WO2013148337A1 - Methods for treating neoplasia - Google Patents
Methods for treating neoplasia Download PDFInfo
- Publication number
- WO2013148337A1 WO2013148337A1 PCT/US2013/032269 US2013032269W WO2013148337A1 WO 2013148337 A1 WO2013148337 A1 WO 2013148337A1 US 2013032269 W US2013032269 W US 2013032269W WO 2013148337 A1 WO2013148337 A1 WO 2013148337A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- alt
- fusion protein
- cells
- tumor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
- A61K38/2013—IL-2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
- A61K33/243—Platinum; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/08—Peptides having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/1774—Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/21—Interferons [IFN]
- A61K38/212—IFN-alpha
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/10—Drugs for disorders of the urinary system of the bladder
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/32—Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
Definitions
- bladder cancer (also referred to herein as urothelial cancer) is the fourth most common type of cancer in men and the ninth most common cancer in women, with an estimated 70,500 new cases (52,760 men and 17,770 women) and 14,680 deaths (10,410 men and 4,270 women) annually (Jemal, A. et al., CA Cancer J Clin, 60: 277-300, 2010).
- Localized disease is often treated using immunotherapy (Bacillus Calmette-Guerin), an electrocautery device connected to a cytoscope, or by cystectomy.
- Advanced disease is often treated by chemotherapy or a combination of chemotherapy and radiation.
- the median survival is approximately 7 to 8 months (Raghavan, D.
- the present invention features methods of treating cancer.
- the invention features administering an IL-2 fusion protein in combination with one or more therapeutic agents to a subject having cancer in an effective amount to treat the cancer.
- the invention generally features a method of ameliorating cancer in a subject involving administering an effective amount of an IL-2 fusion protein and one or more therapeutic agents to the subject in need thereof, thereby ameliorate the cancer.
- the invention features a method of reducing tumor burden in a subject involving administering an effective amount of an IL-2 fusion protein and a therapeutic agent to the subject in need thereof, thereby reducing the tumor volume.
- the invention features a method of treating chemo-resistant cancer in a subject involving administering an effective amount of an IL-2 fusion protein and a therapeutic agent to the subject in need thereof, thereby treating the chemo-resistant cancer.
- the invention features a method of inducing a durable
- immunological memory response against cancer in a subject involving administering an effective amount of an IL-2 fusion protein and a therapeutic agent to the subject in need thereof, thereby inducing a durable immunological memory response against cancer.
- the invention features a method of increasing the survival of a subject having cancer involving administering an effective amount of an IL-2 fusion protein and a therapeutic agent to the subject in need thereof, thereby increasing the survival of the subject.
- the invention features a kit for the treatment of bladder cancer containing an IL-2 fusion protein and one or more therapeutic agents.
- the IL-2 fusion protein does not specifically target or bind to the cancer.
- the IL-2 fusion protein comprises a T cell receptor (TCR) domain.
- T cell receptor domain is a single chain T cell receptor.
- the one or more therapeutic agents are selected from the group consisting of abiraterone acetate, altretamine, anhydrovinblastine, auristatin, azacitidin, AZD 8477, bendamustin, bevacizumab, bexarotene, bicalutamide, BMS 184476, 2,3,4,5,6- pentafluoro-N-(3-fluoro-4-methoxyphenyl)benzene sulfonamide, bleomycin, bortezomib, N,N-dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-proly- 1-Lproline-t-butylamide, cachectin, capecitabin, cemadotin, cetuximab, chlorambucil, cyclophosphamide, 3',4'-didehydro-4'- deoxy-8'-norvin- caleuk
- mechlorethamine nitrogen mustard
- melphalan mivobulin isethionate
- rhizoxin sertenef
- streptozocin mitomycin, methotrexate, 5-fluorouracil, nilutamide, onapristone, oxaliplatin, paclitaxel, panitumumab, pazopanib, pralatrexate, prednimustine, piritrexim, procarbazine, pyrazoloacridine, rituximab, RPR109881, romidepsin, sorafinib, stramustine phosphate, sunitinib, tamoxifen, tasonermin, taxol, temozolomide, topotecan, transtuzumab, tretinoin, trimetrexate, vemurafenib, vinblastine, vincristine, vindesine sulfate, vinflunine
- the one or more therapeutic agents are selected from the group consisting of gemcitabine and platinum-based compounds including cisplatin.
- the cancer is selected from the group consisting of bladder cancer, urothelial cancer of the urethra, ureter and renal pelvis, kidney cancer, breast cancer, colon cancer, head and neck cancer, lung cancer, prostate cancer, glioblastoma, osteosarcoma, liposarcoma, soft-tissue sarcoma, ovarian cancer, melanoma, liver cancer, esophageal cancer, pancreatic cancer and stomach cancer.
- the cancer is bladder or urothelial cancer.
- the cancer is chemo-resistant.
- the IL-2 fusion protein and the one or more therapeutic agents are administered within about 7-14 days. In yet other embodiments the IL-2 fusion protein and the one or more therapeutic agents are administered within about 3-5 days or are administered concurrently. In additional embodiments the IL-2 fusion protein is ALT-801 and the one or more therapeutic agents is cisplatin. In further embodiments the one or more therapeutic agents is gemcitabine. In yet additional embodiments the IL-2 fusion protein specifically targets the cancer cells. In some embodiments the IL-2 fusion protein specifically targets p53 peptide/HLA complexes on the surface of the cancer cells.
- tumor burden also called “tumor load” is meant the number of cancer cells, the size of a tumor, or the amount of cancer in the body.
- IL-2 fusion protein is meant a polypeptide that contains the entire full length IL- 2 protein or a biologically active fragment thereof fused to a second polypeptide.
- the second polypeptide may be a targeting polypeptide, i.e., an antibody or antigen binding fragment thereof; a T cell receptor (TCR) or a peptide binding fragment thereof; a receptor or a ligand binding domain thereof; etc., wherein the second polypeptide specifically targets or directs the IL-2 fusion protein to a cancer cell.
- the second polypeptide can be a non- targeting polypeptide, i.e., a polypeptide that does not specifically target or direct the IL-2 fusion protein to a cancer cell.
- T cell receptor (TCR) domain is meant a polypeptide that comprises all of the portions of a T cell receptor necessary to bind the cognate peptide presented in the appropriate MHC or HLA molecule.
- TCR domains are described in U.S. Patent No. 7,456,263; U.S. Patent No. 6,534,633; U.S. Patent Application Publication No. US2003/0144474; and U.S. Patent Application Publication No. US2011/0070191, which are incorporated by reference herein in their entirety.
- ALT-801 is meant a fusion between IL-2 and a TCR domain capable of binding human p53 peptide (aa 264-272) HLA-A*0201 (c264scTCR-IL-2).
- An illustrative amino acid sequence of ALT-801, including the signal sequence, is:
- MART-lscTCR/IL-2 a fusion between IL-2 and a TCR domain capable of binding MART-1 peptide (aa 27-35) presented in the context of HLA-A*0201.
- An illustrative amino acid sequence of MART-1 scTCR/IL-2, including the signal sequence, is:
- An illustrative nucleic acid encoding MART-lscTCR/IL-2 is: atggagacagacacactcctgttatgggtactgctgctctgggttccaggtt ccaccggtcagaaggaggtggagcagaattctggacccctcagtgttccaga gggagccattgcctctctcaactgcacttacagtgaccgaggttcccagtcc ttctggtacagacaatattctgggaaaagccctgagttgataatgttca tatactccaatggtgacaaagaagatggaaggtttacagcagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattca gcacctacct
- therapeutic agent any chemotherapeutic or biotherapeutic agent that is used in the treatment of cancer.
- therapeutic agents include abiraterone acetate, altretamine, anhydrovinblastine, auristatin, azacitidin, AZD 8477, bendamustin, bevacizumab, bexarotene, bicalutamide, BMS184476, 2,3,4,5, 6-pentafluoro-N- (3-fluoro-4-methoxyphenyl)benzene sulfonamide, bleomycin, bortezomib, N,N-dimethyl-L- valyl-L-valyl-N-methyl-L-valyl-L-proly- 1-Lproline-t-butylamide, cachectin, capecitabin, cemadotin, cetuximab, chlorambucil, cyclophosphamide, 3',
- BCNU BCNU
- CNU carboxyribonucleic acid
- DTIC dacarbazine
- dactinomycin dasatinib, daunorubicin, dolastatin, dovitinib, doxorubicin (adriamycin), epirubicin, epothilone B, erlotinib, eribulin, etoposide, everolimus, 5-fluorouracil, finasteride, flutamide, gefitinib, gemcitabine, hydroxyurea and hydroxyureataxanes, ifosfamide, interferon alfa, imatinib, ipilimumab, irinotecan, largotaxel, lapatinib, lenalidomid, liarozole, lonafarnib, lonidamine, lomustine (CCNU), mechlorethamine (nitrogen mustard),
- RPR109881 romidepsin, sorafinib, stramustine phosphate, sunitinib, tamoxifen, tasonermin, taxol, temozolomide, topotecan, transtuzumab, tretinoin, trimetrexate, vemurafenib, vinblastine, vincristine, vindesine sulfate, vinflunine, and vorinostat.
- chemo-resistant is meant a cancer or cancer cell that has become resistant to one or more therapeutic agents.
- ameliorate is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease.
- inducing a durable immunological memory response against tumors is meant treatment-induced resistance to subsequent challenge or regrowth of a tumor or cancerous growth.
- alteration is meant a change (increase or decrease) in the expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein.
- an alteration includes a 10% change in expression levels, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels.
- an analog is meant a molecule that is not identical, but has analogous functional or structural features.
- a polypeptide analog retains the biological activity of a corresponding naturally-occurring polypeptide, while having certain biochemical modifications that enhance the analog's function relative to a naturally occurring polypeptide. Such biochemical modifications could increase the analog's protease resistance, membrane permeability, or half-life, without altering, for example, ligand binding.
- An analog may include an unnatural amino acid.
- Detect refers to identifying the presence, absence or amount of the analyte to be detected.
- detectable label is meant a composition that when linked to a molecule of interest renders the latter detectable, via spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
- useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin, or haptens.
- disease is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.
- diseases include cancer.
- effective amount or “therapeutic amount” is meant the amount of a required to treat, prevent or ameliorate the symptoms of a disease relative to an untreated patient.
- the effective amount of active compound(s) used to practice the present invention for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.
- fragment is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide.
- a fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.
- Hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
- adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.
- isolated polynucleotide is meant a nucleic acid (e.g., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene.
- the term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences.
- the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.
- an “isolated polypeptide” is meant a polypeptide of the invention that has been separated from components that naturally accompany it.
- the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.
- the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention.
- An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.
- marker any protein or polynucleotide having an alteration in expression level or activity that is associated with a disease or disorder.
- obtaining as in “obtaining an agent” includes synthesizing, purchasing, or otherwise acquiring the agent.
- Primer set means a set of oligonucleotides that may be used, for example, for PCR.
- a primer set would consist of at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 80, 100, 200, 250, 300, 400, 500, 600, or more primers.
- recombinant includes reference to a polypeptide produced using cells that express a heterologous polynucleotide encoding the polypeptide.
- the cells produce the recombinant polypeptide because they have been genetically altered by the introduction of the appropriate isolated nucleic acid sequence.
- the term also includes reference to a cell, or nucleic acid, or vector, that has been modified by the introduction of a heterologous nucleic acid or the alteration of a native nucleic acid to a form not native to that cell, or that the cell is derived from a cell so modified.
- recombinant cells express genes that are not found within the native (non-recombinant) form of the cell, express mutants of genes that are found within the native form, or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all.
- reference is meant a standard or control condition.
- a “reference sequence” is a defined sequence used as a basis for sequence comparison.
- a reference sequence may be a subset of or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
- the length of the reference polypeptide sequence will generally be at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, and even more preferably about 35 amino acids, about 50 amino acids, or about 100 amino acids.
- the length of the reference nucleic acid sequence will generally be at least about 50 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, and even more preferably about 100 nucleotides or about 300 nucleotides or any integer thereabout or therebetween.
- specifically binds is meant a fusion protein that recognizes and binds a cancer cell expressing a particular marker, but which does not substantially recognize and bind other cells in a sample.
- substantially identical is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein).
- a reference amino acid sequence for example, any one of the amino acid sequences described herein
- nucleic acid sequence for example, any one of the nucleic acid sequences described herein.
- such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
- Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine;
- BLAST program may be used, with a probability score between e "3 and e "100 indicating a closely related sequence.
- subject is meant a mammal, including, but not limited to, a human or non- human mammal, such as a bovine, equine, canine, ovine, or feline.
- tumor refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all precancerous and cancerous cells and tissues.
- Ranges provided herein are understood to be shorthand for all of the values within the range.
- a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.
- the terms “treat,” treating,” “treatment,” and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated. Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms “a”, “an”, and “the” are understood to be singular or plural.
- compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
- Figure 1 is a graph showing changes in mean tumor volume of subcutaneous human
- Figure 2 is a graph showing changes in mean tumor volume of subcutaneous human
- Figure 3 is a graph showing the effects of ALT-801 and MART-lscTCR/IL-2, in combination with chemotherapy regimens, on growth of subcutaneous human bladder
- Figure 4 is a graph showing the effects of ALT-801 and MART-lscTCR/IL-2, in combination with chemotherapy regimens, on mouse body weight.
- Figure 5 is a graph showing the effects of ALT-801 and MART-lscTCR/IL-2, in combination with chemotherapy regimens, on growth of subcutaneous human bladder KU7P xenografts in nude mice.
- Figure 6 is a graph showing the effects of ALT-801 and MART-lscTCR/IL-2, in combination with chemotherapy regimens, on mouse body weight.
- Figure 7 is a graph showing the effects of gemcitabine, ALT-801 and MART- lscTCR/IL-2 on growth of subcutaneous human bladder KU7P xenografts in nude mice.
- Figure 8 is a graph showing the survival of albino C57BL/6 mice harboring orthotopic
- Figure 9A is a graph showing the survival of C57BL/6 mice harboring orthotopic MB491uc tumors treated with either ALT-801 or PBS (control).
- Figure 9B is an image showing bioluminescence of orthotopic MB491uc tumors in treatment naive or ALT-801 treated C57BL/6 mice.
- Figure 10 is a graph showing the survival of C57BL/6 mice harboring orthotopic MB491uc tumors treated with either ALT-801 or PBS (control).
- Figure 11 is a graph showing the survival of C57BL/6 mice with MB491uc superficial bladder tumors treated with ALT-801.
- Figures 12 A and 12B are graphs showing the survival of C57BL/6 mice with
- Figure 13 is images of H&E-stained bladder tissue sections from normal
- Figures 14A and 14B are graphs showing immune cell populations in the PMBCs
- Figure 15 is images showing stained macrophages in bladder tissue sections from MB491uc tumor-bearing C57BL/6 mice on study day 10 following treatment with PBS or ALT-801.
- Figures 16A and 16B are graphs showing changes in macrophage levels in the bladders from normal ( Figures 16A) and MB491uc tumor-bearing C57BL/6 mice ( Figures 16B) following treatment with PBS or ALT-801.
- Figures 17A and 17B are graphs showing changes in urine IFNy ( Figures 17A) and TNFa ( Figures 17B) in normal and MB491uc tumor-bearing C57BL/6 mice following treatment with PBS or ALT-801.
- Figure 18 is a graph showing treatment with ALT-801 but not IL-2 prolonged survival of mice bearing orthotopic MB491uc bladder tumors.
- C57BL/6 mice (10-11 weeks old) were instilled intravesically with MB491uc cells (3 x 104 cells/bladder) on study day 0, following polylysine pretreatment of the bladders.
- Kaplan-Meier survival curves comparing the study groups are shown.
- Figures 19A-19D depict the effect of M0, NK, CD4 and CD8 cell depletion on ALT- 801 efficacy in C57BL/6 mice bearing mouse MB491uc orthotopic bladder tumors.
- Figure 19A is a graph depicting survival of mice administered ALT-801 compared to mice administered PBS.
- Figure 19B is a graph depicting survival of mice administered ALT-801 and subjected to NK cell depletion by i.p. injection of anti-NK antibody (Ab) (clone PK136, 250 ⁇ g in 100 ⁇ ) on SD 2, 3, 6, 9, 13, and 16, compared to mice administered PBS.
