECs), of table 6 (heart ECs) and/or tables 12/16/18 (arterial or venous ECs) in a sample isolated from said subject, and (b) analyse the DNA sequence of said gene(s); whereby polymorphisms (e.g., SNPs) in said genes of the 'reference signatures' is an indication of such disorder phenotype or a propensity thereto.
  • polymorphisms e.g., SNPs
  • the engineered ceil according to any one of the previous embodiments, for use in a treatment of for decreasing severity of vascular bed-specific disorder or diseases or circulatory or hypoxic conditions comprise but are not limited to: atherosclerosis, preeclampsia, erectile dysfunction, renal failure, transplant accelerated arteriosclerosis, deep vein thrombosis, sleep apnea, hypoxia during sleep, fetal hypoxia, smoking, anemia, endothelial dysfunction, sinusoidal obstruction syndrome, regional perfusion deficits (e.g., limb, gut, renal ischemia), congestic heart failure, peripheral vascular disease, frost bite, decubitus ulcers, asphyxiation, poisoning (e.g., carbon monoxide, heavy metal), altitude sickness, pulmonary hypertension, sudden infant death syndrome, asthma, chronic obstructive pulmonary disease, congenital circulatory anomalities (e.g., Tetralogy of Fallot), erythroblast
  • a method to differentiate a source cell into a vascular endothelial cell comprising genetically altering the source cell by transduction or transfection of said source cell with a transcription factor of the group consisting of Meox2, Tcf15, Ppar , Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Fox l a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof; in particular said method comprising genetically altering the source cell by transduction or transfection of said source cell with a transcription factor of the group consisting of Meox2, Tcf15, Pparv, Wt1 , Ebf3, Zic3, Lef
  • the source cell being genetically altered by transduction or transfection of said source cell with a transcription factor of the group consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2- 3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof; in particular said source cell is transduced or transfected with the group of transcription factors consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3, eventually including human homoiogues or variants, member of the same family, or orthologues thereof.
  • the source cell being genetically altered by transduction or transfection of said source cell with a transcription factor Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Meox2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source ceil with transcription factor Tcf15 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Pparv or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Wt1 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Zic3 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source ceil being genetically altered by transduction or transfection of said source cell with transcription factor Lef1 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Foxf 1 a or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source ceil being genetically altered by transduction or transfection of said source cell with transcription factor Foxd or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the method of embodiment 101 the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Tcfec or a human homologue or a variant, member of the same family, ortho!ogue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor HoxbS or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Maf or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Cux2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Gata4 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell of embodiment 1 the ceil being genetically altered by transduction or transfection of a source cell with a transcription factor Meis2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Twistl or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Zeb2 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Emx2 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source ceil being genetically altered by transduction or transfection of said source ceil with transcription factor Nkx2-3 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Msx1 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Tox2 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the source cell being genetically altered by transduction or transfection of said source cell with a transcription factor of the group consisting of Meox2, Tcf15, Ppary, WT1 , Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, Hoxb5, af, Cux2, Gata4, Meis2, Twistl and Zeb2 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an organ-specific microvascular endothelial cell.
  • the source cell being genetically altered by transduction or transfection of said source cell with a transcription factor of the group of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate said source ceil into an arterial endothelial cell; in particular said source ceil is transduced or transfected with the group of transcription factors consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3, eventually including human homologues, variants, members of the same family, or orthoiogues thereof, to differentiate said source cell into an arterial endothelial cel.
  • the source cell being genetically altered by transduction or transfection of said source cell with transcription factor Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into an arterial endothelial cell.
  • the source cell being genetically altered by transduction or transfection of said source cell with a transcription factor of the group consisting of Meox2, Tcf15, Ppary, Wt1 and Ebf3 or a human homolog or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source ceil into a cardiac microvascular endothelial cell; in particular said source cell is transduced or transfected with the group of transcription factors consisting of Meox2, Tcf15, Pparv, Wt1 and Ebf3, eventually including human homologues, variants, members of the same family, or orthoiogues thereof, to differentiate said source cell into a cardiac microvascular endothelial cell
  • the source cell being genetically altered by transduction or transfection of said source ceil with a transcription factor of the group consisting of Zic3, Lef1 , Foxf2, Foxfl a and Foxd or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a brain microvascular endothelial cell; in particular said source ceil is transduced or transfected with the group of transcription factors consisting of Zic3, Lef1 , Foxf2, Foxfl a and Foxd , eventually including human homologues, variants, members of the same family, or orthoiogues thereof, to differentiate said source cell into a brain microvascular endothelial ceil.
  • a transcription factor of the group consisting of Zic3, Lef1 , Foxf2, Foxfl a and Foxd or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a brain
  • the source cell being genetically altered by transduction or transfection of said source ceil with a transcription factor of the group consisting of Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2,
  • the source cell being genetically altered by transduction or transfection of said source cell with a transcription factor of the group consisting of Emx2, Nkx2-3, Msx1 , Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an arterial endothelial cell; in particular said source cell is transduced or transfected with the group of transcription factors consisting of Emx2, Nkx2-3, Msx1 , Tox2, Aff3 and Prdm16, eventually including human homologues, variants, members of the same family, or orthologues thereof, to differentiate said source cell into an arterial endothelial cell .
  • a transcription factor of the group consisting of Emx2, Nkx2-3, Msx1 , Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or
  • the source cell is a blood outgrowth endothelial cell (BOEC).
  • BOEC blood outgrowth endothelial cell
  • the source cell is a dedifferentiated cultured human umbilical vein endothelial cell (HUVEC) or a dedifferentiated HUAEC.
  • HUAEC human umbilical vein endothelial cell
  • the source cell is a source cell of the group consisting of endothelial progenitor cells (EPCs), mesenchymal stem cells (MSCs), embryonic stem cells (ESCs), induced pluripotency stem cells (iPSCs), mesoangioblasts (MABs), multipotent adult progenitor cells (MAPCs), blood outgrowth endothelial cells (BOECs), induced endothelial cells (iECs), unfractionated bone marrow cells, umbilical cord or peripheral blood-derived mononuclear cells, adipose tissue-derived ceils, tissue resident progenitor cells, human umbilical vein endothelial cells (HUVECs), human umbilical artery endothelial cells (HUAECs), human dermal microvascular endothelial cells (HDMECs), cultured endothelial cell lines from heart, cultured endothelial cell lines
  • EPCs endothelial progenitor cells
  • MSCs
  • An engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell, the cell being genetically altered by transduction or transfection of a source cell with a transcription factor of the group consisting of eox2, Tcf15, Pparv, Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof.
  • the engineered vascular bed-specific endothelial cell (the 'target ceil') or the engineered source cell to differentiate into a vascular endothelial target cell according to claim 1 , the cell being genetically altered by transduction or transfection of a source ceil with a transcription factor Maf or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source ceil to differentiate into a vascular endothelial target ceil according to claim 1 whereby the cell is being engineered by transduction or transfection of a source cell with a transcription factor of the group consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an arterial endothelial cell.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to claim 1 , whereby the is the cell is being engineered by transduction or transfection of a source cell with a transcription factor of the group consisting of eox2, Tcf15, Ppary, Wt1 and Ebf3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a cardiac microvascular endothelial cell.
  • the engineered vascular bed-specific endothelial ceil (the 'target cell') or the engineered source ceil to differentiate into a vascular endothelial target cell according to claim 1 , whereby the is the cell being engineered by transduction or transfection of a source cell with a transcription factor of the group consisting of Zic3, Lef1 , Foxf2, Foxf 1 a and Foxd or a human homo!ogue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a brain microvascular endothelial cell.
  • a transcription factor of the group consisting of Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl and Zeb2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source ceil into a liver microvascular endothelial cell.
  • a transcription factor of the group consisting of Emx2, Nkx2-3, Msx1 , Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an arterial endothelial cell.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target ceil according to any one of the previous claims 1 to 31 , whereby the transcription factors are overexpressed.
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to any one of the previous claims 1 to 32, whereby the source cell is a blood outgrowth endothelial cell (BOEC).
  • BOEC blood outgrowth endothelial cell
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to any one of the previous claims 1 to 32, whereby the source cell is a source cell of the group consisting of endothelial progenitor cells (EPCs), mesenchymal stem cells (MSCs), embryonic stem cells (ESCs), induced pluripotency stem cells (iPSCs), mesoangioblasts (MABs), muitipotent adult progenitor cells ( APCs), blood outgrowth endothelial cells (BOECs), induced endothelial ceils (iECs), unfractionated bone marrow cells, umbilical cord or peripheral blood-derived mononuclear cells, adipose tissue-derived cells, tissue resident progenitor cells, human umbilical vein endothelial cells (HUVECs), human umbilical artery endothelial cells (HUAECs),
  • the engineered vascular bed-specific endothelial cell (the 'target cell') or the engineered source cell to differentiate into a vascular endothelial target cell according to any one of the previous claims, whereby the transduction or transfection is lentiviral.
  • An engineered vascular bed-specific endothelial cell characterized in that the cell is engineered by induced differentiation of a source cell by transferring directly to source cells the expression product of a transcription factor of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homoiogue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof the expression product being linked to a protein transduction domain (PTD), such as poly-arginine and HlV-derived Tat, or to small cationic peptide domains to enhance its ceil membrane crossing capacity.
  • PTD protein transduction domain
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Foxff a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl , Zeb2, Emx2, Msx1 , Nkx2-3, Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a vascular endothelial target cell.
  • the expression product is of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Foxff a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gat
  • the engineered vascular bed-specific endothelial ceil of claim 38 whereby the expression product is of the group consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a vascular endothelial target ceil.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Meox2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Tcf15 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Ppary or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the expression product is of Wt1 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Zic3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source ceil into a vascular endothelial target cell. 47.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Foxf2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial ceil of claim 38 whereby the expression product is of Foxf 1 a or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial ceil of claim 38 whereby the expression product is of Foxd or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source ceil into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Tcfec or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source ceil into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial ceil of claim 38 whereby the expression product is of HoxbS or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Maf or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a human homolog to differentiate source cell into a vascular endothelial target ceil.
  • the expression product is of Cux2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell. 55.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Gata4 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Meis2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Twistl or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Zeb2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target ceil.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Emx2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the expression product is of Nkx2-3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial ceil of claim 38 whereby the expression product is of Msx1 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Tox2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source eel! into a vascular endothelial target cell.
  • the engineered vascular bed-specific endothelial ceil of claim 38 whereby the expression product is of the group consisting of Meox2, Tcf15, Ppary, Wt1 , Ebf3, Zic3, Lef1 , Foxf2, Foxfl a, Foxd , Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl and Zeb2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an organ-specific microvascular endothelial ceil.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of the group consisting of Prdm16, Emx2, Msx1 , Tox2, Aff3 and Nkx2-3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an arterial endothelial ceil.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, to differentiate source cell into an arterial endothelial cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of the group consisting of Meox2, Tcf15, Pparv, Wt1 and Ebf3 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a cardiac microvascular endothelial cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of the group consisting of Zic3, Lef1 , Foxf2, Foxfl a and Foxd or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a brain microvascular endothelial cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of the group consisting of Tcfec, HoxbS, Maf, Cux2, Gata4, Meis2, Twistl and Zeb2 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into a liver microvascular endothelial cell.
  • the engineered vascular bed-specific endothelial cell of claim 38 whereby the expression product is of the group consisting of Emx2, Nkx2-3, Msx1 , Tox2, Aff3 and Prdm16 or a human homologue or a variant, member of the same family, orthologue thereof, having the same biological function, or a combination thereof to differentiate source cell into an arterial endothelial cell.
  • the engineered vascular bed-specific endothelial cell according to any one of the previous claims 38 to 70, whereby the source cell is a blood outgrowth endothelial cell (BOEC).
  • BOEC blood outgrowth endothelial cell
  • the engineered vascular bed-specific endothelial cell according to any one of the previous claims 38 to 70, whereby the source ceil is a dedifferentiated cultured human umbilical vein endothelial cell (HUVEC) or a dedifferentiated HUAEC.
  • the source ceil is a dedifferentiated cultured human umbilical vein endothelial cell (HUVEC) or a dedifferentiated HUAEC.
  • the engineered vascular bed-specific endothelial cell according to any one of the previous claims 38 to 70, whereby the source cell is a mammalian cell of embryonic or non-embryonic origin.
  • the engineered vascular bed-specific endothelial cell according to any one of the previous claims 38 to 70, whereby the source cell is a source cell of the group consisting of endothelial progenitor cells (EPCs), mesenchymal stem cells (MSCs), embryonic stem cells (ESCs), induced pluripotency stem cells (iPSCs), mesoangiobiasts (MABs), multipotent adult progenitor cells
  • EPCs endothelial progenitor cells
  • MSCs mesenchymal stem cells
  • ESCs embryonic stem cells
  • iPSCs induced pluripotency stem cells
  • MABs mesoangiobiasts
  • MMCs blood outgrowth endothelial cells
  • BOECs blood outgrowth endothelial cells
  • iECs induced endothelial cells
  • unfractionated bone marrow cells umbilical cord or peripheral blood-derived mononuclear cells
  • adipose tissue-derived cells tissue resident progenitor cells
  • human umbilical vein endothelial cells HUVECs
  • human umbilical artery endothelial ceils HUAECs
  • HDMECs human dermal microvascular endothelial cells
  • cultured endothelial cell lines from heart cultured endothelial cell lines from liver, cultured endothelial cell lines from brain.
  • the engineered cell according to any one of the previous claims 1 to 75 for use in a treatment of for decreasing severity of vascular bed-specific disorder in a subject, the method comprising autologous, allogeneic or xenogeneic cell transplantation; in a subject in need of treatment with the engineered cell, thereby decreasing severity of disorder in the subject.
