WO2016061398A1

WO2016061398A1 - Methods, kits & compositions to assess helicobacter pylori infection

Info

Publication number: WO2016061398A1
Application number: PCT/US2015/055810
Authority: WO
Inventors: Sarah TALARICO; Nina Salama
Original assignee: Fred Hutchinson Cancer Research Center
Priority date: 2014-10-17
Filing date: 2015-10-15
Publication date: 2016-04-21
Also published as: CN108474042B; CN108474042A

Abstract

The present disclosure provides methods, kits and compositions to assess Helicobacter pylori (H. pylori) infection. The methods, kits, and compositions can diagnose and quantify the presence of H. pylori infection as well as assess the risk of associated digestive system ulcers or cancers and whether the infection, if present, is susceptible or resistant to treatment with antibiotics. All parameters can be assessed using sample partition digital polymerase chain reaction (spdPCR).

Description

METHODS, KITS & COMPOSITIONS

TO ASSESS HELICOBACTER PYLORI INFECTION

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U .S. Provisional Patent Application No. 62/168,573 filed May 29, 2015 and to U.S. Provisional Patent Application No. 62/065,51 1 filed October 17, 2014, the entire contents of each of which are incorporated by reference herein.

STATEMENT OF GOVERNMENT I NTEREST

[0002] This invention was made with government support under grants 5K01 DK090103 and R01AI054423 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE DISCLOSURE

[0003] The present disclosure provides methods, kits and compositions to assess Helicobacter pylori (H. pylori) infection. The methods, kits, and compositions can detect and quantify the presence of H. pylori infection as well as assess the risk of associated gastric ailments and whether the infection, if present, is susceptible or resistant to treatment with antibiotics. All parameters can be assessed using sample partition digital polymerase chain reaction (spdPCR) assays.

BACKGROUND OF THE DISCLOSURE

[0004] Helicobacter pylori (H. pylori) infects the stomach of over half of the world's population and ~ 1/3 of the U .S. population. H. pylori is responsible for a range of disease outcomes from asymptomatic gastritis (inflammation of the stomach) to peptic ulcer and gastric cancers, but may be protective against other diseases including esophageal cancer and asthma. Both human and bacterial genetic variability appear to contribute to differences in disease outcome. H. pylori exhibits extensive inter-strain genetic diversity as well as intra-strain genetic diversification during the course of infection.

[0005] Methods for diagnosis of H. pylori currently available include both invasive and noninvasive tests. The invasive tests (pathological evaluation of biopsies obtained via endoscopy) offer high sensitivity and specificity as well as the option of genotyping the H. pylori strain by culturing from the biopsy. However, these procedures include risk of esophageal and/or gastric perforation and bleeding and risks from the medications used for patient sedation, as well as substantial costs from the endoscopic procedure and pathology review of the biopsy specimens.

[0006] Non-invasive tests for diagnosis of H. pylori include the serology test, the urea breath test, and the stool antigen test. These tests have varying levels of sensitivity and specificity and do not allow for genotyping of H. pylori to assess antibiotic resistance, presence of virulence genes or alleles, or tracking of transmission within a population. PCR-based methods (either multiple rounds of conventional PCR or real-time PCR) for detecting H. pylori DNA in stool, some of which use sequencing of PCR product to genotype strains, have been reported with sensitivities for detection of H. pylori infection varying between 25% and 92% (Falsafi et al., World J. Gastroenterol., 15, 484-488 (2009); Hirai et al., J. Med. Micro., 58, 1 149-1 153 (2009); Puz et al., Gastroenterology, 135, 1543-1551 (2008); Sicinschi et al., Helicobacter., 17, 96-106 (2012); Sicinschi et al. Helicobacter., 8, 601-607 (2003)).

SUMMARY OF THE DISCLOSURE

[0007] PCR-based tests for detecting and genotyping H. pylori from stool have not been adopted for use in epidemiologic studies or diagnostics likely because of issues with sensitivity, reproducibility, and false positives from contamination. Disclosed herein are non-invasive methods, kits, and compositions utilizing sample partition digital polymerase chain reaction (spdPCR) to detect and genotype H. pylori infection. The methods, kits and compositions offer improved sensitivity over currently available tests and the added features of quantification of H. pylori load as well as ratio of specific genotypes. The disclosed methods, kits, and compositions include detection of the H. pylori 16S rRNA gene, detection of the H. pylori cagA virulence gene, genotyping of the cagA virulence gene, and detection of antibiotic resistant strains of H. pylori. Detecting the 16S gene confirms the presence of infection. Detection and genotyping of the cagA gene allows assessment of strain virulence and classification of a subject's risk for developing gastric ailments associated with H. pylori infection. Detection of mutations within the 23S gene allows assessment of whether a particular infection is susceptible or resistant to treatment with antibiotics. In particular embodiments, each of these parameters is assessed using a spdPCR assay. The described assays provide information on the load/density of H. pylori infection. The ability to obtain quantitative information on the number of genomes per sample and thus the number of bacteria of specific genotypes provides a significant advance over previously-available tests.

BRIEF DESCRIPTION OF THE FIGURES

[0008] FIG. 1 shows 16S spdPCR (here, Droplet Digital™ PCR (ddPCR™) (Bio-Rad Laboratories, Hercules, CA)) amplitude plots for H. py/on^'-negative stool sample spiked with H. py/or/^'-positive genomic DNA. Each dot represents one droplet. Dots above the threshold (set at 3000) are positive for H. pylori 16S. Dots below the threshold are negative for H. pylori 16S. Expected copies per μΙ is shown on the left and measured copies per μΙ (Ch2-Conc.) and absolute number of positive (pos.) and negative (neg.) droplets are shown in the title of each plot.

[0009] FIG. 2 shows spdPCR (here, ddPCR™) amplitude plots for the multiplexed 16S and cagA gene assay. H. py/o/7-negative stool DNA was spiked with genomic DNA of two different H. pylori strains (Oki573 and Em47-1 ) having the cagA gene. Each dot represents one droplet. Dots above the threshold (set at 3000) in the left side panel (16S probe) are positive for H. pylori 16S rRNA gene. Dots above the threshold (set at 6000) in the right side panel {cagA probes) are positive for the H. pylori cagA gene. Dots below the thresholds are negative for H. pylori. Measured copies per μΙ (Ch2-Conc, Ch1-Conc.) and absolute number of positive (pos.) and negative (neg.) droplets are shown in the title of each plot. The concentration of 16S copies is expected to be twice that of cagA copies because there are two copies of the 16S gene and only one copy of the cagA gene in the H. pylori genome.

[0010] FIG. 3 shows spdPCR (here, ddPCR™) amplitude plots for the cagA EPIYA typing assay. H. py/or/^'-negative stool DNA was spiked with genomic DNA of two different H. pylori strains: Oki573 having an East Asian type cagA gene and Em47-1 having a Western type cagA gene. Each dot represents one droplet. Dots above the threshold (set at 2000) in the left side panel (EPIYA-D Probe) are positive for an East Asian type allele of the cagA gene. Dots above the threshold (set at 2000) in the right side panel (EPIYA-C Probe) are positive for a Western type allele of the cagA gene. Dots below the thresholds are negative for H. pylori. Measured copies per μΙ (Ch2-Conc, Ch1-Conc.) and absolute number of positive (pos.) and negative (neg.) droplets are shown in the title of each plot.