- Figure 19C is a graph depicting survival of mice administered ALT-801 and subjected to M0 depletion by i.p.
- FIG. 19D is a graph depicting survival of mice administered ALT- 801 and subjected to CD4 and CD8 cell depletion by i.p. injection of anti-CD4 Ab (clone GK1.5, 250 ⁇ g in 100 ⁇ ) and anti-CD8 Ab (clone 53-6.72, 250 ⁇ g in 100 ⁇ ) on SD 2, 3, 6, 9, 13, and 16, compared to mice administered PBS. Kaplan-Meier survival plots are displayed. P values ⁇ 0.05 are considered significant.
- Figure 20 is a graph depicting changes in blood MDSC levels in C57BL/6 mice bearing mouse MB491uc orthotopic bladder tumors. Bars represent the mean + SEM. * P ⁇ 0.05 compared to control.
- Figure 21 are images of immunohistochemistry staining of macrophages in mouse bladders bearing MB491uc orthotopic bladder tumors.
- mice received MB491uc instillation and 11 days later received PBS or ALT-801 (1.6 mg/kg) i.v. treatment.
- Mice were sacrificed 24 hours after treatment and bladders were collected for staining.
- Bladder sections were stained with anti-iNOS (Ml macrophage marker), and anti-MMP-9 (M2 macrophage marker) and anti-F4/80 (macrophage pan marker) Abs. Representative tissue sections are shown. Magnification 200x.
- Figure 22 is a graph depicting the role of immune cell subsets in ALT-801 -mediated induction of serum IFN- ⁇ levels in C57BL/6 mice.
- C57BL/6 female mice were injected peritoneally with anti-CD4 (GK1.5), anti-CD8 (53-6.72), and/or anti-NKl.l (PK136) Abs to deplete immune cell subsets.
- Figure 23 is a graph depicting the effect of IFN- ⁇ on MB491uc cell growth in vitro.
- MB491uc cells (2 x 10 5 /well) were cultured in RPMI-10 with IFN- ⁇ at 1 ng/mL or 10 ng/mL for 2 days.
- the apoptotic MB491uc cells were determined by flow cytometry following Annexin V staining.
- Figure 24 is a graph depicting that ALT-801 induced LAK cell cytotoxicity against
- Lymphokine activated killer (LAK) cells were prepared from mouse splenocytes following in vitro activation by 20 nM ALT-801 for 3 days.
- the LAK cells (4 x 10 6 /well) were cultured with PKH67-labeled MB491uc (4 x 10 5 /well) in RPMI-10 with 0 to 50 nM ALT-801.
- the cultured cells were harvested 24 hours later and labeled with 0.001 mg/mL PI.
- the percentage of dead PI + MB491uc cells was determined by flow cytometry.
- Figure 25 is a graph depicting that gemcitabine reduced splenocyte MDSC levels in MB491uc tumor bearing mice.
- Female C57BL/6 mice were injected intravenously with MB491uc cells (1 x 106/mouse). After 10 days, one group of mice was treated intravenously 40 mg/kg gemcitabine. Mice were sacrificed 3 days later and the splenocytes were isolated. The percentage of spleen Grl+CDl lb+ MDSCs was determined by flow cytometry.
- Figure 26 depicts flow cytometry analysis of MDSC purity post magnetic sorting.
- Cells positively selected by MACS columns were stained with anti-CD l lb-PE and anti-Grl- FITC antibodies.
- CDl lb+Grl+ cells later subjected to adoptive transfer had a purity of 96%.
- Figure 27 is a graph depicting that ALT-801 induced tumor cell killing by immune cells after MDSC adoptive transfer.
- Splenocytes from MDSC recipient mice (black) or vehicle control mice (white) were collected and activated into LAK cells by incubation with 50 nM ALT-801.
- LAK effector cells were then mixed with MB491uc target cells to assess their cytolytic activity.
- Figure 28 depicts a study design and treatment scheme for a Phase I II clinical trial of ALT-801 administered in combination with gemcitabine and cisplatin in urothelial cancer.
- Figure 29 depicts a study design and treatment scheme for a Phase I/II clinical trial of ALT-801 administered in combination with gemcitabine and cisplatin in urothelial cancer.
- Figure 30 depicts patient demographics and disease status of a Phase I/II clinical trial of ALT-801 administered in combination with gemcitabine and cisplatin in urothelial cancer.
- Figure 31 depicts tumor assessment in a Phase I/II clinical trial of ALT-801 administered in combination with gemcitabine and cisplatin in urothelial cancer.
- Figure 32 depicts objective responses in patients administered ALT-801 in a Phase I II clinical trial of ALT-801 administered in combination with gemcitabine and cisplatin in urothelial cancer.
- Figure 33 depicts progression free survival in patients administered ALT-801 in a Phase I/II clinical trial of ALT-801 administered in combination with gemcitabine and cisplatin in urothelial cancer.
- Figure 34 are graphs depicting increased serum IFN- ⁇ levels in patients administered ALT-801 (left panel: 0.04 mg/kg ALT-801; right panel: 0.06 mg/kg ALT-801).
- the present invention provides methods of treating cancer or symptoms thereof which comprise administering a therapeutically effective amount of a pharmaceutical composition comprising an IL-2 fusion protein and one or more therapeutic agents to a subject (e.g., a mammal such as a human).
- a subject e.g., a mammal such as a human
- one embodiment is a method of treating a subject suffering from or susceptible to cancer or symptom thereof.
- the method includes the step of administering to the mammal a therapeutic amount of an IL-2 fusion protein and one or more therapeutic agents sufficient to treat the cancer or symptom thereof, under conditions such that the cancer is treated.
- the present invention also provides methods of treating cancer or symptoms thereof which comprise administering a therapeutically effective amount of an IL- 2 fusion protein alone to a subject (e.g., a mammal such as a human).
- the invention is based, at least in part, on the discovery that administration of IL-2 fusion protein in combination with one or more therapeutic agents to subjects having bladder cancer (also referred to herein as urothelial cancer) 1) ameliorated the cancer, 2) reduced tumor burden, 3) increased the survival of the subject, and 4) induced a durable
- IL-2 fusion protein combined with one or more therapeutic agents was found to be effective in treating chemo- resistant bladder cancers.
- IL-2 fusion proteins that do not specifically target the cancer cells or tissues were found to be as effective in treating bladder cancer as IL-2 fusion proteins that specifically target the cancer cells.
- IL-2 fusion protein monotherapy was found to be effective in treating bladder cancers, including chemo-resistant cancers.
- IL-2 has stimulatory effects on a number of immune cell types including T and B cells, monocytes, macrophages, lymphokine- activated killer cells (LAK) and NK cells (Waldmann, T. A., Nat Rev Immunol, 6: 595-601, 2006).
- LAK lymphokine- activated killer cells
- NK cells NK cells
- bladder cancer tumors mainly consists of two divergent, but overlapping pathways (Wu, X. R., Nat Rev Cancer, 5: 713-725, 2005).
- the non-muscle invasive bladder tumors are thought to arise from simple and nodular hyperplasia, and harbor frequent mutations in the fibroblast growth factor receptor 3, Ha-Ras, and PIK3CA genes.
- Muscle-invasive bladder cancer tumors are thought to originate from flat carcinoma in situ, severe dysphasia, or de novo.
- At least 50% of these tumors contain defects in the tumor suppressor p53 and/or retinoblastoma genes (Rosser, C. J. et al., Expert Rev Anticancer Ther, 1: 531-539, 2001). Consistent with this finding, elevated tumor overexpression of p53 correlates with progression of metastatic disease in bladder cancer patients (van Rhijn, B. W. G. et al., Cancer Research, 64: 1911-1914, 2004). This is also supported by transgenic mouse models of bladder cancer.
- p53 is an intracellular tumor suppressor protein that acts to arrest the proliferation of cells (Levine, A. J. et al., Nature, 351: 453-456, 1991; and Vousden, K. H. and Prives, C, Cell, 120: 7-10, 2005). When mutated, it loses its ability to suppress abnormal proliferation and accumulates in tumor cells (Levine, A. J.
- p53 mutation/overexpression correlates with tumor aggression and recurrence and is associated with lower overall survival rates and resistance to chemotherapeutic intervention in a variety of cancer types including bladder cancer (van Rhijn, B. W. G. et al., Cancer Research, 64: 1911-1914, 2004; Strano, S. et al., Oncogene, 26: 2212-2219, 2007; and Goebell, P. J. et al., Urol Oncol, 28: 377-388, 2010).
- Applicants identified a peptide epitope (aa264-272) of p53 presented by HLA-A*0201 that is displayed at high levels on the surface of different human tumor cells and tissues, whereas normal tissues do not present detectable levels of this complex. Since this epitope is within a region of p53 that is rarely mutated, its cell surface display serves as a broad-based target for tumors that overexpress p53. Applicants claimed method is based in part on the display of the p53 peptide epitope on the surface of human tumor cells.
- treat refers to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.
- the terms "prevent,” “preventing,” “prevention,” “prophylactic treatment” and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.
- the terms "effective,” “efficacy,” “efficacious” and the like refer to the ability to treat, prevent or ameliorate a disease, disorder and/or symptoms associated therewith.
- the therapeutic methods of the invention in general comprise administration of a therapeutically effective amount of an IL-2 fusion protein in combination with one or more therapeutic agents to a subject (e.g., animal, human) in need thereof, including a mammal, particularly a human.
- a subject e.g., animal, human
- Such treatment will be suitably administered to subjects, particularly humans, suffering from, having, susceptible to, or at risk for cancer, particularly bladder (or urothelial) cancer. Determination of those subjects "at risk” can be made by any objective or subjective determination by a diagnostic test or opinion of a subject or health care provider (e.g., genetic test, enzyme or protein marker, Marker (as defined herein), family history, and the like).
- the invention provides a method of monitoring treatment progress.
- the method includes the step of determining a level of diagnostic marker (Marker) (e.g., a protein or indicator thereof, etc.) or diagnostic measurement (e.g., screen, assay, scan for tumor size assessment, histopathological assessment in surgically removed tissue/biopsy, etc.) in a subject suffering from or susceptible to a disorder or symptoms thereof associated with cancer, particularly bladder cancer, in which the subject has been administered a therapeutic amount of a compound herein sufficient to treat the disease or symptoms thereof.
- the level of Marker or measurement determined in the method can be compared to known levels of Marker or measurement in either healthy normal controls or in other afflicted patients to establish the subject's disease status.
- a second level of Marker or measurement in the subject is determined at a time point later than the
- a pre-treatment level of Marker or measurement in the subject is determined prior to beginning treatment according to this invention; this pre-treatment level of Marker or measurement can then be compared to the level of Marker or measurement in the subject after the treatment commences, to determine the efficacy of the treatment.
- monitoring of treatment efficacy is done based on the objective response of the cancer as assessed using the new international criteria proposed by the Response Evaluation Criteria in Solid Tumors Committee (RECIST) 1.1.
- RECIST Solid Tumors Committee
- treatment efficacy is assessed based on subject overall survival or progression-free survival times or rates.
- the methods described herein rely upon the administration of an IL-2 fusion protein alone or along with one or more therapeutic agents.
- the IL-2 fusion proteins of the invention comprise either the entire mature IL-2 polypeptide or a biologically active fragment thereof fused to a second polypeptide.
- the second polypeptide has a targeting function in that it specifically binds to an epitope, peptide, ligand, or feature on a cancer cell.
- targeting polypeptides include antibodies and antigen binding fragments thereof, T cell receptors and peptide binding fragments thereof, and receptors and ligand binding fragments thereof. Any polypeptide that is able to specifically bind cancer cells may serve as the second polypeptide in a targeted IL-2 fusion protein.
- non-targeting IL-2 fusion proteins are as effective as targeted IL-2 fusion proteins in the described methods.
- the second polypeptide of a non-targeting IL-2 fusion protein includes antibodies and antigen binding fragments thereof, T cell receptors and peptide binding fragments thereof, and receptors and ligand binding fragments thereof. However, in these cases the second polypeptide does not specifically bind to the cancer cells to be treated.
- the second polypeptide is a T cell receptor (TCR) and most preferably a single chain T cell receptor (scTCR). Examples of TCR molecules suitable for second polypeptides are described in U.S. Patent No. 7,456,263; U.S. Patent No. 6,534,633; U.S. Patent Application Publication No. US2003/0144474; and U.S. Patent Application Publication No. US2011/0070191, which are incorporated by reference herein in their entirety.
- TCR fusion and conjugate complexes have been generated that have significantly increased utility as therapeutic molecules.
- the new class of fusion molecules has been created that has increased cell surface residency time, and improved pharmacokinetic profiles, e.g., these molecules have a longer plasma half-life.
- the invention also provides expression vectors that encode such complexes that comprise a TCR molecule covalently linked to a biologically active polypeptide or molecule, and methods for production and use of such fusion and conjugate complexes and expression vectors and conjugate complexes.
- T cell recognizes antigen presented on the surfaces of cells by means of the T cell receptors expressed on their cell surface.
- TCRs are disulfide linked heterodimers, most consisting of a and ⁇ chain glycoproteins. T cells use mechanisms to generate diversity in their receptor molecules similar to those mechanisms for generating antibody diversity operating in B cells (Janeway and Travers; Immunobiology 1997). Similar to the
- TCR genes are composed of segments that rearrange during development of T cells.
- TCR polypeptides consist of amino terminal variable and carboxy terminal constant regions. While the carboxy terminal region functions as a trans-membrane anchor and participates in intracellular signaling when the receptor is occupied, the variable region is responsible for recognition of antigens.
- the TCR a chain contains variable regions encoded by V and D segments only, while the ⁇ chain contains additional joining (J) segments. The rearrangement of these segments and the mutation and maturation of the variable regions results in a diverse repertoire of TCRs capable of recognizing an incredibly large number of different antigens displayed in the context of different TCR molecules.
- TCR T cell receptors
- TCRs have been produced by recombinant methods as soluble, single-chain TCRs (scTCR). Methods for production and use of scTCRs have been disclosed and are described in International application PCT/US98/20263 which are incorporated herein by reference. Such TCRs and scTCRs can be altered so as to create fusions or conjugates to render the resulting TCRs and scTCRs useful as therapeutics.
- the TCR complexes of the invention can be generated by genetically fusing the recombinantly produced TCR or scTCR coding region to genes encoding biologically active polypeptide or molecules to produce TCR fusion complexes. Alternatively, a TCR or scTCRs can also be chemically conjugated with biologically active molecules to produce TCR conjugate complexes.
- fusion molecule an IL-2 and second polypeptide, such as a TCR domain, covalently linked (i.e. fused) by recombinant, chemical or other suitable method.
- the fusion molecule can be fused at one or several sites through a peptide linker sequence.
- the peptide linker may be used to assist in construction of the fusion molecule.
- the fusion molecules of the invention exhibit improved characteristics that make them better therapeutic molecules.
- the cell surface residency time is increased by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more.
- serum half- life or "plasma half-life” as used herein is intended to indicate the amount of time that is required for the concentration or amount of fusion molecule of the invention when in the body to be reduced to exactly one-half of a given concentration or amount.
- the fusion molecules of the invention display significantly longer half lives than IL- 2 when not in a fusion molecule.
- the serum half-life of the disclosed molecules can increase by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 750%, 1000%, 1250%, 1500%, 1750%, 2000% or more over the serum half-life of the components of the claimed molecules when not part of a fusion protein.
- polypeptide refers to any polymer preferably consisting essentially of any of the 20 natural amino acids regardless of its size.
- protein is often used in reference to relatively large proteins, and “peptide” is often used in reference to small polypeptides, use of these terms in the field often overlaps.
- polypeptide refers generally to proteins, polypeptides, and peptides unless otherwise noted.
- Peptides useful in accordance with the present invention in general will be generally between about 0.1 to 100 KD or greater up to about 1000 KD, preferably between about 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 30 and 50 KD as judged by standard molecule sizing techniques such as centrifugation or SDS- polyacrylamide gel electrophoresis.
- the IL-2 fusion protein can be a detectably-labeled molecule suitable for diagnostic or imaging studies such as a fluorescent label such as green fluorescent protein, phycoerythrin, cychome, or Texas red; or a radionuclide e.g., iodine-131, yttrium-90, rhenium-188 or bismuth-212.
