WO2013149904A1 - Diagnostic, détermination du stade et pronostic du cancer de la prostate à base d'un gène marqueur - Google Patents

Diagnostic, détermination du stade et pronostic du cancer de la prostate à base d'un gène marqueur Download PDF

Info

Publication number
WO2013149904A1
WO2013149904A1 PCT/EP2013/056510 EP2013056510W WO2013149904A1 WO 2013149904 A1 WO2013149904 A1 WO 2013149904A1 EP 2013056510 W EP2013056510 W EP 2013056510W WO 2013149904 A1 WO2013149904 A1 WO 2013149904A1
Authority
WO
WIPO (PCT)
Prior art keywords
methylation
pitx2
hoxd3
seq
prostate
Prior art date
Application number
PCT/EP2013/056510
Other languages
English (en)
Inventor
Kyrylo Litovkin
Aleyde Van Eynde
Mathieu Bollen
Monique Beullens
Olivier Gevaert
Original Assignee
Katholieke Universiteit Leuven
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Katholieke Universiteit Leuven filed Critical Katholieke Universiteit Leuven
Publication of WO2013149904A1 publication Critical patent/WO2013149904A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • This invention relates generally to a method of diagnosis and prognosis, in particular staging and/or typing and/or predicting outcome, for distinguishing between a benign prostate hyperplasia and a prostate cancer and between an hormone sensitive and an hormone refractory prostate cancer condition and specifically to identification of differentially methylated CpG islands in the regulatory regions surrounding the transcriptional start site of at least one marker gene of the present invention as a diagnostic and/or prognostic indicator of prostate cancer (PrCa) and for distinguishing androgen-refractory from androgen sensitive prostate cancer.
  • PrCa diagnostic and/or prognostic indicator of prostate cancer
  • the marker genes of the present invention comprise PITX2 and HOXD3. This invention relates more specifically to the detection of hypermethylation of PITX2 and HOXD3.
  • This invention further relates to the prediction, prognosis or diagnosis of prostate cancer, including metastasis, more particularly in patients with prostate cancer.
  • Marker genes have been identified of which promoter regions containing differentially methylated regions, compared to a reference sample, are indicative for the prediction or prognosis of prostate cancer.
  • PrCa Prostate cancer
  • PSA Prostate- Specific Antigen
  • the PSA test is also used to monitor patients for the recurrence of PrCa following surgery or other treatments.
  • the PSA test has greatly improved the detection of PrCa, its usefulness is still controversial.
  • a recent study by Concato et al. shows that PSA screening is not associated with lower mortality (Concato J, et al. (2006) Arch Intern Med. 166:38-43).
  • the serum PSA level is also elevated in non-cancerous prostate disorders such as benign prostate hyperplasia and infection.
  • Initial tests for suspected prostate cancer is done by analysis of blood levels of proteins like PSA or for instance PSP94 protein. Positive tests are followed by a conformational diagnosis.
  • the only test which can fully confirm the diagnosis of prostate cancer is a biopsy, the removal of small pieces of the prostate for microscopic examination.
  • the present invention provides a novel diagnostic test of prostatic tissue or cells obtainable from prostatic tissue.
  • a condition of benign prostatic hyperplasia (BPH), or benign prostatic hypertrophy is common as a man ages. It is thus very important to distinguish between a PrCa and a BPH.
  • hormone-refractory prostate cancers are more aggressive and need specific treatments such as apoptosis and regression induction of the tumors and/or antimetastasis.
  • prostate cancer nomograms there is thus a need in the art for additional prostate cancer screening or diagnosis methods, and more particularly for a biomarker(s) that can discriminate between benign and malignant tumors and between aggressive and indolent (slow-growing) cancers.
  • the present invention fulfills these needs.
  • PITX2 was found to be an independent significant predictor for clinical failure in the context of preoperative PSA, pathological stage, final Gleason score, surgical margin status, lymph-node invasion, adjuvant radiotherapy (RT) and adjuvant hormonal therapy (ADT). Clinical failure is a harder endpoint for prostate cancer than biochemical recurrence.
  • the present invention solves the problems of the related art by providing a diagnostic and prognostic assay that allows one to determine the predisposition to, or the incidence of prostate cancer and allows to distinguish between different types and/or stages of cancer, in particular between hormone-refractory and hormones-sensitive cancer, particularly in prostatic tissues or cells originating from prostatic tissues and to predict outcome, in particular of biochemical recurrence in prostate cancer.
  • the test could also be used on body fluids.
  • the invention is broadly drawn to methods and assays for detecting a prostate proliferative disorder, in particular for identifying prostate tumor cells that have become refractory or resistant to hormone therapy, and thus allowing to identify the prostate cancer or/and to distinguish hormone sensitive from hormone refractory prostate cancers.
  • the present invention relates generally to the identification of the distinguishing difference between a hormone refractory prostate tissue cellular proliferative disorder and a hormone sensitive prostate tissue cellular proliferative disorder in a subject, preferably a human subject.
  • the distinguishing difference relies on the identification of one or more hypermethylated CpG islands surrounding the transcription start site (TSS) of the human genes PITX2 and HOXD3, more in particular the hypermethylated CpG islands are found in regions upstream of the TSS or in the promoter region of said human genes.
  • said group of genes (PITX2, and HOXD3) are to be analysed for their methylation status, and are used to predict the incidence of and more particular the aggressiveness of prostate cancer.
  • PITX2 and HOXD3 are thus particularly useful as prognostic markers, more specifically in the current invention hypermethylation of PITX2, and HOXD3 are indicative for a negative prognosis, or an indication for an aggressive tumor, more particular a prostate tumor.
  • this set of genes can be used in a method of the invention to decide on the proper treatment or proper medicament of the patient.
  • the method of the present invention wherein hypermethylation of PITX2 and HOXD3 is detected in a sample of prostatic tissue or in a biological sample that comprises prostatic cells or prostatic cell components from a human patient when comparing the methylation level of said genes in a reference sample, is used to decide on the proper treatment of said patient, in particular the methylation level of said genes is indicative for the decision about the initiation or continuation of a proper treatment, wherein in a more particular embodiment said proper treatment is selected from a prostatectomy, treatment with a methylation inhibitor, a gonadotropin-releasing hormone agonists, or treatment with a compound which reduces male hormones, radiotherapy, or treatment with neutraceuticals.
  • PITX2 and HOXD3 are hypermethylation markers, meaning that hypermethylation of PITX2 and HOXD3, when comparing the methylation status of a patient or a human being suspected to have prostate cancer, to the methylation level of said genes in a reference sample is indicative for prostate cancer or indicative for the predisposition to prostate cancer, more particularly for typing and/or staging tumors, in particular to identify an aggressive or high grade prostate cancer and for predicting outcome, in particular to predict biochemical recurrence (BCR) and/or clinical failure.
  • BCR biochemical recurrence
  • the prognostic methods that detect whether a prostate cancer in subjects, preferably human, comprises an androgen refractory cancer and/or an androgen sensitive cancer can be carried out by analysis of the methylation status of said genes in a sample of a subject.
  • the invention provides methods for detecting, and in particular for typing and/or staging and/or prediction of outcome; in a subject a prostate cell proliferative disorder, which methods comprise the steps of:
  • the invention provides methods for detecting in a subject an androgen refractory prostate cancer, which methods comprise the steps of:
  • the present invention provides a method for typing and/or staging and/or predicting outcome of a prostate cell proliferative disorder in a human male subject, the method comprising:
  • a analyzing the level of DNA methylation of the regulatory region surrounding the transcription start site (TSS) of the PITX2 and HOXD3 genes in a test sample of prostatic tissue or in a biological test sample that comprises prostatic cells or prostatic cell components from a human patient; and
  • step (a) comparing the methylation level of CpG dinucleotides in the regulatory region surrounding the transcription start sites of PITX2 and HOXD3 of step (a) in the test sample with said level in a reference sample;
  • methylation level of CpG dinucleotides in said regulatory region in the PITX2 and HOXD3 genes of said test sample is predictive for the outcome and/or indicative of the type and/or stage of said prostate cell proliferative disorder.
  • step (b) of said method comprises analyzing the methylation level of CpG dinucleotides in the regulatory region surrounding the transcription start sites of PITX2 and HOXD3, using the following formula:
  • both the methods of the invention comprise a further step as follows: c) identifying methylation of region(s), wherein hypermethylation of PITX2, and HOXD3 is identified as being different when compared to the same region(s) of the gene or associated regulatory region in a subject having an androgen sensitive prostate cancer.
  • Another aspect of the invention is that it provides methylation conditions of regulatory regions of the panel of genes (PITX2, and HOXD3), such as in the CpG islands surrounding the TSS of said panel of human genes, which can be used (a) to analyze the presence of cancer cells in prostate tissue and/or in prostatic secretions, for instance in seminal plasma and (b) to define patients that have a prostate cancer or alternatively patients that have a normal prostate, and (c) to define which patients with a prostate cancer have an androgen refractory prostate cancer or alternatively to define which patients with a prostate cancer have an hormone sensitive prostate cancer.
  • PITX2, and HOXD3 regulatory regions of the panel of genes
  • Such test provides an accurate means or tool to decide about the suitable treatment of the prostate cancer; in particular if the PITX2 and HOXD3 genes are hypermethylated the need for chemotherapy, surgery or radiation therapy is identified.
  • the methods of present invention can also be used to predict effectiveness of such chemotherapies applicable on a prostate cancer.
  • Patients affected by a condition of hypermethylation of regulatory regions of the genes PITX2 and HOXD3 such as in the CpG islands surrounding said genes, and/or CpG islands upstream of the TSS or in the promoter region of said genes can for instance be treated by DNA methyltransferase (DNMT) inhibitors.
  • DNMT DNA methyltransferase
  • Diagnosis of hypermethylation of the CpG island in the regions surrounding the TSS or in the promoter of PITX2 and HOXD3 can thus be used as a decision tool for treatment of a patient affected with such hypermethylation with a therapeutically effective amount of an DNA methyltransferase (DNMT) inhibitor for treating the prostate cancer or for preventing that a androgen sensible prostate cancer evolves into an androgen refractory prostate cancer.
  • DNMT DNA methyltransferase
  • MGI Pharma developed small molecule DNA methyltransferase (DNMT) inhibitors for the treatment of cancer.
