WO2013136818A1 - Method and kit for detecting macrolide antibiotic-resistant mutant bacterium - Google Patents

Abstract

Provided is a method for detecting a macrolide antibiotic-resistant mutant bacterium rapidly and accurately. A macrolide antibiotic-resistant mutant bacterium is detected by a real-time PCR using a first hydrolysis probe and a second hydrolysis probe. A part of the sequence for the first hydrolysis probe is composed of LNA. In the second hydrolysis probe, the 5'-termial is labeled with a reporter fluorescent dye and the 3'-terminal is labeled with a quencher non-fluorescent dye and a minor groove binder (MGB). When a macrolide antibiotic-sensitive bacterium is detected, both fluorescence coming from the first hydrolysis probe and fluorescence coming from the second hydrolysis probe are observed. When a macrolide antibiotic-resistant mutant bacterium is detected, only fluorescence coming from the second hydrolysis probe is observed.

Description

Method and kit for detecting macrolide antibiotic-resistant mutant bacteria

The present invention relates to a detection method and a detection method capable of quickly and accurately detecting a macrolide antibiotic-resistant mutant having resistance to a macrolide antibiotic caused by inhibition of binding to 23S rRNA domain V. About the kit.

Macrolide antibiotics are antibiotics that bind to the 50S subunit of ribosomes in bacterial cells and inhibit protein synthesis, and are known to have relatively little side effects and a broad antibacterial spectrum. Macrolide antibiotics are the main drugs used in the treatment of infections caused by Mycoplasma pneumoniae, Bordetella pertussis, Helicobacter pylori, Campylobacter, Chlamydia, atypical mycobacteria, etc. It is positioned as a drug.

On the other hand, although there are many reports of the pathogens exemplified above, the existence of bacteria that have acquired resistance to macrolide antibiotics is known, and macrolide antibiotics are necessary for appropriate treatment. There is a need for a means for quickly determining mutations resistant to or test reagent kits for carrying it out.

The mutation of the macrolide antibiotic-resistant mutant is not a single base mutation such as SNP, but one of the two adjacent bases that gives the clinically problematic resistance. Therefore, the extension of existing SNP detection methodologies does not always clearly detect mutations in macrolide antibiotic-resistant mutants.

Mycoplasma pneumonia is pneumonia caused by infection with Mycoplasma pneumoniae, a pathogen located between virus and bacteria, mainly affected by children and young adults, and mood discomfort with fever and headache It is characterized by persistent dry cough as it lasts for several days.

Pneumonia mycoplasma is a small pathogen with a diameter of about 125 to 153 nm, but unlike a virus, it does not require living cells to grow and is classified as a bacterium because some antibiotics are effective. On the other hand, Mycoplasma pneumonia does not have the cell wall that is characteristic of bacteria, so β-lactam antibiotics (penicillin, cephem, etc.) used as the first choice for the treatment of bacterial infections are bacteria. However, mycoplasma having no cell wall has little effect, and as described above, macrolide antibiotics as protein synthesis inhibitors are effective.

However, in recent years, macrolide antibiotic-resistant mutant bacteria (Non-patent Document 1) have been detected on a national scale from childhood mycoplasma pneumonia cases, and there are prolonged cases where clinical effects of macrolide antibiotics are not observed, Severe cases such as significantly extending the fever period are increasing (Non-Patent Documents 2 and 3). In particular, the incidence of macrolide antibiotic-resistant mutants increased during the epidemic year of mycoplasma, and these mutants are highly resistant to erythromycin (EM), clarithromycin (CAM), azithromycin (AZM), etc. .

As a treatment strategy for mycoplasma pneumonia, the first choice is based on macrolide antibiotics, and if the fever does not go away after 4 days from the start of administration, the general condition is good or pneumonia on the chest photo Depending on the severity of the disease, change to a drug having an antibacterial action is also considered for macrolide antibiotic-resistant mutants such as minocycline (MINO).

However, MINO has problems with pigmentation of teeth under 6 years of age, and should be administered with caution to children only when it is expected to outweigh the cosmetic disadvantages. Therefore, in consideration of the case where MINO is administered, a determination method capable of obtaining accurate pathological evidence that the patient is suffering from a macrolide antibiotic-resistant mutant is desired. Furthermore, if it is determined early that the disease-causing pathogen is due to macrolide-resistant bacteria, it will be possible to determine whether or not to administer MINO etc. at a more appropriate time. There is a need for a quick and accurate method for determining whether or not a macrolide antibiotic-resistant mutant bacteria.

As a method for judging pneumonia mycoplasma, there are confirmation of antibody titer increase by paired sera, IgM antibody test (kit), etc., but the real-time PCR method is relatively often used in terms of detection sensitivity and accuracy (Non-patent Document 4). Non-patent document 5 describes a method for detecting a macrolide antibiotic-resistant mutant bacterium by melting melting analysis method. The melting point analysis method measures the change in the intensity of the fluorescence signal while gradually raising the temperature of the real-time PCR reaction solution after the amplification reaction, finds the point where the fluorescence intensity changes abruptly, and determines the difference in the sequence contents. It is a method to judge that it reflects.

However, this melting point analysis method requires a process of gradually heating after the real-time PCR reaction is completed, and a predetermined time is required for judgment. In addition, in this melting point analysis method, it is necessary to compare and judge curves, but depending on the test object, a confusing curve may be detected because the shape is similar, and in such a case, it is detected accurately. It is difficult.

Next, whooping cough is a type of respiratory infection caused mainly by the Gram-negative gonococcus Bordetella pertussis, and its onset mechanism is an acute respiratory tract infection characterized by a characteristic convulsive cough attack. is there. Although macrolide antibiotics such as EM and CAM are used as a treatment for Bordetella pertussis, in recent years, occurrence of macrolide antibiotic-resistant mutant bacteria has been reported in the United States and France.

• Diagnosis of pertussis may be difficult, especially in infants under 6 months of age, making early diagnosis difficult. Infants younger than 6 months may suffer from pertussis and die due to pneumonia, encephalopathy, convulsions, and the like. In this way, especially in the case of infants and children, the fatality rate is high, and therefore a quick and accurate determination method is required as to whether or not the disease-causing pathogen is caused by macrolide-resistant bacteria.

As a method for determining pertussis, a culture inspection method is typically used. In the culture test method for pertussis, for example, a nasopharyngeal secretion as a test material is cultured in a special medium for 4 to 5 days to form a colony. (Non-Patent Document 6). However, in addition to the number of days required for culturing in this way, the rate of Bordetella pertussis from pertussis-like patients is as low as about 10 to 20%. There is no denying. It is also difficult to determine drug resistance.

Next, Helicobacter pylori is a spiral bacterium that inhabits the stomach of humans and the like.
It is known that infection with Helicobacter pylori colonizes the gastric mucosa, produces toxins, damages the mucosa, and causes atrophic gastritis as well as gastric and duodenal ulcers. In addition, H. pylori-infected persons have been found to be about 5 times more likely to develop gastric cancer than non-infected persons. Although the combination therapy containing macrolide antibiotics, such as CAM, is performed as a treatment for H. pylori, in recent years, the incidence of macrolide antibiotic resistant mutants has increased.

The culture test for H. pylori is the only method to directly prove the infection of this bacteria, but in addition to requiring a special medium, it is required to be cultured under high humidity and microaerobic conditions. It is not easily implemented in the bacterial laboratory of all medical institutions. Even if culturing is possible, it takes 3 to 7 days to determine the result.

There is a rapid urease test in the test method for Helicobacter pylori using a gastric biopsy sample, but it is impossible to store the test result or judge drug resistance (Non-patent Document 7). In addition, a method for detecting Helicobacter pylori using a stool specimen and determining its drug resistance has been reported (Non-Patent Document 8).

Next, a bacterium belonging to the genus Campylobacter that causes many problems infecting humans is Campylobacter jejuni. Campylobacterjejuni (C.jejuni) is a bacterium that causes gastrointestinal inflammation as the main clinical symptom. The proportion of C. jejuni in gastroenteritis is higher in children than in adults, and there are many hospitalized cases especially in children under 10 years of age. Antibiotic administration is not essential in the treatment of infection and often relieves spontaneously.

However, in some cases, it may become severe, in which case antibiotic administration is required, and the first-line drug is a macrolide antibiotic. C. jejuni is generally confirmed by isolation culture of the same bacteria, and sensitivity is further measured by a micro liquid dilution method. However, it takes a minimum of 3-5 days to obtain a C.jejuni sensitivity measurement. In other words, culture under selective aerobic conditions using selective separation medium, 1-2 days until growth is confirmed; then 1-2 days for pure culture treatment for sensitivity test; inoculate sensitivity panel Further, a period of 1 to 2 days is required (Non-patent Document 9). As described above, there is a problem that results cannot always be obtained at a useful timing for therapeutic intervention.

As a research method, a gene sequence is analyzed by sequence to examine the presence or absence of a macrolide-resistant mutation (Non-patent Document 10), or a gene fragment containing the mutation is amplified by PCR, and the restriction enzyme of the fragment is amplified. A method for determining the presence or absence of mutations based on the cleavage pattern (RFLP; Restriction Fragment LengthmorphPolymorphism (Non-Patent Document 11)) or a product amplified by PCR was bound to a probe immobilized on a solid phase. Although there is a report such as a later method of color development and determination (PCR-LiPA; PCR-and-Line Probe-Assay method: Non-patent document 12), it is not a general clinical laboratory technique. In addition, these methods can obtain results in a shorter time than culture-based methods, but it is necessary to manipulate the products amplified by the PCR method. I am jealous of the dangers.

Next, Chlamydia trachomatis is one of the bacteria belonging to the genus Chlamydia that infect humans. Chlamydiatrachomatis (C. trachomatis) is a pathogen that causes conjunctivitis and pneumonia in neonates and causes urethritis, cervicitis, pelvicitis, etc. in adults. The organism is an obligate intracellular parasitic bacterium having a biphasic growth ring that grows only in eukaryotic cells. In the case of children, macrolide antibiotics are the first choice for the treatment of infections of this bacterium.