- a fluorescent label such as green fluorescent protein, phycoerythrin, cychome, or Texas red
- a radionuclide e.g., iodine-131, yttrium-90, rhenium-188 or bismuth-212.
- a radionuclide e.g., iodine-131, yttrium-90, rhenium-188 or bismuth-212.
- an sc-TCR such as the c264sc-TCR fused to IL-2 (ALT-801) can be produced by transfecting mammalian cells.
- the c264scTCR/IL-2 protein fusion complex recognizes a processed peptide fragment from human wild-type p53 tumor suppressor protein presented in the context of human HLA antigen; HLA-2.1.
- the c264scTCR and its peptide ligand have been described in Card et al., Cancer Immunol Immunother (2004) 53: 345, Belmont, et al. Clin Immunol. (2006) 121 :29, and Wen, et al. Cancer Immunol Immunother. (2008) 57: 1781.
- the human p53 (aa264- aa272) peptide sequence (referred to herein as 264 peptide or p264) recognized by c264scTCR is LLGRNSFEV.
- Expression of tumor suppressor protein p53 is upregulated on malignant cells.
- recognition of tumor cells presenting p53 (aa264-aa272) peptide /HLA-A2 complexes on their surface by the c264scTCR/IL-2 protein fusion promotes immune activity against the tumor cells, hereby providing anti-cancer therapeutic activity. This targeted recognition can be beneficial in treated subjects with tumors that overexpress p53, including bladder tumors.
- fusion molecules of the invention comprise IL-2 fused to other scTCRs specific for tumor associated or viral peptide antigens including those derived from MART-1, gplOO, MAGE, HIV, Hepatitis A, B or C, CMV, AAV, LCMV, JCV, Influenza, HTLV and other viruses, wherein the scTCR is linked to an IL-2, either directly or through a linker.
- the IL-2 fusion proteins may further comprise additional polypeptide tags.
- one tag is a polypeptide bearing a charge at physiological pH, such as, e.g., 6xHIS.
- the TCR fusion or conjugate complex can be purified by a commercially available metallo-sepharose matrix such as Ni-sepharose which is capable of specifically binding the 6xHIS tag at about pH 6-9.
- the EE epitope and myc epitope are further examples of suitable protein tags, which epitopes can be specifically bound by one or more commercially available monoclonal antibodies.
- components of the fusion proteins disclosed herein can be organized in nearly any fashion provided that the IL-2 fusion protein has the function for which it was intended.
- each component of the fusion protein can be spaced from another component by at least one suitable peptide linker sequence if desired.
- the components may be positioned by linkers such that IL- 2 can bind its receptor and provide optimal immunostimulatory activity and/or the second polypeptide can bind its receptor/ligand and mediate its activity.
- the fusion proteins may include tags, e.g., to facilitate identification and/or purification of the fusion protein.
- the IL-2 fusion proteins of the invention have the surprising ability to increase either the plasma half-life of IL-2 (above the plasma half-life of IL-2 alone) or the surface residency time for the fusion molecules (above the surface residency time of IL-2 alone) that bind to a cell surface protein, e.g., a cell surface receptor.
- the IL-2 fusion proteins of the invention may have the ability to increase the plasma half-life of the molecule and increase the surface residency time of the molecule, thereby leading to significant increases in efficacy for the claimed molecules.
- preparation of the IL-2 fusion proteins of the invention can be any convenient preparation of the IL-2 fusion proteins of the invention.
- telomere shortening a DNA sequence that is a sequence of DNA sequences.
- PCR polymerase chain amplification reactions
- preparation of plasmid DNA cleavage of DNA with restriction enzymes
- preparation of oligonucleotides ligation of DNA
- isolation of mRNA introduction of the DNA into a suitable cell
- transformation or transfection of a host culturing of the host.
- the fusion molecules can be isolated and purified using chaotropic agents and well known electrophoretic, centrifugation and chromatographic methods. See generally, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed. (1989); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989) for disclosure relating to these methods.
- the invention further provides nucleic acid sequences and particularly DNA sequences that encode the present fusion proteins.
- the DNA sequence is carried by a vector suited for extrachromosomal replication such as a phage, virus, plasmid, phagemid, cosmid, YAC, or episome.
- a DNA vector that encodes a desired fusion protein can be used to facilitate preparative methods described herein and to obtain significant quantities of the fusion protein.
- the DNA sequence can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
- a variety of host- vector systems may be utilized to express the protein-coding sequence.
- mammalian cell systems infected with virus e.g., vaccinia virus, adenovirus, etc.
- insect cell systems infected with virus e.g., baculovirus
- microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA or cosmid DNA.
- any one of a number of suitable transcription and translation elements may be used. See generally Sambrook et al., supra and Ausubel et al. supra.
- a preferred DNA vector according to the invention comprises a nucleotide sequence linked by phosphodiester bonds comprising, in a 5' to 3' direction a first cloning site for introduction of a first nucleotide sequence encoding a TCR chain, operatively linked to a sequence encoding IL-2.
- each of the fusion protein components encoded by the DNA vector be provided in a "cassette" format.
- cassette is meant that each component can be readily substituted for another component by standard recombinant methods.
- the sequence coding for the TCR molecule is linked to a sequence coding for IL-2 by use of suitable ligases.
- DNA coding for the presenting peptide can be obtained by isolating DNA from natural sources such as from a suitable cell line or by known synthetic methods, e.g. the phosphate triester method. See, e.g., Oligonucleotide Synthesis, IRL Press (M.J. Gait, ed., 1984). Synthetic
- oligonucleotides also may be prepared using commercially available automated
- the gene coding for the TCR molecule can be amplified by the polymerase chain reaction (PCR) or other means known in the art.
- PCR polymerase chain reaction
- Suitable PCR primers to amplify the TCR peptide gene may add restriction sites to the PCR product.
- the PCR product preferably includes splice sites for the IL-2 polypeptide and leader sequences necessary for proper expression and secretion of the TCR-IL-2 fusion complex.
- the PCR product also preferably includes a sequence coding for the linker sequence, or a restriction enzyme site for ligation of such a sequence.
- the fusion proteins described herein are preferably produced by standard recombinant DNA techniques. For example, once a DNA molecule encoding the TCR protein is isolated, sequence can be ligated to another DNA molecule encoding the IL-2 polypeptide.
- the nucleotide sequence coding for a TCR molecule may be directly joined to a DNA sequence coding for the IL-2 peptide or, more typically, a DNA sequence coding for the linker sequence as discussed herein may be interposed between the sequence coding for the TCR molecule and the sequence coding for the IL-2 peptide and joined using suitable ligases.
- the resultant hybrid DNA molecule can be expressed in a suitable host cell to produce the IL-2 fusion protein.
- the DNA molecules are ligated to each other in a 5' to 3' orientation such that, after ligation, the translational frame of the encoded polypeptides is not altered (i.e., the DNA molecules are ligated to each other in-frame).
- the resulting DNA molecules encode an in- frame fusion protein.
- nucleotide sequences also can be included in the gene construct.
- a promoter sequence which controls expression of the sequence coding for the TCR peptide fused to the IL-2 peptide, or a leader sequence, which directs the IL-2 fusion protein to the cell surface or the culture medium, can be included in the construct or present in the expression vector into which the construct is inserted.
- An immunoglobulin or CMV promoter is particularly preferred.
- the components of the fusion protein can be organized in nearly any order provided each is capable of performing its intended function.
- the TCR is situated at the C or N terminal end of the IL-2 molecule.
- a fusion molecule or a conjugate molecule in accord with the invention can be organized in several ways.
- the C-terminus of the TCR is operatively linked to the N-terminus of the IL-2 molecule. That linkage can be achieved by recombinant methods if desired.
- the N-terminus of the TCR is linked to the C-terminus of the IL-2 molecule.
- the linker sequence comprises from about 1 to 20 amino acids, more preferably from about 1 to 16 amino acids.
- the linker sequence is preferably flexible so as not hold the IL-2 in a single undesired conformation.
- the linker sequence can be used, e.g., to space the recognition site from the fused molecule.
- the peptide linker sequence can be positioned between the TCR chain and the IL-2 peptide, e.g. , to chemically cross-link same and to provide molecular flexibility.
- the linker is preferably predominantly comprises amino acids with small side chains, such as glycine, alanine and serine, to provide for flexibility.
- the linker sequence comprises glycine, alanine or serine residues, particularly glycine and serine residues.
- the linker sequence is suitably linked to the ⁇ chain of the TCR molecule, although the linker sequence also could be attached to the a chain of the TCR molecule.
- linker sequence may be linked to both a and ⁇ chains of the TCR molecule to create a single-chain molecule. Suitable linker sequences are SGGGGSGGG (i.e., Ser Gly Gly Gly Gly Ser Gly Gly Gly),
- linker sequences could be used including any of a number of flexible linker designs that have been used successfully to join antibody variable regions together, see Whitlow, M. et al., (1991) Methods: A Companion to Methods in Enzymology 2:97-105. Suitable linker sequences can be readily identified empirically. Additionally, suitable size and sequences of linker sequences also can be determined by conventional computer modeling techniques based on the predicted size and shape of the TCR molecule.
- the IL-2 gene fusion construct described above can be incorporated into a suitable vector by known means such as by use of restriction enzymes to make cuts in the vector for insertion of the construct followed by ligation.
- the vector containing the gene construct is then introduced into a suitable host for expression of the IL-2 fusion peptide. See, generally, Sambrook et al., supra. Selection of suitable vectors can be made empirically based on factors relating to the cloning protocol. For example, the vector should be compatible with, and have the proper replicon for the host that is being employed. Further the vector must be able to accommodate the DNA sequence coding for the IL-2 fusion protein that is to be expressed.
- Suitable host cells include eukaryotic and prokaryotic cells, preferably those cells that can be easily transformed and exhibit rapid growth in culture medium.
- Specifically preferred hosts cells include prokaryotes such as E. coli, Bacillus subtillus, etc. and eukaryotes such as animal cells and yeast strains, e.g., S. cerevisiae.
- Mammalian cells are generally preferred, particularly J558, NSO, SP2-0 or CHO.
- Other suitable hosts include, e.g., insect cells such as Sf9. Conventional culturing conditions are employed. See Sambrook, supra. Stable transformed or transfected cell lines can then be selected.
- Cells expressing a TCR fusion complex of the invention can be determined by known procedures. For example, expression of a TCR fusion complex linked to an immunoglobulin can be determined by an ELISA specific for the linked immunoglobulin and/or by immunoblotting.
- a host cell can be used for preparative purposes to propagate nucleic acid encoding a desired fusion protein.
- a host cell can include a prokaryotic or eukaryotic cell in which production of the fusion protein is specifically intended.
- host cells specifically include yeast, fly, worm, plant, frog, mammalian cells and organs that are capable of propagating nucleic acid encoding the fusion.
- mammalian cell lines which can be used include CHO dhfr- cells (Urlaub and Chasm, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)), 293 cells (Graham et al., J Gen. Virol, 36:59 (1977)) or myeloma cells like SP2 or NSO (Galfre and Milstein, Meth. Enzymol., 73(B):3 (1981)).
- Host cells capable of propagating nucleic acid encoding a desired fusion protein encompass non-mammalian eukaryotic cells as well, including insect (e.g., Sp. frugiperda), yeast (e.g., S. cerevisiae, S. pombe, P. pastoris. , K. lactis, H. polymorpha; as generally reviewed by Fleer, R., Current Opinion in Biotechnology, 3(5):486496 (1992)), fungal and plant cells. Also contemplated are certain prokaryotes such as E. coli and Bacillus.
- Nucleic acid encoding a desired fusion protein can be introduced into a host cell by standard techniques for transfecting cells.
- transfecting or “transfection” is intended to encompass all conventional techniques for introducing nucleic acid into host cells, including calcium phosphate co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection, viral transduction and/or integration. Suitable methods for transfecting host cells can be found in Sambrook et al. supra, and other laboratory textbooks.
- the present invention further provides a production process for isolating an IL-2 fusion protein of interest.
- a host cell e.g., a yeast, fungus, insect, bacterial or animal cell
- a nucleic acid encoding the protein of the interest operatively linked to a regulatory sequence
- the fusion protein of interest is isolated from harvested host cells or from the culture medium. Standard protein purification techniques can be used to isolate the protein of interest from the medium or from the harvested cells.
- the purification techniques can be used to express and purify a desired fusion protein on a large-scale (i.e. in at least milligram quantities) from a variety of implementations including roller bottles, spinner flasks, tissue culture plates, bioreactor, or a fermentor.
- An expressed IL-2 fusion protein can be isolated and purified by known methods. Typically the culture medium is centrifuged and then the supernatant is purified by affinity or immunoaffinity chromatography, e.g. Protein-A or Protein-G affinity chromatography or an immunoaffinity protocol comprising use of monoclonal antibodies that bind the expressed fusion complex such as a linked TCR or immunoglobulin region thereof.
- affinity or immunoaffinity chromatography e.g. Protein-A or Protein-G affinity chromatography or an immunoaffinity protocol comprising use of monoclonal antibodies that bind the expressed fusion complex such as a linked TCR or immunoglobulin region thereof.
- the fusion proteins of the present invention can be separated and purified by appropriate combination of known techniques.
- methods utilizing solubility such as salt precipitation and solvent precipitation
- methods utilizing the difference in molecular weight such as dialysis, ultra-filtration, gel-filtration, and SDS-polyacrylamide gel electrophoresis
- methods utilizing a difference in electrical charge such as ion-exchange column
- the IL-2 fusion proteins of the present invention be substantially pure. That is, the fusion proteins have been isolated from cell substituents that naturally accompany it so that the fusion proteins are present preferably in at least 80% or 90% to 95% homogeneity (w/w). Fusion proteins having at least 98 to 99% homogeneity (w/w) are most preferred for many pharmaceutical, clinical and research applications.
- the fusion protein should be substantially free of contaminants for therapeutic applications.
- the soluble fusion proteins can be used therapeutically, or in performing in vitro or in vivo assays as disclosed herein.
- Substantial purity can be determined by a variety of standard techniques such as
- Truncated IL-2 fusion proteins of the invention contain a TCR molecule that is sufficiently truncated so the TCR fusion complex can be secreted into culture medium after expression. Thus, a truncated IL-2 fusion protein will not include regions rich in
- hydrophobic residues typically the transmembrane and cytoplasmic domains of the TCR molecule.
- preferably from about residues 199 to 237 of the ⁇ chain and from about residues 193 to 230 of the a chain of the TCR molecule are not included in the truncated TCR fusion complex.
- misfolded as it relates to the fusion proteins is meant a protein that is partially or completely unfolded (i.e. denatured).
- a fusion protein can be partially or completely misfolded by contact with one or more chaotropic agents as discussed below.
- misfolded fusion proteins disclosed herein are representative of a high Gibbs free energy (AG) form of the corresponding native protein.
- AG Gibbs free energy
- native fusion protein which is usually correctly folded, it is fully soluble in aqueous solution, and it has a relatively low AG. Accordingly, that native fusion protein is stable in most instances.
- misfolding can be detected by a variety of conventional biophysical techniques including optical rotation measurements using native (control) and misfolded molecules.
- soluble or similar term is meant that the fusion molecule and particularly a fusion protein that is not readily sedimented under low G-force centrifugation (e.g. less than about 30,000 revolutions per minute in a standard centrifuge) from an aqueous buffer, e.g., cell media. Further, the fusion molecule is soluble if the it remains in aqueous solution at a temperature greater than about 5-37°C and at or near neutral pH in the presence of low or no concentration of an anionic or non-ionic detergent. Under these conditions, a soluble protein will often have a low sedimentation value e.g., less than about 10 to 50 svedberg units.
- Aqueous solutions referenced herein typically have a buffering compound to establish pH, typically within a pH range of about 5-9, and an ionic strength range between about 2mM and 500mM. Sometimes a protease inhibitor or mild non-ionic detergent is added.
- a carrier protein may be added if desired such as bovine serum albumin (BSA) to a few mg/ml.
- BSA bovine serum albumin
- exemplary aqueous buffers include standard phosphate buffered saline, tris- buffered saline, or other well known buffers and cell media formulations.
- the invention includes IL-2 fusion proteins that are useful for the treatment of neoplasia.
- the IL-2 fusion proteins of the invention are useful for preventing or reducing tumor growth or for reducing the propensity of a neoplastic cell to invade a surrounding tissue or to otherwise metastasize.