  • the engineered cell according to any one of the previous claims 1 to 75, for use in a treatment of for decreasing severity of vascular bed-specific disorder or diseases or circulatory or hypoxic conditions comprise but are not limited to: atherosclerosis, preeclampsia, erectile dysfunction, renal failure, transplant accelerated arteriosclerosis, deep vein thrombosis, sleep apnea, hypoxia during sleep, fetal hypoxia, smoking, anemia, endothelial dysfunction, sinusoidal obstruction syndrome, regional perfusion deficits (e.g., limb, gut, renal ischemia), congestic heart failure, peripheral vascular disease, frost bite, decubitus ulcers, asphyxiation, poisoning (e.g., carbon monoxide, heavy metal), altitude sickness, pulmonary hypertension, sudden infant death syndrome, asthma, chronic obstructive pulmonary disease, congenital circulatory anomalities (e.g., Tetralogy of Fallot),
  • atherosclerosis preeclampsia, erectile
  • the engineered ceil according to any one of the previous claims 1 to 75 for use in a treatment for decreasing severity of vascular bed-specific diseases affecting the brain (e.g., stroke), the liver (e.g., sinusoidal obstruction syndrome), the heart (myocardial ischemia) or the extremities (e.g., peripheral vascular disease) in a subject, the method comprising autologous, allogeneic or xenogeneic cell transplantation; in a subject in need of treatment the engineered cell, thereby decreasing severity of disorder in the subject.
  • vascular bed-specific diseases affecting the brain e.g., stroke
  • the liver e.g., sinusoidal obstruction syndrome
  • the heart myocardial ischemia
  • extremities e.g., peripheral vascular disease
  • localised injection localised injection, catheter administration, systemic injection, intraperitoneal injection, parenteral administration, oral administration, intra-cranial injection, intra-arterial injection, intra-venous injection, intra-ventricuiar infusion, intra-placental injection, intra-uterine injection, surgical intra-myocardial injection, transendocardial injection, transvascular injection
  • a pharmaceutical composition comprising an engineered cell according to any one of the previous claims 1 to 75.
  • an engineered cell according to any one of the previous claims 1 to 75 as a (or one of the) cellular component(s) of tissue engineered constructs for implantation in patients (for example to coat the inside of artificial arterial conduits or as the intimai cellular component of a fully biological tissue-engineered vascular graft or to coat cardiac valves).
  • An in vitro method of diagnosing a vascular bed-specific disorder phenotype in a subject comprising (a) analysing the level of expression or activity of expression product of at least 5 genes of the '(differential) reference signatures' of table 4 (brain ECs), of table 5 (liver ECs), of table 6 (heart ECs) and/or tables 12/16/18 (arterial or venous ECs) in a sample isolated from said subject, and (b) compare said level of expression or activity with the level of expression or activity in '(differential) reference signatures' of table 4 (brain ECs), of table 5 (liver ECs), of table 6 (heart ECs) and/or tables 12/16/18 (arterial or venous ECs); whereby a deviated level of expression or activity relative to such 'reference signature' is an indication of such disorder phenotype or a propensity thereto.
  • An in vitro method of diagnosing a vascular bed-specific disorder phenotype in a subject comprising: (a) genotyping one or more genes in the '(differential) reference signatures' of table 4 (brain ECs), of table 5 (liver ECs), of table 6 (heart ECs) and/or tables 12/16/18 (arterial or venous ECs) in a sample isolated from said subject, and (b) analyse the DNA sequence of said gene(s); whereby polymorphisms (e.g., SNPs) in said genes of the 'reference signatures' is an indication of such disorder phenotype or a propensity thereto.
  • polymorphisms e.g., SNPs
  • source cell is defined as the cell that is converted, by methods described in the invention, to a vascular bed-specific endothelial cell. Any mammalian cell of embryonic or non-embryonic origin with endothelial (differentiation) potential can be used as the source cell.
  • EPCs endothelial progenitor cells
  • MSCs mesenchymal stem cells
  • ECS embryonic stem cells
  • iPSCs induced pluripotency stem cells
  • MABs mesoangioblasts
  • MABs mesoangioblasts
  • MABs multipotent adult progenitor cells
  • BECs blood outgrowth endothelial cells
  • iECs induced endothelial cells
  • unfractionated bone marrow cells umbilical cord or peripheral blood-derived mononuclear cells
  • adipose tissue-derived cells tissue resident progenitor cells
  • HAVECs human umbilical vein endothelial cells
  • HAAECs human umbilical artery endothelial cells
  • HDMECs human dermal microvascular endothelial cells
  • target cell or the “cell product” is defined as the vascular bed- specific endothelial cell that results from the conversion imposed by the methods described in the invention, wherein the vascular-bed identifies the desired endothelial cell type; for example, the pulmonary vascular bed, refers to vascular endothelial cells of the lungs.
  • the target cell or cell product thus refers to vascular endothelial cells in general, including subtypes based on the vascular bed, such as for example an organ-specific microvascular endothelial cell, an arterial endothelial cell, a cardiac microvascular endothelial cell, a brain microvascular endothelial cell, or a liver microvascular endothelial cell
  • (differential) reference signature designates a list of genes that can be used as a reference to define the endothelial subtype identity of the cell product.
  • the latter needs to have certain expression levels of the said list of genes in order to be defined as a certain endothelial subtype, e.g., an arterial endothelial cell, a capillary endothelial cell from the heart, the brain or the liver.
  • ESCs Embryonic stem cells
  • blastocyst early stage embryo
  • ESCs are stem cells derived from the inner cell mass of an early stage embryo known as blastocyst. They are able to differentiate into all derivatives of the three germ layers (ectoderm, mesoderm and endoderm). These include each more than 220 cell types in the adult body. ESCs can become any tissue in the body, excluding placenta. Only the morula's cells are totipotent, able to become all tissues and placenta.
  • IPSCs are somatic cells that have been reprogrammed, for example, by introducing exogenous genes that confer on the somatic cell a less differentiated phenotype. The cells can then be induced to differentiate into less differentiated progeny. IPSCs have been derived using modifications of an approach originally discovered in 2006 (Takahashi et al., 2007). For example, in one instance, to produce iPSCs, scientists started with skin cells that were then modified by standard laboratory technique using retroviruses to insert genes into the cellular DNA. In one instance, the inserted genes were Oct4, Sox2, Klf4 and c-myc, known to act together as natural regulators to keep cells in an embryonic stem cell-like state.
  • MAPC multipotent adult progenitor cell
  • adult with respect to MAPCs is non-restrictive. It refers to a non-embryonic somatic cell.
  • Multipotent with respect to MAPCs, refers to the ability to give rise to cell types of more than one embryonic lineage.
  • MAPCs can form cell lineages of all three primitive germ layers (i.e., endoderm, mesoderm and ectoderm). Human MAPCs and methods for their isolation and growth are described in U.S. Patent 7,015,037 and U .S. Patent Application Serial No. 10/467,963 (PCT/US02/04652, published as WO 02/064748).
  • MAPCs have also been derived from other mammals: mice (U.S. Patent 7,015,037 and U.S. Patent Application No. 10/467,963); rats (U .S. Patent Application No. 10/467,963); pigs (U.S. Patent Application PCT/US2005/038979).
  • Progenitor cells are cells produced during differentiation of a stem cell that have some, but not all, of the characteristics of their terminally-differentiated progeny. Defined progenitor cells, such as “endothelial progenitor cells”, are committed to a lineage, but not to a specific or terminally-differentiated cell type.
  • endothelial cells encompasses not only terminally-differentiated cell types, but also cells that are committed to a specific endothelial lineage (e.g., venous and/or arterial lineage), but are not terminally-differentiated.
  • progenitor as used in the acronym “MAPC” does not limit these cells to a particular lineage.
  • “Stem cell” means a cell that can undergo self-renewal (i.e., progeny with the same differentiation potential) and also produce progeny cells that are more restricted in differentiation potential .
  • Effective amount generally means an amount which provides the desired local or systemic effect.
  • an effective amount is an amount sufficient to effectuate a beneficial or desired clinical result.
  • the effective amounts can be provided all at once in a single administration or in fractional amounts that provide the effective amount in several administrations. The precise determination of what would be considered an effective amount may be based on factors individual to each subject, including their size, age, injury, and/or disease or injury being treated, and amount of time since the injury occurred or the disease began. One skilled in the art will be able to determine the effective amount for a given subject based on these considerations which are routine in the art.
  • Subject means a vertebrate, such as a mammal, such as a human. Mammals include, but are not limited to, humans, dogs, cats, horses, cows and pigs.
  • “Therapeutically effective amount” refers to the amount determined to produce any therapeutic response in a mammal.
  • effective amounts of therapeutic cells or cell-associated agents may prolong the survivability of the patient, an/or inhibit overt clinical symptoms.
  • Treatments are therapeutically effective within the meaning of the term as used herein, include treatments that improve a subject's quality of life even if they do not improve the disease outcome per se.
  • Such therapeutically effective amounts are ascertained by one of ordinary skill in the art through routine application to subject populations such as in clinical and pre-clinical trials. Thus, to "treat” means to deliver such an amount.
  • Treating are used broadly in relation to the invention and each such term encompasses, among others, preventing, ameliorating, inhibiting, or curing a deficiency, dysfunction, disease, or other deleterious process, including those that interfere with and/or result from therapy.
  • the invention is based on genetically altering the source cells by overexpression of transcription factor genes. It is accordingly an object of the present invention to provide methods of altering source cells into vascular endothelial cells by overexpression of transcription factor genes as provided throughout this application. As described in detail in the Examples provided herein, this has been accomplished by lentiviral transduction. Nevertheless, genetic modification by introducing DNA or RNA into the source cell can be accomplished by a variety of methods available to those skilled in the art, and are within the admit of the present invention.
  • viral transfer including the use of DNA or RNA viral vectors, such as retroviruses (including lentiviruses), Simian virus 40 (SV40), adenovirus, adeno-associated viruses, alpha virus, including Sindbis virus (U.S. Patent No.
  • herpes virus and bovine papillomavirus include calcium phosphate transfection, DEAE dextran transfection methods; (iii) membrane fusion transfer, using DNA-loaded membranous vesicles such as liposomes, red blood cell ghosts and protoplasts; and (iv) physical transfer techniques, such as microinjection, microprojectile, electroporation, nucleofection or direct "naked" DNA transfer.
  • the genetic material can be introduced using promoters that will allow for the gene of interest to be positively or negatively induced using certain chemicals/drugs, to be eliminated following administration of a given drug/chemical/temperature, or can be tagged to allow induction by chemicals (including, but not limited to, the tamoxifen responsive mutated estrogen receptor) in specific cell compartments (including, but not limited to, the cell membrane).
  • chemicals including, but not limited to, the tamoxifen responsive mutated estrogen receptor
  • the genetic material can be introduced by site-directed homologous recombination, using Zinc finger nucleases or TALE nucleases, into gene loci that are known to have favourable chromatin configurations and are thus transcriptionally active, such as the AASV1 locus on human chromosome 19 or the murine ROSA26 locus.
  • Fluorescent proteins e.g., green fluorescent protein of Aequorea Victoria, Cherry protein, for example, have been routinely used.
  • Alternative selectable markers include the ⁇ -Gal gene, the truncated nerve growth factor receptor, drug selectable markers (including, but not limited to: NEO, MTX, hygromycin, blasticidin).
  • TFs can increase their expression level or activity can also be increased in alternative ways.
  • Certain chemical compounds have been described to mimic or act as ligands for several of these TFs or to stabilise the protein ⁇ e.g., rosiglitazone for PPARy and PRDM16).
  • Other chemical compounds can act by repressing the effect of specific TFs.
  • TFs ⁇ e.g., PRDM16
  • TFs often act through complexing with co-factors which modulates the effect of the TFs.
  • methods in which such chemical components or co-factors are used as a substitute for their 'target' TF represent another embodiment of the current invention.
  • Assessment of successful conversion of the source cell to the desired cell product can be done by quantitative real-time polymerase chain reaction (qRT- PCR) for genes from the (differential) reference signature or for genes previously described in the literature to be specific for the desired vascular bed-specific EC.
  • whole genome gene expression of the cell product can be assayed by microarray or equivalent methods ⁇ e.g., RNA-seq).
  • methods to identify successfully converted cells by their expression of proteins encoded by genes from the (differential) reference signature or genes previously published in the literature, by a variety of methods including but not limited to: fluorescence activated cell sorting (FACS), immunofluorescence staining or Western blotting.
  • FACS fluorescence activated cell sorting
  • Western blotting Western blotting.
  • Assessment of the purity of the cell product can be performed by qRT-PCR for potentially contaminating cell types or, at the protein level, by FACS, immunofluorescence or Western blotting.
  • successful conversion can also be monitored on life cells using reporter constructs, stably incorporated in the source cells, based on vascular bed-specific EC promoters that then become activated upon successful conversion. These promoters can drive expression of a fluorescence gene, such that successfully converted cells can be identified by FACS.
  • the successfully converted cells can be separated from the not successfully converted cells by FACS or magnetic beads, using antibodies against cell surface markers uniquely expressed on the successfully converted cells.
  • the reporter technology based on fluorescence genes described above to monitor successful conversion of the source cells can also be used to separate them from the not successfully converted cells.
  • the promoters of the reporter constructs can drive the expression of an antibiotic resistance gene, allowing for positive selection of the successfully converted cells by exposure to antibiotics (including, but not limited to G418, hygromycin, blasticidin).
  • the corresponding proteins can be transferred directly to cells when they are linked to a protein transduction domain (PTD), small cationic peptide domains that can freely and rapidly cross cell membranes.
  • PTD protein transduction domain
  • Several PTDs such as poly-arginine and HIV-derived Tat have been identified that allow a fused protein to efficiently cross membranes.
  • variants, members of the same family ⁇ e.g., the Prdm family), homologues or orthologues of the factors/genes, which have the same biological function/activity can be used or assayed for in methods of the invention.
  • variants, homologues or orthologues of use in the present invention may be homologous or have sequence identity (nucleotide or amino acid sequence) with the transcription factors provided herein.
  • “Homology” refers to the percent identity between two polynucleotide or two polypeptide sequences. Examples of assays and programs to determine if a factor/gene is homologous are known in the art.
  • Determination of the percent identity between any two sequences can be accomplished using a mathematical algorithm.
  • Computer implementations of the mathematical algorithms can be utilised for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program, the ALIGN program and GAP, BESTFIT, BLAST, FASTA, and TFASTA.
  • the invention is also directed to use the cell product for distinct therapeutic and diagnostic purposes.
  • the present invention provides the target cells obtained using the methods of the present invention, as well as the use thereof, in particular in any pharmaceutical compositions containing the cell product.
  • Such compositions are suitable for administration to subjects in need of such cells.
  • the cells would be administered in therapeutically effective amounts.
  • the choice of the pharmaceutical composition for administering cells for a given application to patients will depend on a variety of factors.
  • Prominent among these will be the species of subject, the nature of the disorder, dysfunction, or disease being treated and its state and distribution in the subject, the nature of other therapies and agents that are being administered, the optimum route of administration, survivability via the route, the dose regimen, and other factors that will be apparent to those skilled in the art.
  • the choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form.
  • a pharmaceutically acceptable preservative or stabiliser can be employed to increase the life of cell/medium compositions. If such preservatives are included, it is well within the purview of the skilled artisan to select compositions that will not affect the viability or efficacy of the cells.
  • the components of the compositions should be chemically inert. This will present no problem to those skilled in chemical and pharmaceutical principles.
  • the cell products can be administered by a variety of methods available to the art, including but not limited to: localised injection, catheter administration, systemic injection, intraperitoneal injection, parenteral administration, oral administration, intracranial injection, intra-arterial injection, intra-venous injection, intra-ventricular infusion, intra-placental injection, intra-uterine injection, surgical intra-myocardial injection, transendocardial injection, transvascular injection, intra- coronary injection, intra-muscular injection, surgical injection into a tissue of interest or via direct application to tissue surfaces ⁇ e.g., during surgery or on a wound).
  • Methods to administer the cells may be combined with methods to increase cell survival, including, but not limited to: incorporation into a biopolymer ⁇ e.g., fibronectin, fibrin, fibrinogen, thrombin, collagen, proteoglycans) or synthetic polymer, encapsulation achieved by polymers (such polymeric encapsulation systems include, but are not limited to: alginate, polysaccharide hydrogels, chitosan, calcium or barium alginate, a layered matrix of alginate and polylysine, a photopolymerisable poly(ethylene glycol) (PEG) polymer, a polyanionic material termed Biodritin (U.S.