  • Short oligonucleotide DNA methylation inhibitors in the art are Decitabine 5-Aza-CdR, SI 10 AzapG, S53 GpAza, S54 GpAzapG, S55 AzapGpAzapG, S56 pGpAzapAzapG, S52R AzapsG, Zebularine and SI 12 HEGpAzapG.
  • a specific DNMT inhibitor is for instance the compound called SI 10 of the company SuperGen which is a dinucleotide containing decitabine, S 110, which has superior activity due to increased stability because of less degradation by hydrolytic cleavage and deamination.
  • MG 98 HYB 101584
  • MG 98 is a second generation antisense oligonucleotide that selectively targets DNA methyltransferase 1 (DNMT1) mRNA.
  • MG 98 is created by MethylGene Inc. (Stewart D, et al. 11th NCI-EORTC-AACR symposium on new drugs in cancer therapy. : 148, 7 Nov 2000. ; Winquist E, et al. European Journal of Cancer. 38 (Suppl. 7): 141, Nov 2002. ; Stewart DJ, et al. Annals of Oncology. 14: 766-774, May 2003 and Ramchandani S, et al. Proceedings of the National Academy of Sciences of the United States of America. 94: 684- 689, Jan 1997.
  • the invention also provides for a method for predicting the likelihood of successful treatment of prostate proliferative disorder or prostate cancer, with a DNA demethylating agent and/or a DNA methyltransferase inhibitor and/or HDAC inhibitor comprising detecting a methylation change in the region surrounding the TSS or the promoter region of PITX2 and HOXD3 wherein detection of the methylation change is indicative of successful treatment to a higher degree than if the methylation modification is not detected.
  • kits for typing and/or staging and/or predicting outcome, detecting a predisposition to, or detecting the incidence of, prostate cancer in a sample comprising:
  • the analysis of said genes is restricted to the region surrounding their TSS.
  • said region extends from 1.5 kb upstream to about 1.5 kb downstream from the transcription start site of said genes.
  • said region extends from 1.0 kb upstream to about 1.0 kb downstream from the transcription start site of said genes.
  • the regulatory region surrounding the transcription start site of the gene PITX2 preferably corresponds to position about -16 to about +73 of the transcription start site.
  • the regulatory region surrounding the transcription start site of the gene HOXD3 preferably corresponds to position about 909 to 823 upstream of the transcription start site.
  • the detection of hypermethylation in said region of PITX2, and HOXD3 indicates the presence of prostate cancer cells or is indicative of a predisposition to, or the incidence of, prostate cancer.
  • said hypermethylation is detected when comparing the methylation status of the DNA of a test sample to the methylation status of a control sample and/or a benign prostate hyperplasia sample.
  • hypermethylation (and/or hypomethylation) of the (marker) genes of this invention has the meaning of differential methylation i.e. hypermethylation (increased) and/or hypomethylation (decreased) of said genes, when compared to the methylation status of said genes in a reference or control sample.
  • Iso- methylation of the (marker) genes of this invention has the meaning of substantially the same methylation level of said genes, when compared to the methylation status of said genes in a reference or control sample, i.e. the said genes are not differentially methylated compared to the methylation status of said genes in a reference or control sample.
  • control sample or reference sample is a sample from a healthy prostate. In other particular embodiments of this invention, the control sample or reference sample is a sample from a benign hyperplasia substrate.
  • the method of this invention comprises PCR analysis of polynucleotide materials of the cells derived from prostatic tissue. In other particular embodiments of this invention, the method of this invention comprises PCR analysis of polynucleotide materials of the cells derived from prostatic fluid.
  • An embodiment of the present invention is a method of diagnosing a disease state or cell proliferative disorder in the prostate of a subject, said method comprising: (a) analyzing the level of DNA methylation of the regulatory region surrounding the transcription start site (TSS) of PITX2, and HOXD3 or an homologous sequence of said genes in a biological sample isolated from said subject, and (b) comparing said DNA methylation with the DNA methylation in a control sample and/or a benign prostate hyperplasia sample; whereby increased CpG methylation in PITX2, and HOXD3 relative to the control sample or the benign prostate hyperplasia sample in the regulatory regions surrounding the transcriptional start site of said genes, in particular as defined hereinbefore, is an indication for prostate cancer and/or an indication of an hormone refractory prostate cancer, androgen-independent prostate cancer (AIPC) or androgen-independent metastatic prostate cancer.
  • TSS transcription start site
  • AIPC androgen-independent prostate cancer
  • the previous method further comprising a step of analyzing histone (de)acetylation of the gene(s) of this invention in said sample.
  • the previous method whereby the disease state or cell proliferative disorder is a cancer.
  • the previous method to distinguish between a healthy prostate and a disordered or diseased prostate.
  • the previous method to distinguish between an androgen sensitive prostate cancer or androgen dependent prostate cancer and androgen-independent prostate cancer The previous method to discover an androgen-independent metastatic prostate cancer in a prostate cell or prostate tissue.
  • the previous method to carry out a prostate cancer grading or prostate cancer staging The previous method to decide on the proper treatment or proper medicament of the prostate disease state
  • the previous method to decide on the treatment to decrease the activity of the EZH2 protein The previous method to decide on the treatment with a DNA demethylating agent and/or a DNA methyltransferase inhibitor and/or HDAC inhibitor.
  • a method for typing and/or staging and/or predicting outcome of a prostate cell proliferative disorder in a human male subject comprising:
  • a analyzing the level of DNA methylation of the regulatory region surrounding the transcription start site (TSS) of the PITX2 and HOXD3 genes in a test sample of prostatic tissue or in a biological test sample that comprises prostatic cells or prostatic cell components from a human patient; and
  • step (a) comparing the methylation level of CpG dinucleotides in the regulatory region surrounding the transcription start sites of PITX2 and HOXD3 of step (a) in the test sample with said level in a reference sample;
  • methylation level of CpG dinucleotides in said regulatory region in the PITX2 and HOXD3 genes of said test sample is predictive for the outcome and/or indicative of the type and/or stage of said prostate cell proliferative disorder.
  • step (b) comprises analyzing the methylation level of CpG dinucleotides in the regulatory region surrounding the transcription start sites of PITX2 and HOXD3, using the following formula:
  • prostate cell proliferative disorder of a more advanced stage is a high clinical stage disorder of pT stage III or IV.
  • said regulatory region surrounding the TTS comprises one or more CpG islands and extends about 1.5 kb upstream to about 1.5 kb downstream from said transcription start site of said gene(s).
  • the method according to statement 12 wherein the regulatory region surrounding the transcription start site of the gene PITX2 corresponds to position about -16 to about +73 of the transcription start site.
  • test and/or reference sample is selected from the list comprising prostatic tissue, prostatic fluid, seminal fluid, ejaculate, blood, urine, prostate secretions, histological slides, and paraffin-embedded tissue.
  • a kit for typing and/or staging a prostate cell proliferative disorder in a human male subject comprising at least one primer of the group consisting of methylated specific primers for PITX2 (SEQ ID N° 67 and 68), and at least one primer of the group consisting of methylated specific primers for HOXD3 (SEQ ID N° 61 and 62) and at least one primer of the group consisting of unmethylated specific primers for PITX2 (SEQ ID N° 69 and 70) and at least one primer of the group consisting of unmethylated specific primers for HOXD3 (SEQ ID N° 63 and 64) is used.
  • kit according to statement 17 further comprising control plasmids comprising the inserts represented by SEQ ID N° 98 and 99.
  • Figure 1A is a schematic representation of the strategy we have chosen for the analysis of methylation status of different potential prostate cancer biomarkers.
  • a melting curve assay was applied to a set of model genotypes corresponding to non-cancerous DNA and tissues (human genomic DNA (HG DNA), cell lines PZ-HPV7, BPH1) and PCa cell lines (androgene-sensitive LNCaP and androgene-insensitive PC-3 and DU 145).
  • Melting curve assay implies amplification of a part of the gene promoter with methylation independent primers after bisulphite conversion of DNA, followed by registration of melting profile of the resulting amplicons.
  • FIG. IB Results of the bisulphite sequencing of the PCR- fragments covering MAGEA2 CpG- island around the transcription site, obtained from whole blood human genomic DNA (HG DNA) and LNCaP cell line. Numbers from -2 to 5 and from 12 to 16 represent positions of CpG-dinucleotides relative to the transcription start site (TSS). The selected CpG-island is completely hypomethylated in cancer LNCaP cell line in comparison with whole blood human genomic DNA.
  • Figure 3 Graphs showing PCR cycles (X-axis) plotted against the fluorescence intensity of the PCR product accumulated in EvaGreen® reaction mixture (Y-axis) using 100% M and 100% U plasmid standards as a template tested with M and U primers for APC. The M and U reactions were 100%) specific since M primers did not cross-react with U standard and vice versa. No primer dimers were observed in "no template" control.
  • Figure 6 Schematic representation of the protocol for quantitative multiplex nested-MSP analysis.
  • Multiplex PCR step a mixture of gene-specific methylation-independent primer pairs is used to co-amplify 80-180 bp fragments of CpG islands covering regulatory elements of the selected genes.
  • quantitative step two real time PCRs (qMSP and qUSP) are performed for each gene separately with primer sets specific for methylated (M) and unmethylated (U) sequences using the DNA template derived from Multiplex PCR step (diluted 1 :500 in sterile water).
  • Figure 7 Gray-scale representation of the levels of 16 genes promoter hypermethylation as determined by the invention methods employing quantitative multiplex nested-MSP on prostate cell lines, prostate tissues and HG DNA. Intensity of color correlates with the degree of methylation, also indicated by number (%). For the TDRD1 and MAGEA2 genes reverse methylation value is presented (100 - % of methylation).
  • Figure 8 Gray-scale representation of the levels of 16 genes promoter hypermethylation as determined by the invention methods employing quantitative multiplex nested-MSP on matched tumor/adjacent benign prostate tissue samples from 7 patients. Intensity of color correlates with the degree of methylation, also indicated by number (%). For the TDRDl and MAGEA2 genes the reverse methylation values are presented (100 - % of methylation).
  • Figure 9 Average tumor volume measured (A) in ml and (B) in % of the total prostate gland volume in patients with low (LM) and high (HM) methylation of tumor DNA. Low and high methylation levels are discriminated based on the median methylation value for each gene.
  • Figure 10 Results of Kaplan-Meier analysis for biochemical progression-free survival probability within 16 years after radical prostatectomy in groups of patients with high (HM - above the cutoff methylation value) and low (LM - below the cutoff methylation value, indicated on the graph) degree of HOXD3 (A) and TDRDl (B) methylation in PCa tumors from the PCa2 cohort.