- the IL-2 fusion proteins disclosed herein may be administered systemically, for example, formulated in a pharmaceutically-acceptable buffer such as physiological saline.
- Preferable routes of administration include, for example, subcutaneous, intravenous, interperitoneally, intramuscular, or intradermal injections that provide continuous, sustained levels of the drug in the patient.
- Treatment of human patients or other animals will be carried out using a therapeutically effective amount of a therapeutic identified herein in a physiologically- acceptable carrier. Suitable carriers and their formulation are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin.
- the amount of the therapeutic agent to be administered varies depending upon the manner of administration, the age and body weight of the patient, and with the clinical symptoms of the neoplasia. Generally, amounts will be in the range of those used for other agents used in the treatment of other diseases associated with neoplasia, although in certain instances lower amounts will be needed because of the increased specificity of the compound.
- the IL-2 fusion proteins of the invention are useful for preventing or ameliorating neoplastic disease.
- an agent identified or described herein is administered to the site of a potential or actual disease- affected tissue or is administered systemically.
- the dosage of the administered agent depends on a number of factors, including the size and health of the individual patient. For any particular subject, the specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.
- the administration of a therapeutic agent for the treatment of neoplasia may be by any suitable means that results in a concentration of the therapeutic that, combined with other components, is effective in ameliorating, reducing, or stabilizing a neoplasia.
- the compound may be contained in any appropriate amount in any suitable carrier substance, and is generally present in an amount of 1-95% by weight of the total weight of the composition.
- the composition may be provided in a dosage form that is suitable for parenteral (e.g., subcutaneously, intravenously, intramuscularly, intravesicularly or intraperitoneally) administration route.
- An advantageous method of administration is intravenous infusion.
- the pharmaceutical therapeutic agent may be formulated according to conventional pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of
- compositions according to the invention may be formulated to release the IL-2 fusion protein substantially immediately upon administration or at any
- compositions are generally known as controlled release formulations, which include (i) formulations that create a substantially constant concentration of the drug within the body over an extended period of time; (ii) formulations that after a predetermined lag time create a substantially constant concentration of the drug within the body over an extended period of time; (iii) formulations that sustain action during a predetermined time period by maintaining a relatively, constant, effective level in the body with concomitant minimization of undesirable side effects associated with fluctuations in the plasma level of the active substance (sawtooth kinetic pattern); (iv) formulations that localize action by, e.g., spatial placement of a controlled release composition adjacent to or in contact with the thymus; (v) formulations that allow for convenient dosing, such that doses are administered, for example, once every one or two weeks; and (vi) formulations that neoplasia by using carriers or chemical derivatives to deliver the therapeutic agent to a particular cell type (e.g., neo
- controlled release is obtained by appropriate selection of various formulation parameters and ingredients, including, e.g., various types of controlled release compositions and coatings.
- the therapeutic is formulated with appropriate excipients into a pharmaceutical composition that, upon administration, releases the therapeutic in a controlled manner. Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, molecular complexes, nanoparticles, patches, and liposomes.
- compositions may be administered parenterally by injection, infusion or implantation (subcutaneous, intravenous, intramuscular, intraperitoneal, intravesicularly or the like) in dosage forms, formulations, or via suitable delivery devices or implants containing conventional, non-toxic pharmaceutically acceptable carriers and adjuvants.
- injection, infusion or implantation subcutaneous, intravenous, intramuscular, intraperitoneal, intravesicularly or the like
- suitable delivery devices or implants containing conventional, non-toxic pharmaceutically acceptable carriers and adjuvants.
- Formulations can be found in Remington: The Science and Practice of Pharmacy, supra.
- compositions for parenteral use may be provided in unit dosage forms (e.g., in single- dose ampoules), or in vials containing several doses and in which a suitable preservative may be added (see below).
- the composition may be in the form of a solution, a suspension, an emulsion, an infusion device, or a delivery device for implantation, or it may be presented as a dry powder to be reconstituted with water or another suitable vehicle before use.
- the composition may include suitable parenterally acceptable carriers and/or excipients.
- the active therapeutic agent(s) may be incorporated into microspheres, microcapsules, nanoparticles, liposomes, or the like for controlled release.
- the composition may include suspending, solubilizing, stabilizing, pH-adjusting agents, tonicity adjusting agents, and/or dispersing, agents.
- the pharmaceutical compositions according to the invention may be in the form suitable for sterile injection.
- the suitable therapeutic(s) are dissolved or suspended in a parenterally acceptable liquid vehicle.
- acceptable vehicles and solvents that may be employed are water, water adjusted to a suitable pH by addition of an appropriate amount of hydrochloric acid, sodium hydroxide or a suitable buffer, 1,3-butanediol, Ringer's solution, and isotonic sodium chloride solution and dextrose solution.
- the aqueous formulation may also contain one or more preservatives (e.g., methyl, ethyl or n-propyl p-hydroxybenzoate).
- a dissolution enhancing or solubilizing agent can be added, or the solvent may include 10-60% w/w of propylene glycol or the like.
- Controlled release parenteral compositions may be in form of aqueous suspensions, microspheres, microcapsules, magnetic microspheres, oil solutions, oil suspensions, or emulsions.
- the antibody may be incorporated in biocompatible carriers, liposomes, nanoparticles, implants, or infusion devices.
- Materials for use in the preparation of microspheres and/or microcapsules are, e.g., biodegradable/bioerodible polymers such as polygalactia poly-(isobutyl cyanoacrylate), poly(2-hydroxyethyl-L-glutam- nine) and, poly(lactic acid).
- Biocompatible carriers that may be used when formulating a controlled release parenteral formulation are carbohydrates (e.g., dextrans), proteins (e.g., albumin), lipoproteins, or antibodies.
- Materials for use in implants can be non-biodegradable (e.g., polydimethyl siloxane) or biodegradable (e.g.,
- Formulations for oral use include tablets containing the active ingredient(s) in a mixture with non-toxic pharmaceutically acceptable excipients.
- Excipients may be, for example, inert diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starches including potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate, or sodium phosphate); granulating and disintegrating agents (e.g., cellulose derivatives including microcrystalline cellulose, starches including potato starch, croscarmellose sodium, alginates, or alginic acid); binding agents (e.g., sucrose, glucose, sorbitol, acacia, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, carboxymethylcellulose sodium, methylcellulose, hydroxypropyl methyl
- the tablets may be uncoated or they may be coated by known techniques, optionally to delay disintegration and absorption in the gastrointestinal tract and thereby providing a sustained action over a longer period.
- the coating may be adapted to release the active drug in a predetermined pattern (e.g., in order to achieve a controlled release formulation) or it may be adapted not to release the active drug until after passage of the stomach (enteric coating).
- the coating may be a sugar coating, a film coating (e.g., based on hydroxypropyl methylcellulose, methylcellulose, methyl hydroxyethylcellulose, hydroxypropylcellulose, carboxymethylcellulose, acrylate copolymers, polyethylene glycols and/or
- polyvinylpyrrolidone or an enteric coating (e.g., based on methacrylic acid copolymer, cellulose acetate phthalate, hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate succinate, polyvinyl acetate phthalate, shellac, and/or ethylcellulose).
- a time delay material such as, e.g., glyceryl monostearate or glyceryl distearate may be employed.
- the solid tablet compositions may include a coating adapted to protect the composition from unwanted chemical changes, (e.g., chemical degradation prior to the release of the chimeric antibody).
- the coating may be applied on the solid dosage form in a similar manner as that described in Encyclopedia of Pharmaceutical Technology, supra.
- Formulations for oral use may also be presented as chewable tablets, or as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example, peanut oil, liquid paraffin, or olive oil.
- an inert solid diluent e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin
- water or an oil medium for example, peanut oil, liquid paraffin, or olive oil.
- Powders and granulates may be prepared using the ingredients mentioned above under tablets and capsules in a conventional manner using, e.g., a mixer, a fluid bed apparatus or a spray drying equipment.
- Controlled release compositions for oral use may, e.g., be constructed to release the chimeric antibody therapeutic by controlling the dissolution and/or the diffusion of the active substance.
- Dissolution or diffusion controlled release can be achieved by appropriate coating of a tablet, capsule, pellet, or granulate formulation of compounds, or by incorporating the compound into an appropriate matrix.
- a controlled release coating may include one or more of the coating substances mentioned above and/or, e.g., shellac, beeswax, glycowax, castor wax, carnauba wax, stearyl alcohol, glyceryl monostearate, glyceryl distearate, glycerol palmitostearate, ethylcellulose, acrylic resins, dl-polylactic acid, cellulose acetate butyrate, polyvinyl chloride, polyvinyl acetate, vinyl pyrrolidone, polyethylene, polymethacrylate, methylmethacrylate, 2-hydroxymethacrylate, methacrylate hydrogels, 1,3 butylene glycol, ethylene glycol methacrylate, and/or polyethylene glycols.
- shellac beeswax, glycowax, castor wax, carnauba wax, stearyl alcohol, glyceryl monostearate, glyceryl distearate, glyce
- the matrix material may also include, e.g., hydrated metylcellulose, carnauba wax and stearyl alcohol, carbopol 934, silicone, glyceryl tristearate, methyl acrylate-methyl methacrylate, polyvinyl chloride, polyethylene, and/or halogenated fluorocarbon.
- a controlled release composition containing one or more therapeutic compounds may also be in the form of a buoyant tablet or capsule (i.e., a tablet or capsule that, upon oral administration, floats on top of the gastric content for a certain period of time).
- a buoyant tablet formulation of the compound(s) can be prepared by granulating a mixture of the compound(s) with excipients and 20-75% w/w of hydrocolloids, such as
- the obtained granules can then be compressed into tablets.
- the tablet On contact with the gastric juice, the tablet forms a substantially water-impermeable gel barrier around its surface. This gel barrier takes part in maintaining a density of less than one, thereby allowing the tablet to remain buoyant in the gastric juice.
- the invention provides for the combined administration of an IL-2 fusion protein and one or more therapeutic agents.
- the IL-2 fusion protein may be administered before, concurrently, or after administration of the therapeutic agents. Moreover, if more than one therapeutic agent is used these agents may be administered concurrently or separately.
- the administration of the IL-2 fusion proteins and one or more therapeutic agents may be administered in various dosage schedules. In certain embodiments the IL-2 fusion protein and the one or more therapeutic agents are administered in multiple dosing schedules that may be separated by one or more rest periods.
- an IL-2 fusion protein and one or more therapeutic agent of the invention in a neoadjuvant setting prior to additional therapy or surgery or as first line, second line or later line therapy depending on the disease stage of the patient.
- the combined therapy is given to subjects with bladder cancer prior to cystectomy. Such therapy may eradicate micrometastases, downstage tumor, reduce implantation of circulating tumor cells post-surgery and improve survival.
- the combined therapy of the invention is given to subjects with advanced or metastatic bladder cancer as a first line or second line therapy. Such treatment can be provided to subjects who are resistant or ineligible for standard therapies. Use of the IL-2 fusion protein as monotherapy may also be effectively used in these treatment settings.
- an IL-2 fusion protein and one or more therapeutic agent of the invention may be advantageous in providing a more efficacious therapy than treatment with the individual agents.
- the combined therapy comprises ALT-801 as the IL-2 fusion protein and cisplatin and/or gemcitabine as the therapeutic agents.
- embodiments of the invention include treatment of subjects with bladder (or urothelial) cancer, wherein said cancer may be transitional cell carcinoma, carcinoma (or tumor) in situ, nonmuscle-invasive, muscle-invasive, locally advanced, metastatic, Stage I through IV, or low or high grade.
- combined administration of an IL-2 fusion protein and one or more therapeutic agents is more effective at treating or preventing cancer in subjects than treatment with the therapeutic agents alone.
- the effectiveness of the combined treatment using IL-2 fusion protein and one or more therapeutic agents can be compared to treatment with therapeutic agents alone on prospective or retrospective basis, using historic efficacy measures of similar study groups or in cross-over studies. Measurements of efficacy may are well established for cancer treatment and may include overall tumor responses (i.e. rates of progressive disease, stable disease, partial responses or complete responses based on RECIST, WHO or other criteria), progression free survival, time to progression, overall survival or survival rates, hazard ratios, relapse rate or time, tumor biomarker analysis, quality of life measurements, rate of or time to additional treatment, etc.
- better efficacy of the combined treatment using IL-2 fusion protein and one or more therapeutic agents compared treatment with the therapeutic agents alone is typically defined as a statistically significant improvement (i.e. P value ⁇ 0.10 or preferably ⁇ 0.05) in the efficacy measure or may be defined as an increase in time to event measures of weeks, months or years or an improvement rate measures by 1%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 750%, 1000%, 1250%, 1500%, 1750%, 2000% or more.
- treatment of subjects with advance or metastatic bladder cancer using the combined administration of ALT-801 and gemcitabine + cisplatin of the invention provided better anti-tumor efficacy than that previously reported for
- ALT-801 and gemcitabine + cisplatin of the invention provided much better overall response and complete response rates than that reported for gemcitabine + cisplatin or other cisplatin-based chemotherapy regimens by von der Maase et al. or others.
- combined administration of an IL-2 fusion protein and one or more therapeutic agents is effective at treating or preventing cancer in subjects that are resistant to chemotherapy.
- combined treatment of the inventions includes one or more therapeutic agents for which the cancer is resistant.
- combined treatment of the inventions includes one or more therapeutic agents which are different from that which the cancer is resistant.
- the combined administration of ALT-801 and gemcitabine + cisplatin was efficacious in providing complete response (CR) in patients with bladder cancer that progressed on previous gemcitabine + cisplatin therapy.
- the combination of an IL-2 fusion protein and one or more therapeutic agent of the invention may provide more efficacious therapy through a variety of mechanisms.
- the IL-2 fusion protein and cytotoxic therapeutic agent regimen can provide efficacy through the combination of direct effects of these agents on the cancer. In some circumstances, the timing of these effects may provide improved outcomes. For example, rapid activity of a cytotoxic therapeutic agent against bulky disease in combination with durable long-term activity of an IL-2 fusion protein against residual disease could provide better efficacy than either agent alone.
- therapeutic agents not only have direct cytotoxic effects on tumor cells but may also potentiate the immune system via so-called off-target effects to achieve efficient anti-cancer immunity in combination with the IL-2 fusion protein of the invention (Galluzzi, L.
- treatment with the therapeutic agent may increase the expression of an antigenic target on the cancer cell surface, thereby allowing more effective anti-tumor immune responses induced by the IL-2 fusion protein.
- the antigenic target is recognized by a component of the IL-2 fusion protein and immune responses are directed against the tumor cells via IL-2 fusion protein interaction.
- the therapeutic agent increases the HLA or
- platinum-based compounds including cisplatin, oxaliplatin and carboplatin, not only induce class I HLA expression but markedly reduce the expression of the T cell inhibitory molecule PD-L2 on human tumor cells (Lesterhuis, W. J. et al., J Clin Invest, 121: 3100-3108). Down-regulation of PD-L2 could result in enhanced anti-tumor effects of T cells stimulated by an IL-2 fusion protein.
- Various therapeutic agents including cisplatin, paclitaxel and doxorubicin, have the capability to sensitize tumor cells to cytotoxic T lymphocytes (CTLs) by increasing the permeability of tumor cells to granzyme, thereby rendering them susceptible to CTL-mediated lysis even if they do not express the antigen recognized by CTLs (Ramakrishnan, R. et al., J Clin Invest, 120: 1111-1124).
- CTLs cytotoxic T lymphocytes
- the combination of an IL-2 fusion protein with gemcitabine can result in more efficacious therapy due to the activity of gemcitabine to increase the expression of class I HLA on tumor cells and to enhance the cross-presentation of tumor antigen to the CD8 + T cells activated by the IL-2 fusion protein (Liu, W. M. et al., Br J Cancer, 102: 115-123; Nowak, A. K. et al., J Immunol, 170: 4905- 4913, 2003; and Nowak, A. K. et al., Cancer Res, 63: 4490-4496, 2003).