  • Patent 6,281 ,341 polyacrylates, and polymers such as hydroxyethyl methacrylate methyl methacrylate), encapsulation in silicon capsules with pores applied by photolithographic techniques, encapsulation using immune- compatible polycations, including but not limited to, poly-l-lysine polycation or poly- l-ornithine or poly(methylene-co-guanidine) hydrochloride, encapsulation in biocompatible semipermeable membranes ("macroencapsulation").
  • the gene or reference signature can be used as a diagnostic in patients with vascular bed-specific disorders (for instance by genotyping for the signature); furthermore, the gene or reference signature can be used to estimate the risk for acquiring certain cardiovascular disorders by looking for polymorphisms ⁇ e.g., SNPs) in one or more genes of the signature;
  • the gene or reference signature can be used to design tailored therapy, e.g., vascular bed-specific drug delivery or activation of reference signature genes to increase vascularisation;
  • the gene or reference signature can be used as a read-out for the (side) effect on the ECs of the targeted organ/tissue by current or novel (anti-)angiogenic or other therapies;
  • the gene or reference signature can be used as a read-out for existing or to be developed alternative (combinatorial) approaches not described herein to specify source cells towards a vascular bed-specific EC phenotype.
  • vascular bed-specific ECs ('the target cells' or desired 'cell products'), the following applications can be defined:
  • either autologous, allogeneic or xenogeneic cells can be administered to a patient, either in terminally differentiated or in partially differentiated form, genetically altered or unaltered, by direct introduction to a site of interest, e.g., on or around the surface of an acceptable matrix, or systemically, in combination with a pharmaceutically acceptable carrier so as to repair, replace or promote the growth of existing and/or new blood vessels;
  • in vitro drug toxicity testing either using the cell product alone, or as a (or one of the) cellular component(s) in the context of engineered 2D or 3D tissue equivalents; as a (or one of the) cellular component(s) of tissue-engineered constructs for implantation in patients (for example to coat the inside of artificial arterial conduits or as the intimal cellular component of a fully biological tissue-engineered vascular graft or to coat cardiac valves).
  • Examples of (vascular bed-specific) conditions or diseases or circulatory or hypoxic conditions that can be treated with the compositions and the methods of the invention comprise but are not limited to: atherosclerosis, preeclampsia, erectile dysfunction, renal failure, transplant accelerated arteriosclerosis, deep vein thrombosis, sleep apnea, hypoxia during sleep, fetal hypoxia, smoking, anemia, endothelial dysfunction, sinusoidal obstruction syndrome, regional perfusion deficits ⁇ e.g., limb, gut, renal ischemia), congestic heart failure, peripheral vascular disease, frost bite, decubitus ulcers, asphyxiation, poisoning (e.g., carbon monoxide, heavy metal), altitude sickness, pulmonary hypertension, sudden infant death syndrome, asthma, chronic obstructive pulmonary disease, congenital circulatory anomalities ⁇ e.g., Tetralogy of Fallot), erythroblastosis, myocardial infarction, aortic stenosis,
  • Example 1 Identification of and induction in dedifferentiated cultured heart endothelial cells or blood outgrowth endothelial cells (BOECs) of a gene (and functional) signature specific for heart microvascular endothelial cells using individual transcription factors or combinations thereof and studies on the in vivo role of these transcription factors
  • ABSTRACT Endothelial cells lining the inside of blood vessels in different organs show significant heterogeneity caused by cell-intrinsic and -extrinsic factors. They are morphologically and functionally adapted to meet the unique demands of the tissue in which they reside.
  • ECs ABSTRACT Endothelial cells
  • TFs mesenchyme homeobox 2 or MEOX2, transcription factor 15 or TCF15, Early B-cell factor 3 EBF3, peroxisome proliferation-activated receptor gamma or PPARy, and Wilms tumour 1 or WT1
  • TFs mesenchyme homeobox 2 or MEOX2, transcription factor 15 or TCF15, Early B-cell factor 3 EBF3, peroxisome proliferation-activated receptor gamma or PPARy, and Wilms tumour 1 or WT1
  • BOECs blood outgrowth endothelial cells
  • fatty acid transporter gene expression was decreased in ECs - but not cardiomyocytes - of Meox2 +/ ⁇ :Tcf15 +/ ⁇ hearts compared to their wild-type (WT) littermates, while glucose transporter Glutl was upregulated. Accordingly, Meox2 +/ ⁇ :Tcf15 +/ ⁇ hearts, but not livers, had a reduced uptake of fatty acids, while glucose uptake was increased. Finally, aged - but not young - Meox2 +/ ⁇ :Tcf15 +/ ⁇ m ⁇ ce developed cardiac fibrosis and had impaired heart function.
  • ECs lining the inside of blood vessels in different organs show significant heterogeneity caused by cell-intrinsic and -extrinsic factors and are morphologically and functionally adapted to meet the unique demands of the tissue in which they reside.
  • the ECs of the liver - a filter and storage organ - are organised in sieve plates and lack a basal lamina to facilitate the passive exchange of big molecules between the blood and the hepatocytes (Aird, 2007a).
  • Brain ECs, on the other hand, rest on a basal lamina are in close contact with astrocyte end feet and pericytes, have tight junctions between them and are equipped with specific carrier molecules to transport only the necessary substances and to avoid entrance of pathogens or toxic compounds into the central nervous system.
  • Heart capillary ECs influence cardiac function by secreting signalling molecules ⁇ e.g., nitric oxide or NO), possess a basal lamina and have a high vesicular transport activity (Brutsaert, 2003).
  • signalling molecules ⁇ e.g., nitric oxide or NO
  • the existence of endothelial diversity has tremendous implications for the development and treatment of diseases, because often the vasculature of the targeted organ is affected or has a direct role in the pathogenesis. From this perspective, adequate and customised EC repair is indispensable for successful restoration of organ function (Aird, 2007a).
  • VEGF vascular endothelial growth factor
  • PPARy peroxisome proliferator- activated receptor ⁇
  • Meox2 also known as Gax or Mox2
  • Tcf15 also known as paraxis
  • Meox2 and Tcf15 play a role in early specification of paraxial mesoderm to somitic dermomyotome and a defect in heart development was not reported in Meox2- or Tcf15-deficient mice (Burgess et al., 1996; Mankoo et al., 1999). Nevertheless, expression of both factors was shown in the adult mouse heart, without indication of specific cellular localisation.
  • Meox2 participates in regulating EC homeostasis, being either pro- or anti-angiogenic depending on the expression level and EC type.
  • Tcf15 has never been studied in ECs, except that it was initially cloned from an endothelial library.
  • Meox2 and Tcf15 are exclusively expressed in ECs and, using gain- and loss-of-function in vitro and in vivo studies, that they are critical regulators of the balance between FA and glucose transport across heart ECs.
  • Our first aim was to learn more about molecular and functional differences between capillary (microvascular) ECs from three clinically relevant vascular beds (i.e., those in brain, heart and liver).
  • a second objective was to restore or induce the 'ex vivo' signature in cultured heart ECs or EC progenitors, respectively. From studies in macrovascular ECs, it is known that TFs play a central role in determining their specific gene signature. Hence, within our 'ex vivo' microvascular EC gene profiles, we expected to find - and indeed found - TFs that co-determine their unique signature.
  • mice Animals and human biopsies. Tie2-GFP mice (Motoike et al., 2000) were used as EC donors for expression profiling. After obtaining informed consent, human ECs were isolated from heart biopsies (right atrial appendage from patients undergoing left-sided valve surgery without pulmonary hypertension or right heart failure), brain biopsies (cortical tissue from epileptic patients undergoing amygdalo- hippocampectomy) or liver biopsies (patients undergoing elective cholecystectomy). Experimental procedures with animals and human-derived samples were approved by the Ethics Committee on Animal Use of KU Leuven and of University Hospitals Leuven, respectively. Human samples were handled according to the Declaration of Helsinki. EC isolation and culture.
  • tissues from 8- 12 weeks-old mice were dissected out, surrounding connective tissue and visible large vessels removed and tissues enzymatically digested using optimised procedures for each organ (i.e., 1 .2 U/ml dispase, followed by Percoll gradient centrifugation for liver; 0.7 mg/ml crude collagenase + 39 U/ml DNAse I followed by BSA density gradient centrifugation for brain; 0.7 mg/ml crude collagenase for kidney, lung and pancreas; 1 .5 mg/ml collagenase I for heart, skeletal muscle, BAT and WAT).
  • optimised procedures for each organ i.e., 1 .2 U/ml dispase, followed by Percoll gradient centrifugation for liver; 0.7 mg/ml crude collagenase + 39 U/ml DNAse I followed by BSA density gradient centrifugation for brain; 0.7 mg/ml crude collagenase for kidney, lung and pancreas; 1 .5 mg/m
  • sorting was based on the CD31 + CD34 + CD45 " fraction and either males or females were used.
  • biopsies For human heart ECs, epicardial tissue was removed and biopsies were digested with 1 .5 mg/ml collagenase I; for human liver ECs, biopsies were digested with 0.08 Wunsch U/ml liberase and 39 U/ml DNAse I; for human brain ECs, meninges and the most external layer of white matter were removed and biopsies were digested with 0.7 mg/ml crude collagenase and 39 U/ml DNAse I followed by BSA density gradient centrifugation.
  • the Tie2 + podoplanin " CD45 " or CD31 + Tie2 + CD45 " EC fraction was sorted and replated, or RNA from ⁇ 10 5 sorted ECs was collected for qRT-PCR analysis. Before every experiment cell purity was assessed by CD31 FACS staining. Cardiomyocyte isolation and culture. Single ventricular myocytes were enzymatically dissociated from 3- to 4-months-old mice. Mice were injected i.p. with heparin, anaesthetised with pentobarbital, and the heart was quickly excised. After cannulation of the aorta, hearts were mounted on a Langendorff perfusion set.
  • the heart was briefly rinsed with normal Tyrode solution, containing 137 mM NaCI, 5.4 mM KCI, 0.5 mM MgCI 2 , 1 mM CaCI 2 , 1 1 .8 mM Hepes, 10 mM glucose and 10 mM 2,3-butanedione monoxime (BDM; Sigma Aldrich), pH adjusted to 7.4 with NaOH. Subsequently it was perfused with a Ca 2+ -free Tyrode solution for 10 min.
  • normal Tyrode solution containing 137 mM NaCI, 5.4 mM KCI, 0.5 mM MgCI 2 , 1 mM CaCI 2 , 1 1 .8 mM Hepes, 10 mM glucose and 10 mM 2,3-butanedione monoxime (BDM; Sigma Aldrich), pH adjusted to 7.4 with NaOH. Subsequently it was perfused with a Ca 2+ -free Tyrode solution for 10 min.
  • the Ca 2+ -free Tyrode solution contained 130 mM NaCI, 5.4 mM KCI, 1 .2 mM KH 2 PO 4 , 1 .2 mM MgSO 4 , 6 mM Hepes, 20 mM glucose and 10 mM BDM, pH adjusted to 7.2 with NaOH. Collagenase type II 672 U/ml (Worthington), and 30 ⁇ CaCI 2 added to the Ca 2+ -free Tyrode solution, were recirculated for 8-10 min.
  • the enzymes were washed out with low Ca 2+ Tyrode solution, i.e., the Ca 2+ -free solution to which 0.18 mM CaCI 2 was added, supplemented with 0.5% Bovine Serum Albumin (BSA; Sigma) for 3 min. and then again with low Ca 2+ Tyrode solution without BSA for 3 min. All solutions used were continuously gassed with 95% O 2 /5%CO 2 .
  • the heart was then removed from the perfusion apparatus, the ventricles dissociated into single cells by pipetting and afterwards with 5 min. gentle shaking.
  • cardiomyocytes were collected in TRIzol® or RIPA buffer for ex-vivo qPCR or Western blot analysis, or resuspended in culture medium (M-199 medium, Gibco-Life Technologies), supplemented with 2 mM carnitine, 5 mM taurine, 5 mM creatine (all Sigma Aldrich), and 10 mM BDM, plated onto dishes previously coated with laminin (Sigma Aldrich), and allowed to attach for four hours under standard conditions (95% O 2 /5% CO 2 , 37° C) before using them for the in vitro fatty acid (FA) uptake experiments.
  • M-199 medium Gibco-Life Technologies
  • Microarray analysis and data filtering Microarrays on pooled EC samples were performed by the VIB Nucleomics Core. Briefly, RNA quality control was done using a Bioanalyser 2100 (Agilent Technologies) and 500 pg of RNA from the EC fraction of 5 selected samples per tissue was amplified, biotin-labelled and run on a mouse genome-wide microarray (Affymetrics Mo Gene1 -0ST). Microarray data were filtered to obtain a validated tissue-specific EC signature: first, only genes that were statistically significantly and differentially overexpressed at least 4-fold (Log 2 > 2) versus the other two tissues-ECs and that had a mean Log 2 probe intensity greater than 6 were retained.
  • RNA/protein isolation, cDNA preparation, qRT-PCR and Western blot were performed as described extensively in Example 3. Briefly, total RNA from cell lysates was extracted using TRIzol® reagent or RLT lysis buffer. mRNA was reverse transcribed using Superscript III Reverse Transcriptase (Invitrogen) and cDNA underwent 40 rounds of amplification on an ABI PRISM 7700 cycler (Perkin Elmer/Applied Biosystems) for standard SYBER GREEN qRT-PCR. Primer sequences are listed in Table 2. mRNA levels were normalised using GAPDH, ACTB or TUBB as housekeeping gene.
  • Proteins were extracted with RIPA buffer (Sigma) supplemented with protease inhibitors. For Western blotting, 10 to 40 g of proteins was used. Blot pictures were recorded with a Bio-Rad Chemidoc XRS+ molecular imager, equipped with Image Lab software (Bio-Rad laboratories). An antibody list for Western blotting is provided in
  • the lentiviral construct for overexpressing human MEOX2 (EX-Z3242-Lv1 14) was purchased from Genecopoeia; PPARG1 was cloned from human heart EC cDNA and other TFs were amplified starting from cDNA plasmids (Thermo Scientific Molecular Biology; (maps for the used lentiviruses can be found in Figure 2.A-D and cloning information in Table 3).
  • Lentiviruses were produced in HEK293 cells using two helper plasmids (psPax2 and PMD2G) and Fugene® transfection reagent (Roche Applied Science) and virus productions were titered to use the minimum amount of virus giving 100% transduction.
  • psPax2 and PMD2G helper plasmids
  • Fugene® transfection reagent Fugene® transfection reagent
  • BOEC isolation and culture BOECs were isolated and grown from peripheral and umbilical cord blood (after obtaining informed consent), as previously published (Hendrickx et al., 2010). Briefly, two times 25 ml peripheral (venous) blood was taken using a 20 ml syringe filled with 2.5 ml heparin (5,000 U/ml). Cord blood (50 ml) was collected in dedicated plastic collector bags (Fenwal) containing sodium citrate as anticoagulant. After dividing the blood equally in two 50 ml falcon tubes, the blood was diluted with an equal volume of PBS containing 1 % PSA (penicillin/streptomycin/amfotericinB; Invitrogen).
  • PBS penicillin/streptomycin/amfotericinB
  • Invitrogen penicillin/streptomycin/amfotericinB
  • Ten falcon tubes (10 ml) were prepared by filling them with 2.5 ml histopaque (Ficoll PaqueTM Plus, GE Healthcare). The layer of 10 ml diluted blood was carefully put onto each histopaque layer taking care not to mix the two layers and the 10 ml falcon tubes were centrifuged for 30 min. at 750 g in a centrifuge with a swing-out rotor of which the brake was switched off. Buffy coats were collected into a new 50 ml falcon tube. 45 ml of PBS/1 % PSA/2% FBS (FBS: fetal bovine serum; Hyclone) was added to the falcon tube and the pellet was washed thoroughly by resuspension.
  • FBS fetal bovine serum
  • EBM-2 EBM-2 basal medium + EGM-2 singlequots; Lonza.
  • the cells were plated on one or more collagen type-l coated six-well plate(s) (3 ml/well; Greiner Bio-One) and incubated at 37°C and 5% CO2.
  • the media of the cells was changed 100% every day during the first week and thereafter every other day until colonies appeared (usually between day 1 1 -28 days after plating). Once colonies had reached a sufficient size (usually 2-4 weeks after plating), the colonies were harvested together by trypsinisation.
  • Cells were resuspended in EBM-2 growth medium and 3 ml/well was plated in collagen-coated six-wells. Once the wells were confluent, cells were split (1 :3). From then on cells were plated in 10 cm collagen type l-coated plates (Greiner Bio-One).
  • FA uptake assays were performed in human heart ECs 72 hours post-transduction or in freshly isolated adult murine cardiomyocytes, after 4 hours of culture. Briefly, cells were medium-deprived and washed with Gey's buffer. For FFA uptake measurement, cells were incubated with 500 nM BODIPY-PA (Molecular Probes) in Gey's buffer for 30 min. (for cardiomyocytes 1 mM 2,3- butanedione monoxime was also added), or 5 ⁇ BODIPY-PA in PBS containing 0.1 % FA free-BSA.
  • BODIPY-PA Molecular Probes
  • VLDL-associated FA uptake cells were incubated for 2 hours with 10 g/ml Dil-Human VLDL (Kalen Biomedical) in Gey's buffer. Cells were washed twice and maintained in Gey's buffer for 1 hour, then fixed with 4% paraformaldehyde and stained with DAPI. Pictures were taken with a Zeiss Axiovert 200M microscope at 40X magnification. The number of fluorescent vesicles in the cytoplasm was determined by a blinded investigator in 20-40 cells per condition, in 3-5 independent experiments.
  • Meox2 +/ ⁇ :Tcf15 +/ ⁇ mice were obtained by intercrossing Meox2 Cre/+ (C57BI/6 background; Jackson Laboratories; stockN°003755) and Tcf15 +/ ⁇ mice (129S7/SvEvBrd * C57BI/6 background; provided by E.N. Olson and J.A. Rawls, Dallas, TX and Tempe, AZ, USA; Burgess et al., 1996). Mice were analysed at 3-4 months of age or at 1 1 months of age.
  • Heart ECs or liver ECs (CD31 + CD34 + CD45 ⁇ cells) were isolated as described above from 7 to 17 weeks-old littermates, either males or females, and gene expression was evaluated by qRT-PCR.
  • Oil Red-O, Hematoxylin-Eosin, Sirius red and immunofluorescence stainings were performed as described (Hendrickx et al., 2010). Briefly, for Oil Red- O staining mice were anesthetised with pentobarbital, hearts were rapidly excised, washed in KCI 1 M and PBS, directly snap-frozen in liquid N 2 and conserved at - 80°C until used. Frozen hearts were embedded in Tissue-tek freezing medium (Leica Biosystems), cryo-sectioned at 10 ⁇ , air-dried for 10 min. and immediately stored at -20°C to be used the same day.
  • Tissue-tek freezing medium Leica Biosystems
  • Tissue slides were rinced with milliQ water and fixed 1 h with 3.7% formaldehyde in milliQ water. After one rinse in milliQ water, slides were immersed in a freshly prepared, Wattman-filtered Oil Red-O solution (0.3% Oil Red-O in 60% Triethyl-phosphate-H 2 O) for 30 min. Then rinsed with milliQ water and deionised water and mounted with Aquadrop (Merck). Pictures were taken with a Zeiss Axiovert 200M microscope at 40X magnification and quantification was carried out with the use of ImageJ software evaluating the percentage of stained tissue surface. The procedure for immunofluorescence/immunohistochemical staining was performed on 3-6 ⁇ thick sections of paraffin embedded tissues.
  • An antibody list for IF is provided in Table 1. Images were recorded on a Zeiss Axiovert 200M microscope equipped with a Zeiss MRc5 camera and Axiovision 4.8 software. Oil red-O staining, capillary/cardiomyocyte ratio, cardiomyocyte cross-sectional area and Sirius red staining were quantified using Image J software by a blinded investigator.