  • Figure 11 Results of Kaplan-Meier analysis for biochemical progression-free survival probability within 16 years after radical prostatectomy in groups of patients with high (HM - above the cutoff methylation value) and low (LM - below the cutoff methylation value, indicated on the graph) degree of PITX2 (A) and RASSFI (B) methylation in PCa tumors from the PCa2 cohort.
  • Figure 12 Results of Kaplan-Meier analysis for clinical failure (CF) probability within 16 years after radical prostatectomy in groups of patients with high (HM - above the cutoff methylation value) and low (LM - below the cutoff methylation value, indicated on the graph) degree of PITX2 methylation in PCa tumors from the PCa2 cohort.
  • Disease state means any disease, disorder, condition, symptom, or indication.
  • the term “cell proliferative disorder” refers to conditions in which the unregulated and/or abnormal growth of cells can lead to the development of an unwanted condition or disease, which can be cancerous or non-cancerous.
  • the detection of the cell proliferative disorder may be by way of routine examination, screening for a cell proliferative disorder or pre-stadia such cell proliferative disorder, monitoring and/or staging the state and/or progression of the cell proliferative disorder, assessing for recurrence following treatment, and monitoring the success of a treatment regimen.
  • the cell proliferation disorder is cancer.
  • cancer concerns malignant neoplasm, malignant tumor or invasive tumor and also can include solid neoplasm or solid tumors cancers. Cancers are classified by the type of cell that resembles the tumor and, therefore, the tissue presumed to be the origin of the tumor. Examples of general categories include: Carcinoma: Malignant tumors derived from epithelial cells. This group represents the most common cancers, including the common forms of breast, prostate, lung and colon cancer. Sarcoma: Malignant tumors derived from connective tissue, or mesenchymal cells. Lymphoma and leukemia: Malignancies derived from hematopoietic (blood-forming) cells Germ cell tumor: Tumors derived from totipotent cells.
  • Blastic tumor A tumor (usually malignant) which resembles an immature or embryonic tissue.
  • the cancer is prostate cancer.
  • “Hormone refractory prostate cancer” and in particular "androgen-independent prostate cancer (AIPC)” has to be understood for the meaning of this invention as prostate cancer that has become refractory, that is, it no longer responds to hormone therapy.
  • Prostate cancer staging or “staging” as used herein concerns how much and where the cancer is located. The more cancer there is in the body, the more likely it is to spread and less likely that treatments will work. Therefore, the more advanced stages can affect long-term results and survival. According an older prostate cancer staging the prostate cancer is broken down into four primary stages for instance the four ABCD stages of staging to gauge the severity of prostate cancer to describe the detection and location of the cancer. Stage A: Cancer found when not suspected or due to a high PSA level, Stage B: Cancer found due to abnormal digital rectal exam and is held in the prostate, Stage C: Cancer that has spread to the tissues outside of the prostate, Stage D: Cancer that has spread to the lymph nodes or bone.
  • TNM grading system A particular system in the art which replaced the ABCD staging system of prostate cancer to give an even more accurate description of the cancer is the TNM grading system.
  • T describes the tumor and uses different numbers to explain how large it is;
  • N stands for nodes and tells whether the cancer has spread to the lymph nodes;
  • M means metastatic, and tells whether the cancer has spread throughout the body.
  • Stage Tl Microscopic tumor confined to prostate and undetectable by a digital rectal exam (DRE) or ultrasound; Stage Tla: Tumor found in 5% or less of prostate tissue sample; Stage Tib: Tumor found in more than 5% of a prostate tissue sample; Stage Tic: Tumor is identified by needle biopsy as a follow-up to screening that detected elevated PSA results; Stage T2: Tumor confined to prostate and can be detected by DRE or ultrasound; Stage T2a: Tumor involves less than half of one lobe of the prostate, and can usually be discovered during DRE exam; Stage T2b: Tumor involves more than half of one lobe of the prostate, and can usually be felt during DRE exam; Stage T2c: Tumor involves both lobes of the prostate and is felt during a DRE exam; Stage T3 : Tumor has spread to surrounding tissues or to the seminal vesicles; Stage T3a: Tumor has spread to outside of the prostate on only one side; Stage T3b:
  • an effective amount refers to an amount of a compound, or a combination of compounds, of the present invention effective when administered alone or in combination as an anti-proliferative agent.
  • an effective amount refers to an amount of the compound present in a formulation or on a medical device given to a recipient patient or subject sufficient to elicit biological activity, for example, anti-proliferative activity, such as e.g., anti-cancer activity or anti-neoplastic activity.
  • the combination of compounds optionally is a synergistic combination. Synergy, as described, for example, by Chou and Talalay, Adv. Enzyme Regul. vol. 22, pp.
  • a therapeutically effective amount as used herein means the amount of a compound that, when administered to a mammal for treating a disease, is sufficient to effect such treatment for the disease.
  • the “therapeutically effective amount” will vary depending on the compound, the disease and its severity and the age, weight, etc., of the mammal to be treated.
  • a therapeutically effective amount of one or more of the compounds can be formulated with a pharmaceutically acceptable carrier for administration to a human or an animal. Accordingly, the compounds or the formulations can be administered, for example, via oral, parenteral, or topical routes, to provide an effective amount of the compound.
  • the compounds prepared in accordance with the present invention can be used to coat or impregnate a medical device.
  • prophylactically effective amount means an effective amount of a compound or compounds, of the present invention that is administered to prevent or reduce the risk of unwanted cellular proliferation.
  • “Pharmacological effect” as used herein encompasses effects produced in the subject that achieve the intended purpose of a therapy.
  • a pharmacological effect means that primary indications of the subject being treated are prevented, alleviated, or reduced.
  • a pharmacological effect would be one that results in the prevention, alleviation or reduction of primary indications in a treated subject.
  • a pharmacological effect means that disorders or symptoms of the primary indications of the subject being treated are prevented, alleviated, or reduced.
  • a pharmacological effect would be one that results in the prevention or reduction of primary indications in a treated subject.
  • Prostate biopsy as used herein is a procedure in which small samples are removed from a man's prostate gland to be tested for the presence of cancer. It is typically performed when the scores from a PSA blood test rise to a level that is associated with the possible presence of prostate cancer.
  • a subject from which a biological sample can be obtained for analysis according to the invention is an animal such as a mammal, e.g. a dog, cat, horse, cow, pig, sheep, goat, primate, rat, or mouse.
  • a preferred subject is a human being, particularly a patient suspected of having or at risk for developing a cell proliferative disorder such as a prostate cancer, or a patient with such a cell proliferative disorder such as a prostate cancer.
  • Treating includes any effect, e.g., lessening, reducing, modulating, or eliminating, that results in the improvement of the condition, disease, disorder, etc.
  • Treating or “treatment” of a disease state includes: (1) preventing the disease state, i.e. causing the clinical symptoms of the disease state not to develop in a subject that may be exposed to or predisposed to the disease state, but does not yet experience or display symptoms of the disease state; (2) inhibiting the disease state, i.e., arresting the development of the disease state or its clinical symptoms; or (3) relieving the disease state, i.e., causing temporary or permanent regression of the disease state or its clinical symptoms.
  • Prostatic cell component(s) mean any part of or component of a prostatic cell or cell compartment derived from a prostatic cell, including exosomes and preferably comprising DNA of said prostatic cell.
  • homologous sequence is meant, a nucleotide sequence that is shared by one or more polynucleotide sequences, such as genes, gene transcripts and/or non-coding polynucleotides.
  • a homologous sequence can be a nucleotide sequence that is shared by two or more genes encoding related but different proteins, such as different members of a gene family, different protein epitopes, different protein isoforms or completely divergent genes, such as a cytokine and its corresponding receptors.
  • a homologous sequence can be a nucleotide sequence that is shared by two or more non-coding polynucleotides, such as noncoding DNA or RNA, regulatory sequences, introns, and sites of transcriptional control or regulation. Homologous sequences can also include conserved sequence regions shared by more than one polynucleotide sequence. Homology does not need to be perfect homology (e.g., 100%), as partially homologous sequences are also contemplated by the instant invention (e.g., 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80% etc.).
  • regulatory region surrounding the transcription start site is meant a regulatory region located upstream or 5' to the TSS and/or a regulatory region around the TSS and/or a regulatory region located downstream or 3' to the TSS of the concerned gene.
  • the location of the concerned region can vary from 15Kbp upstream to 15 Kbp downstream of the TSS.
  • the region under investigation may correspond to all or part of the promoter region of the concerned gene.
  • the region under investigation corresponds an exon and/or intron region and/or TSS region of the concerned gene.
  • the region of the concerned gene is preferably between about 1500 bp upstream and about 1500 bp downstream from the TSS of the gene.
  • said region extends from -1500 bp and +1500 bp from the TSS of the gene.
  • reference is made to the position of the regulatory region surrounding the transcription start site of a gene said position is determined based on the information available in genome version hgl9 (Genome Reference Consortium).
  • promoter refers to the regulatory region located upstream, or 5' to the structural gene and/or TSS. Such a region extends typically between approximately 5 Kb, 500 bp or 150 to 300 bp upstream from the transcription start site of the concerned gene. For all the genes of this invention, we identified at least 1 CpG islands (genomic regions that contain a high frequency of CG dinucleotides) surrounding the transcriptional start site.
  • nucleotide sequence of one or more regions in a polynucleotide does not vary significantly between generations or from one biological system, subject, or organism to another biological system, subject, or organism.
  • the polynucleotide can include both coding and non-coding DNA and RNA.
  • control plasmid a plasmid comprising a sequence insert, corresponding to methylated or unmethylated DNA sequence after bisulphite conversion, which is representative for the respective methylated or unmethylated state of its corresponding gene.
  • Said insert is in particular selected from the list comprising SEQ ID N° 77-100, as depicted in table 13.
  • genes of this invention comprise all the genes, variants, alternative names of said genes that are known to a person skilled in the art. Some of the alternative names of the genes of this invention are summarized here below.