[0011] FIG. 4 shows spdPCR (here, ddPCR™) amplitude plots for the clarithromycin resistance assay. H. pylori genomic DNA of a clarithromycin-sensitive strain and an isogenic clarithromycin-resistant strain having one of the 23S point mutations were spiked in to H. pylori- negative stool DNA at different ratios indicated on the left side of the figure. Each dot represents one droplet. Dots above the threshold (set at 3000) in the amplitude plots in the left panel (probe detecting clarithromycin sensitivity) are positive for clarithromycin-sensitive H. pylori. Dots above the threshold (set at 3500) in the amplitude plots in the right panel (probes detecting clarithromycin resistance) are positive for clarithromycin-resistant H. pylori. Dots below the thresholds in both the left and right panels are negative for H. pylori. Measured copies per μΙ (Ch2-Conc, Ch1- Conc.) and absolute number of positive (pos.) and negative (neg.) droplets are shown in the title of each plot.

[0012] FIG. 5 shows the fractional abundance of clarithromycin-resistant mutant H. pylori DNA detected by ddPCR for a range of clarithromycin-sensitive to clarithromycin-resistant mutant DNA ratios. H. py/or/^'-negative stool DNA was spiked with H. pylori genomic DNA of a clarithromycin-sensitive and an isogenic clarithromycin-resistant mutant at the ratios listed on the x-axis. Genome copy number of clarithromycin-sensitive and clarithromycin-resistant mutant H. pylori was quantified using the ddPCR™ assay. Bars indicate Poisson 95% confidence limits for duplicate wells.

[0013] FIG. 6. H. pylori 16S ddPCR amplitude plot for H. py/or/^'-negative stool DNA spiked with three different concentrations of H. pylori genomic DNA. Each dot represents one droplet. Dots above the threshold (set at 4500) are positive for the H. pylori 16S gene. Dots below the threshold are negative for the H. pylori 16S gene. Expected number of H. pylori genome copies per μΙ of ddPCR reaction and measured number of H. pylori 16S gene copies per μΙ of ddPCR reaction with Poisson 95% confidence intervals in parentheses is shown above the amplitude plot. Two 20 μΙ reactions were run for each sample and the results of each reaction were combined.

[0014] FIG. 7. Analysis of H. pylori load in the stool by quantification of H. pylori 16S gene copy number per μg stool DNA using ddPCR. A) Comparison of H. pylori 16S copy number of 50 Costa Rican stool samples for two separate ddPCR runs. A trend line was fitted to the data and the corresponding linear equation and correlation coefficient (R²) are indicated. B) Boxplots (box indicates 25^th-75^th percentile and median, whiskers indicate the minimum and maximum data points) of the H. pylori 16S copy number of 25 Costa Rican stool samples from H. py/on^'-positive volunteers with positive serum CagA antibody test and 12 Costa Rican stool samples from H. py/or/^'-positive volunteers with negative serum CagA antibody test. The H. pylori 16S copy number per μg stool DNA of CagA antibody-positive and CagA antibody-negative individuals was compared using the Wilcoxon rank-sum test (p=0.009).

[0015] FIG. 8. ddPCR amplitude plots for the cagA gene detection assay (probes: cagA_FAM) and the cagA EPIYA typing assay (probes: EPIYA-C_HEX and EPIYA-D_FAM). H. pylori genomic DNA was spiked in to H. py/or/^'-negative stool DNA. The H. pylori 16S copy number per μΙ ddPCR reaction is indicated in parentheses after the name of each spiked strain. On the left are the amplitude plots for a North American H. pylori strain, Em47-1 , which has a Western type cagA gene encoding an EPIYA-C motif. On the right are the amplitude plots for a Japanese H. pylori strain, Oki573, which has an East Asian cagA gene encoding an EPIYA-D motif. Each dot represents one droplet. Dots above the threshold (set at 6500 for the cagA gene detection assay and 2000 for the cagA EPIYA typing assay) are positive for the cagA gene. The scale of the y-axis differs between plots. Number of cagA gene copies per μΙ ddPCR reaction is indicated to the right of each amplitude plot. Absolute number of positive droplets (pos.) and absolute number of negative droplets (neg.) are shown in the title of each plot. Two 20 μΙ reactions were run for each sample and the results of each reaction were combined.

[0016] FIG. 9. Amplitude plots for the clarithromycin resistance assay. H. pylori genomic DNA of a clarithromycin-sensitive wild-type strain and three isogenic clarithromycin-resistant strains were spiked in to H. py/or/^'-negative stool DNA individually. Each dot represents one droplet. Dots above the threshold (set at 2000) in the amplitude plot in the upper panel (probe detecting wild-type) are positive for clarithromycin-sensitive H. pylori. Dots above the threshold (set at 4000) in the amplitude plot in the lower panel (probes detecting clarithromycin resistance mutations) are positive for clarithromycin-resistant H. pylori. Dots below the thresholds in both the upper and lower panels are negative for H. pylori. The spiked H. pylori genomic DNA for wells A01 through H01 are indicated in the legend on the right.

[0017] FIG. 10. Graph of the fractional abundance of clarithromycin-resistant mutant H. pylori DNA detected by ddPCR (solid symbols) and the expected fractional abundance (open symbols) for a range of wild-type to clarithromycin-resistant mutant DNA ratios. H. py/or/^'-negative stool DNA was spiked with H. pylori genomic DNA of a clarithromycin-sensitive wild-type strain and three isogenic clarithromycin-resistant mutants (square: A2143G mutation, circle: A2142G mutation, triangle: A2142C mutation) at the ratios listed on the x-axis. Expected fractional abundance was calculated based on the 23S copy number measured by ddPCR for each strain when spiked individually. Bars indicate Poisson 95% confidence limits for duplicate wells.

[0018] FIG. 1 1 provides additional sequences supporting the current disclosure.

DETAILED DESCRIPTION

[0019] Helicobacter pylori (H. pylori) infects the stomach of over half of the world's population and ~ 1/3 of the U.S. population. H. pylori is responsible for a range of disease outcomes from asymptomatic gastritis (inflammation of the stomach) to peptic ulcer and gastric cancers, but may be protective against other diseases including esophageal cancer and asthma. Both human and bacterial genetic variability appear to contribute to differences in disease outcome. H. pylori exhibits extensive inter-strain genetic diversity as well as intra-strain genetic diversification during the course of infection.

[0020] Methods for diagnosis of H. pylori currently available include both invasive and noninvasive tests. The invasive tests (pathological evaluation of biopsies obtained via endoscopy) offer high sensitivity and specificity as well as the option of genotyping the H. pylori strain by culturing from the biopsy. However, the procedures include risk of esophageal and/or gastric perforation and bleeding and risks from the medications used for patient sedation, as well as substantial costs from the endoscopic procedure and pathology review of the biopsy specimens. Non-invasive tests include the serology test, the urea breath test, and the stool antigen test. These tests have varying levels of sensitivity and specificity and do not allow for genotyping of H. pylori to assess antibiotic resistance, presence of virulence genes or alleles, or tracking of transmission within a population. PCR-based methods (either multiple rounds of conventional PCR or real-time PCR) for detecting H. pylori DNA in stool, some of which use sequencing of PCR product to genotype strains, have been reported with sensitivities for detection of H. pylori infection varying between 25% and 92% (Falsafi et al., World J. Gastroenterol., 15, 484-488 (2009); Hirai et al., J. Med. Micro., 58, 1 149-1 153 (2009); Puz et al., Gastroenterology 135, 1543-1551 (2008); Sicinschi et al., Helicobacter., 17, 96-106 (2012); Sicinschi et al. Helicobacter, 8, 601-607 (2003)).

[0021] PCR-based tests for detecting and genotyping H. pylori from stool have not been adopted for use in epidemiologic studies or diagnostics likely because of issues with sensitivity, reproducibility, and false positives from contamination.