- use of gemcitabine may also selectively kill myeloid-derived suppressor cells (MDSCs) responsible for suppressing antigen-specific T-cell responses (Mundy-Bosse, B. L. et al., Cancer Res, 71: 5101-5110; Vincent, J. et al., Cancer Res, 70: 3052-3061; Suzuki, E. et al., Clin Cancer Res, 11: 6713-6721, 2005; and Ko, H. J. et al., Cancer Res, 67: 7477-7486, 2007), thereby providing a better environment for IL-2 fusion protein-mediated anti-tumor immune activity.
- MDSCs myeloid-derived suppressor cells
- Chemotherapy may also induced tumor autophagy leading to the release of adenosine 5 '-triphosphate capable of attracting and stimulating anti-tumor immune responses (Michaud, M. et al., Science, 334: 1573-1577).
- adenosine 5 '-triphosphate capable of attracting and stimulating anti-tumor immune responses
- kits for the treatment or prevention of neoplasia includes a therapeutic or prophylactic composition containing a therapeutically effective amount of an IL-2 fusion protein in unit dosage form and one or more therapeutic agents.
- the IL-2 fusion protein is ALT-801 and the one or more therapeutic agents are cisplatin and/or gemcitabine.
- the kit comprises a sterile container which contains a therapeutic or prophylactic cellular composition; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art.
- Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
- an IL-2 fusion protein and one or more therapeutic agents of the invention are provided together with instructions for administering the IL-2 fusion protein and one or more therapeutic agents to a subject having or at risk of developing cancer (e.g., bladder cancer).
- the instructions will generally include information about the use of the composition for the treatment or prevention of neoplasia.
- the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of ischemia or symptoms thereof; precautions; warnings; indications; counter-indications; overdosage information; adverse reactions; animal pharmacology; clinical studies; and/or references.
- the instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.
- ALT-801 is a fusion protein between interleukin-2 and a T cell receptor (TCR) domain capable of recognizing tumors presenting human p53 peptide (aa264-272)/HLA- A*0201 complexes.
- TCR T cell receptor
- Intravenous administration of ALT-801 significantly prolonged survival of C57BL/6 mice bearing MB491uc orthotopic muscle invasive and superficial bladder cancer when compared with PBS treatment.
- the ALT-801-treated mice also survived rechallenge with MB491uc tumor cells, indicating long-lasting immune response and long-term memory.
- ALT-801 exhibited potent antitumor activity against human bladder cancer HLA-A*0201 + /p53 + UMUC-14 and HLA-A*0201-negative/p53 + KU7 xenografts in nude mice, which demonstrates that ALT-801 ' s TCR domain targeting activity is not required for efficacy.
- ALT-801 combined with gemcitabine showed better antitumor effects and less toxicity than gemcitabine + cisplatin (GC) chemotherapy in the UMUC-14 and KU7 xenograft models, despite the different sensitivity of these tumor cells to GC.
- GC gemcitabine + cisplatin
- Example 2 Effect of ALT-801 in combination with gemcitabine and cisplatin on primary tumor growth of human bladder cancer UMUC-14 in nude mice.
- c264scTCR-IL2 ALT-801
- gemcitabine and cisplatin were evaluated on primary tumor growth in athymic nude mice bearing human bladder UMUC-14 and KU7P cells.
- Treatment with a gemcitabine and cisplatin regimen is the standard-of-care for patients with metastatic bladder cancer.
- HLA-A2 + p53 + UMUC-14 cells were treated with gemcitabine and cisplatin, alone and in combination.
- gemcitabine, cisplatin, and gemcitabine + cisplatin caused a dose dependent decrease in UMUC-14 cell proliferation due to GO/Gl cell cycle arrest. These results are consistent with the mechanism of action of these agents on growing cells.
- In vitro incubation with the gemcitabine + cisplatin combination also induced presentation of the p53 peptide (aa264-272)/HLA-A*0201 complex on the surface of UMUC-14 tumor cells, indicating that the antigenic target for ALT-801 is elevated by this treatment.
- UMUC-14 and KU7P cells were plated in media containing various amounts of gemcitabine and cisplatin and cell proliferation was determined using the WST- 1 reagent 24 hours later. It was found that gemcitabine inhibited UMUC-14 cell growth with an IC 50 of 2030 ⁇ whereas KU7P cell growth was inhibited at an IC50 of 0.05 ⁇ . Cisplatin also showed much greater inhibition of KU7P cells (IC 50 , 1.4 ⁇ ) than UMUC-14 cells (IC 50 , 9.2 ⁇ ). Overall these results indicate that UMUC-14 cell growth is relatively resistant and KU7P cell growth is sensitive to the chemotherapeutic agents.
- Gem + Cis + ALT-801 showed the best efficacy, with a tumor growth inhibition (TGI) (relative to tumors in PBS-treated mice) of 87%, followed by ALT-801 (77% TGI) and Gem + Cis (52% TGI).
- TGI tumor growth inhibition
- ALT-801 in combination with gemcitabine and cisplatin treatment did not significantly reduce the mouse body weight and there was no observed mortality or post- treatment signs of toxicity, suggesting the treatment regimen was safe.
- Example 3 Effects of ALT-801 or MART-lscTCR/IL-2 fusion proteins in combination with gemcitabine on primary tumor growth of UMUC-14 human bladder cancer in nude mice.
- ALT-801 c264scTCR-IL2
- gemcitabine a non- targeted scTCR/IL-2 fusion protein
- MART-lscTCR/IL-2 a non- targeted scTCR/IL-2 fusion protein
- gemcitabine a non- targeted scTCR/IL-2 fusion protein
- ALT-801 c264scTCR/IL-2
- p53 aa264-272
- HLA-A*0201 complex
- MART-lscTCR/IL-2 a different scTCR/IL-2 fusion protein, recognizes the MART-1 (aa27-35) peptide presented in the context of HLA-A*0201 but not p53 (aa264-272)/HLA-A*0201. This protein has served as a non-targeted control reagent in studies with HLA-A*0201 + /p53 + subcutaneous tumors.
- ALT-801 and MART-lscTCR/IL-2 exhibited equivalent abilities to bind cell-surface IL-2 receptors and stimulate NK cell responses.
- ALT-801 exhibited much better anti-tumor activity than MART- lscTCR/IL-2 against subcutaneous HLA-A*0201 + /p53 + A375 human melanoma tumors in mouse model (Wen, et al. 2008 Cancer Immunol Immunother. 57:1781). This effect is likely due to tumor specific recognition by the ALT-801 protein.
- ALT-801 and MART-lscTCR/IL-2 were evaluated to determine the contribution of tumor targeting to the anti-tumor activity of the scTCR/IL-2 fusion proteins.
- Tumor-bearing mice receiving gemcitabine plus cisplatin served as a control group for this study.
- Athymic nude mice (4 animals/group) bearing subcutaneous UMUC-14 tumors (average volume 80 mm 3 ) were treated intravenously (i.v.) with gemcitabine (40 mg/kg) (Gem) plus cisplatin (3 mg/kg) (Cis), ALT-801 (1.6 mg/kg) plus Gem (40 mg/kg) or MART- lscTCR/IL-2 (2.4 mg/kg, dose equivalent activity of ALT-801) plus Gem (40 mg/kg), given for two cycles of treatment.
- the first treatment cycle consisted of 1 Cis injection on Study Day (SD) 1, two Gem injections on SD 1 and SD 8, and four injections of ALT-801 or MART-lscTCR/IL-2 on SD 3, SD 5, SD 8 and SD 10 in the first cycle.
- SD 15 - SD 21 After an 11-day rest period (SD 15 - SD 21), a second cycle of treatment was conducted for this study using the same regimen as in the first cycle followed by a 6-day follow-up period (SD42-SD47).
- the observed efficacy of the non-targeted MART-lscTCR/IL-2 fusion protein indicates that UMUC-14 human bladder xenografts are also highly sensitive to IL-2 based therapies. Therefore, this data demonstrates that the targeting activity of the c264scTCR component of ALT-801 is not required for its potent efficacy against the UMUC-14 bladder tumor cells.
- Example 2 the results clearly indicate that the combination of an IL-2 fusion protein with chemotherapy (either gemcitabine + cisplatin or gemcitabine) resulted in effective treatment against human bladder tumors, including tumor cells that are resistant to the chemotherapeutic agents.
- mice (5 animals/group) bearing subcutaneous UMUC-14 tumors
- the first treatment cycle consisted of 1 Cis injection on Study Day (SD) 9, two Gem injections on SD 9 and SD 16, and four injections of ALT-801 or MART-lscTCR/IL-2 on SD 11, SD 13, SD 16 and SD 18 in the first cycle.
- Body weight loss was also found in both ALT-801+Gem and MART-lscTCR/IL-2+Gem treatment groups when compared to PBS group, however, mean mouse body weights for both the ALT- 801+Gem and MART-lscTCR/IL-2+Gem treatment groups recovered rapidly during the 11- day rest period and 13-day follow-up period.
- a different human bladder tumor cell line, KU7P was used to further evaluate the efficacy of ALT-801 and MART-lscTCR/IL-2, in combination with Gem or Gem+Cis.
- This cell line is a HLA-A*0201 negative and p53 overexpressing cell line and does not display antigens recognized by either the ALT-801 or MART-lscTCR/IL-2 molecules.
- the results of this model could provide further evidence that the "non- targeted" anti-tumor activity of scTCR/IL-2 fusions in combination with Gem is efficacious against primary human bladder tumor xenografts in nude mice.
- Tumor-bearing mice receiving PBS or Gem+Cis served as a control group for this study.
- Athymic nude mice (5 animals/group) bearing subcutaneous KU7P tumors (average volume of 81 mm 3 except for the PBS group [-70 mm 3 ]) were treated with PBS, Gem (40 mg/kg) plus Cis (3 mg/kg), MART-lscTCR/IL-2 (2.19 mg/kg, dose equivalent activity of ALT-801) plus Gem (40 mg/kg), ALT-801 (1.6 mg/kg) plus Gem (40 mg/kg), or ALT-801 (1.6 mg/kg) plus Gem (40 mg/kg) and Cis (3 mg/kg), given for two cycles of treatment.
- the first treatment cycle consisted of 1 Cis injection on Study Day (SD) 7, two Gem injections on SD 7 and SD 14, and four injections of ALT-801 or MART-lscTCR/IL-2 on SD 9, SD 11, SD 14 and SD 16 in the first cycle.
- SD 17 - SD 27 After an 11-day rest period (SD 17 - SD 27), a second cycle of treatment was conducted for this study using the same regimen as in the first cycle followed by a 10-day follow-up period (SD37-SD45).
- this data further demonstrates that the targeting activity of the 264scTCR component of ALT-801 is not required for the potent efficacy in combination with Gem against the KU7P bladder tumor cells.
- the results of this study also indicate that the Gem+Cis regimen was more efficacious at inhibiting growth of KU7P bladder tumors than it was in the UMUC- 14 bladder tumor model and ALT-801 is efficacious against these bladder cancer cells without regard to their sensitivity to the Gem+Cis regimen.
- Example 5 Effect of ALT-801 on survival of C57BL/6 and Albino C57BL/6 mice bearing MB491uc orthotopic muscle invasive bladder tumors.
- the targeting activity of ALT-801 's TCR domain is not necessary for anti-tumor activity.
- ALT-801 c264scTCR-IL2
- c264scTCR-IL2 c264scTCR-IL2
- p53 aa264-272
- HLA-A*0201 complex recognized by ALT-801
- a relevant and reproducible mouse bladder cancer model (murine bladder cancer cell line MB491uc) in immunocompetent albino C57BL/6 mice was used to evaluate the efficacy of ALT-801.
- the MB491uc cell line expresses luciferase allowing for its detection using a bioluminescence assay.
- MB491uc (1 x 10 6 cells/bladder) were instilled intravesically into the bladders of albino C57BL/6 mice (17 weeks old) on study day 0.
- Surviving animals in the ALT-801 treatment group were re-challenged with intravesical instillation of MB491uc cells (1 x 10 6 cells per mouse) 84 days after initial instillation. Additionally naive C57BL/6 control mice were instilled with the tumor cells on the same day to serve as a control. Luciferase-based imaging to detect MB491uc cells was then performed 16 days after re-challenge with MB491uc cells.
- Tumor cell re-challenged mice of the previously ALT-801 -treated group showed no bioluminescence tumor signals, whereas the MB491uc-instilled naive mice showed evidence of tumor cell signal, demonstrating that the mice of the previously ALT-801 -treated group were resistant to re-implantation of the MB491uc tumor cells.
- mice C57BL/6 mice (9-10 weeks old) were instilled intravesically with MB491uc (0.075 x 10 6 cells/bladder) on study day 0, following polylysine pretreatment of the bladders.
- the mice were maintained to assess survival rate among the treatment groups as the efficacy endpoint.
- the survivors of the ALT-801 treatment were re-challenged with intravesical instillation of MB491uc cells (0.075 x 10 6 cells per mouse) 62 days after initial instillation.
- mice of the previously ALT-801- treated group showed no bioluminescence tumor signals, whereas the MB491uc-instilled naive mice showed evidence of tumor cell signal, suggesting that the mice of previously ALT-801 -treated group were resistant to re-implantation of the MB491uc tumor cells ( Figure 9B).
- ALT-801 i.v. treatment was effective in prolonging survival time of immunocompetent mice bearing syngeneic MB491uc orthotopic muscle invasive bladder tumors.
- ALT-801 treatment also provides durable immunological memory response against tumors to which they were previously exposed. These effects are independent of the targeting activity of the ALT-801 fusion protein.
- Example 6 Intravenous administration of ALT-801 prolonged survival of C57BL/6 mice bearing MB491uc orthotopic superficial bladder tumors.
- This study was conducted to evaluate the effect of ALT-801 when administered via intravenous (i.v.) injection in multi-dose regimens on survival of C57BL/6 mice bearing murine MB491uc orthotopic superficial bladder tumors.
- This study employed the relevant and reproducible murine MB491uc bladder cancer model in immunocompetent C57BL/6 mice described in the previous Examples. It has been demonstrated that intravesical instillation of MB491uc cells into the bladders of C57BL/6 mice resulted in a superficial form of bladder cancer 1-2 days post instillation. The tumors advanced to the muscle invasive form by day 7-9 post instillation and tumor-mediated mortality was observed after 2-3 weeks. In the present study, the survival benefit of i.v.
- ALT-801 administration of ALT-801 was examined in C57BL/6 mice bearing murine orthotopic superficial bladder cancer derived from MB491uc cells. Since these tumors lack the human p53 (aa264-272)/HLA-A*0201 complex recognized by ALT-801, this study is designed to assess the "non-targeted" anti-tumor activity of ALT- 801 against mouse orthotopic superficial bladder cancer.
- MB491uc (0.075 x 10 6 cells/bladder in 100 ⁇ ) were instilled intravesically into the bladders of C57BL/6 mice (9-11 weeks old) on study day 0 following polylysine
- mice C57BL/6 mice (9-11 weeks old) were instilled intravesically with MB491uc cells (0.075 x 10 6 cells/bladder) on study day 0, following polylysine pretreatment of the bladders.
- Example 7 Immune cells induced by ALT-801 treatment of C57BL/6 mice bearing MB491uc orthotopic bladder tumors.
- ALT-801 treatment in C57BL/6 mice bearing murine MB491uc orthotopic bladder tumors As described above, C57BL/6 mice were instilled intravesically with MB491uc cells (0.075 x 10 6 cells/bladder) on study day (SD) 0, following polylysine pretreatment of the bladders. Mice without tumor instillation served as a control. The mice (6/group) were then treated i.v. with PBS or ALT-801 (1.6 mg/kg) on SD 7, 10, 14 and 17.
- mice Three days after each treatment (i.e., SD 10, 13, 17, 20), groups of mice were sacrificed, the bladders were examined for tumor progression (hematuria, bladder size, appearance, neovascularization, and morphology) and the blood, spleens and bladders were collected for immune cell analysis.
- PBMCs were prepared from the blood
- splenocytes suspensions were prepared from the spleens and the bladders were fixed and sectioned for immunohistochemical staining.
- Immune cells CD3, NK and CD8 positive cells
- PMBCs and splenocytes were stained with monoclonal antibodies and analyzed by flow cytometry.
- Immune cells (macrophage, NK and CD3 positive cells) were assessed in bladder sections by IHC and tumor cells were examined by H&E staining. Additionally throughout the study, urine was collected from the animals to assess urine cytokine levels (IFNy and TNFa) by ELISA.
- ALT-801 treatment resulted in significant increases bladder macrophage levels.