  • the invention provides a method for typing, staging, predicting outcome and/or identifying a prostate cell proliferative disorder in a human male subject, the method comprises:
  • the method comprise the steps of:
  • detection of hypermethylation in PITX2, and HOXD3 is indicative of a predisposition to, predicting outcome of, or the incidence of, prostate cancer.
  • the present invention provides a method for typing and/or staging and/or predicting outcome of a prostate cell proliferative disorder in a human male subject, the method comprising:
  • a analyzing the level of DNA methylation of the regulatory region surrounding the transcription start site (TSS) of the PITX2 and HOXD3 genes in a test sample of prostatic tissue or in a biological test sample that comprises prostatic cells or prostatic cell components from a human patient; and b. comparing the methylation level of CpG dinucleotides in the regulatory region surrounding the transcription start sites of PITX2 and HOXD3 of step (a) in the test sample with said level in a reference sample;
  • TSS transcription start site
  • methylation level of CpG dinucleotides in said regulatory region in the PITX2 and HOXD3 genes of said test sample is predictive for the outcome and/or indicative of the type and/or stage of said prostate cell proliferative disorder.
  • step (b) of the above methods comprises analyzing the methylation level of CpG dinucleotides in the regulatory region surrounding the transcription start sites of PITX2 and HOXD3, using the following formula:
  • the sample for use in such methods can be any suitable sample such as prostatic tissue, prostatic fluid, seminal fluid, ejaculate, blood, urine, prostate secretions, histological slides, and paraffin-embedded tissue, and is preferably a tissue sample.
  • Prostate biopsy is a procedure in which small samples are removed from a man's prostate gland to be tested for the presence of cancer. It is typically performed when the scores from a PSA blood test rise to a level that is associated with the possible presence of prostate cancer. A biopsy thus provides a specific example of a biological sample for use in present methods. Examination of the condition of the prostate may be performed transrectally, through the ureter or through the perineum.
  • the most common procedure is transrectal, and may be done with tactile finger guidance, (Ghei, M; Pericleous S et al (2005 Sep). Ann R Coll Surg Engl 87 (5): 386-7.) or with ultrasound guidance. If cancer is suspected, a biopsy is offered. During a biopsy tissue samples from the prostate are obtained for instance via the rectum. A biopsy gun can be used to insert and remove special hollow-core needles (usually three to six on each side of the prostate) in less than a second.
  • Suitable samples for diagnostic, prognostic, or personalized medicinal uses can be obtained from surgical samples, such as biopsies or surgical resection.
  • suitable samples for use in the methods of present invention comprise fine needle aspirates, paraffin embedded tissues, frozen tumor tissue samples, fresh tumor tissue samples, fresh or frozen body fluid.
  • body fluids include prostatic fluids, blood samples, serum, plasma, urine, ejaculate, wash or lavage fluid.
  • any tissue or fluid containing cells or nucleic acid, preferably DNA, derived from cells of the prostate is a suitable reagent for use in the methods of present invention.
  • Present methods preferably also include the step of obtaining the suitable sample. Cells may need to be lysed for release of the nucleic acid.
  • the nucleic acid may need to be cleared of proteins or other contaminants, e.g. by treatment with enzymes.
  • the nucleic acid may also need to be concentrated prior to further use in the method of the invention, in particular when the nucleic acid is derived from bodily fluids.
  • the present invention provides for an in vitro method for distinguishing a hormone independent proliferative disorder or hormone refractory proliferative disorder from a hormone sensitive proliferative disorder in tissue and/or in at least one cell obtainable from tissue of the prostate from a subject.
  • Such prognostic/diagnostic method comprises contacting a DNA of a tissue or a DNA of a biological fluid with a reagent which detects the methylation status of the promoter region of PITX2, and HOXD3, wherein hypermethylation of PITX2, and HOXD3, as compared to the methylation status of the promoter region or upstream of the promoter region of said gene(s) from said group from a normal cell or compared to the methylation status of promoter region or upstream of the promoter region of said gene(s) from said group from cells or of tissue of a prostate with steroidal hormone sensitive proliferative disorder, is indicative of said steroidal hormone refractory proliferative disorder.
  • the test is particularly suitable to distinguish between hormone refractory and homone sensitive and in particular for androgen sensitive and androgen-refractory prostate proliferative disorders and to distinguish between benign prostate hyperplasia and prostate cancer.
  • the invention provides a method for distinguishing between androgen sensitive and androgen-refractory prostate cancer by contacting a cellular component of a prostate tissue sample or another sample with a reagent which detects the methylation status of PITX2, and HOXD3 in the promoter or upstream of the promoter region of said gene(s).
  • methylation sensitive restriction endonuclease can be utilized to identify a hypermethylated promoter or upstream region of the genes of this invention, for example.
  • CpG dinucleotide motifs use chemical reagents.
  • chemical reagents that selectively modify the methylated or non-methylated form of CpG dinucleotide motifs can be used in the methods of present invention.
  • Such chemical reagents include bisulphite ions. Sodium bisulphite converts unmethylated cytosine to uracil but methylated cytosines remain unconverted. Analysis of the nucleic acid sequence after bisulfite conversion indicates if the original nucleic acid was all or not methylated.
  • a preferred technique for the detection and/or quantification of methylated DNA is the Methylation Specific PCR (MSP) technique.
  • MSP Methylation Specific PCR
  • This technique can be used in end-point format, wherein the presence of methylated DNA is for instance detected by electroforesis or by the use of dyes such as SYBR Green I or Ethidium Bromide that bind double-stranded DNA that accumulates during the amplification reaction.
  • the method is based on the continuous optical monitoring of an amplification process and utilises fluorescently labeled reagents. Their incorporation in a product can be quantified as the reaction processes and is used to calculate the copy number of that gene or sequence region in the sample.
  • the quantification of the amplification product may require the use of controls to avoid false negativity/positivity of the reaction.
  • Particularly suitable for the quantification of the amplification product are reference genes (e.g. beta-actin) whose methylation status is known, and/or DNA standards (e.g. methylated or unmethylated standards).
  • Accumulation of an amplification product can be monitored through the incorporation of labeled reagents.
  • Some techniques use labeled primers; others rely upon the use of labeled probes to monitor the amplification product.
  • Real-time quantitative methylation specific PCR techniques comprise the use of Amplifluor primers and/or Molecular Beacon probes and/or Fret probes and/or Scorpion primers and/or Taqman probes and/or oligonucleotide blockers (eg. HeavyMethyl approach) and/or DzyNA primers. All these probes and primers have been described and their mode of action is well known in the art.
  • the methods of the invention use unmethylated specific primers indicated by SEQ ID NO's 63, 64, 69 and 70 and/or methylated specific primers indicated by SEQ ID NO's 61, 62, 67 and 68.
  • PCR RNA amplification
  • amplification methods such as NASBA, 3SR, TMA, LCR, selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primed polymerase chain reaction (US Patent No 4,437,975), arbitrarily primed polymerase chain reaction (WO 90/06995), invader technology, strand displacement technlology, and nick displacement amplification (WO 2004/067726) may be used to amplify the appropriate nucleic acid.
  • NASBA 3SR
  • TMA LCR
  • selective amplification of target polynucleotide sequences US Patent No. 6,410,276
  • consensus sequence primed polymerase chain reaction US Patent No 4,437,975
  • arbitrarily primed polymerase chain reaction WO 90/06995
  • invader technology strand displacement technlology
  • nick displacement amplification WO 2004/067726
  • Primers may be designed in both the sense and antisense orientation to direct sequencing across the relevant region of the genes of this invention. Said primers can easily be designed by a person skilled in the art.
  • This invention provides prognostic and/or diagnostic tools or means to determine a prostate cancer and to distinguish between androgen sensitivity and androgen independency of such prostate cancer. Methylation changes are not only ideal for screening purposes, but also interesting targets for monitoring staging or grading of the cancer.
  • Methods for identifying a prostate cell proliferative disorder in a subject can comprise the steps of: a) obtaining a biological sample from the subject; b) determining the methylation state of CpG island upstream and/or downstream of the TSS region and/or in the promoter of the genes of this invention; and c) identifying hypermethylation of the region(s) of PITX2, and HOXD3, wherein hypermethylation on CpG and/or non-CpG dinucleotides of said gene(s) is identified as being different when compared to the same region(s) of the gene(s) or associated regulatory region in a subject not having the prostate cellular proliferative disorder: or wherein detection of said hypermethylation is indicative for the stage/type or grade of the prostate cancer.
  • This unexpected finding allows to diagnose for hormone-independent cancers by a simple assay that detects the hypermethylated CpG islands in the promoter region or upstream of the promoter region of the genes of this invention directly by for instance restriction endonuclease analysis to select the proper treatment for subjects with a prostate cancer, depending on the fact of the prostate cancer is hormone refractory or hormone sensitive or depending on the stage or grade of prostate cancer as can be indicated by the hypermethylation status. This is more reliable than detecting levels of mRNA or gene products of said genes.
  • the diagnostic methods will also allow to indicate the proper treatment for hormone -refractory cancers or avoid that subjects with an hormone sensitive cancer will receive an inadequate treatment or assure that they can be treated differently.
  • patients by the diagnosis of present invention to have hypermethylation of a CpG island in the promoter region or upstream of the promoter region of PITX2, and HOXD3, can be subjected to an antimitotic drug therapy methods of treatment or the treatment can now adequately be directed to replacing the hypermethylated CpG islands (or non-CpG islands) with a non-methylated islands which for instance is possible by a treatment with a therapeutically sufficient dosage of a pharmaceutically acceptable DNA methylation inhibitor.
  • the findings of the present invention allow to diagnose prostatic cells or tissues for prostate cancer and to distinguish between a condition of benign prostate hyperplasia and prostate cancer.
  • the findings of present invention now specifically allow to diagnose for androgen- independent prostate cancer (AIPC) by a simple assay that detects the hypermethylated promoter or upstream region of the promoter directly of the genes of this invention (PITX2, and HOXD3) and to select the proper treatment for subjects with this AIPC or avoid that subjects with an androgen sensitive cancer will receive an inadequate treatment or allow that a such subject will be treated differently than subjects with androgen-sensitive prostate cancer.