[0022] A commercially-available stool-based real-time PCR test for clarithromycin resistance, the H. pylori ClariRes Assay from Ingenetix, is based on an assay developed by Schabereiter-Gurtner et al. {J. Clin. Micro., 42(10), 4512 (2004)). This test detects three major point mutations in the 23S gene that confer clarithromycin resistance using primers and one probe that matches the wild-type (clarithromycin-sensitive) nucleotide sequence. Clarithromycin resistance is detected by melting curve analysis. The presence of mixed infection (both clarithromycin-resistant and clarithromycin-sensitive H. pylori) results in two melting temperatures, but only detects clarithromycin resistance if the resistant H. pylori make up greater than 10% of the population. The sensitivity of this assay for stool samples is 73%.

[0023] Disclosed herein are non-invasive methods, kits, and compositions that use sample partition digital polymerase chain reaction (spdPCR) to detect and genotype H. pylori infection. The methods, kits, and compositions improve sensitivity over currently available tests and provide the added feature of quantification of H. pylori load as well as ratio of specific genotypes. The disclosed methods, kits, and compositions allow detection of the H. pylori 16S rRNA gene, detection of the H. pylori cagA virulence gene, genotyping of the cagA virulence gene, and detection of antibiotic resistance by detecting mutations in the 23S gene.

[0024] The disclosed methods, kits, and compositions provide spdPCR-based assays for amplifying, detecting, quantifying, and/or genotyping H. pylori from stool that are more sensitive and reproducible than current techniques that use multiple rounds of conventional PCR or realtime PCR. The disclosed methods, kits, and compositions also have the added benefits of absolute quantification of bacterial load as well as specific genotypes. In designing and optimizing these methods, kits, and compositions, at least two major hurdles to non-invasive detection and genotyping of H. pylori were overcome: the low abundance of H. pylori in stool and the nucleotide variability among H. pylori strains. As stated, and importantly, the described assays provide information on the load/density of H. pylori infection. The ability to obtain quantitative information on the number of genomes per sample and thus the number of bacteria of specific genotypes provides a significant advance over previously-available tests. [0025] The disclosed methods, kits, and compositions have both clinical and research applications. The H. pylori 16S assay can be used as a non-invasive test for H. pylori infection in a clinical setting and can also enable epidemiologic studies of H. pylori infection that were previously not feasible. The cagA detection and cagA EPIYA typing assays can be used for detection of H. pylori strains that increase a person's risk of gastric ailments associated with H. pylori infection, allowing for tailored monitoring and treatment strategies in populations that are screened for H. pylori. The antibiotic resistance assay can be used for detection of resistance in a clinical setting to inform treatment strategies as well as surveillance of antibiotic resistance in a population.

[0026] Samples of H. pylori include those deposited with the American Type Culture Collection (ATCC) as ATCC 43504; 43571 ; 43629; and 49053. Because H. pylori strains are highly diverse at a genetic level (Fujimoto et al., J. Clin. Microbiol, 32, 331-334 (1994)) and individuals can be infected with more than one strain, it is important to design probes and primers based upon conserved or consensus fragments found in various strains.

[0027] The term "probe" refers to single-stranded sequence-specific oligonucleotides which have a sequence that is complementary to a target oligonucleotide sequence (target) to be detected. The term complementary as used herein means that the sequence of the probe is exactly hybridizing to the sequence of the target.

[0028] In particular embodiments, because the current disclosure requires the detection of, in some instances, single base pair mismatches, very stringent conditions for hybridization can be required, allowing in principle only hybridization of exactly complementary sequences. Even in these embodiments, however, variations are possible in the length of the probes, and it should be noted that, because the central part of the probe is essential for its hybridization characteristics, possible deviations of the probe sequence versus the target sequence may be allowable towards the head and tail ends of the probe, when longer probe sequences are used. These variations, which may be conceived from ordinary knowledge in the art, can be evaluated experimentally, to confirm that they result in acceptably equivalent hybridization characteristics compared to exactly complementary probes. "Acceptably equivalent" means that no statistically significant difference in hybridization results.

[0029] Probes generally can be 5 to 50 nucleotides long and in more particular embodiments can be from 10 to 25 nucleotides or 15 to 20 nucleotides. Nucleotides include ribonucleotides, deoxyribonucleotides and modified nucleotides such as inosine or nucleotides containing modified groups which do not essentially alter their hybridization characteristics.

[0030] The term "primer" as used herein refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis when placed under conditions in which synthesis of a primer product which is complementary to a nucleic acid strand is induced, i.e., in the presence of four different nucleotide triphosphates with appropriate enzymes at a suitable temperature. Specific length and sequence will depend on the complexity of the required DNA or NA targets, as well as on the conditions of primer use such as temperature and ionic strength. In particular embodiments, a primer can be 5-50 nucleotides in length and in more particular embodiments can be from 10 to 25 nucleotides or 15 to 20 nucleotides. The fact that amplification primers do not have to match exactly with the corresponding template sequence to warrant proper amplification is amply documented in the literature. See, for example, Kwok et al., Nucleic Acids Res., 18(4), 999-1005 (1990).

[0031 ] The term "oligonucleotide" as used herein is defined as a molecule including two or more nucleotides. Olignonucleotides include probes and primers. Oligonucleotides used as probes or primers may also include nucleotide analogues such as phosphorothioates (Matsukura et al., Proc. Natl. Acad. Sci. USA, 84(21 ), 7706-10 (1987)), alkylphosphorothioates (Miller et al., Biochem. 18(23), 5134-43, (1979)), peptide nucleic acids (Nielsen et al., Science. 254(5037), 1497-500 (1991 ); Nielsen et al., Anticancer Drug Des. 8(1 ), 53-63 (1993)) or intercalating agents (Asseline et al., Proc. Natl. Acad. Sci. USA 81 (1 1 ), 3297-301 (1984)). The introduction of these modifications may be advantageous in order to positively influence characteristics such as hybridization kinetics, reversibility of the hybrid-formation, biological stability of the oligonucleotide molecules, etc.

[0032] Oligonucleotide sequences are represented throughout the disclosure as single stranded DNA oligonucleotides from the 5' to the 3' end. As is understood by one of ordinary skill in the art, each of these sequences also includes its complementary form, and RNA form (wherein T is replaced by U). Also disclosed are sequences having 90% sequence identity to the oligonucleotides disclosed herein; 91 % sequence identity to the oligonucleotides disclosed herein; 92% sequence identity to the oligonucleotides disclosed herein; 93% sequence identity to the oligonucleotides disclosed herein; 94% sequence identity to the oligonucleotides disclosed herein; 95% sequence identity to the oligonucleotides disclosed herein; 96% sequence identity to the oligonucleotides disclosed herein; 97% sequence identity to the oligonucleotides disclosed herein; 98% sequence identity to the oligonucleotides disclosed herein; or 99% sequence identity to the oligonucleotides disclosed herein.

[0033] "% sequence identity" refers to a relationship between two or more sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between oligonucleotide sequences as determined by the match between strings of such sequences. "Identity" (often referred to as "similarity") can be readily calculated by known methods, including those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, NY (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, NY (1994); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, NJ (1994); Sequence Analysis in Molecular Biology (Von Heijne, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Oxford University Press, NY (1992). Preferred methods to determine sequence identity are designed to give the best match between the sequences tested. Methods to determine sequence identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR, Inc., Madison, Wisconsin). Multiple alignment of the sequences can also be performed using the Clustal method of alignment (Higgins and Sharp CABIOS, 5, 151-153 (1989) with default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Relevant programs also include the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wisconsin); BLASTP, BLASTN, BLASTX (Altschul, et al., J. Mol. Biol. 215, 403-410 (1990); DNASTAR (DNASTAR, Inc., Madison, Wisconsin); and the FASTA program incorporating the Smith-Waterman algorithm (Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 11 1-20. Editor(s): Suhai, Sandor. Publisher: Plenum, New York, N.Y.). Within the context of this disclosure it will be understood that where sequence analysis software is used for analysis, the results of the analysis are based on the "default values" of the program referenced. "Default values" mean any set of values or parameters which originally load with the software when first initialized.