  • mice 7 Wild-type and 8 Meox2 +/ ⁇ :Tcf15 +/ ⁇ mice were injected intravenously with a 2 Ci dose of [1 - 14 C]- Oleic Acid ( 14 C-OA; Perkin Elmer) dissolved in saline (1 :4).
  • 14 C-OA [1 - 14 C]- Oleic Acid
  • saline 1 :4
  • mice were anaesthetised with an i.p. injection of ketamine (75 mg/kg) and xylazine (10 mg/kg) mixture and perfused with 0.9% saline solution.
  • Organs (heart and liver) were dissected, weighed and solubilised by the addition of Solvable (Perkin Elmer, 1 ml/100 mg tissue) in a glass scintillation vial and incubated at 60°C overnight. After cooling to room temperature, 30% (w/w) hydrogen peroxide (100 ⁇ per 1 ml of sample) was added followed by heating at 60°C for another hour to minimise colour quenching of samples. Finally, scintillation fluid (4 ml per 200 ⁇ ; Normascint, Scharlab) was added to each sample followed by vigorous shaking. The vials were then allowed to equilibrate in the dark for at least 60 min. before scintillation counting using an LKB Wallac Rackbeta 1214 Counter (Perkin Elmer). Final data are expressed as % injected dose per gram of tissue.
  • [ 18 F]FDG PET imaging Glucose metabolism in the heart was measured by positron emission tomography (PET) with the radiotracer 2-deoxy-2-[ 18 F]fluoro-D- glucose ([ 18 F]FDG), synthetised by standard nucleophilic substitution methods at the Clinica Universidad de Navarra PET-GMP laboratory. PET imaging was performed in a dedicated small animal scanner (Philips Mosaic, Cleveland, OH), with 2 mm resolution at full width half maximum (FWHM), 1 1 .9 cm axial field of view (FOV) and 12.8 cm transaxial FOV.
  • FWHM full width half maximum
  • FOV 1 1 .9 cm axial field of view
  • the [ 18 F]FDG (7.9 ⁇ 1 .5 MBq in 100 ⁇ saline) was injected through the tail vein simultaneously at the beginning of a list mode study of 60 min.
  • a summed sinogram of the whole emission study and an 18 frame dynamic sinogram (2x 15"; 7x30"; 1 x60"; 1 x120"; 1 x180"; 2x300"; 4x300" were created.
  • Step 1 Defining a differential gene sic/nature.
  • microarray output was representative for the three microvascular EC types, as evidenced by the high expression of general (i.e., Pecaml and Tek) EC markers, the low expression of genes corresponding to contaminating cells and from the expected enrichment of previously known tissue-specific microvascular EC markers ( Figure 3D-E).
  • general i.e., Pecaml and Tek
  • Step 2 Filtering against non-EC penes.
  • Step 3 Test the heart EC sic/nature in additional tissue ECs.
  • Step 4 Cross-over analysis with human ECs.
  • the heart EC gene signature also contained five genes encoding a TF, i.e., Meox2, Tcf15, early B-cell factor 3 (Ebf3), Pparg and Wilms tumour 1 (Wt1; Table 5C and Table 6).
  • Meox2, Tcf15 and Ebf3 have never been associated with the heart vasculature, whereas Ppary has been described for its involvement in FA uptake in ECs in the heart (among other tissues; Kanda et al., 2009) and Wt1 for its detection in heart vessels under ischemic conditions (Wagner et al., 2002).
  • MEOX2/Tcf15 did neither affect each other's expression nor that of WT1, but had a small yet significant inductive effect on PPARG.
  • overexpression of EBF3 alone only induced a limited number of signature genes and thus did not recapitulate the combined effect of MEOX2 and Tcf15.
  • combining EBF3 overexpression with MEOX2/Tcf15 only additionally induced aquaporin 7 (AQP7) and FABP9, and only boosted the upregulation of EEPD1 ⁇ Figure 10B).
  • Step 2 Transcriptional regulation of FA uptake in heart ECs
  • FAs reach the heart EC barrier in mainly two forms, either bound to albumin (free-fatty acids or FFA) or contained in circulating lipoproteins ⁇ e.g., chylomicrons or very low density lipoproteins [VLDL]) from which they can be released by lipoprotein lipase (Lpl), present at the luminal EC surface.
  • albumin free-fatty acids or FFA
  • VLDL very low density lipoproteins
  • mice lacking one allele of each TF were generated by intercrossing Tcf15 +/ ⁇ with Meox2 Cre/+ (further referred to as Meox2 +/ ⁇ ) mice.
  • Meox2 +/ ⁇ mice mice lacking one allele of each TF were generated by intercrossing Tcf15 +/ ⁇ with Meox2 Cre/+ (further referred to as Meox2 +/ ⁇ ) mice.
  • Mice homozygously deficient for Tcf15 (Burgess et al., 1996) or Meox2 (Supplementary Note 3 at the end of Example 1) die perinatally, while heterozygously deficient mice are viable.
  • ECs were isolated from the heart and, as a control, from the liver of adult Meox2 +/ ⁇ :Tcf15 +/ ⁇ mice and their single- heterozygous or Wild-type littermates. While haplodeficiency for Meox2 or Tcf15 alone only slightly affected the heart EC signature, we observed a significant downregulation of -45% of the signature genes in Meox2 +/ ⁇ :Tcf15 +/ ⁇ hearts, supporting the synergistic genetic interaction of both TFs also in vivo ⁇ Figure 13).
  • CD36, Fabp4, Fabp5, and Gpihbpl the latter encoding the anchoring protein for Lpl on the luminal EC surface (Davies et al., 2012), were significantly downregulated in Meox2 +/ ⁇ : Tcf15 +/ ⁇ heart ECs (but not in liver sinusoidal ECs), while Fatp3, a FA transporter regulated by VEGF-B interaction with heart ECs (Hagberg et al., 2010) as well as the glucose transporter Glutl were upregulated in Meox2 +/ ⁇ :Tcf15 +/ ⁇ heart ECs, possibly in a compensatory fashion ⁇ Figure 16A,B).
  • this strategy based on TF overexpression to induce a heart EC- specific gene signature in BOECs can also be tested for other EC types, e.g., liver and brain ECs.
  • liver and brain ECs e.g., liver and brain ECs.
  • TF activity i.e., Tcfec, Hoxb5, Maf, Cux2, Gata4, Meis2, Twistl and Zeb2; Table 5A
  • Resulting pre-specified ECs can than be tested for their therapeutic efficacy in models of liver ⁇ e.g., sinusoidal obstruction syndrome) or brain ⁇ e.g., stroke) vascular disease.
  • Meox2/Tcf15 acted upstream of another endothelial regulator of FA uptake, i.e., PPARy (Kanda et al., 2009), as suggested by the increased PPARG expression upon MEOX2/Tcf15 overexpression and by the significant downregulation of Pparg and some of its known target genes ⁇ CD36, Fabp4 and Aqp7) in Meox2 +/ ⁇ :Tcf15 +/ ⁇ heart ECs.
  • MEOX2/Tcf15 and PPARG also had a synergistic effect in vitro on the regulation of most genes of the signature, which were not induced by the overexpression of PPARG alone.
  • C1qtnf9 - the expression of which was decreased in Meox2 +/ ⁇ :Tcf15 +/ ⁇ heart ECs and increased in vitro upon MEOX2-Tcf15 combined overexpression - is a paralogue of the adipokine Adipoq.
  • adipose tissue is the prime organ for C1 qtnf9 secretion, significant local production has also been detected in the heart.
  • CD36 is highly expressed in microvascular ECs and absent in ECs from large vessels (Chi et al., 2003). Nevertheless, between capillary ECs from different organs there is a different degree of expression of CD36, being very low in brain ECs and high in liver and heart ECs (as evident from our microarray analysis; Figure 15). Indeed, for heart and liver, microvascular EC purity could be determined by FACS for CD36 (as shown for the heart in Figure 3A), whereas under identical FACS staining conditions we could not detect CD36 positive cells in brain ECs. Therefore, to confirm microvascular EC purity of brain EC preparations, we relied upon the significant enrichment for known brain-specific microvascular EC markers such as Glutl, Lat1, Ocln and Tfrc ( Figure 3E).
  • brain-specific microvascular EC markers such as Glutl, Lat1, Ocln and Tfrc
  • Meox2 Cre/+ mice were obtained from the Jackson Laboratories
  • Meox2 Cre/+ x Meox2 Cre/+ crosses to obtain Meox2 cre/cre (or Meox2 ⁇ / ⁇ ) mice
  • Meox2 ⁇ / ⁇ pups died within a few hours after birth, while the ratios just before birth (at embryonic day 19.5) were Mendelian. This observation is at variance with what is reported on the Jackson Laboratory website where it is mentioned that Meox2 mice are viable at birth and die just before weaning (http://jaxmice.jax.org/strain/003755.html).
  • Example 2 Identification of and induction in dedifferentiated cultured human umbilical vein endothelial cells of a gene signature specific for human arterial endothelial cells using individual transcription factors or combinations thereof 2.1.
  • Endothelial cells lining arteries and veins have distinct molecular and functional features.
  • the underlying regulatory mechanisms in human ECs are incompletely understood.
  • TFs transcription factors
  • HEY2 the current 'golden standard' denominator for arterial (A)EC specification.
  • Culture of HUAECs or HUVECs abrogated differential gene expression at least in part due to loss of canonical Notch activity and HEY2 expression.
  • Endothelial cells (ECs) of different vessels across the body differ in morphology, function and gene expression profile, a phenomenon known as 'endothelial heterogeneity' (Aird, 2007a, b). Endothelial diversity is due to exposure to different microenvironments (extracellular matrix, surrounding cells, blood flow) and different intrinsic genetic programs which are present at very early stages of development even before the vascular system is functional (Aird, 2007a). Genetic programs determining arterial or venous EC identity have been mainly studied in zebrafish and mice and much less attention has been given to human cells, mainly because of the difficulty to obtain ECs of human origin.
  • canonical Notch signalling including the ligand delta-like 4 (DII4), the receptors Notch 1 and Notch4 and the downstream TFs Hey1 and Hey2 (gridlock in zebrafish) determine the arterial phenotype across species (Swift and Weinstein, 2009), in part by blocking the TF chicken ovalbumin upstream promoter-TF (COUP-TF)II which is expressed in venous ECs (VECs) (You et al ., 2005).
  • DII4 ligand delta-like 4
  • COUP-TF ovalbumin upstream promoter-TF
  • the Notch-Hey pathway induces ephrinB2 expression and blocks the expression of the corresponding receptor EphB4 in arterial ECs (AECs) whereas in vECs COUP-TFII mediates the opposite effect (Swift and Weinstein, 2009; You et al., 2005).
  • This ephrinB2-EphB4 differential expression establishes a polarity that assists in segregating arteries from veins down to the capillary level (Wang et al., 1998).
  • EC isolation and culture Commercial EC lines used: HAECs (Lonza, Barcelona, Spain; CatN°CC-2535), HCAECs (Lonza, CatN°CC-2585), HIAECs (ATCC, Barcelona, Spain; CatN° CRL-2475), HPAECs (ATCC, CatN° CRL-2598), HIVECs (ATCC, CatN° CRL-2606), and HPVECs (ATCC, CatN° CRL-2607). EC lines were cultured according to the provider's instructions.
  • HHAECs, HHVECs, HUVECs and HUAECs were isolated at the Clinica Universidad de Navarra (after obtaining informed consent) by perfusing the corresponding vessel with collagenase type I (Invitrogen, Carlsbad, CA). Harvested cells were cultured for 24 hours, washed to discard non-attached cells, grown until 100% confluence and split 1 :3 every 3-4 days.
  • ECs from umbilical arteries or veins were magnetically selected using anti-human CD34 magnetic beads (Miltenyi-Biotec, Madrid, Spain) and an AutoMACS magnetic selector (Miltenyi-Biotec) according to the manufacturer's instructions.
  • RNA isolation, quality control and qRT-PCR Total RNA from cell lysates was extracted using TRIzol® reagent or RLT lysis buffer (Qiagen). The RNA integrity/quality of the samples used for microarray hybridisation were determined with a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA). When necessary, mRNA was reverse transcribed using Superscript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and cDNA underwent 40 rounds of amplification on an ABI PRISM 7700 cycler (Perkin Elmer/Applied Biosystems, Foster City, CA) for standard quantitative Real-Time PCR as described in Example 3. Primer sequences are listed in Table 8.
  • mRNA levels were normalised using GAPDH as housekeeping gene. Data, expressed as mean ⁇ s.e.m. comparing two groups were analysed by Student's i-test. SPSS software was used for statistical analyses and differences were considered significant when P ⁇ 0.05.
  • RNA hybridisation of the 38 human EC samples was done in collaboration with the Department of Hematology, Hospital Universitario de Salamanca, using the Affymetrix HG-U133 Plus 2.0 GeneChip Oligonucleotide Microarray (Affymetrix, Santa Clara, CA, USA). All steps were carried out according to the manufacturer's protocol. 100 ng of RNA was amplified and 15 g of amplified and labeled cRNA was hybridised on the array. Arrays were scanned using a GeneChip Scanner 7G. Background correction and normalisation were done using the RMA (Robust Multichip Average) algorithm. The method for differential gene expression analysis was the one contained in the LIMMA Bioconductor package.
  • probes with a corrected P-value below 0.05 were selected.
  • a filtering process was applied first to eliminate probe sets with low expression values. Applying the criterion of an expression value greater than 32 in 5 samples for each experimental condition, 32,939 probe sets were selected for statistical analysis using the LIMMA Bioconductor package.
  • the obtained classifier required 78 probes. Functional and pathway enrichment analysis was done using Ingenuity Pathway Analysis software (Ingenuity Systems, Redwood City, CA, http://www.ingenuity.com). Time course analysis with TLDA. Taqman® Low Density Array (TLDA) plates with Taqman® primers for our described HUAECfresh/HUVECfresh fingerprint, previously described arteriovenous markers and some general endothelial markers were obtained from Applied Biosystems. HUAECfresh/HUVECfresh samples and samples from HUAECs and HUVECs cultured for 24 hours, 48 hours or 6 days were run on a 7900 HT fast real time PCR system (Applied Biosystems) and analysed according to the manufacturer's instructions.
  • TLDA Taqman® Low Density Array
  • RNA extracted using TRIzol® reagent was quantified and quality controlled with a Bioanalyser 2100 (Agilent Technologies) and samples were processed in collaboration with the VIB Nucleomics Core Facility. 100-500 ng of total RNA was hybridised according to the manufacturer's instructions.
  • Hierarchical clustering was used to cluster the individual gene expression profiles based on Pearson correlation and complete linkage. Immunofluorescence staining and Western blot. The procedure for IF staining was done on cord blood samples as described previously (Aranguren et al., 2007). Antibodies used were: Rabbit anti-human Rasgrf2 (Sigma, CatN 0 HPA018679), Alexa488-labelled mouse anti-human smooth muscle a-actin (Sigma, CatN° F3777), Rabbit anti-human Nr3c2 (Santa-Cruz, CatN° SC-1 1412) and goat anti- human Msx1 (R&D Systems, CatN° AF5045).
  • siRNA knockdown was performed using Silencer® Select pre-designed siRNA from Applied Biosystems for RBPJ (siRNA ID#: s7251 and s7253) or Negative Control 1 (siRNA ID#: am4636). Briefly, 2,500 HUAECs/cm 2 were cultured overnight. The next day, cells were transfected with 5 pmol siRNA mixed with 0.5 ⁇ of lipofectamine 2000 (Invitrogen) in 100 ⁇ of OPTI-MEM (Invitrogen). The day after transfection, media was replaced and cells were maintained for 6 days, with an additional siRNA transfection at day 3. The canonical Notch pathway was induced by immobilised DLL4 ligand activation.
  • DLL4-Fc (R&D Systems, CatN° 1389-D4) was incubated overnight at 4°C at 1 ⁇ g ml in 0.1 % gelatin 1 % BSA in PBS with gently shaking to allow its adsorption to the cell culture dish. The next day, DLL4-Fc coated plates were incubated at 37°C for 1 hour. Non-attached DLL4-Fc was removed by washing and 2,500 HUAECs/cm 2 were seeded and cultured for 72 hours.
  • the canonical Notch pathway was blocked by ⁇ -secretase inhibitor DAPT (Calbiochem, San Diego, CA, USA; CatN° 565784; alone or in combination with immobilised DLL4-Fc) at 3 ⁇ concentration.
  • DAPT ⁇ -secretase inhibitor
  • the lentiviral construct for overexpression of HEY2 was obtained from Genecopoeia (Rockville, USA; Table 10). Open reading frames (ORF) for MSX1 , EMX2, Prdm16, NKX2-3, Aff3 and TOX2 were cloned from cDNA (Open Biosystems) or total cDNA (BD) after the cytomegalovirus (CMV) promoter in pRRL2-CMV-PGK-Cherry ⁇ Figure 23 and Table 10).
  • the lentiviral construct for overexpression of SOX17 was kindly provided by C. Verfaillie (Stem Cell Institute, KU Leuven; Figure 23).
  • HEK293 cells were plated (5x10 6 cells/10 cm dish) and the next day transfected with the plasmid of interest together with two helper plasmids (psPax2 and PMD2G) using Fugene transfection reagent (Roche).
  • psPax2 and PMD2G helper plasmids
  • Fugene transfection reagent Fugene transfection reagent
  • 400 ⁇ of OPTIMEM was mixed with 1 ⁇ g PMD2G, 3 ⁇ g psPax2 and 4 ⁇ g lentiviral construction plasmid ⁇ Table 10).
  • 24 ⁇ of Fugene was added and the mixture was incubated for 20 min. at RT and gently applied to the cells. The next day, medium was replaced and lentiviral particle-containing supernatant was collected 36 hours later.
  • Viruses were concentrated by centrifugation using 50.000 MWCO Vivaspin(R) 20ml centrifugal concentrators (Sartorius Stedim). Transduced cells were kept for 6 days and collected into TRIzol® buffer. For long-term overexpression of HEY2 and Prdm16, transduced cells were cultured up to 28 days.
  • the culturing process rapidly erases differential arteriovenous gene expression
  • Hierarchical clustering analysis for the arteriovenous fresh profile showed a perfect separation of the 4 HUAEC-F and HUVEC-F samples, confirming a high degree of difference between the two EC subtypes ⁇ Figure 26 A).
  • the influence of the culture process on EC gene expression has been previously described for brain microvascular ECs, lymphatic ECs and venular ECs but not for AECs or large VECs.
  • canonical Notch signalling induces arterial specification during vascular development, by boosting the expression of AEC markers like ephrinB2, and blunting the expression of VEC markers like EphB4. Due to the silencing of the Notch target HEY2 in HUAEC-C compared to HUAEC-F ⁇ Figure 26, Table 12), we hypothesised that the canonical Notch pathway might be inactive in vitro, which could explain the loss of the arterial phenotype upon culture.
  • ligand binding to the Notch receptor induces ⁇ - secretase-mediated cleavage of the receptor, thereby releasing the Notch intracellular domain (NICD).
  • HEY1, HEY2 and EFNB2 expression could be reactivated in HUAEC-C by stimulation with the Notch-ligand DLL4, and this could be blocked again by DAPT treatment (Figure 28Bright, Figure 28 E).
  • DLL4-Fc anchored DLL4-Fc or bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • HUAEC-F-specific fingerprint contained 8 TFs (Figure 25D), only 2 of which were previously associated with arterial specification, i.e., HEY2 and SOX17 ( Table 11). Since canonical Notch pathway induction in HUAEC-C was not able to completely restore the arteriovenous fresh profile, some of the newly identified TFs might be important for arterial specification. To determine the role of the 8 TFs we attempted to convert HUVEC-C into cells with a HUAEC-Fexpression profile by overexpression of these factors.
  • Figure 29A-B Six days after transduction, we analysed expression of the genes within the arteriovenous fresh profile (Figure 29A-B), of markers previously reported to be enriched in AEC or VEC ( Figure 29C) and of general EC markers (Figure 29D).
  • Figure 29A shows the heat map analysis of the arteriovenous fresh profile for individual TFs or the combination of all 8 of them. More distant localisation from the cherry control sample indicates a stronger capacity of the TF (combination) to induce arterial specification.