Since cell culture is essential for the isolation culture of the obligate intracellular parasitic bacterium C. trachomatis, the isolation culture is not routinely performed, and there is a problem that the presence of resistant bacteria cannot be found. In general, antigen detection methods, nucleic acid detection methods, and antibody test methods are used to detect the same bacteria. Although it is possible to detect bacteria by these techniques, it is not a technique for capturing the growth of bacteria, and therefore the effect of antibiotics on the bacteria growing in the host cell cannot be determined. There have been reports of cases in which antibiotics have not succeeded clinically or cases of recurrence, suggesting the presence of antibiotic resistance, and a method for more easily detecting this has been awaited.

There has been a report that a mutation at a site homologous to a drug resistance mutation against a macrolide antibiotic in another bacterium has been found in a bacterium that has been confirmed to be resistant to macrolide on isolated culture (Non-patent Document 13). This report is conducted by extracting nucleic acids after separating and culturing bacteria and decoding the sequence of gene fragments amplified by PCR. Therefore, in order to reproduce, a facility capable of culturing and maintaining routine cells for separation culture is required, and further labor for separation culture and manipulation of PCR amplification products are required. In addition, the need to manipulate PCR amplification products inevitably risks contaminating the experimental environment.

Next, the Mycobacterium avium complex (MAC) is known as a group of bacteria belonging to atypical mycobacteria that infect humans, and these are known to cause opportunistic infections in humans. It is an environment-resident bacterium that exists widely in soil and water systems. Mycobacterium avium and Mycobacterium intracellulare are known in this group. In addition, this group belongs to the same Mycobacterium genus as M. tuberculosis, but anti-tuberculosis drugs are generally ineffective, and the infection is treated with a combination therapy combining multiple antibiotics instead of a single agent. If the key drug at this time is a macrolide antibiotic and a bacterium resistant to the macrolide antibiotic is infected, the treatment may fail. In the ATS (American Thoracic Society) / IDSA (American Infectious Diseases Society) guidelines, it is recommended that MAC be examined for its sensitivity to CAM, a macrolide antibiotic.

Methods that have been reported as existing judgment methods include reports of electrophoresis and subsequent staining of PCR reaction products to analyze and confirm the size of amplification products, and reports that use a real-time PCR method combined with a melting point analysis method. . In both cases, there remains a problem that it takes time to perform additional analysis subsequent to the PCR reaction, and further to determine the result.

The present invention has been made in view of such problems, and provides a rapid and accurate detection method and detection kit for a macrolide antibiotic-resistant mutant without relying on an existing SNP detection method. Objective.

The method for detecting a macrolide antibiotic-resistant mutant bacterium according to the present invention is a macromolecule that has acquired resistance to a macrolide antibiotic by inhibiting binding to 23S rRNA domain V in a biological sample of a subject. A detection method for detecting a ride antibiotic resistant mutant by real-time PCR, comprising the step of contacting the biological sample with a first hydrolysis probe and a second hydrolysis probe, The second hydrolysis probe and the second hydrolysis probe are designed to bind to the same template sequence. In the case of a standard strain, the hydrolysis probe is derived from the first hydrolysis probe and the second hydrolysis probe. On the other hand, in the case of a macrolide antibiotic-resistant mutant, fluorescence of only the second hydrolysis probe is observed while fluorescence is observed.

This feature is obtained by using different modification techniques for improving thermal stability for the first hydrolysis probe and the second hydrolysis probe, both of which have a short chain length, respectively. When the probes are used in combination, when the standard strain is used, each probe shows similar thermal stability, and as a result, it is possible to stably bind to the template sequence, When a macrolide antibiotic-resistant mutant sequence is used as a target, only the second probe with a small variation in thermal stability is stabilized in the template sequence as a result of the difference in the degree of change in thermal stability of each probe. This is achieved by being able to combine.

The first hydrolysis probe is partially composed of LNA (Locked Nucleic Acid), the second hydrolysis probe is labeled with a reporter fluorescent dye at the 5 'end, and the quencher non-fluorescence is at the 3' end. It is possible to use those labeled with a dye and MGB.

The present invention can detect macrolide antibiotic-resistant mutant bacteria quickly and accurately.

It is a figure explaining the 1st hydrolysis probe in the case of pneumonia mycoplasma. It is a figure explaining the template arrangement | sequence in the case of a pneumonia mycoplasma. It is a figure explaining the 2nd hydrolysis probe in the case of pneumonia mycoplasma. It is a figure explaining the 1st hydrolysis probe in the case of Bordetella pertussis. It is a figure explaining the template arrangement | sequence in the case of Bordetella pertussis. It is a figure explaining the 2nd hydrolysis probe in the case of Bordetella pertussis. It is a figure explaining the 1st hydrolysis probe in the case of Helicobacter pylori or Campylobacter jejuni. It is a figure explaining the template arrangement | sequence in the case of Helicobacter pylori. It is a figure explaining the 2nd hydrolysis probe in the case of Helicobacter pylori or Campylobacter jejuni. It is a figure explaining the 1st hydrolysis probe in the case of Campylobacter jejuni bacteria or H. pylori. It is a figure explaining the template arrangement | sequence in the case of Campylobacter jejuni microbe. It is a figure explaining the 2nd hydrolysis probe in the case of Campylobacter jejuni bacteria or H. pylori. It is a figure explaining the 1st hydrolysis probe in the case of Chlamydia trachomatis. It is a figure explaining the template arrangement | sequence in the case of Chlamydia trachomatis. It is a figure explaining the 2nd hydrolysis probe in the case of Chlamydia trachomatis. It is a figure explaining the 1st hydrolysis probe in the case of avian type Mycobacterium tuberculosis group. It is a figure explaining the template arrangement | sequence in the case of an avian type tuberculosis microbe group. It is a figure explaining the 2nd hydrolysis probe in the case of avian type Mycobacterium tuberculosis group. In Example 1, it is a figure which shows the detection result of the amplification curve in a sensitive arrangement | sequence. It is a figure which shows the sequence result in the case of pneumonia mycoplasma. In Example 1, it is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. In Example 2, it is a figure which shows the detection result of the amplification curve in a sensitive arrangement | sequence. In Example 2, it is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. It is a figure which shows the sequence result in the case of Bordetella pertussis. In Example 3, it is a figure which shows the detection result of the amplification curve in a sensitivity arrangement | sequence, (a) is B1228, (b) is C0127, (c) is C0131, (d) is B0902. Yes, (e) is D0104, (f) is D0403, (g) is D0423, and (h) is D0425. In Example 3, it is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case, (a) is B1228, (b) is C0127, (c) is C0131, (d) is B0902, (e) is D0104, (f) is D0403, (g) is D0423, and (h) is D0425. In Example 4, it is a figure which shows the detection result of the amplification curve in a sensitivity arrangement | sequence, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) is A2058T. (E) is A2059G, (f) is A2059C, and (g) is A2059T. In Example 4, it is a figure which shows the detection result of the amplification curve in the case of sensitivity unquestioned, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) Is A2058T, (e) is A2059G, (f) is A2059C, and (g) is A2059T. It is a figure which shows the sequence result in the case of Helicobacter pylori. In Example 5, it is a figure which shows the detection result of the amplification curve in a sensitivity arrangement | sequence, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) is A2058T. (E) is A2059G, (f) is A2059C, (g) is A2059T, and (h) is genomic DNA derived from the positive target strain JCM12093. In Example 5, it is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) Is A2058T, (e) is A2059G, (f) is A2059C, (g) is A2059T, and (h) is genomic DNA derived from the positive target strain JCM12093. In Example 5, it is a figure which shows the detection result of the amplification curve of a sensitivity arrangement | sequence when the probe which deleted 1 base of 5 'end was used, (a) is no mutation, (b) is A2058G (C) is A2058C, (d) is A2058T, (e) is A2059G, (f) is A2059C, (g) is A2059T, (h) is a positive target strain Genomic DNA derived from. In Example 5, it is a figure which shows the detection result of a sensitivity unquestioned amplification curve at the time of using the probe which deleted 1 base of 5 'side, (a) is no mutation, (b) is A2058G (C) is A2058C, (d) is A2058T, (e) is A2059G, (f) is A2059C, (g) is A2059T, (h) is a positive target strain Genomic DNA derived from. It is a figure which shows the sequence result in the case of Campylobacter jejuni bacteria. In Example 6, it is a figure which shows the detection result of the amplification curve in a sensitivity arrangement | sequence, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) is A2058T. (E) is A2059G, (f) is A2059C, (g) is A2059T, and (h) is genomic DNA derived from the positive target strain JCM2013. In Example 6, it is a figure which shows the detection result of the amplification curve in the case of an unquestioned sensitivity, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) Is A2058T, (e) is A2059G, (f) is A2059C, (g) is A2059T, and (h) is genomic DNA derived from the positive target strain JCM2013. In Example 6, it is a figure which shows the detection result of the amplification curve of a sensitivity sequence in the case of using the probe which extended 1 base of 5 'ends, (a) is no mutation, (b) is A2058G. Yes, (c) is A2058C, (d) is A2058T, (e) is A2059G, (f) is A2059C, (g) is A2059T, (h) is derived from the positive target strain Genomic DNA. In Example 6, it is a figure which shows the detection result of a sensitivity unquestioned amplification curve at the time of using the probe which extended 1 base of 5 'ends, (a) is no mutation, (b) is A2058G. Yes, (c) is A2058C, (d) is A2058T, (e) is A2059G, (f) is A2059C, (g) is A2059T, (h) is derived from the positive target strain Genomic DNA. It is a figure which shows the sequence result in the case of Chlamydia trachomatis. In Example 7, it is a figure which shows the detection result of the amplification curve in a sensitivity arrangement | sequence, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) is A2058T. (E) is A2059G, (f) is A2059C, (g) is A2059T, and (h) is a nucleic acid derived from 2 positive specimens. In Example 7, it is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) Is A2058T, (e) is A2059G, (f) is A2059C, (g) is A2059T, and (h) is a nucleic acid derived from a positive specimen. It is a figure which shows the sequence result in the case of an avian type Mycobacterium tuberculosis group. In Example 8, it is a figure which shows the detection result of the amplification curve in a sensitivity arrangement | sequence, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) is A2058T. (E) is A2059G, (f) is A2059C, (g) is A2059T, and (h) is a genomic DNA derived from the standard strain JCM6384 used as a positive target. In Example 8, it is a figure which shows the detection result of an amplification curve in the case of sensitivity unquestioned, (a) is no mutation, (b) is A2058G, (c) is A2058C, (d) Is A2058T, (e) is A2059G, (f) is A2059C, (g) is A2059T, and (h) is genomic DNA derived from the standard strain JCM6384 used as a positive target.