  • AIPC androgen- independent prostate cancer
  • Example 1 Materials and Methods Patients and sample collection
  • PCa prostate cancer
  • PCa2 cohort 67 PCa samples
  • PCa3 cohort 16 PCa samples
  • All paraffin embedded were obtained from the UZ Leuven (Leuven, Belgium).
  • Characteristics of the cohorts of patients analyzed are represented in Table 1.
  • the PCal A cohort represents the high-risk patients of PCal .
  • the PCa2A cohort represents a further cohort of high-risk patients, of which PCa2 represent the untreated ones.
  • PCa patients from PCal cohort were selected based on following criteria:
  • prostate cell lines LNCaP, DU 145, PC-3, PZ-HPV-7, BPH1 American Type Culture Collection, Rockville, MD, USA
  • human genomic DNA Clontech Laboratories, Inc., Mountain View, CA, USA
  • PCal 75 (69 final) PCa with high-risk for nodal involvement based on - 3.5 year follow-up
  • PCa2 67 The patients of PCa2A cohort that were not
  • High risk PCa patients are based on the EAU-NCCN guidelines, meaning cT3-cT4 or biopsy Gleason score 8-10 or PSA>20 ng/ml.
  • Genomic DNA was extracted using the GenElute Mammalian Genomic DNA Purification Kit (Sigma-Aldrich, St. Louis, MO, USA) for cell lines and snap-forzen tissues, and the WaxFreeTM DNA kit (TrimGen, Sparks, MD, USA) for paraffin-embedded tissues following the manufacturer's protocol.
  • concentration of DNA was determined with the spectrophotometer NanoDrop ND-1000 (Thermo Fisher Scientific, Wilmington, DE, USA). Methylation analysis
  • Genomic DNA from all prostrate samples (500 ng) was bisulfite-converted using the EZ DNA methylation kit (Zymo Research Corp., Orange, CA, USA) according to the manufacturer's protocol. The final elution of bisulfite treated DNA was done in 25 ul elution buffer. Samples were stored at -80°C. The modified DNA was used as a template for quantitative multiplex nested-MSP.
  • step 1 Quantitative multiplex nested MSP analysis was performed in two subsequent steps.
  • multiplex nested PCR was performed to co-amplify 12 genes, using external primer pairs independent of DNA methylation, i.e. containing no CpG sites, or no more than one CpG site close to 5' end, designed according to guidelines (MSP PCR, PCR11). All primers are listed in Table 2.
  • PCR was performed in a volume of 25 ul containing reaction buffer (16.6 mM (NH 4 ) 2 S0 4 , 67.0 mM Tris pH 8.8, 6.7 mM MgCl 2 x6H 2 0, 10.0 mM ⁇ -mercapto-ethanol), 2,5 ul of dNTP Mix 2mM each (Fermentas GmbH, St. Leon-Rot, Germany), 2.5 ul of 10* 24 primer mix 2uM each primer (Sigma-Aldrich N.V. Bornem, Belgium), 0.5U IMMOLASETM DNA polymerase (Bioline USA Inc., Boston, MA, USA), 3 ul of bisulfite-converted DNA template.
  • reaction buffer 16.6 mM (NH 4 ) 2 S0 4 , 67.0 mM Tris pH 8.8, 6.7 mM MgCl 2 x6H 2 0, 10.0 mM ⁇ -mercapto-ethanol
  • 2,5 ul of dNTP Mix 2mM each Fermentas GmbH
  • Reactions were carried out in triplicate using the following conditions: 95°C for 10 min, then 30 cycles at 95°C for 30 s, 57°C for 30 s, 69°C for 30 s; and a final extension step at 69°C for 3 min.
  • a negative control for the assay (water only) was included.
  • the final PCR product from each triplicate was diluted 1 :500 in sterile distilled water.
  • step 2 separate quantification of methylated and unmethylated DNA fragments of each gene preamplified in step 1 was performed in two independent quantitative reactions (MSP and USP) containing a pair of internal primers, correspondingly, for methylated (M) or unmethylated (U) sequences, for each of 3 repeats separately, on a Rotor-Gene TM 6000 (Corbett Life Science Pty Ltd, Mortlake, NSW, Australia).
  • Reactions were carried out in a volume of 15 ul in the same PCR mix with addition of 0.75 ul EvaGreen® dye (Biotium Inc, Hayward, CA, USA), 0.4 uM of M or U forward and reverse primers (listed in Table 2), 0.3U IMMOLASETM DNA polymerase (Bioline, London, UK) and 2ul of diluted PCR product from multiplex nested PCR. Cycling conditions were as follows: 95°C for 10 min, then 30-35 cycles at 95°C for 20 s, 61°C for 15 s, 69°C for 15 s. Melting curve analysis of amplification products was performed at the end of each PCR reaction by increasing the temperature from 70°C to 95°C by 0.5°C every 10 s.
  • Plasmid M and U clones were obtained by separate amplification of a promoter region of every gene with methylation independent primers using alternatively methylated PCa cell lines (M standard) and human genomic DNA from whole blood (U standard) under the PCR conditions listed above. Amplified fragments were cloned in DH5aTM competent cells (Invitrogen Ltd, Paisley, UK), using pGEM®-T Easy Vector System (Promega Corporation, Madison, WI, USA).
  • PTGS2-NR SEQ. ID NO 24 AAAATAATCCCCACTCTCCTATCTA
  • BCL2-NF2 SEQ. ID NO 29 TTAGTTCGGTGTTATTTGTGGTTT 1 1 1
  • BCL2-NR2 SEQ. ID NO 30 ACGTCAAATACAACTAACTAAACATCTC
  • RASSF1 -NF7S SEQ. ID NO 35 GTCGTTTAGTTTGGATTTTGG 131
  • RASSFl -NR6a SEQ. ID NO 36 CTCAAACTCCCCCGACATAA
  • RASSF1 -MF SEQ. ID NO 37 GGTTCGTTTTGTGGTTTCGTTC 72
  • RASSF1 -MR SEQ. ID NO 38 CCCGATTAAACCCGTACTTCG
  • TDRD 1-NF2 SEQ. ID NO 41 GGAATACGTGGGTATATTGAGTTGT 139
  • TDRD 1-NR2 SEQ. ID NO 42 GACTACCGATACTAAAAACCCTACC
  • TDRD l-UF SEQ. ID NO 45 GTGGGTATATTGAGTTGTATGTGGATGT 63
  • LGALS3-NF SEQ. ID NO 47 AATTTTTTATTTAGGTGATTTTGGAGA 151
  • LGALS3-NR SEQ. ID NO 48 CAAAAACGACCAAAAAACTCC
  • LGALS3-MF SEQ. ID NO 49 AGTTTAGGTTTCGGGAGCGTTAC 61
  • LGALS3-MR SEQ. ID NO 50 ACTAAAAAACGCGACCTCCG
  • LGALS3-UR SEQ. ID NO 52 CAAACACTAAAAAACACAACCTCCA
  • CDH13-NF1 SEQ. ID NO 53 GAGGTTGAGTTTTAATAGTTTAAAGAAGT 104
  • CDH13 NR1 CDH13 NR1 , SEQ. ID NO 54 CTCCCTCGTTTTACATAACAAATAC
  • CDH13 MF2 SEQ. ID NO 55 GATGTTATTTTCGCGGGGTTC 50
  • CDH13 MR CDH13 MR
  • SEQ. ID NO 56 AAATACGAAATAAACACCTCGCG
  • CDH13 UF2 SEQ. ID NO 57 GGGATGTTATTTTTGTGGGGTTT 59
  • PITX2-NF SEQ. ID NO 65 TTTTTGGTTTTAAGATGTTAGGTTAATA 89
  • PITX2-MF SEQ. ID NO 67 GTTAATAGGGAAGCGCGGAGTC 59
  • PITX2-MR SEQ. ID NO 68 AAACACCCAAACGAACGACG
  • GSTP1 -1 1NF SEQ. ID NO 71 GGCGGGATTATTTTTATAAGGTT
  • GSTP1 -1 1NR SEQ. ID NO 72 CTAAAAACTCTAAACCCCATCC
  • GSTP1 -1 1MR SEQ. ID NO 74 CTAATAACGAAAACTACGACGACGA
  • GSTP1 -1 1UF SEQ. ID NO 75 GTTTGGAGGTTGTGAGGTTTTT
  • the HOXD3 promoter region that is amplified by the external HOXD3 primer set corresponds to 909 to 823 bp upstream of its transcription start site (TSS).
  • the HOXD3 TSS is located at chromosome2: 177,028,805 based on hgl9 genome version.
  • the amplicon that is obtained by the external primer pair of PITX2 gene corresponds to position -16 to +73 of the TSS.
  • the PITX2 TSS that is used in this study, is located at chromosome 4: 111,544,254 based on hgl9 genome version and is known as the second TSS, which gives rise to a short alternative splice variant NM_000325.5 (NCBI reference sequence).
  • methylation treshold below which a sample was regarded as unmethylated. The latter was determined for each marker based on its degree of methylation in BPH tissues.
  • the methylation threshold was set at ⁇ %CCND2, 2% for RARB, GSTP1, APC, PTGS2 and BCL2, 5% for TDRDI, 15% for LGALS3, PITX2 and CDH13, 20% for RASSF1 and HOXD3.
  • the second methylation threshold or a cutoff value (CV) was introduced for all markers based on the median methylation value (MV), which was calculated for samples methylated > 1%. If for some gene the median value was lower than the first methylation threshold determined based on methylation of BPH, the latter was applied as a cutoff value.
  • CV cutoff value
  • MV methylation value
  • HM highly methylated
  • LM lowly methylated
  • Categorical clinicopathologic variables included pT stage (I, II vs III, IV), Gleason score (4-7a vs 7b- 10) and lymph nodes (negative vs positive).
  • genotypes comprised three PCa cell lines (androgene-sensitive LNCaP, androgene-refractory PC-3 and DU 145, corresponding to early and late stage cancer) and two benign prostate cell lines PZ- HPV 7 and BPHl, as well as a genomic DNA sample extracted from the whole blood, which corresponds to non-cancerous DNA with regular levels of methylation (Fig. 1A).
  • a genomic DNA sample extracted from the whole blood, which corresponds to non-cancerous DNA with regular levels of methylation
  • Fig. 1A methylation independent primers were designed to amplify promoter fragments of the candidate genes and analyze their methylation status by the melting curve assay to detect the presence of unmethylated and partially or fully methylated copies.
  • the analyzed genes are classified into two groups: hyper- and hypomethylated markers (Table 3).
  • Methylation-independent primers either from the screening step or designed separately were used to amplify a part of a CpG island in the promoter regions of the selected genes. PCR amplification was performed separately for each gene using genotypes that had shown differential methylation of a separate gene by melting curve analysis. Subsequently, the PCR fragments were subcloned in pGEM-T-easy plasmid vector and multiple clones were sequenced. The sequence information was used to validate the correct amplification of the gene and to determine the methylation status of all CG dinucleotides.
  • the plasmids containing the PCR fragment corresponding to the fully methylated and unmethylated DNA, were selected and labeled as plasmid M and U, respectively.
  • a final set of methylation independent primers was designed for amplification of PCR fragments around 100 base pairs (bp) in length whenever possible, but not exceeding 200 bp (listed in Table 1).
  • two sets of nested primers specific for either methylated or unmethylated bisulphite modified DNA sequence of each gene were designed (Table 1).
  • both plasmids M and U were used as a template for amplification with both primer sets (Fig. 3).
  • the advantage of the developed two-step quantitative multiplex nested-MSP assay is that it utilizes the same bisulphite-converted DNA template (which is often very limited in a volume and quantity) to preamplify the selected number of gene promoters of interest in one PCR tube. This makes the procedure independent of sampling and pipeting diversions and allows at the same time to obtain the sufficient amount of the DNA targets for MSP primers to reduce false priming errors.
  • the second quantitative step enables (the researcher) to determine the lowest methylation levels and discriminate between functionally significant and insignificant or background methylation.
  • the developed two-step quantitative multiplex nested-MSP assay was used to determine the degree of methylation of the selected genes in prostate cell lines as well as in PCa samples and BPH genotypes.
  • cancer lines usually exhibit higher levels of CpG island hypermethylation than primary cancers, which may be a result of repeated passages and adaptation to culture environment, as well as of contamination of tumor samples by adjacent normal cells.
  • PCa cell cultures also show more polar methylation values as compared to the PCa samples (Fig. 7 and 8).
  • LNCaP cell line corresponding to hormone-dependent (early stage) PCa surprisingly showed the highest methylation value for 11 out of 14 hypermethylated genes analyzed.
  • two markers of PCa progression and biochemical recurrence CDH13 and HOXD3 were not significantly methylated in this line.
  • PC-3 showed the highest value for 3 genes reported to be associated with biochemical recurrence: APC, PITX2 and HOXD3, DU 145 - for HOXD3 and CDH13.
  • APC, PITX2 and HOXD3, DU 145 - for HOXD3 and CDH13 A combination of these markers has a greater prognostic value in comparison with that of a single marker.
  • both BPH 1 and PZ-HPV7 showed methylation higher than 10 % for 5 different genes each (Fig. 7).
  • methylation higher than 20% was detected for RASSFI, PITX2, HOXD3, TDRD5, TBX20 and SOXl implying that a higher methylation cutoff value must be introduced for these markers to reveal their diagnostic and/or prognostic significance.