- the induced macrophage levels returned to near normal levels by SD20 as the bladder morphology returned to normal.
- Similar but less significant changes in NK and CD3 positive cells were also seen in ALT-801 treated mice.
- ALT-801 induction of macrophage and other immune cell subtypes in the bladder are responsible for the anti-bladder tumor effects observed in this model.
- Analysis of cytokine levels in the urine also indicated that ALT-801 treatment resulted in stimulation of immune responses.
- Example 8 ALT-801 increased survival of mice in a murine model of multiple myeloma.
- ALT-801 significantly prolonged the survival of 5T33P myeloma bearing mice compared with PBS and re-challenged mice of the ALT-801 group survived significant longer than naive 5T33P -instilled mice.
- ALT-801 exhibits potent activity against HLA-A*0201 + /p53 overexpressing (p53 + ) human melanoma, mammary
- Murine 5T33 myeloma cells one of a series of transplantable murine myelomas arising spontaneously in C57BL/KaLwRij mice, are highly tumorigenic in C57BL/KaLwRij mice with as few as 500 cells inducing paralysis and death as early as day 36 post-tumor implantation.
- a 5T33-derived cell line, 5T33P was isolated from BM of paralyzed C57BL/6 mice that had been previously instilled with 1 x 10 7 of the parental 5T33 cell line. In this model, administration of at least 1 x 10 7 5T33P cells is required to cause paralysis in C57BL/6 mice with a take rate of approximately 100%.
- mice injected with 1 x 10 7 5T33P cells show signs of paralysis in hind legs between SD20 and SD30 post-tumor inoculation.
- the expression of the 5T33-produced IgG2b paraprotein by BM cells also can be used to evaluate the tumor development status in this model.
- ALT-801 did not affect 5T33P cell proliferation and induce cellular apoptosis. Based on previous nonclinical studies, this level of ALT-801 is expected to be in the therapeutic range. Thus, ALT-801 does not appear to have a direct cytotoxic effect on the 5T33P cells.
- mice receiving PBS dose equivalent volume
- ALT-801- SD4 treatment group ALT-801 was administered i.v. at 1.6 mg/kg on SD4, SD8, SD11, and SDl 5. Mice were monitored for clinical signs of paralysis or tumor growth and survival. Mice exhibiting hind leg paralysis were considered as moribund. All of the mice of the PBS group showed signs of paralysis between SD22 and SD34 and this group had a median survival of 29 days post tumor cell administration. In contrast, all of the mice of the ALT-
- ALT-801-SD4 groups survived beyond SD73 (the end of the observation period for the ALT-801-SD1 group), indicating that these mice were cured of the 5T33P tumors.
- multidose ALT-801 treatment initiated on either SDl or SD4 was found to significantly prolong survival of 5T33P myeloma-bearing mice when compared with the PBS control group (ALT-801-SD1 vs. PBS, P ⁇ 0.002; ALT-801-SD4 vs. PBS, P ⁇ 0.002).
- No marked difference was observed between ALT-801-SD4 group and ALT-801-SD1 group (P > 0.05).
- mice of the ALT-801-SD4 treatment group were re-challenged with lx 10 7 5T33P cells on SD106.
- five treatment-naive mice were also injected with lx 10 7 5T33P cells as a control for tumor development. No further ALT-801 study drug treatment was
- mice/group mice Female C57BL/6 mice (5 mice/group) were injected i.v. with 5T33P myeloma cells. After four days, the 5T33P tumor-bearing mice were administered a single i.v. injection of either ALT-801 (1.6 mg/kg) or PBS (dose equivalent volume). Mouse survival was monitored as the study endpoint with mice exhibiting hind leg paralysis considered as moribund.
- ALT-801 Single-dose ALT-801 on myeloma cells in the bone marrow were assessed in the 5T33P model.
- Tumor-bearing mice were treated with ALT-801 (1.6 mg/kg) or PBS and bone marrow cells were collected 1, 4 and 8 days post treatment. The cells were then cultured in vitro for 6 days and the culture supernatants were analyzed by ELISA for 5T33P cell-produced paraprotein (mouse IgG2b).
- ALT-801 treatment in vivo resulted in significantly lower levels of paraprotein in subsequent bone marrow cultures when compared to that of the PBS group (P ⁇ 0.05).
- ALT-801 was also effective at reducing the number of 5T33P myeloma cells in the bone marrow 4 days post treatment, as assessed using a bone marrow cell culture assay to detect 5T33P-derived paraprotein.
- Immune cell depletion studies demonstrated that the anti-myeloma activity of ALT-801 was primarily due to CD8+ T cells and partially due to NK cells. Other immune cells may play a role in the ALT-801 mediated anti-myeloma effects since the CD8+ and NK-cell depletion could not completely eliminate the anti-tumor effect on 5T33P tumor cells in the C57BL/6 mice.
- the results of these studies were consistent with previous studies demonstrating that ALT-801 treatment was highly effective at prolonging survival of myeloma-bearing immunocompetent mice.
- Example 9 ALT-801 significantly prolonged survival of MB491uc tumor bearing mice.
- ALT-801 The efficacy of intravenous administration of ALT-801 was compared to that of IL-2 in the orthotopic MB491uc muscle invasive bladder cancer model in immunocompetent C57BL/6 mice.
- Preclinical animal studies have indicated that ALT-801 exhibited the similar anti-tumor activity against subcutaneous HLA-A*0201 + p53 overexpressing (p53 + ) UMUC- 14 and HLA-A*0201 -negative p53 overexpressing (p53 + ) KU7 human bladder tumor xenografts in nude mice, indicating that targeting HLA-A*0201/p53 peptide complex on tumor cells seems not essential for ALT-801 therapeutic potency.
- ALT-801 against murine MB491uc orthotopic muscle invasive bladder tumors in immunocompetent C57BL/6 mice also implied the "non-targeted" anti-tumor activity of ALT-801. It has been known that murine MB491uc tumor cells lack the human HLA- A*0201/p53 peptide complex recognized by ALT-801. Clinical studies have shown that bladder cancers exhibit modest sensitivity to IL-2-based therapies. To understand the antitumor activity of ALT-801, it was of interest to compare the anti-tumor activity of IL-2 and ALT-801 in bladder tumor models.
- ALT-801 and IL-2 intravenous treatment were evaluated in a mouse bladder orthotopic model in immunocompetent C57BL/6 mice.
- C57BL/6 mice (10-11 weeks old) were instilled intravesically with MB491uc cells (3 x 10 4 cells/bladder in 100 ⁇ ) on day 0 following polylysine pretreatment of the bladder.
- Example 10 ALT-801 increased survival of MB491uc tumor bearing mice following M0, NK, or CD4 and CD8 cell depletion.
- ALT-801 treatment increased the percentage of CD3 + T cell
- CD8 + T cell, and NK cell percentages in spleen and blood of MB491uc -bearing mice were significantly elevated throughout a four dose ALT-801 treatment course. Increased infiltration of CD3 + T cells and NK cell in the bladders was also observed following repeated dosing of ALT-801 in MB491uc tumor-bearing mice. In contrast, bladder macrophage levels increased with orthotopic MB491uc tumor progression regardless of ALT-801 treatment. These results indicated that one or more of these immune cell subsets play a role in the anti-tumor activity of ALT-801 in this model.
- ALT-801 intravenous injection was evaluated following depletion of M0, NK, or CD4 and CD8 cells in C57BL/6 mice bearing mouse MB491uc orthotopic bladder tumors. Mice received MB491uc instillation on SD 0 and then received i.v. PBS or ALT-801 (1.6 mg/kg) treatment on SD 7, 10, 14, and 17. Prior to ALT-801 or PBS treatment, groups of mice were subjected to either M0 depletion by i.p. injection of
- Clophosome 150 ⁇ 8 ⁇ on SD 6, 9, 13, and 16; NK cell depletion by i.p. injection of anti- NK Ab (clone PK136, 250 ⁇ g in 100 ⁇ ) on SD 2, 3, 6, 9, 13, and 16; or CD4 and CD8 cell depletion by i.p. injection of anti-CD4 Ab (clone GK1.5, 250 ⁇ g in 100 ⁇ ) and anti-CD8 Ab (clone 53-6.72, 250 ⁇ g in 100 ⁇ ) on SD 2, 3, 6, 9, 13, and 16. Mice were maintained to assess survival rate among the study groups as the efficacy endpoint.
- MDSCs expand in a wide array of tumor models. MDSCs act to suppress NK and T cells through a variety of mechanism. Without being bound to a particular theory, the presence of MDSCs in mice bearing orthotopic MB491uc tumors may provide evidence of
- C57BL/6 mice were instilled intravesically with MB491uc tumor cells (0.03 x 10 6 cells/mouse) as described above. Control mice did not receive tumor cells.
- Blood was collected from control and tumor-bearing C57BL/6 mice (5 per group) on days 3, 5, 7, 10 and 13 post tumor cell instillation.
- Levels of GR-l + /CDl lb + MDSCs in the blood were evaluated by flow cytometry. Blood MDSC levels were elevated in tumor bearing mice as early as 3 days post tumor cell instillation and further increased with time in these animals (Figure 20). Blood MDSC levels in tumor bearing mice were significantly increased compared to control mice 13 days after MB491uc cell instillation.
- Example 11 Intravenous administration of ALT-801 increased Ml-type macrophages in bladders of C57BL/6 mice bearing MB491uc orthotopic bladder tumors.
- Macrophages play an important role in solid tumors due to their abundance, plasticity and diversity. Two distinct activation states of macrophages are recognized: the classically activated (Ml) phenotype and the alternatively activated (M2) phenotype. Each type of macrophages has its own markers for identification. Features of Ml macrophages include expression of iNOS, ROS and the production of IL-12. M2 macrophages are associated with high production of IL-10, IL-lb, VEGF and matrix metalloproteinases (MMPs).
- mice/group Two treatment groups, PBS and ALT-801, (3 mice/group) were included in this study.
- SD On study day (SD) 0, MB491uc cells (0.06 x 10 6 cells/mouse) were instilled intravesically into bladder following 10 minutes of poly-lysine pretreatment.
- 100 ⁇ L ⁇ o ⁇ ALT- 801 (1.6 mg/kg) or PBS were injected intravenously through the tail vein.
- Mice were sacrificed within 24 hours of treatment and their bladders were snap-frozen in OCT with liquid nitrogen. IHC staining was performed to check the activation states of macrophages in the bladders.
- iNOS and MMP-9 are used to identify Ml and M2 macrophages, respectively.
- F4/80 antibody staining showed substantial number of macrophages in the bladders of MB491uc orthotopic tumor-bearing mice compared to non- tumor bearing mice. There was no significant difference between PBS and ALT-801 treatment groups in terms of the level of F4/80 antibody staining of the bladder macrophages. In conclusion, a higher percentage of the macrophages were repolarized to the Ml phenotype in the bladders after intravenous ALT-801 treatment of MB491uc-bearing mice.
- ALT-801 efficacy was dependent on the macrophages in MB491uc tumor-bearing mice, these results suggest that repolarized Ml macrophages may contribute to the anti-tumor effects exerted by ALT-801.
- Example 12 ALT-801 induced IFN- ⁇ producing cells in C57BL/6 mice.
- IFN- ⁇ plays an important role in anti-tumor immunity by inhibiting various tumor cell growth, up-regulating MHC molecule expression on tumor cells, activating various immune cells and anti-angiogenesis.
- IFN-y can be produced by multiple subsets of immune cells, e.g. CD4 + T cells, CD8 + T cells and NK cells after activation.
- monoclonal antibodies against mouse CD4, CD8 and NK cells were injected peritoneally into C57BL/6 female mice to deplete the correspondent immune cell subsets. Serum IFN- ⁇ levels in the immune cell-depleted mice were determined after 24 hours of ALT-801 injection.
- MB491uc cells (2 x 10 5 /well) were cultured in RPMI-10 with IFN- ⁇ at 1 or 10 ng/mL.
- the IFN-y-treated MB491uc cells were harvested and stained with FITC-labeled Annexin V.
- the Annexin V positive apoptotic MB491uc cells were determined by flow cytometry. IFN- ⁇ treatment does not directly result in detectable cytotoxicity against MB491uc cells ( Figure 23).
- Mouse splenocytes were cultured in RPMI-10 with 20 nM ALT-801 for 3 days and then used as effector LAK cells against PKH67-labeled MB491uc target cells in cytotoxicity assays.
- the effector cells (4 x 10 6 /well) and target cells (4 x 10 5 /well) were incubated at 37°C for 24 hours in RPMI-10 containing 0 - 50 nM ALT-801.
- the cytotoxicity of LAK cells against MB491uc cells was evaluated by flow cytometry based on staining with propidium iodide.
- ALT- 801 -activated splenocytes effectively lysed MB491uc cells in a manner dependent on the concentration of ALT-801 present during the cytotoxicity assay ( Figure 24).
- Gemcitabine is one of the drugs in the standard combination chemotherapy for muscle invasive bladder cancer. It has been reported that gemcitabine reduces myeloid-derived suppressor cells (MDSCs) in tumor-bearing mice. In this report, we studied the effect of gemcitabine on MDSCs induced by MB491uc cells in mice. MB491uc tumor-bearing mice were treated intravenously with gemcitabine at 40 mg/kg. Three days after gemcitabine treatment, splenocytes were isolated and the percentage of Grl + CDl lb + MDSCs was determined by flow cytometry. The MDSCs accounted for 1.19 ( ⁇ 0.25) percent of the splenocytes in normal control mice without MB491uc tumors.
- MDSCs myeloid-derived suppressor cells
- ALT-801 has the same activity as IL-2 to stimulate human T cells and NK cells in vitro.
- IL-2-activated immune cells that display cytotoxicity against various tumor cells are referred to as LAK (lymphokine-activated killer) cells.
- LAK lymphokine-activated killer
- the LAK cell activity was investigated using ALT-801 pre-activated mouse splenocytes used as effector cells and MB491uc tumor cells as targets.
- the results of this study showed that ALT- 801-activated splenocytes effectively lysed MB491uc cells in the manner that was dependent on the ALT-801 concentration during the killing phase.
- the finding indicates that ALT-801 is capable of activating effector immune cells and augmenting their cytotoxic activity against bladder tumor cells.
- gemcitabine treatment significantly reduced the levels of MDSCs in the spleens of MB491uc tumor-bearing mice.
- Example 13 ALT-801 induced tumor cell killing by immune cells after MDSC
- MDSCs are a heterogeneous population of immature myeloid cells consisting of myeloid progenitor cells, immature macrophages, immature dendritic cells, and immature granulocytes.
- MDSCs act to suppress NK and T cells through direct cell contact, cytokines, and byproducts of metabolic pathways, control expansion and activation of Tregs, and support neoangiogenesis and metastatic spread of the tumor cells.
- mice In mice, MDSCs are defined by cell surface expression of CD l ib and Grl. Normal mice only have a small proportion (2-4%) of spleen cells that are CDl lb + Grl + , but cells with this phenotype can reach 20-40% in some mouse tumor models. To investigate the activity of these cells, spleens were harvested from C57BL/6 mice bearing subcutaneous MB49G tumors and isolated MBSCs by magnetic sorting with anti-Grl and anti-Ly6G Ab beads. Through this procedure, lxlO 7 MDSCs with 96% purity were collected from each animal ( Figure 26).
- the purified MDSCs were then transferred into syngeneic normal mice to allow assessment of their immunosuppressive activity on normal immune effector cells. Forty hours after adoptive transfer, spleen cells of recipient mice were collected and activated by culturing with 50 nM ALT-801 for two days. The resulting LAK effector cells were co- cultured with PKH67-labeled MB491uc tumor cell targets overnight to assess tumor cell killing.
- MDSCs are potential therapeutic targets for anticancer treatment.
- gemcitabine a widely-used chemotherapeutic, can selectively eliminate MDSCs in tumor-bearing animals and enhance tumor-suppressive immune activity (Suzuki et al., Clin Cancer Res, 11: 6713-6721, 2005).
- combination therapy with gemcitabine and ALT-801 was found to be more effective than either agent as monotherapy.
- Example 14 A model of the anti-tumor mechanism action of ALT-801
- ALT-801 activates CD4 + and NK cells to secrete IFN-y.