[0034] Also included within the disclosure are sequences that hybridize to disclosed sequences under high stringency conditions. High stringency conditions include, for example, 2 h to 4 days incubation at 42°C using a DIG-labeled DNA probe (prepared by, e.g., using a DIG labeling system; Roche Diagnostics GmbH, 68298 Mannheim, Germany) in a solution such as DigEasyHyb solution (Roche Diagnostics GmbH) or a solution comprising 50% formamide, 5XSSC (150 mM NaCI, 15 mM trisodium citrate), 0.02% sodium dodecyl sulfate, 0.1% N- lauroylsarcosine, and 2% blocking reagent (Roche Diagnostics GmbH), followed by washing the filters twice for 5 to 15 minutes in 2XSSC and 0.1% SDS at room temperature and then washing twice for 15-30 minutes in 0.5XSSC and 0.1 % SDS or O.IXSSC and 0.1 % SDS at 65-68°C.

[0035] Oligonucleotides can be prepared by any appropriate technique including the cloning of recombinant plasmids containing inserts including the corresponding nucleotide sequences, if need be by cleaving the latter out from the cloned plasmids upon using the adequate nucleases and recovering them, e.g. by fractionation according to molecular weight. The oligonucleotides can also be synthesized chemically, for instance by the conventional phospho-triester method. [0036] H. Pylori Genes. A "gene" refers to an oligonucleotide sequence that encodes an H. pylori protein or a non-coding RNA that can have a variety of functions, e.g. tRNA, rRNA, asRNA. As is understood by one of ordinary skill in the art, this definition includes various sequence polymorphisms, mutations, and/or sequence variants. In particular embodiments, the sequence polymorphisms, mutations, and/or sequence variants do not affect the function of the encoded product. The term "gene" may include not only coding sequences but also regulatory regions such as promoters, enhancers, and termination regions. The term further can include all introns and other DNA sequences spliced from the mRNA transcript, along with variants resulting from alternative splice sites. Nucleic acid sequences encoding the H. pylori protein can be DNA or RNA that directs the expression of the H. pylori protein or RNA. These nucleic acid sequences may be a DNA strand sequence that is transcribed into RNA or an RNA sequence that is translated into protein. The nucleic acid sequences include both the full-length nucleic acid sequences as well as non-full-length sequences derived from the full-length protein or RNA. The sequences can also include degenerate codons of the native sequence or sequences that may be introduced to provide codon preference. In addition to particular sequences provided, gene sequences to encode H. pylori proteins and RNA described herein are available in publicly available databases and publications, incorporated by reference herein.

[0037] The 16S rRNA gene. The 16S rDNA gene is a section of prokaryotic DNA found in all bacteria. It is highly conserved between different species but also contains hypervariable regions useful for bacterial identification. The gene codes for rRNA that is part of the ribosome, which itself is composed of two subunits, the large and small subunits (LSU and SSU respectively). In most bacteria the 16S rRNA gene encodes the SSU while the 23S rRNA gene encodes the LSU.

[0038] Sequence information regarding the H. pylori 16S rRNA gene can be found at, for example, GenBank Accession Nos. HM046432.1 ; HM046431 .1 ; M86748.1 ; M55309.1 ; M55307.1 ; M55306.1 ; and M55305.1.

[0039] cagA Virulence gene - Detection and Genotyping. The cagA gene of H. pylori is the gene expressing cytotoxic-associated protein A. The length of the cagA gene coding sequence available in GenBank varies for the different strains of H. pylori, but is 820 base pairs on average, primarily starting from the 3' end of the coding sequence. About 60% of H. pylori strains possess the cagA gene.

[0040] Based on immunoblot studies, it has been demonstrated that persons infected with cagA (+)-strains have higher degrees of gastric inflammation and epithelial cell damage in comparison to infections with cag>A(-)-strains. Also, enhanced expression of a number of cytokines has been found with cag/A(+)-strain infections in comparison to cag>4(-)-strain infections (Huang et al., Infect Immun. 63(5), 1732-8 (1995)). As both the intensity of the inflammation and the degree of epithelial damage may be associated with the pathogenesis of gastric cancer, the examination of the presence or absence of the cagA gene upon H. pylori infection is important.

[0041] The cagA gene can also be grouped into the Western allele type and the East Asian allele type based on the EPIYA amino acid motif at the C-terminus of the protein. Western cagA alleles encode an EPIYA-C motif while East Asian cagA alleles encode an EPIYA-D motif. Strains having the East Asian cagA allele type are associated with increased risk for stomach cancer development.

[0042] Based on the foregoing, cagA presence and type is important in ability to classify a subject as at-risk for developing gastric ailments associated with H. pylori infection. These gastric ailments include chronic active gastritis, gastric and duodenal ulcers, gastric adenocarcinomas, mucosa-associated lymphoid tissue lymphomas, asymptomatic gastritis, peptic ulcers and other gastric cancers.

[0043] Genbank accession numbers of the cagA coding sequences of H. pylori isolates include: AB057096, AF222808, AB057098, AY330639, AB090088, AY330637, AF247651 , AB057095, AB057072, AB057090, AB057094, AB057060, AB057070, AB057078, AB057065, AB057084, AB057075, AY330644, AB057064, AF222809, AF289439, AF289442, AF289460, AF479032, AB057074, AB057088, AB190940, AF289433, AF289433, AF289462, AF289462, AB090143, AF289457, AF289450, AF083352, AB057068, AB057085, AB057061 , AF289444, AB057086, AB190956, AB190948, AB190942, AF289447, AF289447, DQ011620, AF289443, AF222807, AF289436, AB190941 , AF289463, AB190951 , AB090147, AB190950, AB057073, AF289458, AF289458, AF289448, AF289448, AB190953, AY330642, AY330642, AB090146, AF289461 , AF289461 , AF289440, AF289440, AB057089, AB057099, AF427099, AB057093, AF289452, AF289445, AF289445, AF289455, AF289455, AF289453, AF289453, DQ067454, AF282853, U60176, AF202973, AB015413, AB015416, AF001357, AB003397, AB057003, AB090090, AF289446, AB190947, AB090086, AF289434, AF289438, AF289451 , AB1 10963, AB057071 , AB015415, AB190949, AB090151 , and AB057069.

[0044] Antibiotic Resistance. In particular embodiments, the methods, kits, and compositions are used to determine subjects who are likely to be resistant to treatment with antibiotics. Exemplary antibiotics include Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Loracarbef, Ertapenem, Imipenem, Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cephalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefsulodine, Cefepime, Teicoplanin, Vancomycin, Azithromycin, Clarithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Aztreonam, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin, Piperacillin, Ticarcillin, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Norfloxacin, Ofloxacin, Trovafloxacin, Mafenide, Prontosil, Sulfacetamide, Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim, Trimethoprim sulfa, Sulfamethoxazole, Co- trimoxazole, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Chloramphenicol, Clindamycin, Ethambutol, Fosfomycin, Furazolidone, Isoniazid, Linezolid, Metronidazole, Mupirocin, Nitrofurantoin, Platensimycin, Pyrazinamide, Quinupristin/Dalfopristin, Rifampin, Spectinomycin, Amphotericin B, Flucanazole, Fluoropyrimidins, Gentamycin, Methicillin, Oxacillin and clavulanic acid.