  • Methylation of all genes was detected to a much greater extent in tumor samples in comparison with histologically cancer-free adjacent tissues (Fig. 8).
  • PCa samples 1 and 6 have a higher Gleason score 3+4 compared to other samples (GS 3+3).
  • GS 3+3 Gleason score 3+4 compared to other samples
  • 9 and 6 genes respectively, show methylation close to or above the 50%) level.
  • PCa samples 5 and 7 show lower levels of methylation, which corresponds to the notion that the degree of methylation increases with tumor progression.
  • HOXD3 shows methylation above median in a sample PCa 4 and PCa 6, while PITX2 has a higher methylation level in sample PCa 1.
  • the developed two-step quantitative multiplex nested-MSP assay effectively distinguished PCa cell lines from non-malignant cells, as well as PCa tumors from surrounding malignant tissues based on the quantification of the methylation values of 16 markers.
  • the group of PCa-specific markers includes RARB, GSTPl, CCND2, PTGS2, BCL2 (all 5 show 100% specificity at the 2% methylation cutoff value) and APC (98%> specificity).
  • the second group of genes was moderately methylated in BPH samples, so the methylation cutoff value should be raised to 5-20% of methylated gene copies to increase specificity of these markers. This decreased their sensitivity, while specificity still never reached 100% (Table 5). However, we will utilize these markers for prognostic rather than diagnostic purposes.
  • the group of prognostic markers includes LGALS3, TDRD1, RASSF1, PITX2, HOXD3, CDH13.
  • Table 4 Mean methylation values (%) of 12 genes in one BPH and two PCa cohorts.
  • the Table represents the mean methylation values, standard deviations, the median, minimal and maximal methylation values, 25% and 75% percentiles (Ql and Q3).
  • Ql and Q3 percentiles
  • Methylation of markers could be detected, but due to presence of the unmethylated DNA from non- malignant cells the detected methylation levels could be lower than the methylation cutoff set for each separate marker (1-2% methylation for PCa-specific markers, 5-20% for prognostic markers.
  • the two-step quantitative multiplex nested-MSP assay detected PCa cancer with very high efficiency.
  • PCa-specific genes In the PCal cohort only 5 of 69 samples showed no significant methylation of PCa-specific genes.
  • the two-step quantitative multiplex nested-MSP assay showed very high sensitivity for PCa at the 100% with specificity level: 92.75% in the PCal cohort (mixed DNA from malignant and non-malignant cells) and 100.00% in the PCa2 cohort (DNA predominantly from the tumor sites).
  • Methylation-independent tumors may be identified by the two-step quantitative multiplex nested-MSP assay and discriminated from methylation- associated tumors in case if PCa was detected by other diagnostic means.
  • DNA methylation was not associated with the age of patients (Spearman correlation, Table 9). Methylation of PITX2 and HOXD3 was highly associated with pathological tumor pT stage (pT as unordered categorical variable: pTl-2, 3a, 3b, 4; DNA methylation as a continuous variable, Kruskal-Wallis test, Table 8) and ecstracapsular extention (Mann-Whitney U test, Table 8).
  • HOXD3 methylation was associated with seminal vesicle invasion (Mann- Whitney U test, Fisher exact test, Table 8) and lymph node invasion (Mann- Whitney U test, Table 9), although the number of patients with lymph node metastases in the PCa2 cohort was rather low (7 of 67).
  • An association with tumor volume (measured as a percentage of a total gland volume) in the PCa2 cohort was detected for HOXD3 (Mann- Whitney U test, Fig. 9). All statistically significant association between clinicopathologic parameters and DNA methylation at least in one of the two PCa cohorts analyzed are indicated in Table 9.
  • Example 3 Results on prognostic significance of DNA methylation markers.
  • Amplified fragments were cloned in DH5aTM competent cells (Invitrogen Ltd, Paisley, UK), using pGEM®-T Easy Vector System (Promega Corporation, Madison, WI, USA) according to a manufacturer's protocol.
  • APC - M SEQ. ID NO 81 ggaagcggagagagaagtagttgtgtaattcgttggatgcggattagggcgttttttattttcgtcgggagttcg tcgattggttgggtgtgggcgtacgtgatcgatatgtggttgtattggtgtagttcg
  • TDRD 1 - M SEQ. ID NO 91 tgagtttgtaattagagtataagttgttttcggggaaggcggagggaatacgtgggtatattgagttgtacgtgg acgcggagtgcgtaggcgtgcgttgaggttaggagggcgtattggggattggaggcgagggaagtgtagg gcgtatttaggcggtagggtttttagtatcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcggtagtcgg
  • TDRD 1 - U SEQ. ID NO 92 tgagtttgtaattagagtataagttgtttttggggaaggtggagggaatatgtgggtatattgagttgtatgtggat gtggagtgtgtaggtgtgtgttgaggttaggagggtgtattggggattggaggtgagggaagtgtagggtgtcggtagtc
  • LGALS3 - M SEQ. ID NO 93 aattttttatttaggtgattttggagagggcgggggatagacgcggtcgtagtttaggtttcgggagcgttacgg aatttaacggtggtagcggaggtcgcgtttttttagtgttcgcgggagttttttttttcgttcgggagtttttttggtcgtttttgcgg cggcggtttcggcgcggggttcgtttagttttggttcggggagaggattggttgggtaggg gcgtcgttttcgggagaggattggttgggtaggg gcgtcgttttcgggagaggcgggtcgggcggggttgggagtatttgaggttcg
  • CDH13 - M SEQ. ID NO 95 gaggttgagttttaatagtttaaagaagtaaatgggatgttattttcgcggggttcgtttttcgcgaggtgtttattt cgtatttgttatgtaaacgagggag
  • DNA methylation was examined within univariate and multivariate Cox proportional hazards regression models for biochemical recurrence (BCR)-free survival and Clinical failure (CF)- free survival. -values refer to the Wald test. DNA methylation is analyzed as a continuous variable. Using a multivariate Cox proportional hazard regression model comprising clinicopathological and methylation variables as indicated in the tables, the relative contribution of each variable to BCR or CF was assessed.
  • PITX2 and HOXD3 are univariate but not multivariate predictors for biochemical recurrence (BCR)
  • a two-gene model consisting of PITX2 and HOXD3, is an independent significant predictor, both univariate and multivariate for BCR in the context of known prognostic clinical variables.
  • the multivariate models on the cohort PCa2A and PCa2 are the two-gene models PITX2*0.022862+HOXD3*0.0014012 (two-gene model A) and PITX2*0.020677+ HOXD3*0.0043132 (two-gene model B), respectively (Table D).
  • Cox proportional hazard regression analysis showed that the cross-validated two-gene model A had a P- value of 0.00046288 (Wald test) and HR of 4.3517 (95% CI 1.9-9.9) in the cohort PCa2A (Table D). In the validation set PCal, this model had a P-value of 0.0041718 and hazard ratio of 11.1273 (95% CI 2.1-57.84).
  • the cross-validated two-gene model B had a P-value of 0.00039066 and a HR of 4.8467 (95% 2.0259-11.5953) in the cohort PCa2, and a P-value of 0.0044938 and a HR of 11.83 (95% CI 2.15-65.04) in the independent validation cohort PCal A.
  • the two-gene model A and B is an independent predictor of BCR, as shown by multivariate analysis (Table E-F) in the PCa2A group and PCa2 groups, respectively.
  • the two-gene PITX2+HOXD3 methylation model A added independent prognostic information to known prognostic clinicopathologic parameters like pre -operative PSA, final Gleason score, surgical margin status (HR 3.3, 95% CI 1.4-7.8; P-value 0.0065225, Table F).
  • the two-gene PITX2+HOXD3 methylation model B added independent prognostic information to known prognostic clinicopathologic parameters like pre-patho logical T-stage and surgical margin status (HR 3.1, 95% CI 1.1-9.0, P-value 0.04047, Table F).
  • a two-gene methylation model consisting of both PITX2 and HOXD3, but not PITX2 or HOXD3 separately, is an independent significant predictor for BCR in the context of known prognostic clinical variables (compare Table B, C with F).
  • HOXD3 1.01897566 0.09793689 0.99654132 1.04191504 pre.op.PSA 1.01556351 0.07081252 0.99869056 1.03272153 pathological.T.stage.grouped 3.26790425 0.00097063 1.61706962 6.60404354 final. Gleason. Score 1.26678087 0.46692734 0.66989661 2.39549467 surgical.margin.status 2.89802382 0.00958351 1.29562062 6.48225406 lymph.node nvasion 1.08148243 0.91026705 0.27694682 4.22320875
  • Adjuvant.RT 0.19607238 0.04318491 0.04041232 0.95130346
  • Table C Multivariate Cox Proportional Hazard Model analyses on BCR-free survival PITX2 methylation (%), pre-operative PSA, pathological stage, final Gleason score, surgical margin status, lymph node invasion, adjuvant radiotherapy (RT) and adjuvant hormonal therapy (ADT) in cohort PCa2.
  • HR Hazard ratio; BCR, Biochemical recurrence, CI, confidence
  • Table D Univariate Cox Proportional Hazard Model analyses on BCR-free survival for two- gene models A (PITX2*0.022862 + HOXD3*0.0014012) and B (PITX2*0.020677 + HOXD3*0.0043132).
  • HR Hazard ratio
  • BCR Biochemical recurrence
  • CI confidence intervals
  • Table E Multivariate Cox Proportional Hazard Model analyses on BCR-free survival for two- gene model A (PITX2*0.022862 + HOXD3*0.0014012), pre-operative PSA, clinical stage, final Gleason score, surgical margin status, lymph node invasion, adjuvant radiotherapy (RT) and adjuvant hormonal therapy (ADT) in cohort PCa2A.
  • HR Hazard ratio
  • BCR Biochemical recurrence
  • CI confidence intervals.
  • Adjuvant.RT 0.190680152 0.0160051 0.05 0.73
  • Adiuvant.ADT 0.509708341 0.2708728 0.15 1.69
  • Table F Multivariate Cox Proportional Hazard Model analyses on BCR-free survival for two- gene model B (PITX2*0.020677 + HOXD3*0.0043132), pre-operative PSA, pathological stage, final Gleason score, surgical margin status, lymph node invasion, adjuvant radiotherapy (RT) and adjuvant hormonal therapy (ADT) in cohort PCa2.
  • HR Hazard ratio
  • BCR Biochemical recurrence
  • CI confidence intervals.
  • Adjuvant.RT 0.230679729 0.0731373 0.05 1.15
  • Table G Univariate Cox Proportional Hazard Model analyses on Clinical failure-free survival for DNA methylation of 11 genes in cohort PCa2.
  • HR Hazard ratio;
  • CI confidence intervals.
  • Table H Multivariate Cox Proportional Hazard Model analyses on CF-free survival DNA methylation of PITX2, pre-operatieve PSA, pathological stage, final Gleason score, surgical margin status, lymph node invasion, adjuvant radiotherapy and adjuvant hormonal therapy in cohort PCa2.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Cette invention concerne en général une méthode de diagnostic et de pronostic, en particulier de détermination du stade et/ou de typage et/ou de prédiction du résultat, pour distinguer entre une hyperplasie bénigne de la prostate et un cancer de la prostate, et entre un état cancéreux de la prostate sensible à une hormone et réfractaire à une hormone et, en particulier, d'identification d'îlots CpG différentiellement méthylés dans les régions régulatrices entourant le site d'initiation de la transcription d'au moins un gène marqueur de la présente invention en tant qu'indicateur de diagnostic et/ou de pronostic du cancer de la prostate (PrCA) et pour distinguer un cancer de la prostate réfractaire aux androgènes d'un cancer de la prostate sensible aux androgènes. Les gènes marqueurs de la présente invention comprennent PITX2 et HOXD3. Cette invention concerne plus particulièrement la détection de l'hyperméthylation de PITX2 et HOXD3. Cette invention concerne en outre la prédiction, le pronostic et/ou le diagnostic du cancer de la prostate, notamment la métastase, plus particulièrement chez des patients atteints du cancer de la prostate. Des gènes marqueurs ont été identifiés dont les régions promotrices contiennent des régions différentiellement méthylées, en comparaison à un échantillon de référence, qui sont indicateurs pour la prédiction ou le pronostic du cancer de la prostate.
PCT/EP2013/056510 2012-04-06 2013-03-27 Diagnostic, détermination du stade et pronostic du cancer de la prostate à base d'un gène marqueur WO2013149904A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB1206209.7 2012-04-06
GB201206209A GB201206209D0 (en) 2012-04-06 2012-04-06 Marker gene based diagnosis, staging and prognosis of prostate caner
EPPCT/EP2012/068810 2012-09-24
PCT/EP2012/068810 WO2013041731A1 (fr) 2011-09-23 2012-09-24 Diagnostic, stadification et pronostic du cancer de la prostate sur la base d'un gène marqueur