- IFN-y activates macrophages, repolarizes tumor-associated macrophages (TAMs ) from the tumor-promoting M2 to the tumor-destructive Ml stage, and induces the THI immune responses against the tumor cells.
- TAMs tumor-associated macrophages
- ALT-801 alone stimulates memory CD8 + T cells to proliferate and up-regulate innate- type killer receptors.
- ALT-801 treatment induced secretion of IFN- ⁇ upon infusion in normal and tumor- bearing mice.
- IFN- ⁇ was at a high level both in serum and urine approximately 4-6 hrs after ALT-801 intravenous infusion (Fishman et al., Clin Cancer Res, 2011. 17:7765).
- CD4 and NK cells are the major source of the serum IFN- ⁇ based on an immunodepletion study showing that serum levels of IFN- ⁇ induced by ALT-801 administration were substantially reduced by the elimination of CD4 + T cells and NK cells in mice (Example 12).
- IFN- ⁇ did not inhibit bladder cancer cell growth nor induce apoptosis in bladder cancer cells.
- ALT-801 lost its anti-bladder cancer activity against intravesically implanted MB491uc bladder tumors.
- immunohistochemical staining results indicated that this may be because IFN- ⁇ is required to repolarize the M2 TAMs to Ml TAMs (Example 11).
- Ml TAMs mount a rapid and potent anti-tumor response against the tumors.
- IFN- ⁇ is the most potent stimulator of monocytes and macrophages (Schroder et al., J Leukoc Biol, 2004. 75:163).
- the pivotal role of monocytes/macrophages in ALT-801 - mediated anti-tumor activity was demonstrated by the results of studies showing that the depletion of monocytes using liposomes eliminated the efficacy of ALT-801 against orthotopic MB491uc bladder tumors (Example 10).
- IFN- ⁇ (from ALT- 801 -activated CD4 + and NK cells) has the potential to activate circulating monocyte and macrophages (such as Kupffer cells in the liver) to infiltrate into the tumor lesions for cell-mediated killing of the tumors (Seki et al., Clin Dev Immunol, 2011, 2011:868345).
- monocyte and macrophages such as Kupffer cells in the liver
- INF- ⁇ - a pleiotropic cytokine - is also known to exhibit various anti-tumor functions (Schroder et al., J Leukoc Biol, 2004, 75:163; Zaidi et al., Clin Cancer Res, 2011, 17:6118).
- INF- ⁇ secreted from ALT-801 -activated CD4 + and NK cells directly affects tumor growth via the activation of a large number of secondary response genes (Boehm et al., Annu Rev Immunol, 1997, 15:749).
- ALT-801 -activated CD4 + T cells are capable of infiltrating the tumors and secreting IFN- ⁇ in the tumor microenvironment to effectively re-polarize the TAMs for tumor destruction.
- the data of the IHC study (Example 11) are consistent with this theory.
- ALT- 801 -activated CD8 cells are important to the anti-bladder cancer activity of ALT-801.
- cytokine-mediated stimulation could promote antigen- nonspecific expansion of memory CD8 + cells with a unique phenotype.
- memory CD8 + T cells resulting from antigen-dependent expansion which up-regulates PD- 1 and CD25
- the cytokine-mediated expanded memory CD8 + T cells in these studies express NKG2D, granzyme B, possess broad lytic capabilities and are suggested to be responsible for the dramatic anti-tumor effects of cancer immuno-therapy (Tietze et al., Blood, 2012, 119:3073).
- ALT-801 activation of this type of memory CD8 + T cell plays a major role in the anti-MB491uc tumor activity in mice.
- ALT-801 alone could induce memory CD8 + T cell expansion in-vitro.
- the phenotype of CD8 + CD44 high T cells were compared after activation with ALT-801 or anti-CD3 antibody (TCR-dependent engagement).
- the exposure of CD8 + T cells to ALT-801 or anti-CD3 antibody generated CD8 + CD44 high T cells with markedly different phenotypes.
- ALT-801 stimulation led to up-regulation of NKG2D but not higher levels of CD25 and PD-1 expression whereas anti-CD3 stimulation led to higher levels of CD25 and PD-1 expression but not NKG2D up-regulation.
- non-tumor bearing mice were injected intravenously with ALT-801 at 1.6 mg/kg (in 100 ⁇ ) or PBS (100 ⁇ ) twice (72 hours apart) and the phenotypes of PBMCs and splenocytes were analyzed one day after the second PBS or ALT-801 treatment.
- Levels of CD8 + CD44 high memory T cells expressing NKG2D expanded following ALT-801 treatment compared levels seen in IL-2- or PBS-treated mice.
- ALT-801 is apparently capable of activating CD8 + CD44 hlgh memory T cells with unique phenotype in an antigen- independent fashion.
- NKG2D7CD257CD8 + /CD44 high T cells from naive C57BL/6 mice were sorted.
- the sorted NKG2D7CD25 CD8 + /CD44 high T cells were labeled with CelltraceTM Violet tracer, and adoptively transferred (0.4 x 10 6 cells/recipient mouse) into naive C57BL/6 mice.
- mice were treated with two doses of PBS or with ALT-801 and splenocytes were harvested one day after the second treatment to analyze for NKG2D phenotype.
- NKG2D was expanded and up- regulated in the CelltraceTM Violet-labeled CD8 + CD44 high T cells from ALT-801 -treated mice but not in PBS controls.
- the ALT-801 -activated CD8 + CD44 high T cells exhibited antigen-independent potent anti-tumor activity against bladder cancer cells.
- ALT-801 activates memory CD8 + T cell to proliferate and up-regulate innate-like surface receptors in an antigen-independent manner.
- These activated memory T cells mount effective but antigen-independent killing against bladder cancer cells. It is possible that this innate-type, antigen-independent response is the reason that the anti-tumor activity is not dependent on targeting p53-peptide/HLA-A*0201 antigen
- MDSCs myeloid-derived suppressor cells
- MDSCs are a heterogeneous population of immature myeloid cells consisting of myeloid progenitor cells, immature macrophages, immature dendritic cells, and immature granulocytes (Gabrilovich et al., Nat Rev Immunol, 2009, 9:162).
- MDSCs expand in a wide array of transplantable and autochthonous tumor models.
- MDSC accumulation in the blood, spleen, marrow, and tumor site is likely an early event in tumor progression due presumably to expansion and recruitment of cells from the bone marrow to the tumor site through secretion of tumor- derived factors, such as granulocyte-macrophage colony-stimulating factor and TNF-a (Bayne et al., Cancer Cell, 2012, 21 :822; Pylayeva- Gupta et al., Cancer Cell, 2012, 21:836; Zhao et al., J Clin Invest, 2012, 122:4094.).
- tumor- derived factors such as granulocyte-macrophage colony-stimulating factor and TNF-a
- MDSCs act to suppress NK and T cells through direct cell contact, cytokines, and byproducts of metabolic pathways, control expansion and activation of Tregs, promotion of Treg infiltration to the tumors, and support neoangiogenesis and metastatic spread of the tumor cells (Gabrilovich et al., Nat Rev Immunol, 2009, 9: 162; Peranzoni et al., Curr Opin Immunol, 2010, 22:238; Marigo et al. Immunol Rev, 2008, 222: 162; Chioda et al., Cancer Metastasis Rev, 2011, 30:27; Schlecker et al., J Immunol, 2012, 189:5602).
- MDSCs appear to be closely related to tumor associated macrophages (TAMs), which usually exhibit M2 polarization and can contribute to tumor progression and immune suppression by producing IL-10, TGF , and pro- angiogenic factors such as matrix metalloproteases, VEGF, and platelet-derived growth factor (Mantovani et al., Hum
- CDl lb + /CD15 low /CD33 high with co-expression of the monocyte-macrophage markers CD 14, CD115, CD116, and CCR2.
- CDl lb + /CD15 high /CD33 low cells were found to be present in higher levels in bladder cancer patients, whereas the CDl lb + /CD15 low /CD33 hlgh cells were found to be present in significant amounts in healthy volunteers.
- both populations were found to secrete substantial amounts of cytokines, only the
- CD1 lb + /CD15 high /CD33 low population was noted to have immunosuppressive activity.
- 2 distinct MDSC populations were found to infiltrate the tumors: 60% to 70% of those cells described as CDl lb + /HLA-DR + with remaining 30% to 40% described as CDl lb + and CD15 + .
- the clinical significance of those cells was not fully explored.
- a correlation was found between increased levels of circulating tumor cells described as CDl lb + /HLA-DR + with remaining 30% to 40% described as CDl lb + and CD15 + .
- immunosuppressive CD14 + /HLA-DR low cells and clinical cancer stage and pathological grade in patients with urothelial carcinomas of the bladder.
- patients with urothelial carcinomas of the bladder exhibit elevated levels of MDSCs, including immunosuppressive phenotypes, which correlate with advanced disease.
- the intravesically implanted tumors substantially elevate the MDSCs in the blood when the disease progresses to the muscle-invasive stage (Example 10).
- Example 12 ⁇ MDSCs from MB491uc tumor-bearing C57BL/6 mice were sorted and adoptively transferred into non-tumor-bearing (recipient) C57BL/6 mice.
- Splenocytes from wild-type C57BL/6 mice exhibited significantly stronger cytotoxicity against MB491uc cells than splenocytes isolated from MDSC recipient mice (Example 13).
- gemcitabine treatment significantly reduced the levels of MDSCs of tumor-bearing mice (Example 12). These data suggest that gemcitabine may be a useful chemotherapeutic drug to eliminate MDSCs, thereby allowing ALT- 801 -stimulated immune effector cells to mediate anti-tumor activity against bladder cancer.
- ALT-801 in combination with gemcitabine resulted in significantly greater anti-tumor activity than either ALT- 801 or gemcitabine alone.
- Example 15 Human clinical trial protocol.
- the study includes a dose escalation phase to determine the maximum tolerated dose (MTD) of ALT-801 in combination with cisplatin and gemcitabine and a two-stage expansion phase at the MTD.
- the dose escalation in this study is conducted using a (3+3) dose escalation design, and the two-stage expansion phase at the MTD using a modified Simon two-stage design.
- there are five dose levels of ALT-801 (0.04 mg/kg, 0.06 mg/kg and 0.08 mg/kg, 0.10 mg/kg and 0.12 mg/kg) in addition to two de-escalation dose levels.
- cisplatin 70 mg/m 2 /dose
- gemcitabine 1000 mg/m 2 /dose
- the planned initial on-study treatment is for 3 courses. Each course consists of cisplatin (Day #1), gemcitabine (Day #1), ALT-801 (Day #3 & Day #5), gemcitabine (Day #8), ALT-801 (Day #8 & Day #10), and a rest period (Days #11-21). Prior to commencing the second or the third course, subjects need to meet the continuation criteria. At the completion of the three full courses of study treatment, each patient enrolled will have been scheduled to have a total of 12 doses of the study drug ALT-801, 3 doses of cisplatin, and 6 doses of gemcitabine.
- ALT-801, cisplatin and gemcitabine are administered by intravenous infusion into a central or peripheral vein under the supervision of a qualified physician experienced in the use of anti-cancer agents including aldesleukin (Proleukin ® ), cisplatin and gemcitabine.
- the following is the schema for the dose levels during the dose- escalation phase of the study.
- the -1 and -2 dose levels of ALT-801 are included in case of DLT events in the initial dose level. -1 0.02 70 1000
- a minimum of 3 patients are enrolled at each dose level. All patients are monitored for Dose Limiting Toxicity (DLT) for 8 weeks from the initial dose. If 0/3 patients have study treatment-related, dose-limiting toxicity by 8 weeks after the initial dose, the next cohort are opened for enrollment. If one patient at a dose-level develops drug-related DLT, up to six patients are enrolled at that dose level and each subsequent higher dose level. If 0 or 1 of 6 patients in a cohort of 6 patients has an event that meets criteria for study treatment-related DLT, then the next cohort are opened for enrollment.
- DLT Dose Limiting Toxicity
- That dose level is designated as exceeding the maximum tolerated dose. If there are 3 patients in the dose level below this level, then additional patients (up to 6 total) are enrolled at that dose level. When there is a dose level with 0 or 1 out of 6 patients with DLT, which is either the maximum planned dose level (level 5) or which is one level below a dose that was not tolerated, the dose that is the maximum tolerated dose is considered defined. Further changes in the treatment plan may be considered by protocol amendment at that point.
- Dose limiting toxicity is defined as any toxicity of grade 3 that does not resolve to Grade 1 or lower within 72 hours and any toxicity of Grade 4 occurring during treatment courses with exceptions and details described in the study protocol. Patients experiencing a DLT should discontinue study treatment. Study treatment discontinuation due to adverse events experienced prior to study drug administration, disease progression or patient' s decision to withdraw from study treatment without occurrence of any study treatment discontinuation event will not necessarily define a DLT event. Study treatment
- OR rate ORR
- the sample size is driven by the parameter that had the larger sample size for each stage.
- the patient enrollment will be temporarily suspended based on occurrence of any the following, and the sponsor, the Data Safety Monitoring Board and principal investigators will meet to discuss how to proceed with future patient enrollment in the study:
- Patients are evaluated for clinical toxicities during the treatment. Patients' blood samples are collected to assess the pharmacokinetic profile and immunogenicity of the study drug. The anti-tumor response are evaluated for up to 18 weeks from the initial dose of the first course of treatment. All patients who receive at least one dose of the study drug ALT- 801 are included in the anti-tumor response evaluation. Between each cohort and at the end of the study, all clinical and safety data are analyzed for all patients enrolled in the study for dose-response effects. Population
- Patients of 18 years of age and above who are candidates for systemic cisplatin and gemcitabine for the treatment of muscle invasive or metastatic urothelial cancer of bladder, renal pelvis, ureters, and urethra may be selected for further evaluation of eligibility for study participation. Patients also need to have adequate cardiac, pulmonary, liver and kidney functions and to have an Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1 and a life expectancy of at least 12 weeks.
- ECOG Eastern Cooperative Oncology Group
- a total of up to 30 assessable patients will be accrued to the initial dose escalation phase of the study (Phase lb); the estimated number is 21. Up to an additional 40 assessable patients will be enrolled at the expansion phase (Stage 1 and 2) of the study (Phase II). A total of approximately 61 assessable patients will be enrolled and complete the study.
- Blood samples are collected to assess typing for HLA-A2, immune cell levels, phenotype, pharmacokinetics, immunogenicity of the study drug ALT-801, and the serum levels of IFN- ⁇ and TNF-a.
- Tumor samples are collected to test HLA-A*0201/p53 aa 264- 272 complex presentation.
- Blood samples for pharmacokinetic analysis of ALT-801 are taken on the first day of ALT-801 administration in the first course of study treatment. Venous blood is obtained at Time 0 (before the start of infusion), at 30 minutes (15 minutes after completion of infusion), and 1, 3 and 6 hours from Time 0 for the assessment of ALT-801 serum concentration. Non-compartmental and compartmental analyses are conducted.
- the same blood samples collected for PK analysis are used to assess the
- Urine samples for urinalysis, blood samples for standard chemistry, CBC, differential and coagulation are obtained at screening, on each study drug infusion day, discharge days and follow-up visits.
- Blood samples for immunogenicity testing, which include assays for anti-ALT-801 and IL-2 neutralizing antibodies, are collected prior to dosing on the first ALT- 801 infusion day and at Week 9 from the initial dose of study treatment.
- the anti-tumor response are evaluated for up to 18 weeks from the initial dose of study treatment: for non-responders: Week 9 and 13; for early responders: Week 9 and 14; for late responders: Week 9, 13 and 18.
- Objective Response are evaluated using the new international criteria proposed by the Response Evaluation Criteria in Solid Tumors
- Baseline evaluations should be performed up to 28 days before starting study treatment. The same method of assessment and the same technique should be used to characterize each identified and reported lesion at baseline and during follow-ups. Imaging-based evaluation is preferred to evaluation by clinical examination when both methods have been used to assess the anti-tumor effect of the treatment. However, cystoscopic evaluation may be used routinely in this population, in addition to radiologic testing.
- Progression-free survival and overall survival of all enrolled patients are assessed at 6, 9, 12, 18, 24, 30 and 36 months from the start of study treatment, or through the point designated as the end of the study follow up.
- AEs Adverse Events
- Patients may volunteer information concerning AEs.
- All adverse events are graded by using the NCI Common Terminology Criteria for Adverse Events version 4.0 (CTCAE v4.0), and logged in the patient Case Report Form.