[0045] Antibiotic resistance is assessed by detecting mutations within the H. pylori 23S gene. As previously stated, the H. pylori 23S gene encodes the ribosomal LSU.

[0046] The following Table 1 provides a compilation of antibiotic resistance due to mutations on the H. pylori 23S rRNA gene.

Table 1. Compilation of Antibiotic Resistance due to Mutations on the H. pylori 23S rRNA Gene.

A = adenine; G = guanine; C= cytosine; U = uracil; R = resistant; Cla = clarithromycin; Azm = azithromycin; Ery = erythromycin; Mac = macrolides; Lin = lincosamides; MLSB = macrolides, lincosamides and streptogramine B.

[0047] Positions in the 23S gene are defined according to the description of relevant H. pylori sequences as described and referenced in Megraud, Drug Resistance Updates, 4, 178-186 (2001 ).

[0048] Sample Partition Digital PCR (spdPCR). Conventional PCR theoretically results in an exponential amplification of a nucleic acid sequence (e.g. template or target nucleic acid) from a sample. By measuring the number of amplification cycles required to achieve a threshold level of amplification (as in real-time PCR), the starting concentration of nucleic acid can be calculated. However, there are many factors that affect the exponential amplification of the PCR process, such as varying amplification efficiencies, low copy numbers of starting nucleic acid, and competition with background contaminant nucleic acid.

[0049] spdPCR is generally insensitive to these factors because it does not rely on the assumption that the PCR process is exponential. In spdPCR, individual nucleic acid molecules are separated from the initial sample into partitions, and then amplified to detectable levels. Each partition then provides digital information on the presence or absence of each individual nucleic acid target molecule within each partition. When enough partitions are measured using this technique, the digital information can be consolidated to make a statistically relevant measure of starting concentration for the nucleic acid target in the sample. In embodiments in which multiple target nucleic acids are analyzed, sample partition digital PCR provides statistically relevant measures of the absolute and relative concentrations or ratios of multiple target nucleic acids. A comparison of results between conventional PCR and spdPCR is provided in Table 3.

[0050] Particular embodiments can also use qualitative spdPCR. Qualitative spdPCR-based analyses determine whether or not a target is present in a partitioned sample, generally without any substantial quantification of target. spdPCR that is qualitative can be performed by determining whether a partitioned sample is positive for the presence of target(s). In some embodiments, qualitative spdPCR is used to determine the percentage of partitioned samples in a packet that are positive for the presence of target(s). Qualitative spdPCR can be used to determine whether a packet of partitioned samples contains at least a threshold percentage of positive samples.

[0051] In particular embodiments, spdPCR includes Droplet Digital™ PCR (ddPCR™) (Bio- Rad Laboratories, Hercules, CA). ddPCR technology uses a combination of microfluidics and surfactant chemistry to divide PCR samples into water-in-oil droplets. Hindson et al., Anal. Chem. 83(22): 8604-8610 (2011 ). The droplets support PCR amplification of the target template molecules they contain and use reagents and workflows similar to those used for most standard Taqman probe-based assays.

[0052] Following PCR, each droplet is analyzed or read in a flow cytometer to determine the fraction of PCR-positive droplets in the original sample. These data are then analyzed using Poisson statistics to determine the target concentration in the original sample. See Bio-Rad Droplet Digital™ (ddPCR™) PCR Technology.

[0053] While ddPCR™ is a preferred spdPCR approach, other sample partition PCR methods based on the same underlying principles may also be used. These approaches are now described more generally.

[0054] Sample Partitioning. Numerous methods can be used to divide samples into discrete partitions (e.g., droplets). Exemplary partitioning methods and systems include use of one or more of emulsification, droplet actuation, microfluidics platforms, continuous-flow microfluidics, reagent immobilization, and combinations thereof. In some embodiments, partitioning is performed to divide a sample into a sufficient number of partitions such that each partition contains one or zero nucleic acid molecules. In some embodiments, the number and size of partitions is based on the concentration and volume of the bulk sample.

[0055] Methods and devices for partitioning a bulk volume into partitions by emulsification are described in Nakano et al. J. Biotechnol. 102, 117-124 (2003) and Margulies et al. Nature 437, 376-380 (2005). Systems and methods to generate "water-in -oil" droplets are described in U.S. Publication No. 2010/0173394. Microfluidics systems and methods to divide a bulk volume into partitions are described in U.S. Publication Nos. 2010/0236929; 2010/0311599; and 2010/0163412, and U.S. Patent No. 7,851 ,184. Microfluidic systems and methods that generate monodisperse droplets are described in Kiss et al. Anal. Chem. 80(23), 8975-8981 (2008). Further microfluidics systems and methods for manipulating and/or partitioning samples using channels, valves, pumps, etc. are described in U.S. Patent No. 7,842,248. Continuous-flow microfluidics systems and methods are described in Kopp et al., Science, 280, 1046-1048 (1998).

[0056] Partitioning methods can be augmented with droplet manipulation techniques, including electrical (e.g., electrostatic actuation, dielectrophoresis), magnetic, thermal (e.g., thermal Marangoni effects, thermocapillary), mechanical (e.g., surface acoustic waves, micropumping, peristaltic), optical (e.g., opto-electrowetting, optical tweezers), and chemical means (e.g., chemical gradients). In some embodiments, a droplet microactuator is supplemented with a microfluidics platform (e.g. continuous flow components).

[0057] Some embodiments use a droplet microactuator. A droplet microactuator can be capable of effecting droplet manipulation and/or operations, such as dispensing, splitting, transporting, merging, mixing, agitating, and the like. Droplet operation structures and manipulation techniques are described in U.S. Publication Nos. 2006/0194331 and 2006/0254933 and U.S. Patent Nos. 6,91 1 ,132; 6,773,566; and 6,565,727.

[0058] Amplification. The partitioned nucleic acids of a sample can be amplified by any suitable PCR methodology that can be practiced within spdPCR. Exemplary PCR types include allele-specific PCR, assembly PCR, asymmetric PCR, endpoint PCR, hot-start PCR, in situ PCR, intersequence-specific PCR, inverse PCR, linear after exponential PCR, ligation-mediated PCR, methylation-specific PCR, miniprimer PCR, multiplex ligation-dependent probe amplification, multiplex PCR, nested PCR, overlap-extension PCR, polymerase cycling assembly, qualitative PCR, quantitative PCR, real-time PCR, single-cell PCR, solid-phase PCR, thermal asymmetric interlaced PCR, touchdown PCR, universal fast walking PCR, etc. Ligase chain reaction (LCR) may also be used.

[0059] PCR may be performed with a thermostable polymerase, such as Taq DNA polymerase (e.g., wild-type enzyme, a Stoffel fragment, FastStart polymerase, etc.), Pfu DNA polymerase, S-Tbr polymerase, Tth polymerase, Vent polymerase, or a combination thereof, among others.

[0060] PCR and LCR are driven by thermal cycling. Alternative amplification reactions, which may be performed isothermally, can also be used. Exemplary isothermal techniques include branched-probe DNA assays, cascade-RCA, helicase-dependent amplification, loop-mediated isothermal amplification (LAMP), nucleic acid based amplification (NASBA), nicking enzyme amplification reaction (NEAR), PAN-AC, Q-beta replicase amplification, rolling circle replication (RCA), self-sustaining sequence replication, strand-displacement amplification, etc.

[0061] Amplification may be performed with any suitable reagents (e.g. template nucleic acid (e.g. DNA or RNA)), primers, probes, buffers, replication catalyzing enzymes (e.g. DNA polymerase, RNA polymerase), nucleotides, salts (e.g. MgC ), etc. In some embodiments, an amplification mixture includes any combination of at least one primer or primer pair, at least one probe, at least one replication enzyme (e.g., at least one polymerase), and deoxynucleotide (and/or nucleotide) triphosphates (dNTPs and/or NTPs), etc.