Hereinafter, embodiments of the present invention will be specifically described with reference to the accompanying drawings. However, the embodiments are for facilitating understanding of the principle of the present invention, and the scope of the present invention is as follows. The present invention is not limited to the embodiments, and other embodiments in which those skilled in the art appropriately replace the configurations of the following embodiments are also included in the scope of the present invention.

In the method for detecting a macrolide antibiotic-resistant mutant according to the present embodiment, resistance to a macrolide antibiotic is reduced by inhibiting the binding of 23S rRNA to domain V in a biological sample of a subject. The resulting resistant mutant is detected.

Ribosome is the shape that 50S subunit and 30S subunit are combined, messenger RNA is read in 30S subunit, and amino acid is connected by the function of peptidyltransferase in 50S subunit to synthesize polypeptide. However, 23S rRNA plays an important role in this process. The center of the functional site is domain V, which is the fifth of the six domains, and macrolide antibiotics bind to this domain V to inhibit its function and suppress protein synthesis to prevent antibiotics. When it works as a substance, the important sites for binding of this macrolide antibiotic to domain V are the two adjacent adenines with base numbers 2058 and 2059 in Escherichia coli. When a methylation mutation occurs, the conformation changes, and the macrolide antibiotic cannot bind to domain V, cannot inhibit protein synthesis, and the fungus has a clinically problematic macrolide antibiotic. You will gain resistance to the substance.

This site is common to many bacteria, not limited to pneumonia mycoplasma, and is considered a hot spot for resistance to macrolide antibiotics. There is a slight difference in the base number depending on the number of intervening bases. 1) 2063 and 2064, pertussis (standard strain Tohama I; NCBI Reference Sequence: NC_002929.2) 2037 and 2038 are H. pylori (standard strain Helicobacter pylori 26695; NCBI Reference Sequence: NC_000915.1 ) Is 2146th and 2147th (there are also references 2142 and 2143th with the sequence of Accession number U27270 as standard), but Campylobacterjejuni (standard strain Campylobacterjejuni subsp. Jejuni; 2075th is Chlamydia trachomatis (standard strain Chlamydia trachomatis D / UW-3 / CX; NCBIReference Sequence: NC_000117.1), 2038th and 2039th are Mycobacterium avium (standard strain Mycobacterium avium 104; NCBI Reference In (Sequence: NC_008595.1), 2279th and 2280th correspond to these sites, and in Mycobacteriumintracellulare (standard strain Mycobacteriumintracellulare ATCC-13950; NCBI Reference Sequence: NC_016946.1), 2266th and 2267th correspond to these sites. In addition, since the base number differs according to the kind of pathogenic microorganisms or strains, the above-mentioned hotspots for resistance to macrolide antibiotics are described with numbers in Escherichia coli. In addition, unless otherwise specified, those exemplified above as standard strains will be described as standard strains of pathogenic bacteria.

In this embodiment, the macrolide antibiotic-resistant mutant bacteria are pneumonia mycoplasma mutant bacteria, Bordetella pertussis mutant bacteria, Helicobacter pylori mutant bacteria, Campylobacter jejuni mutant bacteria, Chlamydiatrachomatis mutant bacteria, MAC mutant bacteria, but are not limited thereto. In addition, resistant mutants such as Escherichia coli and Streptococcus pneumoniae are also included.

The macrolide antibiotic is not particularly limited, but for example, EM, CAM, and roxithromycin (RXM) if it is a 14-membered ring system, and AZM if it is a 15-membered ring system. If it is a 16-membered ring, it is josamycin (JM) or rokitamicin (RKM).

Hereinafter, the case where the macrolide antibiotic resistant mutant is a Mycoplasma pneumoniae is described.

In this embodiment, there is a step of bringing a biological sample into contact with the first hydrolysis probe and the second hydrolysis probe by real-time PCR.

The first hydrolysis probe has a sequence of 5'-aacgggacggaaag-3 '(SEQ ID NO: 1) (Fig. 1), and Tm is 66 ° C. Here, Tm is a melting temperature, which is a temperature at which 50% of double-stranded DNA is dissociated into single-stranded DNA (melting temperature). The first hydrolysis probe is labeled with the reporter dye Alexa647 through the ssH amino linker at the 5 'end and with the black Hole Quencher 3 (BHQ3), which is a quencher non-fluorescent dye. .

The first hydrolysis probe is partially composed of LNA (LockedNANucleic Acid) as indicated by a capital letter GAAA in FIG. The introduction of LNA into the sequence increases the thermal stability of the completely complementary duplex, resulting in an increase in Tm value and a reduction in probe length. The reason why LNA is gaaa is that the template array ctcgg tgaaa tccaggtacg ggtga agaca cccgt taggc gcaac gggac gggtga agctt tactg tagcttaata ttgat caggat g t ccatcgta This is because the sequence containing the bases on both sides of the 2058th and 2059th positions (the 2063th and 2064th positions in the pneumonia mycoplasma standard strain) are preferable, as indicated by the arrows in the position indicated by (B) . 2, the portion indicated by the underline (A) is the Forward primer array tccag gtacg ggtga agaca (sequence number 3), and the portion indicated by the underline (C) is the reverse primer array atcat, as will be described later. gtaga gaata ggtag gagc (SEQ ID NO: 4). In the case of the mutant strain, the first hydrolysis probe has a relatively large degree of change in double-stranded thermal stability, that is, a degree of decrease in Tm.

As shown in FIG. 3, the second hydrolysis probe has the same sequence as the first hydrolysis probe, and Tm is 67 ° C. The second hydrolysis probe is labeled at the 5 'end with a reporter fluorescent dye VIC and at the 3' end with a quencher non-fluorescent dye and Minor Groove Binder (MGB). MGB labeled at the 3 'end binds to the minor groove (Minor Groove) of the double-stranded helix structure between the probe and target sequence, resulting in increased thermal stability of the double-stranded chain. A probe with a high Tm value can be obtained. In the second hydrolysis probe, in the case of the mutant strain, the degree of change in the thermal stability of the double strand, that is, the degree of decrease in Tm, is gentler than that of the first hydrolysis probe. In FIG. 3, the quencher non-fluorescent dye and MGB are joined to the 3 ′ end, respectively. However, the structure is not limited to this. For example, the quencher non-fluorescent dye is joined to the 3 ′ end. A structure in which MGB is bonded to the quencher non-fluorescent dye is also possible. This explanation applies to the second hydrolysis probe described below as well.

In both the first and second hydrolysis probes, two substances, a reporter fluorescent dye at the 5 ′ end and a quencher non-fluorescent dye at the 3 ′ end, are close to each other until the probe is hydrolyzed by the DNA polymerase. Therefore, the energy of the fluorescent signal emitted from the reporter dye is suppressed as a result of being absorbed (quenching) by the quencher dye. As the real-time PCR reaction proceeds, the probe that is stably bound to the template sequence is hydrolyzed by the 5 '→ 3' exonuclease activity of DNA polymerase, and the reporter fluorescent dye and quencher non-fluorescent dye are separated and separated. Since the energy of the fluorescent signal derived from the reporter dye is not quenched, a fluorescent signal is observed when excited.

Examples of MGB include, but are not limited to, beryl, netropsin, distamycin A, 4 ', 6-diamidino-2-phenylindole (DAPI), and the like. The reporter fluorescent dye is not particularly limited, but is, for example, a fluoresceine fluorescent dye, specifically, VIC or FAM. The quencher non-fluorescent dye is not particularly limited, and is, for example, BHQ1.

The biological sample is not particularly limited, and examples thereof include airway-derived samples from subjects, serum, plasma, lymph fluid, blood, saliva, etc. Among these, airway-derived samples are particularly preferable. These include sputum, airway aspirate, bronchoalveolar lavage fluid.

The primer for real-time PCR uses the same base sequence as the 10 to 40 consecutive base sequences selected in the specific region of the macrolide antibiotic-resistant mutant bacterium, and is a forward primer for the sample DNA. The reverse primer is a base complementary to 10 to 40 consecutive base sequences selected in the specific region of the base sequence of the macrolide antibiotic-resistant mutant of the present invention. Can be designed from an array. For example, a base sequence that is tccag gtacg ggtga agaca (SEQ ID NO: 3) as a forward primer and atcat gtaga gaata ggtag gagc (SEQ ID NO: 4) as a reverse primer can be exemplified. These primers for real-time PCR can be synthesized by a known method according to the base sequence.

The detection kit for a macrolide antibiotic-resistant mutant when the macrolide antibiotic-resistant mutant is a Mycoplasma pneumoniae mutant has the first hydrolysis probe and the second hydrolysis probe described above. . Furthermore, it contains primers for real-time PCR and polymerase for real-time PCR. In addition, as other components, various buffers, nuclease-free water, a single immobilized substance, and the like can also be included.

In the invention according to the present embodiment, as described above, probes that are designed to bind to the same target template sequence and have substantially the same Tm value (that is, competitively bind to each other) are used. Therefore, when the target sequence is a sensitive sequence (the probe sequence and the target are completely identical), the two probes are equally annealed with the target sequence in the reaction solution, and are equally hydrolyzed. Origin fluorescence is observed. On the other hand, although the two probes have a short chain length (14 bases), they can maintain a relatively high Tm such as 66-67 ° C by different modification techniques (LNA or MGB). . As described above, since the modification techniques for increasing the Tm of a probe having a short chain length are different, it is considered that the Tm when a sequence containing a mutation becomes a target is dissociated between the two types of probes. That is, the degree of change (decrease) in Tm when targeting a sequence having a mutation is greater in the case of the first hydrolysis probe (LNA probe) than in the second hydrolysis probe (MGB probe). It is considered large (MGB probe has a milder Tm change).