  • the TF largely complemented each other for arteriovenous fingerprint regulation, although some of these blocks also overlapped (Figure 29B).
  • HEY2 contributed less robustly to arterial gene regulation (-22%; Table 14).
  • the hierarchical cluster analysis revealed a significant degree of complementarity between TFs, we also observed overlap, suggesting complex interactions. Therefore, we mapped these interactions in a network (Figure 31C). While some genes (e.g., APO, GRB14, ARL 15) were exclusively regulated by one TF, most genes were co-regulated by more than one TF (e.g. FAT1 was co-regulated by 6 TFs).
  • Atherosclerosis leading to ischemia, only affects arteries. Restoration of the perfusional defect mostly requires the expansion of arterial blood (i.e., oxygen) supply to the tissues affected by ischemia.
  • arterial blood i.e., oxygen
  • Current 'general' revascularisation strategies based on growth factors or stem cells have not taken into account this specific need for arterial supply and this may in part explain their limited clinical success (Conway and Carmeliet, 2004; Deng et al., 2006; Pearson, 2009).
  • the Matrigel plug implantation assay we used here is not a pathological model, the fact that we found a more elaborate and arterial-like vascular network (characterised by smooth muscle coating and collagen deposition) in the presence of cells overexpressing the 8 arterial TFs suggests that this overexpression strategy could improve the outcome of cell transplantation in clinically relevant animal models of arterial growth, such as limb ischemia.
  • increased insight in the arterial specification may provide new targets for specific growth factor therapy.
  • the arterialising TF combination that we identified, along with the arteriovenous signature can be used in different approaches.
  • endothelial progenitors e.g., blood outgrowth endothelial cells or BOECs
  • BOECs blood outgrowth endothelial cells
  • Another approach would be to use these arterialised BOECs to coat the inside of artificial vessel conduits to reduce their thrombogenicity when implanted in ischemic patients.
  • These cells could also be used as the endothelial component of a 'biological' arterial conduit consisting of an endothelial and smooth muscle cell layer.
  • Example 3 Identification and validation of Prdm16 as an important arterialising transcription factor acting in part upstream of Notch which induces an arterial endothelial-specific gene (and functional) signature in dedifferentiated cultured human umbilical vein endothelial cells (HUVECs) or blood outgrowth endothelial cells (BOECs)
  • HAVECs human umbilical vein endothelial cells
  • BOECs blood outgrowth endothelial cells
  • Prdm16 deficiency in both zebrafish and mice resulted in arterial vascular defects. Furthermore, the lack of a single Prdm16 allele in adult mice impaired their recovery from an ischemic insult, a process that requires expansion of pre-existing arterial collateral vessels.
  • Micro-array analysis of Prdm16-, Hey2-, or control (Cherry) lentivirus- treated endothelial progenitors (blood outgrowth endothelial cells or BOECs) revealed that Prdm16 also instructs ECs to adopt the murine arterial gene signature in a superior fashion than Hey2. These in vitro studies further demonstrated that Prdm16 induces many conserved arterial signature genes in BOECs.
  • Prdm16 ectopic Prdm16 overexpression resulted in a robust induction of many Notch components in both HUVECs and BOECs, raising the hypothesis that Prdm16 lies directly upstream of Notch during the arterial specification of ECs. Indeed, concomitant blocking of the canonical Notch pathway upon Prdm16 overexpression severely hampered or completely abolished the inductive effect of Prdm16 on key Notch pathway genes. Likewise, Prdm16 was able to induce several conserved arterial-specific genes, including Gja5 and Dkk2 in the presence of DMSO, but not DAPT. Intriguingly, treatment with DAPT only partially blunted the arterialising effect of Prdm16.
  • Prdm16 and notch genetically interact during arterial development in zebrafish were induced the expression of semaphorin 3C and - to a lesser extent - semaphorin 3G, known to be attractants for smooth muscle cells (SMCs). Accordingly, SMC coating of arteries of Prdm 76-deficient embryos was strongly reduced.
  • Prdm16 induced a specific function of arterial ECs, i.e. SMC attraction. Therefore, our data indicate for the first time a role for Prdm16 in the establishment of an arterial gene and functional signature in ECs, in part by acting directly upstream of Notch.
  • Prdm 16 is a member of a large family of factors characterised by a PR domain at their N-terminal side. In humans, 17 members of the Prdm family have been identified, and 15 members in mice. Given the fact that members of the Prdm family control processes such as cell commitment, differentiation, growth and apoptosis, it is not surprising that Prdm proteins play important roles during bidirectional cell fate decisions. Perhaps this is reflected by their highly specific expression profiles. Indeed, Prdm members are generally expressed in a cell type- and tissue-specific manner.
  • Prdm16 for instance, is highly enriched in brown adipose tissue (BAT), while its expression is absent in white adipose tissue (WAT) and induces browning of pre-adipocytes (Seale et al., 2007).
  • BAT brown adipose tissue
  • WAT white adipose tissue
  • Prdm family members can regulate gene expression according to different mechanisms. First, they can cause epigenetic changes in gene expression profiles, depending or not on their intrinsic histone methyltransferase capacity. Secondly, Prdm molecules also have DNA-binding capacities, through their Zn-finger domains.
  • Prdm molecules may regulate gene expression independent of their DNA binding capacity by complexing with other DNA-binding molecules.
  • Prdm16 for instance can form transcriptional complexes with C-terminal binding proteins (CtBPs) and peroxisome proliferator-activated receptor gamma co- activator 1 (PGC1 ) in adipose tissue. Both are in direct competition with each other to bind Prdm16 and define whether Prdm16 acts as a transcriptional repressor or activator (Kajimura et al., 2008; Seale et al., 2007).
  • CtBPs C-terminal binding proteins
  • POC1 peroxisome proliferator-activated receptor gamma co- activator 1
  • Prdm family members While several Prdm family members have been described in bidirectional cell fate decisions, none, with the exception of Prdm6, has been described to play a role in the vasculature in general, nor in the establishment of endothelial specification in particular.
  • CtBP molecules interaction with CtBP molecules is a common feature of multiple Prdm family members and CtBPs have been implicated in vascular development since CtBP2 ⁇ / ⁇ mice display extraembryonic vascularisation defects.
  • mice The thoracic aorta and vena cava from Tie2-GFP mice (expressing GFP in the blood-vascular ECs or but not in lymphatic ECs (Motoike et al., 2000)) were dissected out and placed in ice-cold MCDB131 medium (Gibco). Excess fat and contaminating tissue around the vessels were removed and vessels were cut into smaller pieces before incubation in 1 X PBS (Gibco, pH 7.4) containing 2 mg/ml crude extract collagenase (Roche) at 37°C until fully dissociated.
  • 1 X PBS Gibco, pH 7.4
  • 1 mg/ml crude extract collagenase (Roche) at 37°C until fully dissociated.
  • tubes were repeatedly shaken, filtered through a 100 m nylon mesh (BD Biosciences), spun down (600 g, 7 min.), resuspended in PBS supplemented with 1 % BSA and run through a FACS AriaTM device (Beckton Dickinson) to separate the endothelial (GFP + ) from the non-endothelial (GFP " ) fraction.
  • BD Biosciences BD Biosciences
  • FACS AriaTM device Beckton Dickinson
  • RNA extraction To extract total RNA, 1 ml TRIzol® (Invitrogen) was added to the cells and stored at -80°C. After thawing, samples were vortexed and 200 ⁇ chloroform was added (Merck) prior to incubation for 10 min. at RT. The samples were centrifuged at full speed for 15 min., after which the upper transparent layer was taken off and transferred into a new Eppendorf tube. 500 ⁇ isopropanol (Merck) was added, 200 ⁇ 4 M LiCI (Merck) and 1 ⁇ glycogen (Invitrogen) was added and the samples were stored for at least 10 min. at RT.
  • TRIzol® Invitrogen
  • RNA samples 32 ⁇ of an RNA sample was mixed with 4 ⁇ random hexamer primers and 4 ⁇ 10 mM dNTP mix (Superscript III First Strand Kit). The sample was denatured for 5 min. at 65°C and cooled down for 2 min. at 4°C. Simultaneously, a solution of 8 ⁇ 10X RT buffer, 16 ⁇ MgCI 2 (25 mM), 8 ⁇ DTT (0.1 M), 6 ⁇ H 2 O, 1 ⁇ RNase OUT and 1 ⁇ SSIII reverse transcriptase (Superscript III First Strand Kit) was prepared. Subsequently, 40 ⁇ of the solution was added to each sample and the first cDNA synthesis cycle was started: 10 min. at 25°C, 50' min. at 50°C and 5 min. at 85°C. The samples were cooled down to 4°C and 1 ⁇ RNaseH was added prior to incubation for 20 min. at 37°C.
  • cDNA was subjected to PCR-based amplification and detected with a nonspecific fluorescent dye (SYBR green) which intercalates in the de novo formed double stranded DNA.
  • SYBR green nonspecific fluorescent dye
  • Each PCR reaction was performed by adding 1 ⁇ cDNA to 6 ⁇ SYBR green (Applied Biosystems), 4 ⁇ MQ water and 1 ⁇ primer mix (2.5 ⁇ forward and reverse primer; a primer list is provided in Table 15).
  • the polymerase reaction was performed on a Real-Time PCR system (Step One Plus, Applied Biosystems): 2 min. at 50°C, 10 min. at 95°C and subsequently 40 rounds of amplification at 95°C for 50 sec, each time followed by 45 sec. at 60°C.
  • GAPDH or ⁇ -actin were used as housekeeping genes to standardise for the total amount of cDNA in the samples.
  • Statistical analysis and data interpretation was performed in close collaboration with the University of Navarra, (Pamplona, Spain) and Integromics (Madrid, Spain).
  • RNA of ECs from 8-12 week-old mice was extracted (RNeasy minikit, Qiagen). The quality and purity of the RNA samples was analysed by the VIB Nucleomics Core facility with a Bioanalyser 2100 and validated by PCR analysis prior to further proceedings. 500 pg of RNA from 5 selected isolations per tissue was amplified, labeled with biotin and hybridised on a mouse genome-wide microarray (Affymetrics Mo Gene1 -0 ST array). The qualitative and statistical analysis of the microarray output was performed by the Nucleomics Core. The analysis was based on the RMA expression levels of the probe sets that had at least once a present MAS 5.0 detection call. Differential expression was assessed via the moderated f-statistic.
  • RNA from Prdm16-overexpressing, Hey2-overexpressing or Cherry control- overexpressing HUVECs was used for a comparative Nanostring experiment (which also included 6 additional TFs, as decribed in detail in Example 2).
  • RNA quality/concentration were determined with a Bioanalysisr 2100 (Agilent Technologies, Santa Clara, CA) and 100-500 ng of total RNA was hybridised, according to the manufacturers' instructions, in collaboration with the VIB Nucleomics Core Facility at KU Leuven. Some of the results were confirmed by qRT-PCR and for those genes for which the Nanostring probe intensity value was low, results were analysed by qRT-PCR.
  • WISH whole-mount in situ hybrydisation
  • Probe synthesis Primers were designed using Primer 3.0 software (http://frodo.wi.mit.edu/primer3/) to amplify a 601 bp long fragment of zebrafish prdm16. The following primers were used: 5 TGACCAGTGCCCCAAAG3' and 5'TTCTTTCCCTCGCAAAAGC3'. A cDNA sample containing a mix of cDNA derived from whole zebrafish (uniZF) was used as a scaffold for the PCR based amplification of prdm16.
  • RNA probe was purified added to hybridisation buffer (Hyb+) and stored at -20°C. From this stock concentration, a 1 :100 working concentration was used for performing WISH. WISH.
  • AB zebrafish embryos were collected at 24 and 48 hpf and fixed using Memfa fixative (1 M MOPS, 10 mM MgSO 4 and 20 mM EGTA) for 1 h on a shaker. Afterwards, the fixative was replaced by 100% EtOH. After a few minutes, fresh EtOH was added to the embryos for storage at -20°C.
  • embryos were directly submitted to WISH. First, embryos were rehydrated and rinsed three times with PBS-T (PBS containing 0.1 % Tween20). Afterwards, embryos were permeabilised with 1 X proteinase K in PBS-T for 15 min.
  • embryos were paraffin-embedded, cross-sectioned (7 ⁇ ) on a microtome (Leica) and counterstained with nuclear fast red (NFR). Briefly, slides were deparaffinised and placed into the NFR solution for 5-10 min.. Afterwards, slides were rinsed with MQ water, dehydrated and mounted with DPX. Cross-sections were examined on a Zeiss Axio Imager Z1 microscope. Production of wild-type and mutant Prdm16 expressing ientivirus
  • a pYX-Asc vector containing the full cDNA for mPrdm16 was purchased from Open Biosystems (clone ID 6409778).
  • mPrdm16 was subsequently amplified by means of PCR (primer list: see Table 10) using Phusion® Hot Start II DNA polymerase according to the manufacturers' protocol and cloned into a pRRL2-PGK-Cherry vector using Xbal and Xhol restriction enzymes. Plasmids were transformed and purified by miniprep. Correct insertion was confirmed by sequencing and maxipreps were made prior to lentiviral production.
  • HEK293 cells were plated (5x10 6 cells/10 cm dish) and the next day transfected with our plasmid of interest together with two helper plasmids (psPax2 and PMD2G) using Fugene transfection reagent (Roche).
  • psPax2 and PMD2G helper plasmids
  • Fugene transfection reagent Fugene transfection reagent
  • 400 ⁇ of OPTIMEM was mixed with 1 g PMD2G, 3 g psPax2 and 4 g pRRL2 plasmid.
  • 24 ⁇ of Fugene was added and the mixture was incubated for 20 min. at RT and gently applied to the cells. The next day, medium was replaced and lentiviral particle-containing supernatant was collected 36 h later.
  • Viruses were concentrated by centrifugation and used directly to transduce HUVECs/BOECs (or stored at -80°C).
  • the lentiviral construct for overexpression of HEY2 was obtained from Genecopoeia (Rockville, USA; Table 10).
  • E14.5 and E17.5 FvB embryos were dissected out, rinsed in RNA later and put in a 15 ml falcon tube to snap-freeze in liquid nitrogen.
  • Unfixed cryo-preserved embryos were sectioned (7 ⁇ ) on a cryostat (Leica, CM3000) and sections were stained for Prdm16. Therefore, air-dried sections were incubated with 4% paraformaldehyde (PFA) for 10 min. at 4°C, sections were washed with MQ water and three times with Tris-HCI-NaCI-Tween (TNT) before they were immersed in PBS-Tr (PBS with 0.1 % Triton-X) for 30 min..
  • PFA paraformaldehyde
  • the sections were blocked for 1 h with tris-NaCI-BMP buffer (TNB) containing 20% pre-immune donkey serum (PID; Sigma-Aldrich) and incubated overnight on a shaker with Sheep-anti-Prdm16 primary antibody (1 :20 in 20% PID/TNB; R&D Systems) at 4°C.
  • TNB tris-NaCI-BMP buffer
  • PID pre-immune donkey serum
  • PID pre-immune donkey serum
  • TNT buffer After washing three times with TNT buffer, the sections were incubated with secondary Donkey-anti- Sheep-Texas Red antibody (Jackson Laboratories; 1 :100) in TNB and FITC- conjugated anti-aSMA (Sigma; 1 :500) for 2 h at RT and once again washed three times with TNT before mounting with a glue (prolong gold) containing DAPI.
  • secondary Donkey-anti- Sheep-Texas Red antibody Jackson Laboratories; 1 :100
  • FITC- conjugated anti-aSMA Sigma
  • Sections were deparaffinised and subjected to antigen retrieval (based on a pH 6-citrate buffer) and microwave heating. Slides were washed three consecutive times with tris-buffered saline (TBS) prior to blocking with 10% pre-immune goat serum (PIG) in TNB for 1 h. In a next step, slides were incubated overnight with primary Ab against Coup-TFII (Perseus Proteomics; 1 :200) at 4°C.
  • TBS tris-buffered saline
  • PAG pre-immune goat serum
  • tissues were washed three times with PBS and post-fixed with 4% PFA for 2 h at RT. Tissues were washed multiple times and further processed for paraffin sectioning and nuclear fast red (NFR) staining.
  • NFR nuclear fast red
  • Knockdown of zPrdm16 was achieved by injecting Tg(kdr:eGFP) s843 zebrafish with a morpholino (Mo) at the one cell stage.
  • the prdm16 Mo is a 25 bp oligomer (purchased from GeneTools LLC; sequence 5'-3': ATATGCTGCCCAAGACTAGAAATAC) which complementary binds to the region containing the ATG start codon and thereby blocks translation.
  • the Mo was diluted in phenol red (resulting in a better contrast during and after injection) to obtain the correct Mo concentration.
  • the injection needle was calibrated at 5X magnification of a Sterna 2000-C microscope (Zeiss).
  • Dechorionated embryos were incubated in 0.3% Danieau water to which we added a final concentration of 12.5 ⁇ DAPT or an equal volume of DMSO.
  • Zebrafish embryos were screened for vascular defects at 48 hpf.
  • Tg(kdrl-eGFP) 3843 zebrafish with morpholinos targeting either prdm16 or grl or the combination of the latter two.
  • 10.8 ng prdm16 Mo or 3.6 ng grl Mo were injected alone or together.
  • Ns Mo was used to compensate for the differential amount of Mo between conditions.
  • a bolus injection of 14.4 ng ns Mo was used as a control.
  • mice Prior to surgery, mice were anaesthetised with 200 ⁇ of a (26:8:66) mixture of ketamin: xylazin: NaCI. During the surgery, mice were placed on a heating pad and the temperature was monitored to remain at 37°C. The fur of both hind limbs was removed by Veet® treatment. After making an incision to open the skin, the nerve was carefully dissociated from the femoral artery in the right upper limb. Subsequently, to induce femoral artery occlusion, two surgical clamps were placed onto the right femoral artery, one above and one below the branching point with the arteria caudalis femoralis.
  • the follow-up of the ischemic mice implied non-invasive monitoring of blood flow during recovery of the ischemic insult by Laser Doppler scanning.
  • This system scans a preselected area of the hind limb with a laser beam. When the laser beam hits red blood cells in motion, a sound wave is sent back to a detector in the scanning head. The intensity of this feedback signal is proportional to the amount of moving red blood cells (i.e., the blood flow) and is transformed into a colour code by the Lisca software, red representing high blood flow, blue/black representing low/no blood flow.
  • the left non-ligated limb was also scanned and used as an internal reference to calculate the relative perfusion in the ligated right limb.
  • Laser Doppler measurements were performed at day 3, 7, 10, 14 and 21 after surgery, under isoflurane anaesthesia and temperature monitored (37°C) conditions.
  • mice were sacrificed. Therefore, mice were sedated with a (26:8:66) mixture of ketamine: xylazine: NaCI.
  • the vessels were perfused (by inserting a needle into the apex (left ventricle) of the heart and making an incision in the right atrium) with adenosine to induce vasodilatation.
  • vessels were perfused with Zinc Fix (zinc formalin fixative) for 10 min.
  • the right adductor and gastrocnemius muscles were dissected out and placed in Zinc Fix overnight.
  • the next day after washing the tissues three times with MQ water, they were stored in 70% EtOH at 4°C until further histological processing.
  • HUVECs were obtained as described in Example 2. BOECs from peripheral blood or umbilical cord blood were obtained as described under Example 1. HUVECs or hBOECs were plated one day prior to transduction into a 24-well plate (25,000 cells/well). The next day, 0.5 to 10 ⁇ of virus (depending on the virus and the virus production) was added to the medium. The morning following transduction, medium was changed and cells were directly harvested 5 days later (6 days after transduction) on TRIzol® lysis buffer. RNA cDNA was made and analysed by qRT-PCR. Alternatively, we added 50 ⁇ DAPT or its solvent DMSO to the medium. For luciferase assays, cells were transduced as described above.