[0062] Amplification reagents can be added to a sample prior to partitioning, concurrently with partitioning and/or after partitioning has occurred. In some embodiments, all partitions are subjected to amplification conditions (e.g. reagents and thermal cycling), but amplification only occurs in partitions containing target nucleic acids (e.g. nucleic acids containing sequences complementary to primers added to the sample). The template nucleic acid can be the limiting reagent in a partitioned amplification reaction. In some embodiments, a partition contains one or zero target (e.g. template) nucleic acid molecules.

[0063] In some embodiments, nucleic acid targets, primers, and/or probes are immobilized to a surface, for example, a substrate, plate, array, bead, particle, etc. Immobilization of one or more reagents provides (or assists in) one or more of: partitioning of reagents (e.g. target nucleic acids, primers, probes, etc.), controlling the number of reagents per partition, and/or controlling the ratio of one reagent to another in each partition. In some embodiments, assay reagents and/or target nucleic acids are immobilized to a surface while retaining the capability to interact and/or react with other reagents (e.g. reagent dispensed from a microfluidic platform, a droplet microactuator, etc.). In some embodiments, reagents are immobilized on a substrate and droplets or partitioned reagents are brought into contact with the immobilized reagents. Techniques for immobilization of nucleic acids and other reagents to surfaces are well understood by those of ordinary in the art. See, for example, U.S. Patent No. 5,472,881 and Taira et al. Biotechnol. Bioeng. 89(7), 835-8 (2005).

[0064] Target Sequence Detection. Detection methods can be utilized to identify sample partitions containing amplified target(s). Detection can be based on one or more characteristics of a sample partition such as a physical, chemical, luminescent, or electrical aspects, which correlate with amplification.

[0065] In particular embodiments, fluorescence detection methods are used to detect amplified target(s), and/or identification of sample partitions containing amplified target(s). Exemplary fluorescent detection reagents include TaqMan probes, SYBR Green fluorescent probes, molecular beacon probes, scorpion probes, and/or LightUp probes^® (LightUp Technologies AB, Huddinge, Sweden). Additional detection reagents and methods are described in, for example, U.S. Patent Nos. 5,945,283; 5,210,015; 5,538,848; and 5,863,736; PCT Publication WO 97/22719; and publications: Gibson et al., Genome Research, 6, 995-1001 (1996); Heid et al., Genome Research, 6, 986-994 (1996); Holland et al., Proc. Natl. Acad. Sci. USA 88, 7276-7280, (1991 ); Livak et al., Genome Research, 4, 357-362 (1995); Piatek et al., Nat. Biotechnol. 16, 359-63 (1998); Neri et al., Advances in Nucleic Acid and Protein Analysis, 3826, 17-125 (2000); Compton, Nature 350, 91-92 (1991 ); Thelwell et al., Nucleic Acids Research, 28, 3752-3761 (2000); Tyagi and Kramer, Nat. Biotechnol. 14, 303-308 (1996); Tyagi et al., Nat. Biotechnol. 16, 49-53 (1998); and Sohn et al., Proc. Natl. Acad. Sci. U.S.A. 97, 0687-10690 (2000).

[0066] In some embodiments, detection reagents are included with amplification reagents added to the bulk or partitioned sample. In some embodiments, amplification reagents also serve as detection reagents. In some embodiments, detection reagents are added to partitions following amplification. In some embodiments, measurements of the absolute copy number and the relative proportion of target nucleic acids in a sample (e.g. relative to other targets nucleic acids, relative to non-target nucleic acids, relative to total nucleic acids, etc.) can be measured based on the detection of sample partitions containing amplified targets.

[0067] In some embodiments, following amplification, sample partitions containing amplified target(s) are sorted from sample partitions not containing amplified targets or from sample partitions containing other amplified target(s). In some embodiments, sample partitions are sorted following amplification based on physical, chemical, and/or optical characteristics of the sample partition, the nucleic acids therein (e.g. concentration), and/or status of detection reagents. In some embodiments, individual sample partitions are isolated for subsequent manipulation, processing, and/or analysis of the amplified target(s) therein. In some embodiments, sample partitions containing similar characteristics (e.g. same fluorescent labels, similar nucleic acid concentrations, etc.) are grouped (e.g. into packets) for subsequent manipulation, processing, and/or analysis.

[0068] Classifying a subject as at risk for developing a gastric ailment associated with H. pylori infection and/or as having an antibiotic resistant or susceptible form of H. pylori infection can be based on comparing spdPCR results to a reference level. Reference levels can include "normal" or "control" levels or values, defined according to, e.g., discrimination limits or risk defining thresholds, in order to define cut-off points and/or abnormal values for H. pylori load or type. The reference level can be a level of an indicia typically found in a subject who is not suffering from H. pylori infection. Other terms for "reference levels" include "index," "baseline," "standard," "healthy," "pre-infection," etc. Such normal levels can vary, based on whether an indicia is used alone or in a formula combined with other indicia to output a score. Alternatively, the reference level can be derived from a database of scores from previously tested subjects who did not develop H. pylori infection, an associated gastric ailment or antibiotic resistance over a clinically relevant time period. Reference levels can also be derived from, e.g., a control subject or population whose H. pylori status is known. In some embodiments, the reference level can be derived from one or more subjects who have been exposed to treatment for H. pylori, or from subjects who have shown improvements in H. pylori load following exposure to treatment. In some embodiments the reference level can be derived from one or more subjects with H. pylori infection who have not been exposed to treatment. A reference level can also be derived from H. pylori infection, associated gastric ailment risk and/or antibiotic resistance risk algorithms or computed indices from population studies.

[0069] In particular embodiments, a "reference level" can refer to a standardized value for H. pylori infection, gastric ailment risk or antibiotic resistance which represents a level not associated with H. pylori infection, not associated with gastric ailment risk and/or not associated with antibiotic resistance; a level associated with a particular type of H. pylori infection, associated gastric ailment risk and/or antibiotic resistance; a level associated with a severity of H. pylori infection, associated gastric ailment risk and/or antibiotic resistance; or a level associated with a particular subject at the time of diagnosis, at the beginning of a treatment, or at a time point during a treatment. The reference level can be an intra-assay reference level, an inter-assay reference level, a universal reference level which is useful across a variety of testing locations or can be a reference level specific for a testing location and specific assay used to measure H. pylori infection, associated gastric ailment risk and/or antibiotic resistance. In certain embodiments, the reference level, is derived from (i) an individual who does not have H. pylori infection, an associated gastric ailment risk and/or antibiotic resistance; or (ii) a group of individuals who do not have H. pylori infection, an associated gastric ailment risk and/or antibiotic resistance. Reference levels for a subject can also be related to time points of the subject undergoing treatments to monitor the natural progression or regression of H. pylori infection, associated gastric ailment risk and/or antibiotic resistance in the subject. [0070] In particular embodiments, reference levels can be derived from a "dataset". A dataset represents a set of numerical values resulting from evaluation of a sample (or population of samples) under a desired condition. The values of the dataset can be obtained, for example, by experimentally obtaining measures from a sample and constructing a dataset from these measurements; or alternatively, by obtaining a dataset from a service provider such as a laboratory, or from a database or a server on which the dataset has been stored.

[0071 ] Subjects include humans, veterinary animals (dogs, cats, reptiles, birds, etc.), livestock (horses, cattle, goats, pigs, chickens, etc.), and research animals (monkeys, rats, mice, fish, etc.).