As a result, when a sequence having a mutation is targeted, the Tm of the two types of probes will diverge, and only one second hydrolysis probe (MGB probe) will undergo hydrolysis. Only the fluorescence derived from the second probe is observed. As a result, the macrolide resistant mutant strain in which only the fluorescence derived from the second probe is observed can be accurately distinguished from the normal strain in which the fluorescence derived from both probes is observed at a glance. It should be noted that the fluorescence of only the second hydrolysis probe is observed that the fluorescence of the first hydrolysis probe is very weak compared to the fluorescence of the second hydrolysis probe and is hardly observed. This includes the case where the fluorescence of the hydrolysis probe is observed very strongly. In addition, as in the conventional melting point analysis method (melting curve analysis), there is no need for a heating process to measure the intensity change of the fluorescence signal while gradually increasing the temperature of the real-time PCR reaction solution after the amplification reaction. Macrolide antibiotic-resistant mutant bacteria can be quickly distinguished from normal strains.

Next, the case where the macrolide antibiotic resistant mutant is a Bordetella pertussis mutant will be described.

As described above, the method includes a step of bringing a biological sample into contact with the first hydrolysis probe and the second hydrolysis probe by real-time PCR.

The first hydrolysis probe has a sequence of 5'-cggctagacggaaag-3 '(SEQ ID NO: 5) (Fig. 4), and Tm is 67 ° C. The first hydrolysis probe is labeled with Alexa647 at the 5 'end via ssH amino linker and labeled with BHQ3 at the 3' end.

The first hydrolysis probe is partially composed of LNA (LockedNANucleic Acid) as indicated by a capital letter GAAA in FIG. Here reason LNA is gaaa is template sequence ttccg acctg cacga atggc gtaac gatgg ccaca ctgtc tcctc ctgag actcagcgaa gttga agtgt ttgtg atgat gcaat ctacc cgcgg ctaga cggaa agacc ccatg aacct ttactgtagc tttgc attgg actgt gaacc ggcct gtgta ggata ggtgg gaggc shown in FIG. 5 In gcaga actcg agtcgccaga ttcga gggag ccatc cttga aatac (SEQ ID NO: 6), the underlined (B) arrow indicates the mutation site 2058th and 2059th (2037th and 2038th in B. pertussis standard strains) adenine This is because a sequence containing bases on both sides is preferable. In FIG. 5, the part indicated by the underline (A) corresponds to the Forward primer array, and the part indicated by the underline (C) corresponds to the Reverse primer array. This first hydrolysis probe has a relatively large decrease in Tm in the case of a mutant strain.

As shown in FIG. 6, the second hydrolysis probe has the same sequence as the first hydrolysis probe, and Tm is 68 ° C. The second hydrolysis probe is further labeled at the 5 'end with a reporter fluorescent dye and at the 3' end with a quencher non-fluorescent dye and MGB (Minor Groove Binder). The MGB, reporter fluorescent dye, and quencher non-fluorescent dye are not particularly limited as described above. The biological sample is not particularly limited as described above.

The primer for real-time PCR can be appropriately designed in the same manner as described above. For example, the base sequence is gcacgaatggcgtaacgatg (SEQ ID NO: 7) as a forward primer and ctccctcgaatctggcgactc (SEQ ID NO: 8) as a reverse primer. Can be given as

A detection kit for a macrolide antibiotic-resistant mutant when the macrolide antibiotic-resistant mutant is a Bordetella pertussis mutant, has the first hydrolysis probe and the second hydrolysis probe described above. . Furthermore, it contains primers for real-time PCR and polymerase for real-time PCR. In addition, as other components, various buffers, nuclease-free water, a single immobilized substance, and the like can also be included.

Thus, even when the macrolide antibiotic-resistant mutant is a Bordetella pertussis mutant, the macrolide-resistant mutant can be distinguished from the normal strain and accurately determined at a glance as described above.

Next, the case where the macrolide antibiotic resistant mutant is a H. pylori mutant will be described.

As described above, the method includes a step of bringing a biological sample into contact with the first hydrolysis probe and the second hydrolysis probe by real-time PCR.

The first hydrolysis probe has a sequence of 5'-cggcaagacggaaag-3 '(SEQ ID NO: 9) (Fig. 7), and Tm is 68 ° C. The first hydrolysis probe is labeled with Alexa647 at the 5 'end via ssH amino linker and labeled with BHQ3 at the 3' end.

The first hydrolysis probe is partially composed of LNA (Locked Nucleic Acid) as indicated by a capital letter GAAA in FIG. Here reason LNA is gaaa is template sequence ccgac ctgca tgaat ggcgt aacga gatgg gagct gtctc aacca gagat tcagtgaaat tgtag tggag gtgaa aattc ctcct acccg cggca agacg gaaag acccc gtgga ccttt actacaactt agcac tgcta atggg aatat catgc gcagg atagg tggga ggctt shown in FIG. 8 In tgaag taagg gctttggctc ttatg gagcc atcct (SEQ ID NO: 10), the arrows at the underlined (B) indicate the 2058th and 2059th adenine mutation positions (2146th and 2147th in the H. pylori standard strain) adenine However, a sequence containing bases on both sides is preferable. In FIG. 8, a portion indicated by an underline (A) corresponds to the forward primer array, and a portion indicated by an underline (C) corresponds to the reverse primer array. This first hydrolysis probe has a relatively large decrease in Tm in the case of a mutant strain.

As shown in FIG. 9, the second hydrolysis probe has the same sequence as the first hydrolysis probe, and Tm is 70 ° C. The second hydrolysis probe is further labeled at the 5 'end with a reporter fluorescent dye and at the 3' end with a quencher non-fluorescent dye and MGB (Minor Groove Binder). The MGB, reporter fluorescent dye, and quencher non-fluorescent dye are not particularly limited as described above. The biological sample is not particularly limited as described above.

The primer for real-time PCR can be appropriately designed as described above. For example, the base sequence is gcgtaacgagatgggagctg (SEQ ID NO: 11) as the forward primer and tggctccataagagccaaagc (SEQ ID NO: 12) as the reverse primer. Can be given as

The detection kit for a macrolide antibiotic-resistant mutant when the macrolide antibiotic-resistant mutant is a H. pylori mutant has the first hydrolysis probe and the second hydrolysis probe described above. . Furthermore, it contains primers for real-time PCR and polymerase for real-time PCR. In addition, as other components, various buffers, nuclease-free water, a single immobilized substance, and the like can also be included.

Thus, even when the macrolide antibiotic-resistant mutant is a Helicobacter pylori mutant, the macrolide-resistant mutant can be distinguished from the normal strain and accurately determined at a glance as described above.

As described in Examples below, the first hydrolysis probe shown in FIG. 7 and the second hydrolysis probe shown in FIG. 9 can also be used for detection of Campylobacter jejuni mutants. . In addition, as is common to all embodiments, even a probe having a sequence obtained by adding, deleting, or changing a part of the probe sequence shown in the embodiment may be used as long as the effect of the present invention is exhibited. Is possible.

Next, the case where the macrolide antibiotic resistant mutant is a Campylobacter jejuni mutant is described.

As described above, the method includes a step of bringing a biological sample into contact with the first hydrolysis probe and the second hydrolysis probe by real-time PCR.

The first hydrolysis probe has a sequence of 5'- ggcaagacggaaag -3 '(SEQ ID NO: 13) (Fig. 10), and Tm is 67 ° C. The first hydrolysis probe is labeled with Alexa647 at the 5 'end via ssH amino linker and labeled with BHQ3 at the 3' end.

The first hydrolysis probe is partially composed of LNA (LockedNANucleic Acid) as indicated by a capital letter GAAA in FIG. The reason why LNA is gaaa is that the template sequence shown in Fig. 11 In gaggc tttga gtatatgacg ccagt tgtat atgag ccatt gttga gatac (SEQ ID NO: 14), the arrows in the underlined (B) indicate mutation positions 2058 and 2059 (2074 in Campylobacter jejuni standard strain) This is because a sequence containing the bases on both sides is preferred when the 2075th adenine is shown. In FIG. 11, a portion indicated by an underline (A) corresponds to the Forward primer array, and a portion indicated by an underline (C) corresponds to the Reverse primer array. This first hydrolysis probe has a relatively large decrease in Tm in the case of a mutant strain.

As shown in FIG. 12, the second hydrolysis probe has the same sequence as the first hydrolysis probe, and Tm is 67 ° C. The second hydrolysis probe is further labeled at the 5 'end with a reporter fluorescent dye and at the 3' end with a quencher non-fluorescent dye and MGB (Minor Groove Binder). The MGB, reporter fluorescent dye, and quencher non-fluorescent dye are not particularly limited as described above. The biological sample is not particularly limited as described above.

The primer for real-time PCR can be appropriately designed as described above. For example, the base sequence is cgtaacgagatgggagctgt (SEQ ID NO: 15) as a forward primer and ctcccacctatcctgcacat (SEQ ID NO: 16) as a reverse primer. Can be given as

The detection kit for the macrolide antibiotic-resistant mutant when the macrolide antibiotic-resistant mutant is the Campylobacter jejuni mutant, the first hydrolysis probe and the second hydrolysis probe described above And having. Furthermore, it contains primers for real-time PCR and polymerase for real-time PCR. In addition, as other components, various buffers, nuclease-free water, a single immobilized substance, and the like can also be included.

As a result, even if the macrolide antibiotic resistant mutant is a Campylobacter jejuni mutant, the macrolide resistant mutant can be distinguished from the normal strain and accurately determined at a glance. it can.

In addition, as described in the examples described later, the first hydrolysis probe shown in FIG. 10 and the second hydrolysis probe shown in FIG. 12 can be used for detection of H. pylori mutants.

Next, the case where the macrolide antibiotic resistant mutant is a Chlamydia trachomatis mutant will be described.

As described above, the method includes a step of bringing a biological sample into contact with the first hydrolysis probe and the second hydrolysis probe by real-time PCR.

The first hydrolysis probe has the sequence 5′-cgaaaggacgaaaag-3 ′ (SEQ ID NO: 17) (FIG. 13), and Tm is 60 ° C. The first hydrolysis probe is labeled with Alexa647 at the 5 'end via ssH amino linker and labeled with BHQ3 at the 3' end.