  • Firefly and Renilla luciferase activity were measured from 20 ⁇ of lysate according to the manufacturers' protocol using the Dual-Luciferase® Reporter Assay System (E1910) from Promega on a Microplate Luminometer LB 96V (EG&G Berthold).
  • Prdm16 has an arterial-exclusive expression pattern throughout evolution
  • the murine arteriovenous signature represented a completely novel set of 68 and 85 probe sets differentially expressed between mAECs and mVECs, corresponding to 65 arterial- and 62 venous-specific genes, respectively ⁇ Table 16).
  • COUP-TFII a TF known as the prime VEC denominator (You et a/., 2005) was significantly enriched in mVECs compared to mAECs.
  • COUP-TFII was not part of our human arteriovenous fingerprint, despite its differential expression pattern. This prompted us to evaluate more broadly the expression profile of all TFs differentially expressed between AECs and VECs of either human or murine origin, to avoid missing out on potentially strong candidates which could play pivotal roles in arteriovenous specification.
  • a summary of the average probe intensities of these TFs in both AECs and VECs from human and murine origin is listed in Table 17.
  • Prdm16 overexpression resulted in the significantly increased expression of a subset of genes (14 out of 48 detectable genes; -29%) preferentially expressed on mAECs.
  • Prdm16 significantly suppressed the expression of -31 % (15 out of 48 detectable genes) of the mVEC-specific genes in BOECs, while only enhancing the levels of -10% of these genes.
  • Prdm16 clearly induced an arterial shift in BOECs when considering the murine arteriovenous fingerprint.
  • HEY2 significantly upregulated or downregulated only a limited number of genes upon overexpression and none of these were part of the murine arteriovenous fingerprint. This further suggests that also for the murine arteriovenous fingerprint, Prdm16 was a stronger 'arterialiser' than the golden standard Hey2.
  • Prdm16, Hey2 and Coup-TFII were retained in this list.
  • several were previously associated with arteriovenous differentiation or arterial defects in mice or zebrafish (e.g. HEY2, GJA5 and PTPRJ) upon knockdown/knockout ⁇ Table 18).
  • this third fingerprint exhibits hallmarks of a conserved signature that defines the arterial or venous identity of ECs across species. Therefore, we took this third list as our read-out for mechanistic studies discussed below.
  • HEY2 for arterial ECs
  • NR2F2 also known as COUP-TFII; for venous ECs
  • PRDM16 staining confirmed the presence of human PRDM16 protein on HUAECs, while absent on HUVECs ⁇ Figure 35C,D).
  • Prdm16 protein expression taking advantage of Prdm16 +/ ⁇ mice carrying one allele in which the ⁇ - galactosidase gene was knocked-in into the Prdm16 locus.
  • 5-bromo-4-chloro-3- indolyl- -D-galactosidase (X-gal) stainings revealed clear Prdm16 expression in the arterial endothelium of E10.5 embryos, including in the DA and the vitelline artery ⁇ Figure 35E.F).
  • Prdm16 immunofluorescence staining using a commercially available antibody confirmed our findings on later developmental stages: at E14.5, Prdm16 was readily detected in the endothelium of intercostal arteries and the jugular artery, while it was absent in their venous counterparts ⁇ Figure 35G,H). Similarly, at E17.5, ECs from coronary arteries, but not coronary veins stained for Prdm16 ⁇ Figure 35I,J).
  • Prdm16 +/ ⁇ mice confirmed the persistent exclusive arterial expression profile of Prdm16 ⁇ Figure 35K-M).
  • the expression of Prdm16 is restricted to the arterial branch of the vasculature in both humans and mice from early development through adulthood.
  • Prdm16 was not only detected on AECs, but was also frequently found on arterial SMCs (Figure 35G,H).
  • Prdm16 displays an arterial exclusive expression pattern in the zebrafish, murine and human vasculature. Prdm16 deficiency causes severe (arterial) vascular defects in zebrafish and mice
  • Prdm16 deficiency in zebrafish results in (arterial) vascular defects
  • Prdm16 is a likely candidate to act during arteriovenous cell fate decisions
  • eGFP + ECs from prdm16 Mo-treated embryos did not have elevated levels of the venous marker coup-tfll (data not shown).
  • WISH for dll4, efnb2a and gri did however not reveal a mispatterned expression profile as none of these genes showed ectopic expression on the PCV or a reduced arterial expression.
  • WISH for the venous marker coup-tfll also did not reveal an aberrant expression pattern (data not shown).
  • Prdm16 deficiency in mice results in (arterial) vascular defects
  • Prdm 76-deficient mice might have impaired vascular recovery upon an ischemic insult.
  • Prdm16 ' mice do not survive beyond birth, we therefore submitted Prdm16 +/+ and Prdm16 +/ ⁇ mice to a model of moderate limb ischemia - also known as intermittent claudication, as the recovery of such an ischemic insult is highly dependent on the expansion of native arterial collaterals, in a process termed adaptive arteriogenesis.
  • Prdm16 induces an arterial phenotype in ECs in part through canonical Notch
  • Prdm16 and Hey 2 co-regulate multiple arterial-specific genes
  • Prdm16 and Hey2 not only act in a parallel fashion to direct ECs towards an arterial phenotype, they also co-regulate part of the arterial signature.
  • Prdm16 activates Hey1/2 and their downstream target ephrinB2
  • Prdm16 in HUVECs resulted in a robust induction of key canonical Notch pathway related members, including DLL4, HEY1 and HEY2 ([fold upregulation Prdm 16 versus Cherry]: 10.6 ⁇ 3.4; P ⁇ 0.05 for DLL4, 6.8 ⁇ 1 .3; P ⁇ 0.01 for HEY1; 4.5 ⁇ 1 .1 ; PO.05 for HEY2).
  • Prdm16 lies directly upstream of canonical Notch during arterial differentiation
  • Prdm16 enhances RBPJK 'S transcriptional activity
  • Prdm16 would act at least in part through canonical Notch signalling, its ability to induce the Notch ligand DLL4, the Notch downstream effectors HEY1/2 and the Notch downstream target EFNB2 should be attenuated by addition of a ⁇ - secretase inhibitor, such as DAPT.
  • a ⁇ - secretase inhibitor such as DAPT.
  • prdm16 deficiency does not lead to reduced Notch signalling or diminished expression of key Notch effectors, such as grl, despite the strong induction of Notch pathway genes upon ectopic Prdm16 expression in vitro. Most likely, other Prdm family members compensate for the loss of Prdm16.
  • DAPT induces aortic abnormalities in prdm16 Mo, but not ns Mo-treated zebrafish
  • Prdm 16-m edia ted arterialisation is partially dependent on its interaction with CtBPs and DNA
  • the Prdm16-mediated arterial shift requires CtBP and DNA binding
  • Prdm164CfBP but not Prdm164D/V/A, displayed lower inductive activity on DII4 expression levels compared to WT Prdm16 ([fold upregulation versus Cherry]: 5.1 ⁇ 2.0 for WT Prdm16, 1 .7 ⁇ 0.4; for Prdm164CfBP, 4.4 ⁇ 2.0 for Prdm164D/V/3 ⁇ 4).
  • Prdm16 must interact with CtBP and DNA to establish part of its arterial ising effect.
  • Analogous to the previous section we assayed the Prdm16 mutants and their WT equivalent for their capacity to induce canonical Notch signalling, using the RBPJK- luc reporter virus as a read-out.
  • Prdm16 was able to strongly activate canonical Notch signalling, the mutants did so to a far lesser extent (Figure 49).
  • Prdm16-mediated canonical Notch signalling is dependent on its interaction with CtBP and DNA. Prdm16 leads the way to proper arterial SMC coating
  • Prdm16 Since semaphorins act as guidance molecules for migrating SMCs, as was already described for Sema3G, Prdm16 might specifically instruct arterial ECs to secrete these molecules to attract multiple layers of SMCs, explaining our in vivo phenotype of deficient arterial SMC coating in Prdm16 knockout embryos ( Figure SOB). Hence, Prdm16 defines both the molecular and functional identity of arterial endothelial cells.
  • Prdm16 is a key determinant of the arterial identity of ECs, by regulating a conserved set of genes in addition to the regulation of a species-specific set of genes.
  • the arterialising capacity of Prdm16 was superior to that of the current 'golden standard' Hey2.
  • Prdm16 might directly activate the expression of the Notch ligand DII4, thereby triggering the release of NICD, which will ultimately lead to the induction of Notch target genes HEY1/2.
  • the DNA binding deficient mutant of Prdm16 fails to induce the expression levels of HEY1/2 to the same extent as its WT variant, despite comparable DLL4 expression levels between these two variants.
  • Prdm16 might bind CtBP proteins, thereby converting the RBPJK-complex from an inhibitory to an activating state, similar to the function of NICD.
  • both Prdm16-CtBP and NICD could be necessary for full activation of the RBPJK complex.
  • Prdm16 could merely sequester CtBP, thereby releasing it from the RBPJK-complex and hence augmenting endogenous Hey1/2 levels. However, if this would be the case, inhibiting CtBP1/2 via small interfering RNAs would result in elevated levels of Hey1/2 in BOECs, a finding we did not observe. Moreover, adding DAPT to Prdm16-treated BOECs severely attenuated or nearly abolished the induction of Hey1/2, indicating that Prdm16 does not just act as a permissive factor by sequestering CtBPs, but actively drives Hey1/2 expression. Finally, Prdm16 is one of the few Prdm family members with intrinsic methyltransferase activity.
  • Prdm16 might induce methylation and thus alter the transcriptional activity of the loci poised with binding sites for the Prdm16 complex.
  • Endo et al. reported that the binary switches instructed by hamlet occur in a methylation-dependent fashion: hamlet binds to RBPJK binding sites and trimethylates H3K27, while preventing trimethylation of H3K4.
  • Hamlet also increases histone H3 levels, all hallmarks of a dense chromatin structure, not compatible with active transcription.
  • Prdm16 histone acetyltransferases ⁇ e.g., HDACs
  • HDACs histone acetyltransferases
  • Prdm16 might have non-histone post-transcriptional targets. Nevertheless, further studies are warranted to pinpoint the exact mechanism via which Prdm16 induces canonical Notch activity. Altogether, Prdm16 is a main orchestrator of the arterial molecular and functional fingerprint. Thus, Prdm16 could be used as a novel therapeutic target in vascular therapies.
  • FIGURE 1 provides a chart which presents a schematic summary of an embodiment of the invention' and of the examples.
  • Example 1 relates to studies on the establishment of microvascular EC gene and reference signatures and on the use of TF (combinations) to induce a heart EC-specific target cell.
  • Example 2 relates to studies on the establishment of macrovascular EC gene and reference signatures and on the use of TF (combination)s to induce an arterial EC-specific target cell.
  • Example 3 relates to studies validating one of the 8 arterial TFs, i.e., Prdm16, discovered in the studies related to Example 2.
  • FIGURE 2 displays the lentiviral maps for overexpression of Tcf15. EBF3. PPARy. and WT1. A-E.
  • FIG. 1 Schematic circular plasmid maps of the Cherry control vector (panel A; without insertion of a gene in the multiple cloning site or MCS) or constructs containing the open reading frame of murine Tcf15 (mTcf15; panel B), human EBF3 (hEBF3; panel C), human PPARy ⁇ hPPARy panel D) and human Wilms tumour 1 (hWT1; panel E) inserted in the MCS.
  • Expression of the Cherry reporter gene is driven by the phosphoglycerate kinase (PGK) promoter while expression of the inserted transcription factor gene is driven by the cytomegalovirus (CMV) promoter.
  • PGK phosphoglycerate kinase
  • CMV cytomegalovirus
  • FIGURE 3 displays the microarray results and validation.
  • A Representative FACS plots of heart homogenates from Tie2-GFP mice showing gate (G1 ) setting for sorting of GFP + endothelial cells (ECs) and G1 analysis revealing -99% purity for EC marker CD31 and -96% for microvascular EC marker CD36, and negligible contamination ( ⁇ 1 %) with hematopoietic cells (expressing CD45).
  • B. Microarray heat map and principal component analysis of heart EC, liver EC and brain EC samples. For the heat map dark grey represents a high degree of similarity in gene expression profile between the matching samples on the two axes of the plot; light grey represents a low degree of similarity.
  • C Representative FACS plots of heart homogenates from Tie2-GFP mice showing gate (G1 ) setting for sorting of GFP + endothelial cells (ECs) and G1 analysis revealing -99% purity for EC marker CD31 and -96% for microvascular EC marker CD36,
  • Venn diagramme representing the genes differentially expressed in the three vascular beds studied.
  • D Representative plot of microarray probe intensities for EC markers and markers of potential contaminant cell types for a single EC preparation from brain, heart and liver.
  • E The diagram shows the proportions of microarray probe intensities for known vascular bed-specific markers for each of the three vascular beds. Data represent mean ⁇ s.e.m.; * P ⁇ 0.05 versus corresponding specific organ and a minimum 4-fold difference and Log 2 probe intensity >6.
  • FIGURE 4. provides a graphic display on the sic/nature cross-validation versus the non-EC fraction of murine organs.
  • B Validation of a selected subset of the murine liver EC signature: transcription factors and genes most differentially expressed according to the microarray versus heart ECs and brain ECs for a total number of 30 genes.
  • C Validation of the murine heart EC signature.
  • FIGURE 6 provides graphics related to the expanded expression analysis of the heart EC signature in additional tissues revealing that the signature was very similar to that of other metabically active tissues (i.e., brown adipose tissue, white adipose tisse and skeletal muscle; panel A), but very different from other tissues (i.e., lung, pancreas and kidney; panel B).
  • FIGURE 7 provides a graphic display of the mRNA expression determined by qRT- PCR of genes of the heart EC fingerprint in human (h) heart, brain or liver ECs relative to human heart ECs, revealing that part of the signature is also enriched in human heart ECs versus brain and liver ECs.
  • FIGURE 8 displays the heart EC signature analysis in cultured ECs from human biopsies.
  • A Schematic representation of isolation and culture of ECs from human biopsies with subsequent sorting set-up to have a pure Tie2 + :Podoplanin " (non- lymphatic) population.
  • Right heart ECs in culture uniformly stained for the EC marker VE-Cadherin, DAPI was used as nuclear counterstain.
  • FIGURE 9 provides pictures that demonstrate the validation of the heart EC- specific TFs at protein level.
  • B Murine heart, brain and liver tissue cross-sections stained for Meox2, and Tcf15 and co-stained for an EC marker (BS-I lectin for brain and heart, CD105 for liver; DAPI was used as nuclear counterstain). Arrowheads indicate nuclei positively stained for the corresponding TF. Scale bars correspond to 20 ⁇ .
  • FIGURE 10 provides graphics on the effect of TF overexpression on the heart EC signature in cultured human heart ECs.
  • Two of the 31 signature genes were not included, i.e., Klra9 and Klra10, as there is no human equivalent.
  • A Overexpression of MEOX2, Tcf15 or MEOX2/Tcf15versus Cherry.
  • B Overexpression of MEOX2/Tcf15, EBF3 or MEOX2/Tcf15/EBF3 versus Cherry.
  • C Overexpression of MEOX2/Tcf15,PPARG or MEOX2/Tcf15/PPARGversus Cherry (in all experiments where PPARG was overexpressed, an agonist, rosiglitazone, was added at 10 ⁇ ).
  • D Overexpression of MEOX2/Tcf15/PPARG , WT1 or MEOX2/Tcf15/PPARG/WT1 versus Cherry.
  • E Western blots for ZDHHC2, RBP7 and TIMP4 in cultured human heart ECs transduced with Cherry or MEOX2/Tcf15/PPARG. a-TUBULIN was used as loading control.
  • FIGURE 11 provides photographs on the fatty acid uptake in cultured heart ECs overexpressing TFs.
  • A Fluorescence micrographs of cultured human heart ECs transduced with Cherry, WT1 (W), PPARG (P), MEOX2/Tcf15 (MT), MEOX2/Tcf15/PPARG (MTP) or MEOX2/Tcf15/PPARG/WT1 (MTPW) exposed to BODIPY-palmitic acid (PA; green), counterstained with DAPI for nuclei (blue). An excess (10X) of non-labeled PA was added in a competition assay.
  • FIGURE 14 provides a graphic display on the analysis of genes outside the heart EC fingerprint in Meox2 +/ ⁇ :Tcf15 +/ ⁇ mice.
  • mRNA expression determined by qRT-PCR of liver sinusoidal (LS)EC markers in liver ECs sorted from Meox2 +/ ⁇ , Tcf15 +/ ⁇ , or Meox2 +/ ⁇ :Tcf15 +/ ⁇ littermates relative to Wild-type heart ECs (n 4-8) revealing no significant differences in expression. Data represent mean ⁇ s.e.m.
  • FIGURE 15 provides a graphic display of the expression levels of fatty acid and glucose transporter genes in heart, brain and liver ECs.
  • the graph shows Log 2 probe set intensity in heart, brain and liver ECs.
  • FIGURE 16 provides a graphic display of the expression levels of fatty acid and glucose transporters in Meox2 +/ ⁇ , Tcf15 +/ ⁇ mice ⁇ .
  • FIGURE 17 provides graphic displays showing the lack of effect of Meox2/Tcf15 heterozygous deficiency on FA uptake in cardiomyocytes.
  • B Representative fluorescence micrographs of cultured cardiomyocytes from Wild- type or Meox2 +/ ⁇ :Tcf15 +/ ⁇ littermates exposed to BODIPY-palmitic acid (PA; in green), counterstained with DAPI for nuclei (in blue), revealing no differences in PA uptake between genotypes. An excess (10X) of non-labelled PA was used as competition assay. Quantitative data represent mean ⁇ s.e.m.
  • FIGURE 18 provides a graphic display of the in vivo uptake of fatty acids and glucose in Meox2 +/ ⁇ :Tcf15 +/ ⁇ mice.
  • FIGURE 19 provides graphic displays related to the heart phenotype and function of young adult Meox2 +/ ⁇ :Tcf15 +/ ⁇ mice.
  • FIGURE 20 provides graphic displays related to the heart phenotype and funtion of aged adult Meox2 +/ ⁇ :Tcf15 +/ ⁇ mice .All histological data are relative to Meox2 +/+ :Tcf15 +/+ or Meox2 +/ ⁇ : Tcf 15 +/ ⁇ hearts from 1 1 months-old male mice.
  • A. Oil Red-O staining and relative quantification revealing a significant reduction in fat accumulation in cardiomyocytes upon Meox2/Tcf15 heterozygous deficiency (A/ 3; * P ⁇ 0.05), scale bar 20 ⁇ .
  • FIGURE 21 displays a schematic summary of the findings in Example 1.
  • Meox2 and Tcf15 together regulate the balance between fatty acid (FA) and glucose uptake by orchestrating the expression of multiple signature genes, encoding membranous or intracellular regulators of FA transport, supporting the preferential use of FAs as a source of energy production in cardiomyocytes.
  • Combined Meox2/Tcf15 heterozygous deficiency results in downregulation of these genes and an increase in Glutl, together causing a shift to higher glucose and lower FA delivery to cardiomyocytes. This combined deficiency in the long run causes fibrosis and systolic dysfunction.
  • Lpl lipoprotein lipase
  • FAPB fatty acid binding protein
  • HSPG heparan sulphate proteoglycans
  • Glutl glucose transporter 1
  • Alb albumin
  • VLDL very low density lipoprotein
  • CM chylomicron.
  • FIGURE 22 displays a graphical display of the purity of EC preparations from human umbilical cord. FACS analysis of freshly MACS column-sorted HUAEC (A) or HUVEC (B) revealing only minimal ( ⁇ 1 % in both cell populations) contamination with CD45 + blood or inflammatory cells and high purity (> 97% in both cell populations) for CD31 + and CD34 + endothelial cells.