- CCAE v4.0 NCI Common Terminology Criteria for Adverse Events version 4.0
- the study centers should report all SAEs and all events that trigger patient' s study treatment discontinuation to the sponsor via phone, fax or email (or a combination) up to 1 day after learning of the event.
- the sponsor will use the information to manage and coordinate the dose escalation, cohort expansion and patient enrollment.
- the sponsor will then inform all of the participating clinical sites of the current dose level and the number of patients to be enrolled at that level, or of any patient enrollment suspension via phone, fax or email within a day of its learning of the event.
- the study centers should report the other adverse events to the sponsor following the guidelines defined in the study protocol. All study drug related adverse events (AEs) that are both serious and unexpected will be reported to the FDA in an expedited manner in accordance with 21 CFR ⁇ 312.32.
- Example 16 Phase 1/2 study for an IL-2/T-cell receptor fusion protein in combination with gemcitabine and cisplatin (GC) showed a positive response in patients with locally advanced or metastatic urothelial cancer
- ALT-801 is a human IL-2/single-chain T-cell receptor fusion protein previously tested in a phase 1 in patients with advanced malignancy (Fishman et al. (2011) Clin Cancer Research 17:7765). In various murine models, ALT-801 demonstrated potent activity against syngeneic and xenograft urothelial cancer, suggesting sensitivity of this disease to IL-2 based immunotherapy (see above). Although urothelial cancers are sensitive to platinum-based chemotherapy, combinations such as gemcitabine + cisplatin are associated with complete response rates only around 15%, and limited durability of responses with limited effects of retreatment.
- ALT-801 escalating doses, days 3, 5, 8, 10.
- Patient demographics and disease status are shown at Figure 30.
- ALT-801 planned doses are 0.04 to 0.12 mg/kg/dose in 5 dose cohorts with a 3+3 escalation design.
- Subjects with at least stable disease after 3 courses may receive 4 additional weekly doses of ALT-801 alone.
- Stage IV urothelial cancer patients IF, 2M; 59-63 yrs; 2 patients had predominantly nodal metastases and one patient liver metastases
- IF, 2M 59-63 yrs; 2 patients had predominantly nodal metastases and one patient liver metastases
- ALT-801 +GC 0.04 mg/kg ALT-801 +GC.
- Grade 3/4 toxicities observed include neutropenia (2), thrombocytopenia (2), leukopenia (1), lymphopenia (1) and anemia (1), consistent with GC and ALT-801 known pharmacodynamic effects. All 3 had radiological complete responses by week 13.
- One patient who then underwent radical cystectomy was confirmed pathologically free of tumor cells.
- the response rate (including complete responses) observed in treatment naive subjects with advanced/metastatic urothelial cancer following treatment with ALT-801 + GC is highly unexpected based on previously published clinical studies in this patient population. For example, von der Maase et al. (J. Clin. Oncol. (2000) 17:3068) reported in a Phase III clinical study of patients with advanced or metastatic bladder cancer, treatment with gemcitabine + cisplatin resulted in an overall tumor response rate (i.e., rate of partial response and complete response) of 49.4% (81 of 182 assessed patients) and a complete response rate of 12.2% by independent radiologic review.
- an overall tumor response rate i.e., rate of partial response and complete response
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Inorganic Chemistry (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Urology & Nephrology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicinal Preparation (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020197034966A KR20190134832A (ko) | 2012-03-29 | 2013-03-15 | 종양 형성 치료방법 |
| KR20147030163A KR20150002706A (ko) | 2012-03-29 | 2013-03-15 | 종양 형성 치료방법 |
| US14/388,575 US20150216937A1 (en) | 2012-03-29 | 2013-03-15 | Methods for treating neoplasia |
| CN201380028390.7A CN104470535A (zh) | 2012-03-29 | 2013-03-15 | 用于治疗肿瘤的方法 |
| CA2868431A CA2868431A1 (en) | 2012-03-29 | 2013-03-15 | Methods for treating neoplasia |
| JP2015503334A JP6639228B2 (ja) | 2012-03-29 | 2013-03-15 | 新生物を治療するための方法 |
| EP13768152.4A EP2830648A4 (en) | 2012-03-29 | 2013-03-15 | METHOD FOR TREATING NEOPLASIA |
| AU2013240191A AU2013240191B2 (en) | 2012-03-29 | 2013-03-15 | Methods for treating neoplasia |
| AU2018203584A AU2018203584A1 (en) | 2012-03-29 | 2018-05-22 | Methods for treating neoplasia |
| US16/510,835 US20190328838A1 (en) | 2012-03-29 | 2019-07-12 | Compositions comprising il-2 fusion proteins and methods for treating neoplasia |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261617370P | 2012-03-29 | 2012-03-29 | |
| US61/617,370 | 2012-03-29 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/388,575 A-371-Of-International US20150216937A1 (en) | 2012-03-29 | 2013-03-15 | Methods for treating neoplasia |
| US16/510,835 Continuation US20190328838A1 (en) | 2012-03-29 | 2019-07-12 | Compositions comprising il-2 fusion proteins and methods for treating neoplasia |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013148337A1 true WO2013148337A1 (en) | 2013-10-03 |
Family
ID=49261086
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/032269 Ceased WO2013148337A1 (en) | 2012-03-29 | 2013-03-15 | Methods for treating neoplasia |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US20150216937A1 (OSRAM) |
| EP (1) | EP2830648A4 (OSRAM) |
| JP (2) | JP6639228B2 (OSRAM) |
| KR (2) | KR20190134832A (OSRAM) |
| CN (2) | CN111420032A (OSRAM) |
| AU (2) | AU2013240191B2 (OSRAM) |
| CA (1) | CA2868431A1 (OSRAM) |
| WO (1) | WO2013148337A1 (OSRAM) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10322192B2 (en) | 2016-03-02 | 2019-06-18 | Eisai R&D Management Co., Ltd. | Eribulin-based antibody-drug conjugates and methods of use |
| US10722527B2 (en) | 2015-04-10 | 2020-07-28 | Capsugel Belgium Nv | Abiraterone acetate lipid formulations |
| US11040027B2 (en) | 2017-01-17 | 2021-06-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
| US11446322B2 (en) | 2017-07-25 | 2022-09-20 | Taris Biomedical Llc | Methods of treating tumor metastasis |
| US12006354B2 (en) | 2017-05-24 | 2024-06-11 | Novartis Ag | Antibody-IL2 engrafted proteins and methods of use in the treatment of cancer |
| US12029749B2 (en) | 2017-11-08 | 2024-07-09 | Taris Biomedical Llc | Methods of treatment and maintenance therapy for bladder cancer using gemcitabine |
| US12582599B2 (en) | 2014-03-06 | 2026-03-24 | Taris Biomedical Llc | Methods for treatment of bladder cancer with gemcitabine |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016100375A2 (en) | 2014-12-15 | 2016-06-23 | Washington University | Compositions and methods for targeted cytokine delivery |
| WO2017136818A2 (en) | 2016-02-05 | 2017-08-10 | Washington University | Compositions and methods for targeted cytokine delivery |
| SG11201809838VA (en) * | 2016-05-06 | 2018-12-28 | Taris Biomedical Llc | Method of treating lower tract urothelial cancer |
| KR102650803B1 (ko) * | 2016-10-05 | 2024-03-25 | 유니버시티 오브 센트럴 플로리다 리서치 파운데이션, 인코포레이티드 | Nk 세포 및 항-pdl1 암 요법과 관련된 방법 및 조성물 |
| CN108392634A (zh) * | 2018-03-28 | 2018-08-14 | 清华大学 | B7s1抑制剂在制备肝癌药物中的用途 |
| US12325734B2 (en) | 2019-01-15 | 2025-06-10 | Altor Bioscience Llc | Human immunodeficiency virus-specific T cell receptors |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004062603A2 (en) * | 2003-01-09 | 2004-07-29 | Arizeke Pharmaceuticals Inc. | Methods of treating lung diseases |
| WO2008042436A2 (en) * | 2006-10-03 | 2008-04-10 | Biogen Idec Ma Inc. | Biomarkers and assays for the treatment of cancer |
| US7851599B2 (en) * | 2006-04-07 | 2010-12-14 | Philogen S.P.A. | Combination of an anti-ED—B fibronectin domain antibody—IL-2 fusion protein and gemcitabine |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6537973B1 (en) * | 1992-03-16 | 2003-03-25 | Isis Pharmaceuticals, Inc. | Oligonucleotide inhibition of protein kinase C |
| BR0013231A (pt) * | 1999-08-09 | 2002-07-23 | Lexigen Pharm Corp | Complexos citocina-anticorpo múltiplos |
| NZ621449A (en) * | 2003-05-30 | 2015-07-31 | Genentech Inc | Treatment with anti-vegf antibodies |
| WO2009117117A1 (en) * | 2008-03-19 | 2009-09-24 | Altor Bioscience Corporation | T cell receptor fusions and conjugates and methods of use there of |
| WO2011066379A2 (en) * | 2009-11-24 | 2011-06-03 | H. Lee Moffitt Cancer Center And Research Institute, Inc. | METHOD OF REDUCING INTRATUMORAL pHe AND ACID-MEDIATED INVASION |
-
2013
- 2013-03-15 KR KR1020197034966A patent/KR20190134832A/ko not_active Ceased
- 2013-03-15 CA CA2868431A patent/CA2868431A1/en not_active Abandoned
- 2013-03-15 WO PCT/US2013/032269 patent/WO2013148337A1/en not_active Ceased
- 2013-03-15 JP JP2015503334A patent/JP6639228B2/ja active Active
- 2013-03-15 EP EP13768152.4A patent/EP2830648A4/en not_active Ceased
- 2013-03-15 AU AU2013240191A patent/AU2013240191B2/en active Active
- 2013-03-15 KR KR20147030163A patent/KR20150002706A/ko not_active Ceased
- 2013-03-15 US US14/388,575 patent/US20150216937A1/en not_active Abandoned
- 2013-03-15 CN CN202010255455.3A patent/CN111420032A/zh active Pending
- 2013-03-15 CN CN201380028390.7A patent/CN104470535A/zh active Pending
-
2018
- 2018-05-22 AU AU2018203584A patent/AU2018203584A1/en not_active Abandoned
- 2018-07-02 JP JP2018126173A patent/JP2018172414A/ja active Pending
-
2019
- 2019-07-12 US US16/510,835 patent/US20190328838A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004062603A2 (en) * | 2003-01-09 | 2004-07-29 | Arizeke Pharmaceuticals Inc. | Methods of treating lung diseases |
| US7851599B2 (en) * | 2006-04-07 | 2010-12-14 | Philogen S.P.A. | Combination of an anti-ED—B fibronectin domain antibody—IL-2 fusion protein and gemcitabine |
| WO2008042436A2 (en) * | 2006-10-03 | 2008-04-10 | Biogen Idec Ma Inc. | Biomarkers and assays for the treatment of cancer |
Non-Patent Citations (3)
| Title |
|---|
| FISHMAN ET AL.: "Phase I trial of alt-801, an interleukin-2/T-cell receptor fusion protein targeting p53 (aa264-272)/HLA-A* 0201 complex, in patients with advanced malignancies", CLINICAL CANCER RESEARCH, vol. 17, no. 24, 2011, pages 7765 - 7775, XP055169211 * |
| See also references of EP2830648A4 * |
| YAFI ET AL.: "First-and second-line therapy for metastatic urothelial carcinoma of the bladder", CURRENT ONCOLOGY, vol. 18, no. 1, 2011, pages E25 - E34, XP055169213 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12582599B2 (en) | 2014-03-06 | 2026-03-24 | Taris Biomedical Llc | Methods for treatment of bladder cancer with gemcitabine |
| US10722527B2 (en) | 2015-04-10 | 2020-07-28 | Capsugel Belgium Nv | Abiraterone acetate lipid formulations |
| US10322192B2 (en) | 2016-03-02 | 2019-06-18 | Eisai R&D Management Co., Ltd. | Eribulin-based antibody-drug conjugates and methods of use |
| US10548986B2 (en) | 2016-03-02 | 2020-02-04 | Eisai R&D Management Co., Ltd. | Eribulin-based antibody-drug conjugates and methods of use |
| US11040027B2 (en) | 2017-01-17 | 2021-06-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
| US12006354B2 (en) | 2017-05-24 | 2024-06-11 | Novartis Ag | Antibody-IL2 engrafted proteins and methods of use in the treatment of cancer |
| US11446322B2 (en) | 2017-07-25 | 2022-09-20 | Taris Biomedical Llc | Methods of treating tumor metastasis |
| US12059428B2 (en) | 2017-07-25 | 2024-08-13 | Taris Biomedical Llc | Methods of treating tumor metastasis |
| US12029749B2 (en) | 2017-11-08 | 2024-07-09 | Taris Biomedical Llc | Methods of treatment and maintenance therapy for bladder cancer using gemcitabine |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2018172414A (ja) | 2018-11-08 |
| JP2015512914A (ja) | 2015-04-30 |
| AU2018203584A1 (en) | 2018-06-14 |
| KR20190134832A (ko) | 2019-12-04 |
| CN104470535A (zh) | 2015-03-25 |
| AU2013240191B2 (en) | 2018-02-22 |
| CN111420032A (zh) | 2020-07-17 |
| CA2868431A1 (en) | 2013-10-03 |
| EP2830648A1 (en) | 2015-02-04 |
| US20150216937A1 (en) | 2015-08-06 |
| EP2830648A4 (en) | 2015-12-02 |
| AU2013240191A1 (en) | 2014-10-09 |
| KR20150002706A (ko) | 2015-01-07 |
| JP6639228B2 (ja) | 2020-02-05 |
| US20190328838A1 (en) | 2019-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20190328838A1 (en) | Compositions comprising il-2 fusion proteins and methods for treating neoplasia | |
| JP7574243B2 (ja) | 抗cd70キメラ抗原受容体 | |
| US11980652B2 (en) | Compositions and methods for subcutaneous administration of cancer immunotherapy | |
| JP6884155B2 (ja) | 癌治療のための併用免疫療法及びサイトカイン制御療法 | |
| JP6858128B2 (ja) | 癌治療のための免疫療法とサイトカイン制御療法との組み合わせ | |
| JP5680661B2 (ja) | Il−2に由来する免疫調節ポリペプチド並びに癌及び慢性感染症の治療におけるその使用 | |
| AU2019379325B2 (en) | Method of treating a tumor with a combination of IL-7 protein and an immune checkpoint inhibitor | |
| KR102001582B1 (ko) | 암 치료 및 예방용 p62와 관련된 방법 및 조성물 | |
| KR20200051804A (ko) | 돌연변이된 ras에 대한 hla 클래스 ii-제한된 t 세포 수용체 | |
| WO2019136305A1 (en) | Cell-based and immune checkpoint inhibitor therapies combined with il-12 for treating cancer | |
| JP2018535647A (ja) | Hla−cw8拘束性の変異krasを認識するt細胞受容体 | |
| KR20220152220A (ko) | Cd19-지시된 키메라 항원 수용체 t 세포 조성물 및 이의 방법 및 용도 | |
| CN119816313A (zh) | 含有抗人表皮生长因子受体2(her2)嵌合抗原受体(car)的自然杀伤细胞的给药方法 | |
| Rasoulouniriana et al. | A distinct subset of FcγRI-expressing Th1 cells exert antibody-mediated cytotoxic activity | |
| WO2025181329A1 (en) | Human t cell receptors and uses thereof | |
| US20250213687A1 (en) | Therapeutic t cell product | |
| US20210338656A1 (en) | Immunostimulatory agents in combination with angiogenesis inhibitors | |
| WO2025146286A1 (en) | Human t cell receptors and uses thereof | |
| Trigo | Synergistic Antitumor Effect of Combined Laser Thermotherapy and Immunomodulators in Malignant Melanoma: Pilot Studies | |
| US20230042446A1 (en) | Adoptive cell therapy with zbtb20 suppression | |
| HK40119904A (zh) | 含有抗人表皮生长因子受体2(her2)嵌合抗原受体(car)的自然杀伤细胞的给药方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13768152 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2868431 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2015503334 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14388575 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2013240191 Country of ref document: AU Date of ref document: 20130315 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013768152 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013768152 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20147030163 Country of ref document: KR Kind code of ref document: A |