The first hydrolysis probe has a part of the sequence composed of LNA (LockedicNucleic Acid) as indicated by capital letters AAAA in FIG. Here reason LNA is aaaa is template sequence cctgc acgaa tggtg taacg atctg ggcac tgtct caacg aaaga ctcgg tgaaattgtagtagc agtga agatg ctgtt taccc gcgaa aggac gaaaa gaccc cgtga acctttactgtactt tggta ttgat ttttg gtttg ttatg tgtag gatag ccagg agact aagaacactcttctt cagga gagtg shown in FIG. 14 In ggagt caacg ttgaa atact ggtct taaca agctg ggaat ctaac (SEQ ID NO: 18), the arrows in the underlined (B) indicate mutations at positions 2058 and 2059 (2038 and 2039 in Chlamydia trachomatis standard strains) This is because a sequence containing both bases is preferred. In FIG. 14, the part indicated by the underline (A) corresponds to the Forward primer array, and the part indicated by the underline (C) corresponds to the Reverse primer array. This first hydrolysis probe has a relatively large decrease in Tm in the case of a mutant strain.

As shown in FIG. 15, the second hydrolysis probe has the same sequence as the first hydrolysis probe, and Tm is 66 ° C. The second hydrolysis probe is further labeled at the 5 'end with a reporter fluorescent dye and at the 3' end with a quencher non-fluorescent dye and MGB (Minor Groove Binder). The MGB, reporter fluorescent dye, and quencher non-fluorescent dye are not particularly limited as described above. The biological sample is not particularly limited as described above.

The primer for real-time PCR can be appropriately designed in the same manner as described above. For example, the base sequence is tgggcactgtctcaacgaaa (SEQ ID NO: 19) as a forward primer and caacgttgactcccactctc (SEQ ID NO: 20) as a reverse primer. Can be given as

A detection kit for a macrolide antibiotic-resistant mutant when the macrolide antibiotic-resistant mutant is a Chlamydia trachomatis mutant, the first hydrolysis probe, the second hydrolysis probe, Have Furthermore, it contains primers for real-time PCR and polymerase for real-time PCR. In addition, as other components, various buffers, nuclease-free water, a single immobilized substance, and the like can also be included.

Thus, even when the macrolide antibiotic-resistant mutant is a Chlamydia trachomatis mutant, the macrolide-resistant mutant can be distinguished from the normal strain and can be clearly and accurately determined as described above.

Next, the case where the macrolide antibiotic resistant mutant is a MAC mutant is described.

As described above, the method includes a step of bringing a biological sample into contact with the first hydrolysis probe and the second hydrolysis probe by real-time PCR.

The first hydrolysis probe has the sequence 5′-cggcaggacgaaaag-3 ′ (SEQ ID NO: 21) (FIG. 16), and Tm is 67 ° C. The first hydrolysis probe is labeled with Alexa647 at the 5 'end via ssH amino linker and labeled with BHQ3 at the 3' end.

The first hydrolysis probe is partially composed of LNA (Locked Nucleic Acid) as indicated by AAAA in capital letters in FIG. Here reason LNA is aaaa is template sequence gactt cccaa ctgtc tcaac catag actcg gcgaa attgc actac gagta aagatgctcg ttacg cgcgg cagga cgaaa agacc ccggg acctt cacta caact tggta ttggt gttcg gtacggtttg tgtag gatag gtggg agact ttgaa gcaca gacgc cagtt tgtgt shown in FIG. 17 ggagt cgttg ttgaaatacc actct gatcg tattg gacac ctaac gtcga accct tatcg ggttc acgga cagtg cctggcgggt agttt aactg gggcg gttgc ctcct aaag This is because an adenine (2279th and 2280th in the M. avium standard strain) is shown, and a sequence containing bases on both sides thereof is preferable. In FIG. 17, a portion indicated by an underline (A) corresponds to the forward primer array, and a portion indicated by an underline (C) corresponds to the reverse primer array. This first hydrolysis probe has a relatively large decrease in Tm in the case of a mutant strain.

As shown in FIG. 18, the second hydrolysis probe is 5′-IIgcaggacgaaaag-3 ′ (SEQ ID NO: 23) in which two bases at the 5 ′ end of the first hydrolysis probe are substituted with inosine (I). It has a sequence and Tm is 66 ° C. In general, by inserting inosine into an oligonucleotide sequence instead of a normal base, it is possible to occupy a single base position in the oligonucleotide sequence without affecting the complementary binding of the DNA duplex. As a result, the oligonucleotide can be extended without affecting Tm. Utilizing this property, the second hydrolysis probe competes with the same target sequence as the first probe while suppressing the Tm value by substituting the two bases at the 5 ′ end farthest from the target mutation with inosine. And designed to combine. The second hydrolysis probe is further labeled at the 5 'end with a reporter fluorescent dye and at the 3' end with a quencher non-fluorescent dye and MGB (Minor Groove Binder). The MGB, reporter fluorescent dye, and quencher non-fluorescent dye are not particularly limited as described above. The biological sample is not particularly limited as described above.

The primer for real-time PCR can be appropriately designed as described above. For example, the base sequence is tcggcgaaattgcactacga (SEQ ID NO: 24) as the forward primer and aacccgataagggttcgacg (SEQ ID NO: 25) as the reverse primer. Can be given as

The detection kit for a macrolide antibiotic-resistant mutant when the macrolide antibiotic-resistant mutant is a MAC mutant has the first hydrolysis probe and the second hydrolysis probe described above. Furthermore, it contains primers for real-time PCR and polymerase for real-time PCR. In addition, as other components, various buffers, nuclease-free water, a single immobilized substance, and the like can also be included.

Thus, even when the macrolide antibiotic-resistant mutant is a MAC mutant, the macrolide-resistant mutant can be distinguished from the normal strain and can be accurately determined at a glance as described above.

The following five points are common items in all the examples of the study in the present invention described below.
(I) The real-time PCR reaction system uses BIO-RAD's “CFX96 Real-Time PCR System”
(II) Real-time PCR reaction was performed with a reaction solution of the following composition: BIO-RAD's iQ SuperMix was 10 μL, the sample to be studied was 4 μL, the PCR primer was 500 [nM] each in the forward and reverse concentrations. 1 hydrolysis probe and 2nd hydrolysis probe each contained at a concentration of 100 [nM], prepared in a final volume of 20 μL with nuclease-free water
(III) The first hydrolysis probe used was labeled with a reporter fluorescent dye at the 5 ′ end and labeled with a dark quencher dye BHQ3 at the 3 ′ end, and the reporter fluorescent dye was Alexa647.
(IV) The second hydrolysis probe used was labeled with a reporter fluorescent dye at the 5 ′ end and labeled with a quencher non-fluorescent dye and MGB at the 3 ′ end, and the reporter fluorescent dye was VIC. point
(V) Regarding the measurement of fluorescence, the fluorescence from the reporter dye Alexa647 of the first hydrolysis probe (LNA probe) is obtained from the Cy5 channel, and the fluorescence from the reporter dye VIC of the second hydrolysis probe (MGB probe) is obtained. Points measured in VIC channel (Note that Alexa647's Emission peak is 665 nm, which is almost the same as Cy5's Emission peak, 667 nm).

(Example 1 Detection of Mycoplasma pneumoniae)
Nucleic acid samples from 12 patient specimens that have been determined to be positive for pneumonia mycoplasma using another housebred PCR detection system so far were used. Nucleic acid preparations were prepared by extracting airway-derived clinical specimens using QIAGEN's QIAamp (registered trademark) DNAmini kit and eluting them uniformly to a volume of 100 μL regardless of the amount of the original specimen. The same QIAGENBuffer AE used for nucleic acid elution was used as a negative control.

Forward / Reverse primer sequences are in the literature (Wolff BJ, Thacker WL, Schwartz SB, et al., Detection of MacrolideResistance in Mycoplasma pneumoniae by Real-Time PCR and High-Resolution MeltAnalysis, Antimicrob.102008 Agents Cother. : 3542.DOI: 10.1128 / AAC.00582-08.) Forward_2020 and Reverse reported in Table.1 were used. That is, the forward primer sequence was tccaggtacg ggtga agaca (SEQ ID NO: 3), and the reverse primer sequence was atcat gtaga gaata ggtag gagc (SEQ ID NO: 4).

As shown in FIG. 1, the first hydrolysis probe has a sequence of 5′-aacgggacggaaag-3 ′ (SEQ ID NO: 1), and LNA is introduced into the portion shown in capital letters in the figure. I used what I have. Moreover, the 2nd hydrolysis probe used what has the same arrangement | sequence as a 1st hydrolysis probe as FIG. 3 shows.

The PCR program (thermal profile) was as follows.
Following the initial warming (DNA synthase activation) at 95.0 ° C for 3 minutes 00 seconds,
95.0 ℃ 0 min 05 sec
60.0 ° C 0 min 20 sec (measurement of fluorescence at the end of this step)
The time required for the real-time PCR measurement was about 1 hour.

FIG. 19 is a diagram showing the detection result of the amplification curve in the sensitive sequence. FIG. 20 is a diagram showing a sequence result. As shown in FIG. 19, in the amplification curve of 12 (+ negative control), two amplification curves showing a positive reaction are shown in a chart in which fluorescence is expected only in the sensitive sequence. (C0826, C1012). In FIG. 20, from the 20 mycoplasma positive specimens examined by real-time PCR, the 2058,2059 base of the 23S rRNA region (corresponding to 2063,2064 in the standard strain of Mycoplasma pneumoniae) and the surrounding sequence are separately sequenced The results confirmed in (1) are shown side by side with the sequence of the site of the standard strain (M129). M129 is the sequence of the standard strain (M129), of which the underlined two letters AA correspond to positions 2058 and 2059, that is, the site where the resistance mutation is introduced. The sequence actually obtained in the sequence is arranged under M129. When the base matches the standard strain of M129, “-” is written, and when there is a difference, the base is written. ing. According to FIG. 20, the sequence results corresponding to the amplification curves C0826 and C1012 showing the two positive reactions shown in FIG. 19 showed that the sequence was completely identical to that of the standard strain. As shown in FIG. 20, the strains that were not detected in FIG. 19 were found to have a base mutation at No. 2058 or No. 2059. On the other hand, FIG. 21 is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. As shown in FIG. 21, an amplification curve showing a positive reaction was detected for the resistant mutant shown in FIG. As described above, according to the present invention, the presence or absence of a macrolide antibiotic-resistant mutant is clearly recognized in an all-or-none manner in a very short time, instead of comparing and comparing curves having similar forms. It was detected.