  • FIGURE 23 displays the lentiviral maps for overexpression of the arterial TFs.
  • A-G Schematic circular plasmid maps of the Cherry control vector (panel A; without insertion of a gene in the multiple cloning site or MCS) or constructs containing the open reading frame of murine Aff3 (mAff3; panel B), human MSX1 (hMSX1; panel C), human EMX2 (hEMX2; panel D), human NKX2-3 (hNKX2-3; panel E), human 70X2 (hTOX2; panel F), or murine Prdm16 (mPrdm16; panel G) inserted in the MCS of the pRRL2 backbone.
  • Cherry reporter gene is driven by the phosphoglycerate kinase (PGK) promoter while expression of the inserted transcription factor gene is driven by the cytomegalovirus (CMV) promoter.
  • PGK phosphoglycerate kinase
  • CMV cytomegalovirus
  • FIGURE 24 provides a graphic display of how the cell culture process assimilates arterial and venous endothelial cells.
  • Hierarchical clustering analysis of all 38 endothelial cell (EC) samples for all 102 probes reveals that freshly isolated cells (on the left) cluster according to their venous or arterial origin, while for cultured cell types (on the right) the clustering does not classify the sample groups correctly, suggesting that the differences in expression profile have been largely erased.
  • Arterial cell types are represented by a red colour while venous cell types are represented by a blue colour in the colour bar below. The colour code for expression levels is displayed on top.
  • HUAEC human umbilical artery EC
  • HUVEC human umbilical vein EC
  • HPVEC human pulmonary vein EC
  • HHAEC human hepatic artery EC
  • HHVEC human hepatic vein EC
  • HIVEC human iliac vein EC
  • HCAEC human coronary artery EC
  • HAEC human aortic EC
  • HPAEC human pulmonary artery EC
  • H IAEC human iliac artery EC
  • NA not assigned.
  • FIGURE 25 provides photographs and graphics on the genome-wide analysis of freshly isolated HUVECs and HUAECs.
  • Other displayed names correspond to the most differentially expressed genes in each part of the diagram.
  • FIGURE 26 displays how the culturing process rapidly erases differential arteriovenous gene expression.
  • A Hierarchical clustering analysis for freshly isolated or cultured HUAEC (red) or HUVEC (blue) revealing that for fresh samples replicates of each cell type tightly cluster together and both clusters are nicely separated. For cultured samples, incorrect clustering occurred.
  • B Diagram representing the probe set intensity difference between HUVEC and HUAEC for each gene of the arteriovenous fresh profile (showing arterial genes (A) on the left and venous genes (V) on the right) for cultured (filled diamond) or freshly isolated (open triangles) cells, revealing only minor differences in cultured cells.
  • C
  • A arterial
  • V venous
  • Panel C represents expression levels after 48 hours of culture (open red circles) relative to those after 24 hours of culture (filled black diamonds).
  • Panel B represents expression levels after 24 hours of culture (filled blue diamonds) relative to those in freshly isolated HUVEC (open black triangles).
  • Panel D represents expression levels after 48 hours of culture (open blue circles) relative to those after 24 hours of culture (filled black diamonds).
  • Panel F represents expression levels after 6 days of culture (filled blue squares) relative to those after 48 hours of culture (open black circles).
  • FIGURE 28 provides a display of how reactivation of Notch signalling only partially restores arterial gene expression in HUAEC-C.
  • A-B Schematic diagrams showing 4 numbered consecutive steps during normal canonical Notch signalling/ ' n vivo (A) or under several experimental conditions in vitro (B), i.e. in the presence of DAPT (left), siRNA against RBPJ (middle) or Delta-like (DLL)4-Fc anchored to the cell culture dish (right).
  • FIGURE 29 provides a graphic display of how combined overexpression of eight transcription factors robustly induces the arteriovenous fresh profile in HUVEC-C.
  • Red colour in the bar on the left represents an arterial gene, while the blue colour represents a venous gene. While almost all the genes are expressed at low levels (in green) in the cherry control condition, each of the individual transcription factors, except for Aff3, upregulated a subset of (mostly arterial) genes in a largely complementary but in some cases overlapping fashion. As expected from the complementarity, the 8 transcription factors together induce the majority of the (arterial) genes.
  • C,D Diagrams representing expression for classical arterial (C, left) or venous (C, right) or general endothelial (D) markers in cultured HUVEC transduced with cherry control virus (white) or all 8 transcription factor-expressing lentiviruses ('ALL TF') relative to cherry control.
  • FIGURE 30 provides a graphic representation of how TFs can induce long-term expression of the arterial gene profile.
  • Diagram representing the expression of selected genes of the fingerprint upon long-term overexpression of transcription factors Prdm16 and Hey2, respectively (data are presented as mean ⁇ s.e.m.; N 3). Although some variation across time is present, transduced cells acquire and maintain TF-dependent gene expression for up to 1 month.
  • FIGURE 31 provides a graphic representation of how individual transcription factors interact in a complex network to regulate the arteriovenous fresh profile.
  • A,B- Pie diagrams representing the proportion of arterial (A) or venous (B) genes of the arteriovenous fresh profile regulated by 0 (blue), 1 (purple), 2 (orange), 3 (green) or more than 3 (beige) transcription factors (TF). Corresponding absolute numbers are listed in the table on the right of the panel.
  • C To summarise all information on the effect of transcription factor overexpression on the arteriovenous fresh profile, we composed an interaction network of the 8 transcription factors and the arteriovenous fresh profile. Since Aff3 did not regulate any gene of the signature, nor was it regulated by the other transcription factors, it is not included in the network.
  • Each transcription factor hub (represented by rounded boxes) is drawn in a different colour and interactions originating from each hub are shown by arrows (induction) or vertical lines (inhibition) in the corresponding colour.
  • Genes are assigned to the hubs according to the transcription factor by which they were most strongly regulated. For those genes exclusively regulated by 1 transcription factor the box of that gene is drawn in dark colour, whereas for genes that are regulated by more than one transcription factor the box is drawn in light colour.
  • Transcription factors are in oval boxes, arterial genes are in rectangular boxes with full line and venous genes in rectangular boxes with dashed lines.
  • FIGURE 32 displays the effect of the 8 TFs on HUVECs in an in vivo Matrigel plug implantation assay system.
  • A Ex vivo explant and (B) cryosections showing more elaborate Cherry + vascular structures (white arrows) upon overexpression of the 8 arterial TFs.
  • C Cryosections stained with smooth muscle a-actin, and the corresponding quantification (right panel), showing a higher % of smooth muscle-coated Cherry + vessels in Matrigels with the 8 TF-transduced HUVECs.
  • FIGURE 33 displays the conserved arteriovenous fingerprint between human and murine EC samples.
  • FIGURE 34 displays microarray results for the conserved arteriovenous sic/nature in Prdm16 overexpressing BOECs, HEY2 overexpressing BOECs or siNR2F2- treated HUVECs.
  • siNR2F2 treatment of HUVECs resulted in a strong induction of multiple arterial genes (dark grey) compared to a non-silencing siRNA (siNS). However, only half of the venous- specific genes (light grey) were inhibited by siNR2F2 treatment.
  • Figure 35 displays the validation of the arterial-exclusive expression pattern of Prdm16 across species at different developmental stapes.
  • A qRT-PCR demonstrating the arterial enrichment for HEY2 and PRDM16 in HUAECs versus HUVECs.
  • Prdm16 staining (grey) on E14.5 embryos indicating its presence on intercostal arteries and the carotid artery (white asterisks in G,H). Conversely, Prdm16 was not detected on ECs from intercostal veins or the carotid vein (white arrows in G,H). Slides were counterstained with a-SMC-actin in white. I,J. Prdm16 immunofluorescence staining on an E17.5 embryo visualising its presence on coronary AECs (white asterisks in J), but not on coronary VECs (white arrows in /). K,L.
  • X-gal staining (dark grey) on adult tissues: Prdm16 is expressed on ECs from the aorta (black asterisks in K), but not the vena cava (black arrows in L). M. X-gal staining on Prdm16 +/+ aorta demonstrating the specificity of the staining as X-gal could not be detected on aortic ECs of a Prdm16 +/+ mouse (black asterisks). Scale bars: 50 ⁇ in E, E', E", F, F', F",G, I and J and 100 ⁇ in C, D, H, K, L and M. * P ⁇ 0.05 versus VECs.
  • FIGURE 36 displays the Prdm16 expression profile and knockdown phenotype in Tg(kdr-eGFP) 5843 zebrafish.
  • WISH whole-mount in situ hybridisation
  • WISH shows prdm16 expression (dark grey) in the dorsal aorta (DA; arrowheads), but not in the posterior cardinal vein (PCV).
  • Panel C shows a cross-section of an embryo stained for prdm16 RNA by WISH. Inset in C zooms in on the region of the DA and PCV, revealing prmd16 expression in the DA, but not in the PCV.
  • D,E Confocal images of Tg(kdr- eGFPf 843 zebrafish at 48 hpf, injected either with non-silencing (D) morpholino (ns Mo) or prdm16 Mo (E).
  • Prdm16 morphants show a clear vascular phenotype, characterised by impaired formation of the dorsal longitudinal anastomotic vessel (DLAV) and improperly formed or absent intersomitic vessels (ISVs, indicated by arrowheads).
  • DLAV dorsal longitudinal anastomotic vessel
  • ISVs intersomitic vessels
  • D',E' Higher magnification of the images in D,E.
  • F Quantification of the ISV developmental defects in ns Mo and prdm16 Mo-treated embryos, expressed as the percentage of embryos showing either normal (white), abnormal (grey) or abolished (black) ISV formation. Numbers of embryos analysed are mentioned in the bar graphs. Scale bars represent: 80 ⁇ in B, 40 ⁇ in C, 100 ⁇ in D,E and 200 ⁇ in D',E'. **** P ⁇ 0.0001 versus ns Mo.
  • FIGURE 37 displays Prdm16 - " mouse embryos with haemorrhages and signs of reduced SMC coverage.
  • A Schematic drawing of an E14.5 embryo, highlighting the region of interest in these embryos. Inset corresponds to region shown in ⁇ B,C).
  • B,C Haematoxylin&Eosin (H&E) staining of Prdm16 +/+ ⁇ A) or Prdm16 ' (B) embryonic day (E)14.5 embryos showing severe bleedings (dotted area in (C) in the Prdm16 ' mice.
  • H&E Haematoxylin&Eosin
  • FIGURE 38 displays Prdm16 + " mice with impaired perfusional recovery upon limb ischemia.
  • B,C
  • FIGURE 39 displays Prdml 6 + " mice with macroscopic signs of necrosis upon limb ischemia.
  • B,C Representative images of the ischemic paw of a Prdml 6 +/+ (B) or Prdm16 +/ ⁇ (C) mouse 7 days after ligation, demonstrating necrotic digits (arrows in C) and signs of inflammation in Prdm16 +/ ⁇ , but not Prdm16 +/+ mice (compare brackets in B and C).
  • FIGURE 40 displays Prdml 6 + " mice with increased fibrosis in ischemic hind limbs compared to their Prdml 6 +l+ littermates.
  • grey fibrosis
  • FIGURE 41 shows how ectopic Prdml 6 drives the onset of multiple Notch pathway penes.
  • A qRT-PCR showing the relative expression levels of several Notch-related genes in HUVECs treated with Prdml 6 lentivirus (black bars) or a control (Cherry; white bars) virus, demonstrating clear upregulation of DLL4, HEY1, HEY2 and EFNB2 upon ectopic Prdm16 expression.
  • Prdm16 had no effect on the expression of the venous markers EPHB4 and COUP-TFII, but was able to suppress NRP2.
  • FIGURE 42 shows how Prdm16 induces canonical Notch signalling in vitro.
  • BOECs were transduced with a Renilla control virus and an RBPJK-luciferase (RBPJK-IUC) reporter virus alone (white bar) or in combination with either a control (Cherry; grey bar) or Prdm 76-encoding lentivirus (black bar).
  • FIGURE 43 shows how Prdm16 activates the canonical Notch pathway.
  • BOECs were treated with a control (Cherry, white bars) or a Prdm16-containing (black bars) lentivirus in the presence of the canonical Notch inhibitor DAPT, or its control DMSO.
  • qRT-PCR analysis revealed that Prdm16-mediated induction of the Notch ligand DLL4 (A) and the Notch downstream target EFNB2 (D) was completely abolished in the presence of DAPT, but not DMSO.
  • Prdm16 induces HEY1 (B) and HEY2 (C) in the presence of DMSO, while its effect on the latter two Notch effector genes was severely hampered in the presence of DAPT.
  • * P ⁇ 0.05 versus Cherry; ** P ⁇ 0.01 versus Cherry; N 3.
  • FIGURE 44 shows how Prdm 16 arterialises BOECs through activation of canonical Notch.
  • * P ⁇ 0.01 versus Cherry; N 3.
  • FIGURE 45 shows how Prdm 16 deficiency in zebrafish does not result in reduced notch signalling. A.
  • ns Mo-treated canonical notch reporter zebrafish Tg(Tp1-Mmu.Hbb:eGFP)) embryo at 72 hpf. Note the clear signal in the dorsal aorta (DA), while the posterior cardinal vein (PCV) is devoid of canonical notch activity. Canonical Notch activity is also high in the neural tube (NT).
  • DA dorsal aorta
  • PCV posterior cardinal vein
  • Canonical Notch activity is also high in the neural tube (NT).
  • FIGURE 46 shows how DAPT induces aortic abnormalities in prdm16 Mo, but not ns Mo-treated zebrafish.
  • A Quantification of the aortic defects seen in ns Mo or prdm16 Mo-treated Tg(kdr-eGFP) 5843 zebrafish simultaneously treated with DMSO or DAPT, demonstrating that, while DAPT had no effect on ns Mo-treated, it clearly resulted in increased aortic defects in prdm16 Mo-treated embryos. Numbers of embryos analysed per condition are mentioned in the graph bars.
  • B-E Representative images of ns Mo DSMO (S), ns Mo DAPT (C), prdm16 Mo DMSO
  • FIGURE 47 displays how co-injections of grl Mo with prdm16 Mo severely aggravates the vascular defects observed in zebrafish treated with only prl Mo or prdm16 Mo.
  • ns Mo (B), grl Mo (C), prdm16 Mo (D) and grl Mo + prdm16 Mo DAPT (E) treated embryos illustrating the aggravated aortic hypoplasia observed in grl Mo + prdm16 Mo-treated zebrafish embryos.
  • Dimensions of the DA are demarcated by dotted lines. Scale bars represent 200 ⁇ . *P ⁇ 0.05; **P ⁇ 0.01 ; ****P ⁇ 0.0001 .
  • FIGURE 48 shows that Prdm16, but not Prdm16ACtBP or PrdmWADNA exerts full arterialising capacity in BOECs.
  • qRT-PCR analysis revealing only partial or completely abolished upregulation of Notch pathway genes ⁇ DLL4, HEY1, HEY2 and EFNB2) in BOECs upon overexpression of Prdml 64CfSP (dark grey) or Prdml 64D/V/4 (light grey) mutants, compared to overexpression of WT Prdm16 (black). Expression values are relative to control (Cherry; indicated by dotted line) treated BOECs.
  • FIGURE 49 shows that Prdml 6, but not Prdml 6ACtBP or Prdml 6 ⁇ induces full canonical Notch activation.
  • FIGURE 50 shows how Prdml 6 leads the way to proper arterial differentiation and development .
  • Prdml 6 Since Prdml 6 is able to induce SEMA3G and more notably SEMA3C, Prdml 6 might instruct AECs, but not VECs to secrete a gradient of Sema3c/Sema3g to attract multiple layers of SMCs during arterial development, thereby functionally defining arterial identity. (Right panel) Alternatively, but not mutually exclusive, Prdml 6 interacts with the Notch pathway to induce arterial differentiation via multiple potential mechanisms. Indeed, Prdml 6 might directly bind to CtBP to convert the RBPJK-containing repressor complex to an activating state.
  • Prdml 6 exerts epigenetic functions via its PR domain or via its interaction with histone modifying enzymes such as HMTs and HDACs.
  • Prdml 6 might activate both Hey1 and Hey2 in a DII4-independent or DII4- dependent manner by directly triggering the release of NICD.
  • DLL4 delta-like ligand 4
  • SEMA semaphorin
  • SMC smooth muscle cell : (A/V)EC: arterial/venous endothelial cell
  • NICD Notch intracellular domain
  • NECD Notch extracellular domain
  • HDAC histone deacetylase
  • CtBP C-terminal binding protein
  • PRDM16 PR domain containing protein 16
  • RBPJK recombination signal binding protein for immunoglobulin kappa J region.
  • TABLE 4 on on General differential signatures of brain, liver and heart murine endothelial cells (ECs)
  • TABLE 5 provides the transcription factors in the tissue EC-related fingerprints
  • TABLE 6 provides the Reference signature of (murine) heart ECs
  • TABLE 7 provides afunctional annotation list for the (validated) signatures
  • TABLE 8 provides a Primer list for work described in Example 2
  • TABLE 9 provides a Nanostring probe list
  • TABLE 10 provides the arterial TF cloning information
  • TABLE 1 1 provides characteristics of the arteriovenous human differential reference signature
  • TABLE 12 provides the probe set intensities in HUAEC/HUVEC of genes contained within the arteriovenous fresh profile.
  • TABLE 13 demonstrates the expression of genes from the arteriovenous fresh profile in DLL4-Fc treated HUAEC.
  • TABLE 16 provides the gene list of arterial- and venous-specific genes differentially expressed ([logvalue]>1 and P ⁇ 0.001 ) between mAECs and mVECs
  • TABLE 17 provides the average arterial and venous probe intensities and corresponding log2 ratios for all TFs identified in our human and murine microarrays
  • Cardiac endothelial-myocardial signalling its role in cardiac growth, contractile performance, and rhythmicity.
  • Liver sinusoidal endothelium a microenvironment-dependent differentiation program in rat including the novel junctional protein liver endothelial differentiation-associated protein-1 . Hepatology 52, 313-326.
  • Msx1 and Msx2 are expressed in sub-populations of vascular smooth muscle cells. Dev Dyn 237, 2187-2194.
  • VEGF-B vascular endothelial growth factor B controls endothelial fatty acid uptake. Nature 464, 917- 921 .
  • Hagberg CE Mehlem A, Falkevall A, Muhl L, Farm BC, Ortsater H, Scotney P, Nyqvist D, Samen E, Lu L, Stone-Elander Set a/.(2012). Targeting VEGF-B as a novel treatment for insulin resistance and type 2 diabetes.
  • CtBP1 C- terminal binding protein 1
  • CTRP9 protein protects against myocardial injury following ischemia-reperfusion through AMP- activated protein kinase (AMPK)-dependent mechanism.
  • AMPK AMP- activated protein kinase
  • Mox2 is a component of the genetic hierarchy controlling limb muscle development. Nature 400, 69-73.
  • Neurons derived from reprogrammed fibroblasts functionally integrate into the fetal brain and improve symptoms of rats with Parkinson's disease. Proc Natl Acad Sci U S A 105, 5856- 5861 .
  • ABLIM3 H CTTCATCACAGGCGAAGTCA TTGGTCCACGAATCTTGATG
  • ADAMTS9 H TACACCGCAAACGACTGTGT TCACGATCGGGAGGTTTATC
  • HN1I H TCCTTCCAGCAGGCCTAATA CCAAAAATGTCGCTGGTCTT
  • PMP2 H GGGGTTAGCCAC C AG AAAAC TCTCTTTGCCATCCCATCTC
  • TCF15 H GCAGCTGCTTGAAGGTGAG CGGTCCCTACACAAAGAAGG
  • TIMP4 H CAGACCCTGCTGACACTGAA AGACTTTCCCTCTGCACCAA
  • WT1 UTR H CAGGCTGCTAACCTGGAAAG CTCCATTTGTGCAAGGAGGT
  • PROX1 H CAGTACTGAAGAGCTGTCTATAACCAGAG TCTG AG CAACTTC CAG G AATCTC
  • PECAM1 H TCTGCACTGCAGGTATTGACAA CTGATCGATTCGCAACGGA
  • Tubb M GGGAGGTGATAAGCGATGAA CCCAGGTTCTAGATCCACCA Gapdh M CCGCATCTTCTTGTGCAGT GAATTTGCCGTGAGTGGAGT
  • Adh1 M ACAAACCCTTCACCATCGAG CCTTCTCCAACGCTCTCAAC
  • Prg4 M GCCACCTGCAACTGTGATTA CTG CACAG CACTTG CCATAC
  • Tnni3 M G AAG CAG G AG ATG G AACG AG TGACTTTTGCTTCCACGTCA
  • Gpihbpl M GGGCACAAGAAGATGGTGAT CTGGAGCAGCTCTGTGTCTG
  • CD36 M TGCCAGTCGGAGACATGCT GCCACGTCATCTGGGTTTTG
  • Nrp1 M ACACCTGAGCTTCGGACGTT CCACTGTGTGTGGCTCTCTCTCA
  • NM_027299 Degs2 10.9 6.6 5.5 -4.3 5.4 1.0
  • NM_001099634 Myof 9.0 5.9 6.0 -3.1 3.0 -0.2