Publications (1)

Publication Number Publication Date
WO2013149904A1 true WO2013149904A1 (fr) 2013-10-10

Family

ID=46176998

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2012/068810 WO2013041731A1 (fr) 2011-09-23 2012-09-24 Diagnostic, stadification et pronostic du cancer de la prostate sur la base d'un gène marqueur
PCT/EP2013/056510 WO2013149904A1 (fr) 2012-04-06 2013-03-27 Diagnostic, détermination du stade et pronostic du cancer de la prostate à base d'un gène marqueur

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/068810 WO2013041731A1 (fr) 2011-09-23 2012-09-24 Diagnostic, stadification et pronostic du cancer de la prostate sur la base d'un gène marqueur

Country Status (2)

Country Link
GB (1) GB201206209D0 (fr)
WO (2) WO2013041731A1 (fr)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015070045A1 (fr) * 2013-11-08 2015-05-14 Baylor College Of Medicine Nouveaux marqueurs diagnostiques/pronostiques et cible thérapeutique pour le cancer
GB201322034D0 (en) 2013-12-12 2014-01-29 Almac Diagnostics Ltd Prostate cancer classification
US10619210B2 (en) 2014-02-07 2020-04-14 The Johns Hopkins University Predicting response to epigenetic drug therapy
WO2016036994A1 (fr) * 2014-09-04 2016-03-10 Miodx Procédé d'analyse permettant d'éviter une intervention chirurgicale
EP3037545A1 (fr) * 2014-12-23 2016-06-29 The Provost, Fellows, Foundation Scholars, & the other members of Board, of the College of the Holy & Undiv. Trinity of Queen Elizabeth near Dublin Test de méthylation d'ADN pour le cancer de la prostate
WO2017114754A1 (fr) * 2015-12-30 2017-07-06 Technische Universität Dresden Procédés et moyens de diagnostic de tumeurs
US11795495B1 (en) * 2019-10-02 2023-10-24 FOXO Labs Inc. Machine learned epigenetic status estimator
CN113215260A (zh) * 2021-06-18 2021-08-06 杭州昱鼎生物科技有限公司 一种gstp1，apc和rassf1在制备前列腺癌标志物中的应用及其试剂盒
CN116179694A (zh) * 2022-11-02 2023-05-30 武汉艾米森生命科技有限公司 检测甲基化水平的试剂在制备前列腺癌诊断产品中的应用以及前列腺癌诊断试剂盒
CN116083588B (zh) * 2023-03-09 2023-09-12 嘉兴允英医学检验有限公司 作为前列腺癌标志物的dna甲基化位点组合及其应用

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4437975A (en) 1977-07-20 1984-03-20 Mobil Oil Corporation Manufacture of lube base stock oil
WO1990006995A1 (fr) 1988-12-16 1990-06-28 Siska Diagnostics, Inc. Systeme auto-entretenu de replication sequentielle
US6410276B1 (en) 1987-07-31 2002-06-25 The Board Of Trustees Of The Leland Stanford Junior University Selective amplification of target polynucleotide sequences
US6506735B1 (en) 1998-02-03 2003-01-14 Methyl Gene, Inc. Optimized antisense oligonucleotides complementary to DNA methyltransferase sequences
WO2004067726A2 (fr) 2003-01-29 2004-08-12 Keck Graduate Institute Reactions isothermes pour amplification d'oligonucleotides
US6953783B1 (en) 1998-10-19 2005-10-11 Methylgene, Inc. Modulation of gene expression by combination therapy
WO2007039291A2 (fr) * 2005-10-03 2007-04-12 Epigenomics Ag Methodes, appareil et nomogrammes utilises pour determiner la progression du cancer de la prostate