(Example 2 Detection of resistance mutation of Mycoplasma pneumonia)
In Example 1 described above, A2058G was 9 cases and A2059C was 1 case, but in this example, together with the sequence having no mutation, A2058G, A2059C, A2058C, A2058T, and A2059G, a total of 5 types of previously reported macros Ride antibiotic resistance mutation positive control, and macrolides that have not been reported yet, A2059T, which is a possible single base mutation, and 9 types of mutations that have mutations in both 2058 and 2059 bases. The detection results of all 16 possible sequences that can occur in 2 bases of a hot spot for resistance to antibiotics are shown. Samples: 1) Subcloning the target sequence from the nucleic acid derived from clinical specimens, 2) Confirming the sequence, 3) Introducing a single base mutation by site-directed mutagenesis (Site-Directed Mutagenesis), 4) The intended mutation It was created artificially by confirming that it was introduced in the sequence. The other experimental methods were the same as in Example 1. FIG. 22 is a diagram showing detection results of amplification curves in sensitive sequences. FIG. 23 is a diagram showing a detection result of an amplification curve in the case of no sensitivity question.

As shown in FIGS. 22 and 23, all mutants having mutations in at least one of 2058 and 2059 bases, that is, five previously reported resistance mutations A2058G, A2058C, A2058T, A2059G, A2059C and possible 1 It was revealed that the presence or absence of a macrolide antibiotic resistance mutation could be detected in a very short time in any of the nine mutations in which both the base mutation A2059T and 2058 and 2059 were mutated.

(Example 3 Detection of Bordetella pertussis mutant)
Another PCR detection system (KostersK, Riffelmann M, Wirsing von Konig CH.Evaluation of a real-time PCR assay for detection of Bordetella pertussis and B. parapertussis in clinical samples.JMed Microbiol. 2001 May; 50 (5): 436-40.), Nucleic acid preparations (B1228, C0127, C0131, B0929, D0104, D0403, D0423, D0425) derived from 8 patient specimens that were judged as pertussis positive were used. As in Example 1 above, the nucleic acid sample was extracted from airway-derived clinical specimens using QIAGEN's QIAamp (registered trademark) DNAmini kit and uniformly eluted in a volume of 100 μL regardless of the amount of the original specimen. It was prepared by. The same QIAGENBuffer AE used for nucleic acid elution was used as a negative control.

The forward primer sequence was gcacgaatggcgtaacgatg (SEQ ID NO: 7), and the reverse primer sequence was ctccctcgaatctggcgactc (SEQ ID NO: 8). These primers were designed with Primer BLAST software.

As shown in FIG. 4, the first hydrolysis probe has a sequence of 5′-cggctagacggaaag-3 ′ (SEQ ID NO: 5), and LNA is introduced into the portion indicated by capital letters in the figure. I used what I have. Moreover, the 2nd hydrolysis probe used what has the same arrangement | sequence as a 1st hydrolysis probe as FIG. 6 shows.

The PCR program (thermal profile) was the same as in Example 1 above.

The time required for real-time PCR measurement was about 1 hour.

FIG. 24 is a diagram showing a sequence result. In Fig. 24, the 20S and 2059 bases (corresponding to 2037 and 2038 in Bordetella pertussis) in the 23S rRNA region and the surrounding sequences were separately confirmed from 8 positive B. pertussis positive samples examined by real-time PCR. The results are shown side by side with the sequence of the relevant site of the standard strain (Tohama I). Tohama I is a sequence of a standard strain, of which the underlined two letters AA correspond to positions 2058 and 2059, that is, a site where a resistance mutation is introduced. The sequence actually obtained in the sequence is arranged under Tohama I. When the base matches the TohamaI standard strain, “•” is indicated, and when there is a difference, the base is indicated. Has been.

FIG. 25 is a diagram showing the detection result of the amplification curve in the sensitive sequence. As shown in FIG. 25, among the eight amplification curves, an amplification curve showing a positive reaction is shown in a chart in which fluorescence is expected only in the sensitive sequence (B1228, C0127, C0131, B0929, D0104, D0403, D0423, D0425). According to FIG. 24, the sequence results corresponding to the amplification curves B1228, C0127, C0131, B0929, D0104, D0403, D0423, D0425 showing the positive reaction shown in FIG. It was shown that it was. On the other hand, FIG. 26 is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case.

Thus, like the above-described embodiments, according to the present invention, rather than comparing and comparing curves having similar forms, the macrolide system can be clearly seen at all times or in a very short time. The presence or absence of antibiotic resistance mutations could be detected.

(Example 4 Detection of resistance mutation of Bordetella pertussis)
The nucleic acid samples derived from the 8 patient specimens examined in Example 3 described above were all sensitive to macrolide antibiotics without mutation. On the other hand, in this example, in addition to positive subjects having no resistance mutation, A2058G positive control, A2058C positive control, A2058T positive control, A2059G positive control, A2059C positive control, A2059T positive control in which resistance mutation was artificially introduced The detection result about is shown. Samples are the same as in Example 2. 1) Subcloning the target sequence from the clinical specimen-derived nucleic acid, 2) Confirming the sequence, and 3) Introducing a single nucleotide mutation by site-directed mutagenesis (Site-Directed Mutagenesis) 4) Created artificially by confirming that the intended mutation was introduced in the sequence. The other experimental methods were the same as in Example 3. FIG. 27 is a diagram showing a detection result of an amplification curve in a sensitive sequence. FIG. 28 is a diagram showing the detection result of the amplification curve when sensitivity is not questioned.

As shown in FIG. 27 and FIG. 28, all the mutant types, namely, A2058G positive control, A2058C positive control, A2058T positive control, A2059G positive control, A2059C positive control, A2059T positive control are macroscopically clearly and in a very short time. It has been found that the presence or absence of a ride antibiotic resistance mutation can be detected.

(Example 5) Detection of resistance mutation of Helicobacter pylori
A nucleic acid sample derived from the JCM12093 strain received from the RIKEN BioResource Center was used as a sample having no resistance mutation (a sample of a sensitive sequence). This sample was extracted in the same manner as in Example 1 above, and the nucleic acid preparation was prepared by eluting to a volume of 200 μL. The nucleic acid concentration of this preparation was measured by absorbance, and further diluted to be about 1 × 10 ⁵ genomes per μL. Samples of sequences with mutations are as follows: 1) Eight 130mer oligonucleotides that overlap each other by 36 bases (using action number NC_011333 as a reference sequence) are connected in a PCR reaction solution, and PCR reaction is performed using this reaction product as a template. 2) Confirm the sequence, 3) Introduce a single base mutation by site-directed mutagenesis, and 4) Confirm that the intended mutation has been introduced. It was created by. The same QIAGEN Buffer AE used for nucleic acid elution was used as a negative control.

The forward primer sequence was gcgtaacgagatgggagctg (SEQ ID NO: 11), and the reverse primer sequence was tggctccataagagccaaagc (SEQ ID NO: 12).

As shown in FIG. 7, the first hydrolysis probe has a sequence of 5′-cggcaagacggaaag-3 ′ (SEQ ID NO: 9), and LNA is introduced into the portion indicated by capital letters in the figure. I used what I have. Moreover, the 2nd hydrolysis probe used what has the same arrangement | sequence as a 1st hydrolysis probe as FIG. 9 shows.

The PCR program (thermal profile) was as follows.
Following the initial warming (DNA synthase activation) at 95.0 ° C for 3 minutes 00 seconds,
95.0 ℃ 0 min 05 sec
64.0 ° C 0 min 20 sec (measurement of fluorescence at the end of this step)
The time required for the real-time PCR measurement was about 1 hour.

FIG. 29 is a diagram showing a sequence result. Fig. 29 shows 8 nucleic acid samples examined by real-time PCR (from JCM12093 strain distributed by RIKEN BioResource Center, and subcloned sequences from genomic DNA from JCM12093 strain, 6 artificially created mutations) Sequence) from the 20S, 2059 base of the 23S rRNA region (corresponding to 2146, 2147 in the H. pylori standard strain (sites also referred to as 2142, 2143 in H. pylori)) and its surroundings The result of confirming the sequence separately by sequencing is shown side by side with the sequence of the corresponding site of the standard strain (Helicobacter pylori 26695 (NCBI Reference Sequence: NC — 000915.1)). Helicobacterpylori 26695 is a sequence of a standard strain, of which the underlined two letters AA correspond to positions 2058 and 2059, that is, a site where a resistance mutation is introduced. Sequences actually obtained by sequencing are arranged under Helicobacter pylori 26695, and when the base matches the Helicobacter pylori 26695 standard strain, `` The base is marked.

FIG. 30 is a diagram showing a detection result of an amplification curve in a sensitive sequence. As shown in FIG. 30, among the 8 amplification curves, an amplification curve showing a positive reaction is shown in a chart where fluorescence is expected to be observed only in the sensitive sequence (AA). According to FIG. 29, the sequence result corresponding to the amplification curve AA showing the positive reaction shown in FIG. 30 showed that the sequence was completely identical with the standard strain. Then, as shown in FIG. 29, the sequence that was not detected in FIG. 30 was found to have a base mutation at No. 2058 or No. 2059. On the other hand, FIG. 31 is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. As shown in FIG. 31, an amplification curve showing a positive reaction was detected for both the resistant mutant sequence shown in FIG. 29 and the sequence having no resistant mutation. Thus, like the above-described embodiments, according to the present invention, rather than comparing and comparing curves having similar forms, the macrolide system can be clearly seen at all times or in a very short time. The presence or absence of antibiotic resistance mutations could be detected.

Next, when the probe sequence in the above-described example was changed, an attempt was made to detect a resistance mutation of H. pylori.