[0072] A subject is classified as having an H. pylori infection if H. pylori whole organisms, H. pylori genes, H. pylori proteins, H. pylori protein activity (urease activity) or human antibodies specific for H. pylori proteins or lipids are detected in the subject's tissues (tissue biopsies, blood, stool, saliva, etc.). A subject is classified as at increased risk of developing a gastric ailment associated with H. pylori infection if H. pylori infection is detected and risk may be increased if specific virulence associated genes (e.g. cagA) and/or alleles of genes (e.g. cagA EPIYA-D) are detected. If the subject is classified as having an increased risk for developing a gastric ailment associated with H. pylori infection, the subject can be directed to undergo monitoring for the development of the gastric ailment. Alternatively or additionally, the subject may be directed to start a prophylactic treatment course before development of the gastric ailment occurs. A "prophylactic treatment course" includes a treatment administered to a subject who does not display signs or symptoms of a gastric ailment associated with H. pylori infection or displays only early signs or symptoms of a gastric ailment associated with H. pylori infection such that treatment is administered for the purpose of diminishing, preventing, or decreasing the risk of developing the gastric ailment further. Thus, a prophylactic treatment functions as a preventative treatment against development of a gastric ailment associated with H. pylori infection. Potential prophylactic treatments against these gastric ailments include antibiotics, and, when available, H. pylori vaccines or pro-biotic treatments.

[0073] In particular embodiments, subjects are classified as at-risk for developing gastric ailments associated with H. pylori because of presence of a cagA positive strain of H. pylori. In additional embodiments, subjects are classified as having a higher risk for developing the gastric ailments if the cagA allele is the East Asian cagA allele. The presence of this allele can classify a subject as at-risk for developing stomach cancer specifically.

[0074] The methods, kits and compositions disclosed herein also can direct therapeutic treatments against H. pylori. A "therapeutic treatment" includes a treatment administered to a subject who displays symptoms or signs of H. pylori infection and is administered to the subject for the purpose of reducing, and optimally eradicating, H. pylori infection.

[0075] If the subject is classified as having an antibiotic resistant strain of H. pylori, the subject can be given a different therapeutic treatment, such as a different antibiotic. For example, if the subject is classified as having a clarithromycin resistant strain of H. pylori, in some instances the subject can be treated with azithromycin or erythromycin. If the subject is classified as having an azithromycin resistant strain of H. pylori, in some instances the subject can be treated with clarithromycin or erythromycin. If the subject is classified as having an erythromycin resistant strain of H. pylori, in some instances the subject can be treated with clarithromycin or azithromycin, etc.

[0076] The methods, kits and compositions disclosed herein provide spdPCR assays with increased sensitivity over previously used approaches. The sensitivity of these assays run using the disclosed methods, kits and compositions can have at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91 % sensitivity; at least 92% sensitivity; at least 93% sensitivity; at least 94% sensitivity; at least 95% sensitivity; at least 96% sensitivity; at least 97% sensitivity; at least 99% sensitivity or 100% sensitivity. Sensitivity of the assays is measured by ability to detect the presence or absence of a particular H. pylori gene within a number of samples, wherein a known number of the samples are spiked with particular H. pylori genes. When the assays assess presence of more than one H. pylori gene, the sensitivity for each assayed target can be at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91 % sensitivity; at least 92% sensitivity; at least 93% sensitivity; at least 94% sensitivity; at least 95% sensitivity; at least 96% sensitivity; at least 97% sensitivity; at least 99% sensitivity or 100% sensitivity. In particular embodiments, sensitivity to detect the 16S gene of H. pylori, cagA presence and EPIYA allele, and an antibiotic resistant or susceptible strain of H. pylori is at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91 % sensitivity; at least 92% sensitivity; at least 93% sensitivity; at least 94% sensitivity; at least 95% sensitivity; at least 96% sensitivity; at least 97% sensitivity; at least 99% sensitivity or 100% sensitivity for all four measures.

[0077] In particular embodiments, kits disclosed herein include primers, probes, and a subset of amplification and detection reagents disclosed herein. The primers and probes can include various combinations of any one of SEQ ID NO: 1 ; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 1 1 ; SEQ ID NO: 12; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; SEQ ID NO: 20; SEQ ID NO: 21 ; SEQ ID NO: 22; SEQ ID NO: 23; SEQ ID NO: 24; and/or SEQ ID NO: 25 . In a particular embodiment, the kits include one or more of the following grouped combinations: SEQ ID NO: 1 ; SEQ ID NO: 20; and SEQ ID NO: 21 ; (ii) SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; and SEQ ID NO: 7; (iii) SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11 ; SEQ ID NO: 12; and SEQ ID NO: 13; and/or (iv) SEQ ID NO: 23; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 25; SEQ ID NO: 18; and/or SEQ ID NO: 19. In a particular embodiment, the kits include one or more of the following grouped combinations: SEQ ID NO: 1 ; and SEQ ID NO: 20; (ii) SEQ ID NO: 4; and SEQ ID NO: 5 (iii) SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; and SEQ ID NO: 1 1 ; and/or (iv) SEQ ID NO: 23 and SEQ ID NO: 15. In a particular embodiment, the kits include one or more of the following grouped combinations: SEQ ID NO: 21 ; (ii) SEQ ID NO: 6; and SEQ ID NO: 7 (iii) SEQ ID NO: 12; and SEQ ID NO: 13; and/or (iv) SEQ ID NO: 16; SEQ ID NO: 25; SEQ ID NO: 18; and SEQ ID NO: 19.

[0078] In various embodiments, the kits may include instructions for using the kit in the methods disclosed herein. In various embodiments, the kit may include instructions regarding preparation of the primers and/or probes, use of the primers and/or probes, proper disposal of the related waste, and the like. The instructions can be in the form of printed instructions provided inside a carton containing the kit. The instructions can also be printed on the carton and/or on other portions of the kit. Instructions may be in the form of a sheet, pamphlet, brochure, CD-Rom, or computer-readable device, or can provide directions to instructions at a remote location, such as a website. The instructions may be in English and/or in any national or regional language.

[0079] In various embodiments, the kits described herein include some or all of the necessary supplies needed to use the kit, thereby eliminating the need to locate and gather such supplies. The supplies can include pipettes, pipette tips, buffers, reagents, plates, films, tubes, thermocyclers, tube racks, gloves, sterilizing liquids, and the like. Variations in contents of any of the kits described herein can be made.

[0080] The primers, probes, amplification reagents, detection reagents and instructions may provide kits that provide assays with sensitivities of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91 % sensitivity; at least 92% sensitivity; at least 93%; at least 94%; at least 95%; at least 96%; at least 97%; at least 98%; at least 99%; or 100%.

[0081] The Exemplary Embodiments and Examples below are included to demonstrate particular embodiments of the disclosure. Those of ordinary skill in the art should recognize in light of the present disclosure that many changes can be made to the specific embodiments disclosed herein and still obtain a like or similar result without departing from the spirit and scope of the disclosure.

[0082] Exemplary Embodiments:

1. A method to assess: (a) H. pylori infection, (b) H. pylori virulence, (c) risk of gastric ailments associated with H. pylori infection and (d) H. pylori clarithromycin susceptibility or resistance in a subject including: analyzing a stool sample obtained from the subject for: the 16S H. pylori gene to assess presence or absence of H. pylori infection; analyzing the cagA H. pylori gene to asses H. pylori virulence; analyzing the cagA EPIYA gene allele to assess risk of gastric ailments associated with H. pylori infection; and analyzing H. pylori 23S gene sequences to assess H. pylori clarithromycin susceptibility or resistance wherein the analyzing is performed using sample partition digital polymerase chain reaction (spdPCR) and wherein presence of the 16S gene in the sample confirms H. pylori infection in the subject; presence of the cagA gene confirms infection with a virulent H. pylori strain in the subject; presence of the East Asian cagA EPIYA allele confirms increased risk of gastric ailments associated with H. pylori infection in the subject and presence of a mutated 23S gene confirms presence of a clarithromycin resistant H. pylori infection in the subject.