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1730160A4 (fr) * 2004-03-17 2008-04-09 Univ Johns Hopkins Compositions servant a diagnostiquer une neoplasie, et methodes d'utilisation desdites compositions
US8268549B2 (en) * 2005-04-15 2012-09-18 University Of Maryland, Baltimore Method and assay for determining methylation of GAL3 promoter for early diagnosis of prostate cancer
WO2009089598A2 (fr) * 2008-01-18 2009-07-23 Katholieke Universiteit Leuven Diagnostic à base de gène msmb, stadification et pronostic du cancer de la prostate
EP2291553A4 (fr) * 2008-05-28 2011-12-14 Genomedx Biosciences Inc Systèmes et procédés de discrimination basée sur l expression d états pathologiques cliniques distincts dans le cancer de la prostate

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4437975A (en) 1977-07-20 1984-03-20 Mobil Oil Corporation Manufacture of lube base stock oil
US6410276B1 (en) 1987-07-31 2002-06-25 The Board Of Trustees Of The Leland Stanford Junior University Selective amplification of target polynucleotide sequences
WO1990006995A1 (fr) 1988-12-16 1990-06-28 Siska Diagnostics, Inc. Systeme auto-entretenu de replication sequentielle
US6506735B1 (en) 1998-02-03 2003-01-14 Methyl Gene, Inc. Optimized antisense oligonucleotides complementary to DNA methyltransferase sequences
US6953783B1 (en) 1998-10-19 2005-10-11 Methylgene, Inc. Modulation of gene expression by combination therapy
WO2004067726A2 (fr) 2003-01-29 2004-08-12 Keck Graduate Institute Reactions isothermes pour amplification d'oligonucleotides
WO2007039291A2 (fr) * 2005-10-03 2007-04-12 Epigenomics Ag Methodes, appareil et nomogrammes utilises pour determiner la progression du cancer de la prostate

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
AHMED H; CAPPELLO F; RODOLICO V; VASTA GR.: "Evidence of heavy methylation in the galectin 3 promoter in early stages of prostate adenocarcinoma: development and validation of a methylated marker for early diagnosis of prostate cancer", TRANSL ONCOL., vol. 2, no. 3, 2009, pages 146 - 56
ANTOINETTE S PERRY ET AL., ENDOCRINE-RELATED CANCER, vol. 13, no. 2, pages 357 - 377
CHOU; TALALAY, ADV. ENZYME REGUL., vol. 22, 1984, pages 27 - 55
CHUNG W; KWABI-ADDO B; ITTMANN M; JELINEK J; SHEN L; YU Y; ISSA JP.: "Identification of novel tumor markers in prostate, colon and breast cancer by unbiased methylation profiling", PLOS ONE, vol. 3, no. 4, 30 April 2008 (2008-04-30), pages E2079, XP055031393, DOI: doi:10.1371/journal.pone.0002079
CONCATO J ET AL., ARCH INTERN MED., vol. 166, 2006, pages 38 - 43
DAVIS AJ ET AL., 11TH NCI-EORTC-AACR SYMPOSIUM ON NEW DRUGS IN CANCER THERAPY, 7 November 2000 (2000-11-07), pages 94
DR F. H. SCHRODER ET AL., THE PROSTATE, vol. 21, no. S4, 20 July 2006 (2006-07-20), pages 129 - 138
GHEI, M; PERICLEOUS S ET AL., ANN R COLL SURG ENGL, vol. 87, no. 5, September 2005 (2005-09-01), pages 386 - 7
IBRAGIMOVA I; IBÁÑEZ DE CACERES I; HOFFMAN AM; POTAPOVA A; DULAIMI E; AL-SALEEM T; HUDES GR; OCHS MF; CAIRNS P.: "Global reactivation of epigenetically silenced genes in prostate cancer", CANCER PREV RES (PHILA, vol. 3, no. 9, 2010, pages 1084 - 92
KIM JH; DHANASEKARAN SM; PRENSNER JR; CAO X; ROBINSON D; KALYANA-SUNDARAM S; HUANG C; SHANKAR S; JING X; IYER M: "Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer", GENOME RES., vol. 21, no. 7, 2011, pages 1028 - 41, XP009151377, DOI: doi:10.1101/gr.119347.110
KRON ET AL., LABORATORY INVESTIGATION, vol. 90, 2010, pages 1060 - 1067
KRON KEN J ET AL: "DNA methylation of HOXD3 as a marker of prostate cancer progression.", LABORATORY INVESTIGATION; A JOURNAL OF TECHNICAL METHODS AND PATHOLOGY JUL 2010, vol. 90, no. 7, July 2010 (2010-07-01), pages 1060 - 1067, XP002697279, ISSN: 1530-0307 *
LIYANG LIU ET AL: "Association of tissue promoter methylation levels of APC, TGF[beta]2, HOXD3 and RASSF1A with prostate cancer progression", INTERNATIONAL JOURNAL OF CANCER, vol. 129, no. 10, 15 November 2011 (2011-11-15), pages 2454 - 2462, XP055063315, ISSN: 0020-7136, DOI: 10.1002/ijc.25908 *
MAHAPATRA S; KLEE EW; YOUNG CY; SUN Z; JIMENEZ RE; KLEE GG; TINDALL DJ; DONKENA KV.: "Global methylation profiling for risk prediction of prostate cancer", CLIN CANCER RES., vol. 18, no. 10, 15 May 2012 (2012-05-15), pages 2882 - 95
ORAL ONCOLOGY, vol. 42, 2006, pages 5 - 13
RAMCHANDANI S ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 94, January 1997 (1997-01-01), pages 684 - 689
STEWART D ET AL., 11TH NCI-EORTC-AACR SYMPOSIUM ON NEW DRUGS IN CANCER THERAPY, 7 November 2000 (2000-11-07), pages 148
STEWART DJ ET AL., ANNALS OF ONCOLOGY, vol. 14, May 2003 (2003-05-01), pages 766 - 774
TIBSHIRANI R; HASTIE T; FRIEDMAN J.: "Regularization Paths for Generalized Linear Models via Coordinate Descent", JOURNAL OF STATISTICAL SOFTWARE, vol. 33, 2010, pages 1 - 22
WEISS ET AL., J. UROL, vol. 181, no. 4, 2009, pages 1678 - 1685
WEISS G ET AL: "DNA Methylation of the PITX2 Gene Promoter Region is a Strong Independent Prognostic Marker of Biochemical Recurrence in Patients With Prostate Cancer After Radical Prostatectomy", JOURNAL OF UROLOGY, LIPPINCOTT WILLIAMS & WILKINS, BALTIMORE, MD, US, vol. 181, no. 4, 1 April 2009 (2009-04-01), pages 1678 - 1685, XP026013957, ISSN: 0022-5347, [retrieved on 20090223], DOI: 10.1016/J.JURO.2008.11.120 *
WINQUIST E ET AL., EUROPEAN JOURNAL OF CANCER, vol. 38, no. 7, November 2002 (2002-11-01), pages 141
YOO DB ET AL., CANCER RESEARCH, vol. 67, no. 13, 1 July 2007 (2007-07-01), pages 6400 - 6408

Also Published As

Publication number Publication date
WO2013041731A1 (fr) 2013-03-28
GB201206209D0 (en) 2012-05-23

Similar Documents

Publication Publication Date Title
WO2013149904A1 (fr) Diagnostic, détermination du stade et pronostic du cancer de la prostate à base d'un gène marqueur
US10113202B2 (en) Method for determining the methylation status of the promoter region of the TWIST1 gene in genomic DNA from bladder cells
JP6141896B2 (ja) 選択された遺伝子のエピジェネティックな変化及び癌
KR101219794B1 (ko) Ｈｏｘａ１１유전자의 메틸화 수준을 측정하는 제제를 포함하는 비소세포폐암 진단용 조성물 및 이를 이용한 비소세포폐암 진단방법
JP2010517582A (ja) 結腸癌の早期検出および予後診断の方法
JP2017507320A (ja) 前立腺癌分類
EP3430162B1 (fr) Marqueur de methylation pour le cancer du pancréas
JP6242388B2 (ja) 前立腺ガンのバイオマーカー
WO2013095956A1 (fr) Micro-arn-148a en tant que biomarqueur pour le cancer colorectal de stade avancé
US9845506B2 (en) Method for determining prognosis of prostate cancer in a subject
Rusiecki et al. Global DNA methylation and tumor suppressor gene promoter methylation and gastric cancer risk in an Omani Arab population
CN111440863A (zh) Kazn基因甲基化检测试剂在制备结直肠癌预后诊断试剂中的应用
Angulo et al. DNA methylation and urological cancer, a step towards personalized medicine: current and future prospects
Yoon et al. Pyrosequencing analysis of APC methylation level in human prostate tissues: a molecular marker for prostate cancer
Liu et al. DNA hypermethylation of MAL gene may act as an independent predictor of favorable prognosis in patients with colorectal cancer
US20220267858A1 (en) Characterization of prostate cancer using dna methylation assay system
Wang et al. Effect of upregulation of DD3 on early detection and prognosis in prostate cancer
M Murphy et al. Multigene Methylation Biomarker Analysis in Prostate Cancer
Asefi et al. A novel epigenetic biomarker, plasma miR-138-5p gene promoter-methylated DNA, for colorectal cancer diagnosis
WO2009074364A1 (fr) Nouveau marqueur pronostique du cancer du sein
EP3464620B1 (fr) Détermination de la prédisposition génétique au cancer agressif de la prostate
Baryshev et al. Allele-specific methylation of the PSA promoter in prostate cells: a new translational marker for the differential diagnosis of prostate cancer
Constâncio Cell-free DNA methylation as a biomarker for early detection of the three major cancers in males
Daniūnaitė Diagnostic and prognostic DNA methylation biomarkers of prostate cancer
Kwan Epigenetic Study of Plasma Circulating DNA in Prostate Cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13713836

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13713836

Country of ref document: EP

Kind code of ref document: A1