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Vascular Medicine (AREA)

Abstract

L'invention concerne des méthodes de production et de validation ultérieure de cellules endothéliales spécifiques du lit vasculaire, avec des signatures génétiques et fonctionnelles spécifiques, à partir de précurseurs cellulaires, ainsi que les utilisations de ces cellules. Les cellules issues de précurseurs cellulaires de la lignée endothéliale selon l'invention sont utilisées, dans un mode de réalisation de l'invention, dans la production in vitro d'équivalents de culture tissulaire mis au point par génie biologique. Lesdits équivalents sont utilisés, dans un autre mode de réalisation de l'invention, dans des essais de toxicité médicamenteuse ou dans la production de canaux vasculaires mis au point par génie biologique pour des greffes in vivo. Dans un autre mode de réalisation, les cellules produites selon l'invention sont utilisées dans le traitement des maladies spécifiques du lit vasculaire affectant le cerveau (l'AVC, par exemple), le foie (le syndrome d'obstruction sinusoïdale, par exemple), le coeur (l'ischémie myocardique), les extrémités (la maladie vasculaire périphérique, par exemple), entre autres.
PCT/EP2013/064410 2012-07-06 2013-07-08 Cellules endothéliales spécifiques du lit vasculaire WO2014006228A1 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201261668978P 2012-07-06 2012-07-06
US61/668,978 2012-07-06
GB1212111.7 2012-07-06
GB201212111A GB201212111D0 (en) 2012-07-06 2012-07-06 Vascular bed-specific endothelial cells
US201361806278P 2013-03-28 2013-03-28
US61/806,278 2013-03-28

Publications (2)

Publication Number Publication Date
WO2014006228A1 true WO2014006228A1 (fr) 2014-01-09
WO2014006228A9 WO2014006228A9 (fr) 2014-04-03

Family

ID=46766308

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/064410 WO2014006228A1 (fr) 2012-07-06 2013-07-08 Cellules endothéliales spécifiques du lit vasculaire

Country Status (2)

Country Link
GB (1) GB201212111D0 (fr)
WO (1) WO2014006228A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3277844A4 (fr) * 2015-04-01 2018-11-07 Institute Of Environmental Science And Research Limited Procédés et matériaux pour la détection de séquences d'arn
CN110577967A (zh) * 2018-05-22 2019-12-17 中国人民解放军军事科学院军事医学研究院 诱导性多能干细胞及其制备方法
WO2020079107A1 (fr) * 2018-10-19 2020-04-23 F. Hoffmann-La Roche Ag Facteurs de transcription synergiques pour induire une barrière transendothéliale à haute résistance
US20210079343A1 (en) * 2018-03-23 2021-03-18 The Children's Medical Center Corporation Endothelial cell factors and methods thereof
US11274279B2 (en) 2020-03-11 2022-03-15 Bit Bio Limited Method of generating hepatic cells

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001048150A1 (fr) * 1999-12-28 2001-07-05 Kyowa Hakko Kogyo Co., Ltd. Cellules pouvant se differencier en cellules du muscle cardiaque
KR20110024660A (ko) * 2009-09-03 2011-03-09 차의과학대학교 산학협력단 인간 배아줄기세포 또는 인간 유도만능줄기세포의 혈관내피세포로의 혈청 및 이종 비함유 분화방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001048150A1 (fr) * 1999-12-28 2001-07-05 Kyowa Hakko Kogyo Co., Ltd. Cellules pouvant se differencier en cellules du muscle cardiaque
KR20110024660A (ko) * 2009-09-03 2011-03-09 차의과학대학교 산학협력단 인간 배아줄기세포 또는 인간 유도만능줄기세포의 혈관내피세포로의 혈청 및 이종 비함유 분화방법

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ARANGUREN X L ET AL: "HUMAN MULTIPOTENT ADULT PROGENITOR CELLS (MAPC) CAN DIFFERENTIATE IN VITRO AND VIVO INTO ARTERIAL AND VENOUS ENDOTHELIUM", CIRCULATION, LIPPINCOTT WILLIAMS & WILKINS, US, vol. 112, no. 17, SUPPL. S, 25 October 2005 (2005-10-25), pages U92, XP009067168, ISSN: 0009-7322 *
ARANGUREN XABIER L ET AL: "In vitro and in vivo arterial differentiation of human multipotent adult progenitor cells.", BLOOD 15 MAR 2007, vol. 109, no. 6, 15 March 2007 (2007-03-15), pages 2634 - 2642, XP055086945, ISSN: 0006-4971 *
ARANGUREN XABIER L ET AL: "Transcription factor COUP-TFII is indispensable for venous and lymphatic development in zebrafish and Xenopus laevis", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 410, no. 1, June 2011 (2011-06-01), pages 121 - 126, XP028231242 *
DOUVILLE JOSETTE M ET AL: "Mechanisms of MEOX1 and MEOX2 Regulation of the Cyclin Dependent Kinase Inhibitors p21(CIP1/WAF1) and p16(INK4a) in Vascular Endothelial Cells", PLOS ONE, vol. 6, no. 12, December 2011 (2011-12-01), XP009174044, ISSN: 1932-6203 *
LUTTUN AERNOUT ET AL: "Differentiation of multipotent adult progenitor cells into functional endothelial and smooth muscle cells.", CURRENT PROTOCOLS IN IMMUNOLOGY / EDITED BY JOHN E. COLIGAN ... [ET AL.] DEC 2006, vol. Chapter 22, December 2006 (2006-12-01), XP009174035, ISSN: 1934-368X *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3277844A4 (fr) * 2015-04-01 2018-11-07 Institute Of Environmental Science And Research Limited Procédés et matériaux pour la détection de séquences d'arn
US20210079343A1 (en) * 2018-03-23 2021-03-18 The Children's Medical Center Corporation Endothelial cell factors and methods thereof
CN110577967A (zh) * 2018-05-22 2019-12-17 中国人民解放军军事科学院军事医学研究院 诱导性多能干细胞及其制备方法
WO2020079107A1 (fr) * 2018-10-19 2020-04-23 F. Hoffmann-La Roche Ag Facteurs de transcription synergiques pour induire une barrière transendothéliale à haute résistance
US11274279B2 (en) 2020-03-11 2022-03-15 Bit Bio Limited Method of generating hepatic cells

Also Published As

Publication number Publication date
GB201212111D0 (en) 2012-08-22
WO2014006228A9 (fr) 2014-04-03

Similar Documents

Publication Publication Date Title
Xie et al. Transcription factor TBX4 regulates myofibroblast accumulation and lung fibrosis
Nurnberg et al. Coronary artery disease associated transcription factor TCF21 regulates smooth muscle precursor cells that contribute to the fibrous cap
Park et al. The Tcf21 lineage constitutes the lung lipofibroblast population
Watanabe et al. Mammary morphogenesis and regeneration require the inhibition of EMT at terminal end buds by Ovol2 transcriptional repressor
Ge et al. Modeling supravalvular aortic stenosis syndrome with human induced pluripotent stem cells
KR101897001B1 (ko) 비-간세포를 간세포로 리프로그래밍하기 위한 키트 및 방법
Mallet et al. TGFβ1 induces vasculogenesis and inhibits angiogenic sprouting in an embryonic stem cell differentiation model: respective contribution of ALK1 and ALK5
Caprioli et al. Nkx2-5 represses Gata1 gene expression and modulates the cellular fate of cardiac progenitors during embryogenesis
AU2023248169A1 (en) Haematopoietic stem/progenitor cells
Zhou et al. Human stem cells overexpressing miR-21 promote angiogenesis in critical limb ischemia by targeting CHIP to enhance HIF-1α activity
Laurenti et al. Inducible gene and shRNA expression in resident hematopoietic stem cells in vivo
WO2014006228A1 (fr) Cellules endothéliales spécifiques du lit vasculaire
Gao et al. Zebrafish hhex-null mutant develops an intrahepatic intestinal tube due to de-repression of cdx1b and pdx1
Ujhelly et al. Lack of Rybp in mouse embryonic stem cells impairs cardiac differentiation
Chatterjee et al. Endothelial lipid phosphate phosphatase-3 deficiency that disrupts the endothelial barrier function is a modifier of cardiovascular development
Andersen et al. Non-cultured adipose-derived CD45− side population cells are enriched for progenitors that give rise to myofibres in vivo
Nomura et al. Differential requirement for nucleostemin in embryonic stem cell and neural stem cell viability
Horikiri et al. SOX10-nano-lantern reporter human iPS cells; a versatile tool for neural crest research
US20100330044A1 (en) Mesp1 as a master regulator of multipotent cardiovascular progenitor specification and uses thereof
WO2019152483A1 (fr) Procédés de construction vasculaire et produits obtenus à partir de ceux-ci
Moody et al. Endoglin is not critical for hematopoietic stem cell engraftment and reconstitution but regulates adult erythroid development
Jackson et al. The haematopoietically-expressed homeobox transcription factor: roles in development, physiology and disease
US10520494B2 (en) Flattop (FLTP) is a novel biomarker for beta cell maturation
Castellanos et al. Regulation of erythropoiesis by the neuronal transmembrane protein Lrfn2
Fujita et al. Generation of a MyoD knock-in reporter mouse line to study muscle stem cell dynamics and heterogeneity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13748268

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13748268

Country of ref document: EP

Kind code of ref document: A1