The first hydrolysis probe used was that of Example 6 described later, that is, a probe having the sequence 5'-ggcaagacggaaag-3 '(SEQ ID NO: 13) shown in FIG. Similarly, the second hydrolysis probe used in Example 6 described later, that is, the probe having the sequence shown in FIG. 12 was used. The sequence of these probes (SEQ ID NO: 13) is a sequence obtained by removing one base from C (cytosine) at the 5 ′ end of the previously used probe sequence (SEQ ID NO: 9), and the template sequence shown in FIG. It is an exact sequence.

The PCR program (thermalprofile) was as follows.
Following the initial warming (DNA synthase activation) at 95.0 ° C for 3 minutes 00 seconds,
95.0 ℃ 0 min 05 sec
60.0 ° C 0 min 20 sec (measurement of fluorescence at the end of this step)
FIG. 32 is a diagram showing detection results of amplification curves in sensitive sequences. As shown in FIG. 32, an amplification curve showing a positive reaction is shown in a chart in which fluorescence is expected to be observed only in the sensitive sequence (AA). On the other hand, FIG. 33 is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. As shown in FIG. 33, an amplification curve showing a positive reaction was detected for both the resistant mutant sequence and the sequence having no resistant mutation. Thus, even when a probe shorter by one base than the probe in the above-described example was used, the presence or absence of a macrolide antibiotic resistance mutation could be detected in an extremely short time with all or none.

(Example 6 Detection of resistance mutation in Campylobacter jejuni)
A nucleic acid sample derived from Campylobacter jejuni subsp. Jejuni strain JCM2013 was dissolved in a buffer solution from the RIKEN BioResource Center, and used as a sample without a resistance mutation (a sample of a sensitive sequence). This sample was further diluted 1000 times and used for the experiment. Samples of sequences with mutations: 1) Subcloning the target sequence from the above-mentioned nucleic acid table from JCM2013 strain, 2) Confirming the sequence, 3) Single-site mutation by site-directed mutagenesis (Site-Directed Mutagenesis) 4) was created by confirming that the intended mutation was introduced by sequencing. As a negative control, the same nuclease-free water used for nucleic acid elution was used.

The forward primer sequence was cgtaacgagatgggagctgt (SEQ ID NO: 15), and the reverse primer sequence was ctcccacctatcctgcacat (SEQ ID NO: 16).

As shown in FIG. 10, the first hydrolysis probe has a sequence of 5′-ggcaagacggaaag-3 ′ (SEQ ID NO: 13), and LNA is introduced into the portion indicated by capital letters in the figure. I used what I have. Further, as shown in FIG. 12, the second hydrolysis probe has the same sequence as the first hydrolysis probe, the 5 ′ end is labeled with a reporter fluorescent dye, and the 3 ′ end is not a quencher. Those labeled with a fluorescent dye and MGB were used. The reporter fluorescent dye was VIC.

The PCR program (thermal profile) was the same as in Example 1 above.

The time required for real-time PCR measurement was about 1 hour.

FIG. 34 is a diagram showing a sequence result. In FIG. 34, 8 nucleic acid samples examined by real-time PCR (derived from JCM2013 strain distributed from RIKEN BioResource Center, sequences not containing mutations and sequences having 6 artificially created mutations) From the results of the sequencing of the 2058,2059 base of the 23S に rRNA region (corresponding to 2074,2075 in the standard strain of Campylobacter jejuni) and the surrounding sequence, the results of the standard strain (Campylobacter jejuni subsp. Jejuni ( NCBI Reference Sequence: NC_002163.1)) is shown side by side with the sequence of the relevant part. This is the sequence of the standard strain, of which the underlined two letters AA correspond to the numbers 2074 and 2075, that is, the site where the resistance mutation is introduced. The sequence actually obtained in the sequence is arranged under the sequence of the standard strain Campylobacter jejuni subsp. Jejuni. In some cases, the base is marked.

FIG. 35 is a diagram showing detection results of amplification curves in sensitive sequences. As shown in FIG. 35, an amplification curve showing a positive reaction is shown in a chart in which fluorescence is expected to be observed only in the sensitive sequence in the amplification curve (AA). The sequence result corresponding to the amplification curve AA showing the positive reaction shown in FIG. 35 showed that the sequence was completely identical with the standard strain according to FIG. Then, as shown in FIG. 34, the sequence that was not detected in FIG. 35 was shown to have a base mutation at No. 2058 or No. 2059. On the other hand, FIG. 36 is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. As shown in FIG. 36, an amplification curve showing a positive reaction was detected for both the resistant mutant sequence shown in FIG. 34 and the sequence having no resistant mutation. Thus, like the above-described embodiments, according to the present invention, rather than comparing and comparing curves having similar forms, the macrolide system can be clearly seen at all times or in a very short time. The presence or absence of antibiotic resistance mutations could be detected.

Next, in the case where the probe sequence in the above Example was changed, an attempt was made to detect a resistance mutation of Campylobacter jejuni.

The first hydrolysis probe used was that of Example 5 described above, that is, the probe having the sequence 5'-cggcaagacggaaag-3 '(SEQ ID NO: 9) shown in FIG. Similarly, the second hydrolysis probe used was that of Example 5 described above, that is, the probe having the sequence shown in FIG. The sequence of these probes (SEQ ID NO: 9) is a sequence obtained by adding one base of C (cytosine) to the 5 ′ end of the previously used probe sequence (SEQ ID NO: 13). The template sequence shown in FIG. Is a sequence that completely matches.

The PCR program (thermalprofile) was as follows.
Following the initial warming (DNA synthase activation) at 95.0 ° C for 3 minutes 00 seconds,
95.0 ℃ 0 min 05 sec
64.0 ° C 0 min 20 sec (measurement of fluorescence at the end of this step)
FIG. 37 is a diagram showing the detection results of the amplification curve in the sensitive sequence. As shown in FIG. 37, an amplification curve showing a positive reaction is shown in a chart in which fluorescence is expected to be observed only in the sensitive sequence (AA). On the other hand, FIG. 38 is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. As shown in FIG. 38, an amplification curve showing a positive reaction was detected for both the resistant mutant sequence and the sequence having no resistant mutation. Thus, even when a probe longer by one base than the probe in the above-described example was used, the presence or absence of a macrolide antibiotic resistance mutation could be detected in an extremely short time with all or none.

(Example 7 Detection of resistance mutation in Chlamydia trachomatis)
Two nucleic acid preparations extracted from phenol / chloroform from clinical specimens positive for Chlamydia trachomatis by Amplicor (registered trademark) method were used. 1) Subcloning the target sequence from the clinical specimen-derived nucleic acid, 2) Confirming the sequence, 3) Introducing a single nucleotide mutation by site-directed mutagenesis (Site-Directed Mutagenesis), 4) The intended mutation A sequence sample having a mutation was artificially created by confirming the introduction by sequencing. As a negative control, the same nuclease-free water used for nucleic acid elution was used.

The forward primer sequence was tgggcactgtctcaacgaaa (SEQ ID NO: 19), and the reverse primer sequence was caacgttgactcccactctc (SEQ ID NO: 20).

As shown in FIG. 7, the first hydrolysis probe has a sequence of 5′-cgaaaggacgaaaag-3 ′ (SEQ ID NO: 17), and LNA is introduced into the portion shown in capital letters in the figure. I used what I have. Further, as shown in FIG. 9, the second hydrolysis probe has the same sequence as the first hydrolysis probe, the 5 ′ end is labeled with a reporter fluorescent dye, and the 3 ′ end is not a quencher. Those labeled with a fluorescent dye and MGB were used. The reporter fluorescent dye was VIC.

The PCR program (thermal profile) was the same as in Example 1 above.

The time required for real-time PCR measurement was about 1 hour.

FIG. 39 is a diagram showing a sequence result. FIG. 39 shows 23S from 9 nucleic acid samples examined by real-time PCR (derived from Chlamydia trachomatis positive clinical specimens 0630 and 0707, and artificially generated mutation-free sequences and six mutation sequences). As a result of separately sequencing the 2058 and 2059 bases of the rRNA region (corresponding to 2038 and 2039 in the Chlamydia trachomatis standard strain) and the surrounding sequences, the standard strain (Chlamydiatrachomatis D / UW-3 / CX NCBI Reference Sequence: NC_000117.1)) is shown side by side with the sequence of the relevant part. NC_000117 is a sequence of a standard strain, of which the underlined two letters AA correspond to positions 2038 and 2039, that is, a site where a resistance mutation is introduced. The sequence actually obtained in the sequence is arranged under the sequence of NC_000117.1. When this base strain and the base match, “•” is written, and when there is a difference, The base is marked.

FIG. 40 is a diagram showing a detection result of an amplification curve in a sensitive sequence. As shown in FIG. 40, an amplification curve showing a positive reaction is shown in a chart in which fluorescence is expected to be observed only in the sensitive sequence in the amplification curve (AA, positive sample). The amplification curve AA showing the positive reaction shown in FIG. 40 and the sequence result corresponding to the positive specimen showed that the sequence was completely identical with the standard strain according to FIG. The strains that were not detected in FIG. 40 were found to have a base mutation at No. 2058 or No. 2059, as shown in FIG. On the other hand, FIG. 41 is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. As shown in FIG. 41, an amplification curve showing a positive reaction was detected for both the resistant mutant sequence shown in FIG. 39 and the sequence having no resistant mutation. Thus, like the above-described embodiments, according to the present invention, rather than comparing and comparing curves having similar forms, the macrolide system can be clearly seen at all times or in a very short time. The presence or absence of antibiotic resistance mutations could be detected.

(Example 8 Detection of resistance mutation in MAC)
Received a lot of nucleic acid sample from Mycobacterium intracellulare JCM6384 standard strain (same as ATCC13950) dissolved in buffer solution from RIKEN BioResource Center, and used it as a sample without resistance mutation (sensitive sequence sample) did. This sample was further diluted 1000 times and used for the experiment. Samples with and without mutations used as positive controls are: 1) 6 160mers overlapping each other by 36 bases, 82mer containing the desired mutation in the middle, 57mer as the forward primer, and reverse primer A 50mer oligonucleotide (action number NC008595.1 is used as a reference sequence) is ligated in the PCR reaction solution and amplified by PCR reaction using this reaction product as a template, 2) the sequence is confirmed, and 3) the intended mutation It was created by confirming that each was introduced in the sequence. As a negative control, the same nuclease-free water used for nucleic acid elution was used.

The forward primer sequence was tcggcgaaattgcactacga (SEQ ID NO: 24), and the reverse primer sequence was aacccgataagggttcgacg (SEQ ID NO: 25).

As shown in FIG. 16, the first hydrolysis probe has a sequence of 5′-cggcaggacgaaaag-3 ′ (SEQ ID NO: 21), and LNA is introduced into the portion indicated by capital letters in the figure. I used what I have. Further, as shown in FIG. 18, the second hydrolysis probe has the same length as the first hydrolysis probe, but 5′-IIgcaggacgaaaag-3 in which two bases at the 5 ′ end are replaced with inosine (I). It has a sequence of '(SEQ ID NO: 23), 5' end is labeled with a reporter fluorescent dye, and 3 'end is labeled with a quencher non-fluorescent dye and MGB. The reporter fluorescent dye was VIC.

The PCR program (thermal profile) was as follows.
Following the initial warming (DNA synthase activation) at 95.0 ° C for 3 minutes 00 seconds,
95.0 ℃ 0 min 05 sec
62.0 ° C 0 min 20 sec (fluorescence measured at the end of this step)
The time required for the real-time PCR measurement was about 1 hour.

FIG. 42 is a diagram showing a sequence result. FIG. 42 shows nucleotides 2058 and 2059 of the 23S rRNA region (standard) from 7 nucleic acid samples examined by real-time PCR (same sequence as an artificially prepared standard strain and 6 types of mutations). Sequential Mycobacterium avium 104 and corresponding sequences were confirmed by sequencing separately, and two MAC standard strains (Mycobacterium avium 104 (NCBIReference Sequence: NC_008595.1), Mycobacteriumintracellulare ATCC 13950 ( NCBI Reference Sequence: NC_016946.1)) is shown side by side with the sequence of the relevant part. Mycobacterium avium 104 is the sequence of the standard strain of MAC, of which the underlined two letters AA correspond to positions 2058 and 2059, that is, the site of the resistance mutation. The sequence actually obtained in the sequence is arranged under Mycobacterium avium 104. When the base matches the standard strain, “・” is written, and when there is a difference, the base is It is written. The bottom of the figure is the sequence of the M.intracellulare ATCC 13950 standard strain.

FIG. 43 is a diagram showing the detection result of the amplification curve in the sensitive sequence. As shown in FIG. 43, an amplification curve showing a positive reaction is shown in the chart in which fluorescence is expected to be observed only in the sensitive sequence in the amplification curve (AA, JCM6384 (standard strain)). . The sequence result corresponding to the amplification curve AA showing the positive reaction shown in FIG. 43 showed that the sequence was completely identical with the standard strain according to FIG. 43. As shown in FIG. 42, the sequence that was not detected in FIG. 43 was found to have a base mutation at No. 2279 or No. 2280. On the other hand, FIG. 44 is a figure which shows the detection result of the amplification curve in the sensitivity unquestioned case. As shown in FIG. 44, an amplification curve showing a positive reaction was detected for both the resistant mutant sequence shown in FIG. 42 and the sequence having no resistant mutation. Thus, like the above-described embodiments, according to the present invention, rather than comparing and comparing curves having similar forms, the macrolide system can be clearly seen at all times or in a very short time. The presence or absence of antibiotic resistance mutations could be detected.

Can be used to detect macrolide antibiotic-resistant mutant bacteria.

SEQ ID NO: 1, 5, 9, 13, 17, 21, 23: Probe SEQ ID NO: 2, 6, 10, 14, 18, 22: Template sequence SEQ ID NO: 3, 4, 7, 8, 11, 12, 15, 16 , 19, 20, 24, 25: Primer

Claims (21)

1. A detection method that detects macrolide antibiotic-resistant mutants that have become resistant to macrolide antibiotics due to inhibition of binding to 23S rRNA domain V in a biological sample of the subject using real-time PCR. There,
   Contacting the biological sample with a first hydrolysis probe and a second hydrolysis probe;
   The first hydrolysis probe and the second hydrolysis probe are designed to bind to the same template sequence;
   The first hydrolysis probe has a nucleic acid having two circular structures by having a crosslinked structure in the nucleic acid molecule,
   The second hydrolysis probe has a 5 ′ end labeled with a reporter fluorescent dye, a 3 ′ end labeled with a quencher non-fluorescent dye and MGB (Minor Groove Binder),
   In the case of a standard strain, fluorescence derived from the first hydrolysis probe and the second hydrolysis probe is observed, whereas in the case of a macrolide antibiotic-resistant mutant, only the second hydrolysis probe is observed. A method for detecting a macrolide antibiotic-resistant mutant bacterium, wherein fluorescence is observed.
2. A detection method that detects macrolide antibiotic-resistant mutants that have become resistant to macrolide antibiotics due to inhibition of binding to 23S rRNA domain V in a biological sample of the subject using real-time PCR. There,
   Contacting the biological sample with a first hydrolysis probe and a second hydrolysis probe;
   The first hydrolysis probe and the second hydrolysis probe are designed to bind to the same template sequence;
   The first hydrolyzing probe and the second hydrolyzing probe are different in the thermal stability of two probes depending on the sequence of a standard strain and the sequence having a mutation. Due to the difference in behavior,
   In the case of a standard strain, fluorescence derived from the first hydrolysis probe and the second hydrolysis probe is observed, whereas in the case of a macrolide antibiotic-resistant mutant, only the second hydrolysis probe is observed. A method for detecting a macrolide antibiotic-resistant mutant bacterium, wherein fluorescence is observed.
3. The method for detecting a macrolide antibiotic-resistant mutant according to claim 1, wherein the macrolide antibiotic-resistant mutant is a Mycoplasma pneumoniae.
4. 4. The macrolide antibiotic resistance mutation according to claim 3, wherein sequences of the first hydrolysis probe and the second hydrolysis probe are 5′-aacgggacggaaag-3 ′ (SEQ ID NO: 1). 5. Method for detecting bacteria.
5. The method for detecting a macrolide antibiotic-resistant mutant according to claim 1, wherein the macrolide antibiotic-resistant mutant is a Bordetella pertussis mutant.
6. 6. The macrolide antibiotic resistance mutation according to claim 5, wherein the sequences of the first hydrolysis probe and the second hydrolysis probe are 5′-cggctagacggaaag-3 ′ (SEQ ID NO: 5). Method for detecting bacteria.
7. The method for detecting a macrolide antibiotic-resistant mutant according to claim 1, wherein the macrolide antibiotic-resistant mutant is a H. pylori mutant.
8. The method for detecting a macrolide antibiotic resistant mutant according to claim 1, wherein the macrolide antibiotic resistant mutant is a Campylobacter jejuni mutant.
9. The macrolide antibiotic according to claim 7 or 8, wherein the sequences of the first hydrolysis probe and the second hydrolysis probe are 5'-cggcaagacggaaag-3 '(SEQ ID NO: 9). A method for detecting a resistant mutant.
10. The macrolide antibiotic according to claim 7 or 8, wherein sequences of the first hydrolysis probe and the second hydrolysis probe are 5'-ggcaagacggaaag-3 '(SEQ ID NO: 13). A method for detecting a resistant mutant.
11. The method for detecting a macrolide antibiotic resistant mutant according to claim 1, wherein the macrolide antibiotic resistant mutant is a Chlamydia trachomatis mutant.
12. 12. The macrolide antibiotic resistance mutation according to claim 11, wherein sequences of the first hydrolysis probe and the second hydrolysis probe are 5′-cgaaaggacgaaaag-3 ′ (SEQ ID NO: 17). Method for detecting bacteria.
13. The method for detecting a macrolide antibiotic-resistant mutant according to claim 1, wherein the macrolide antibiotic-resistant mutant is a MAC mutant.
14. The sequence of the first hydrolysis probe is 5′-cggcaggacgaaaag-3 ′ (SEQ ID NO: 21), and the sequence of the second hydrolysis probe is 5′-IIgcaggacgaaaag-3 ′ (SEQ ID NO: 23). The method for detecting a macrolide antibiotic-resistant mutant bacterium according to claim 13.
15. A detection kit for detecting a macrolide antibiotic-resistant mutant bacterium having resistance to a macrolide antibiotic caused by inhibition of binding to 23S rRNA domain V by real-time PCR,
    A first hydrolysis probe and a second hydrolysis probe;
    The first hydrolysis probe and the second hydrolysis probe are designed to bind to the same template sequence;
    In the first hydrolysis probe, part of the sequence is composed of LNA (Locked Nucleic Acid),
    The second hydrolysis probe has a 5 ′ end labeled with a reporter fluorescent dye, a 3 ′ end labeled with a quencher non-fluorescent dye and MGB,
    In the case of the standard strain, fluorescence derived from the first hydrolysis probe and the second hydrolysis probe is observed, whereas in the case of Mycoplasma pneumoniae, fluorescence of only the second hydrolysis probe is observed. A detection kit for a macrolide antibiotic-resistant mutant.
16. The macrolide antibiotic resistant mutant bacterium detection kit according to claim 15, wherein the macrolide antibiotic resistant mutant is a Mycoplasma pneumoniae mutant.
17. The detection kit for macrolide antibiotic-resistant mutants according to claim 15, wherein the macrolide antibiotic-resistant mutant is a Bordetella pertussis mutant.
18. The macrolide antibiotic resistant mutant bacterium detection kit according to claim 15, wherein the macrolide antibiotic resistant mutant is a H. pylori mutant.
19. The kit for detecting a macrolide antibiotic-resistant mutant according to claim 15, wherein the macrolide antibiotic-resistant mutant is a Campylobacter jejuni mutant.
20. 16. The detection kit for a macrolide antibiotic-resistant mutant according to claim 15, wherein the macrolide antibiotic-resistant mutant is a Chlamydia trachomatis mutant.
21. The macrolide antibiotic resistant mutant bacterium detection kit according to claim 15, wherein the macrolide antibiotic resistant mutant is a MAC mutant.

Images