2. A method of embodiment 1 wherein the analyzing includes amplifying the 16S H. pylori gene with SEQ ID NO: 1 and SEQ ID NO: 20.

3. A method of embodiments 1 or 2 wherein the analyzing includes detecting the 16S H. pylori gene with SEQ ID NO: 21.

4. A method of any one of embodiments 1-3 wherein the analyzing includes amplifying the cagA H. pylori gene with SEQ ID NO: 4 and SEQ ID NO: 5.

5. A method of any one of embodiments 1-4 wherein the analyzing includes detecting the cagA H. pylori gene with SEQ ID NO: 6 and SEQ ID NO: 7.

6. A method of any one of embodiments 1-5 wherein the analyzing includes amplifying the cagA EPIYA gene allele with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11.

7. A method of any one of embodiments 1-6 wherein the analyzing includes detecting the cagA EPIYA gene allele with SEQ ID NO: 12 and SEQ ID NO: 13.

8. A method of any one of embodiments 1-7 wherein the analyzing includes amplifying the 23S gene sequences with SEQ ID NO: 23 and SEQ ID NO: 15.

9. A method of any one of embodiments 1-8 wherein the analyzing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

10. A method of any one of embodiments 1-9 wherein the analyzing of each assayed gene, gene allele or gene sequence occurs with a sensitivity of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91 % sensitivity; at least 92% sensitivity; or at least 93%.

1 1. A method of any one of embodiments 1-10 wherein the analyzing of at least one assayed gene, gene allele or gene sequence occurs with a sensitivity of at least 95%, at least 99% or 100%.

12. A method of any one of embodiments 1-11 wherein the gastric ailment is one or more of gastric ulcers and/or gastric cancers.

13. A method of any one of embodiments 1-12 wherein the gastric ailment is stomach cancer.

14. A method of any one of embodiments 1 -13 wherein the 23S gene mutation is a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

15. A method to assess: (a) H. pylori infection, (b) H. pylori virulence, (c) risk of gastric ailments associated with H. pylori infection and/or (d) H. pylori clarithromycin susceptibility or resistance in a subject including: analyzing a stool sample obtained from the subject for: the 16S H. pylori gene to assess presence or absence of H. pylori infection; the cagA H. pylori gene to asses H. pylori virulence; the cagA EPIYA gene allele to assess risk of gastric ailments associated with H. pylori infection; and/or the H. pylori 23S gene sequence to assess H. pylori clarithromycin susceptibility or resistance wherein the analyzing is performed using sample partition digital polymerase chain reaction (spdPCR) and wherein presence of the 16S gene in the sample confirms H. pylori infection in the subject; presence of the cagA gene confirms infection with a virulent H. pylori strain in the subject; presence of the East Asian cagA EPIYA allele confirms increased risk of gastric ailments associated with H. pylori infection in the subject and/or presence of a mutated 23S gene confirms presence of a clarithromycin resistant H. pylori infection in the subject.

16. A method of embodiment 15 wherein the analyzing includes amplifying the 16S H. pylori gene with SEQ ID NO: 1 and SEQ ID NO: 20.

17. A method of embodiments 15 or 16 wherein the analyzing includes detecting the 16S H. pylori gene with SEQ ID NO: 21.

18. A method of any one of embodiments 15-17 wherein the analyzing includes amplifying the cagA H. pylori gene with SEQ ID NO: 4 and SEQ ID NO: 5.

19. A method of any one of embodiments 15-18 wherein the analyzing includes detecting the cagA H. pylori gene with SEQ ID NO: 6 and SEQ ID NO: 7.

20. A method of any one of embodiments 15-19 wherein the analyzing includes amplifying the cagA EPIYA gene allele with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11. 21. A method of any one of embodiments 15-20 wherein the analyzing includes detecting the cagA EPIYA gene allele with SEQ ID NO: 12 and SEQ ID NO: 13.

22. A method of any one of embodiments 15-21 wherein the analyzing includes amplifying the 23S gene sequences with SEQ ID NO: 23 and SEQ ID NO: 15.

23. A method of any one of embodiments 15-22 wherein the analyzing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

24. A method of any one of embodiments 15-23 wherein the analyzing of each assayed gene, gene allele or gene sequence occurs with a sensitivity of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91 % sensitivity; at least 92% sensitivity; or at least 93%.

25. A method of any one of embodiments 15-24 wherein the analyzing of at least one assayed gene, gene allele or gene sequence occurs with a sensitivity of at least 95%, at least 99% or 100%.

26. A method of any one of embodiments 15-25 wherein the gastric ailment is one or more of gastric ulcers and/or gastric cancers.

27. A method of any one of embodiments 15-26 wherein the gastric ailment is stomach cancer.

28. A method of any one of embodiments 15-27 wherein the 23S gene mutation is a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

29. A method to detect (a) risk of gastric ailments associated with H. pylori infection and (b) H. pylori clarithromycin susceptibility or resistance in a subject having an H. pylori infection including analyzing a stool sample obtained from the subject to assess the sample for the presence of (i) cagA EPIYA H. pylori gene alleles to detect risk of gastric ailments associated with H. pylori infection and (ii) H. pylori 23S gene sequences to detect H. pylori clarithromycin susceptibility or resistance wherein presence of the East Asian cagA allele confirms increased risk of gastric ailments associated with H. pylori infection in the subject and/or presence of a mutated 23S gene confirms presence of a clarithromycin resistant H. pylori infection in the subject.

30. A method of embodiment 29 wherein the 23S gene mutation is a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

31. A method of embodiments 29 or 30 wherein the analyzing includes amplifying the cagA EPIYA gene allele with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 1 1 using spdPCR.

32. A method of any one of embodiments 29-31 wherein the analyzing includes detecting the cagA EPIYA gene allele with SEQ ID NO: 12 and SEQ ID NO: 13. 33. A method of any one of embodiments 29-32 wherein the analyzing includes amplifying the 23S gene sequences with SEQ ID NO: 23 and SEQ ID NO: 15 using spdPCR.

34. A method of any one of embodiments 29-33 wherein the analyzing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

35. A method of any one of embodiments 29-34 wherein the analyzing of each assayed gene allele or gene sequence occurs with a sensitivity of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91 % sensitivity; at least 92% sensitivity; or at least 93%.

36. A method of any one of embodiments 29-35 wherein the analyzing of at least one assayed gene allele or gene sequence occurs with a sensitivity of at least 95%, at least 99% or 100%.

37. A method of any one of embodiments 29-36 wherein the gastric ailment is one or more of gastric ulcers and/or gastric cancers.

38. A method of any one of embodiments 29-37 wherein the gastric ailment is stomach cancer.

39. A method for both identifying a subject as at-risk for developing gastric ailments associated with H. pylori infection and directing a course of antibiotic treatment including using sample partition digital polymerase chain reaction (spdPCR) to assess the presence of nucleotide sequences found in a stool sample of the subject for (i) the 16S gene of H. pylori, (ii) the cagA gene of H. pylori, (ii) the cagA EPIYA gene allele of H. pylori and/or (iii) H. pylori 23S gene sequences associated with H. pylori clarithromycin susceptibility or resistance wherein the presence of H. pylori 16S nucleotide sequences confirms infection with H. pylori, the presence of H. pylori cagA nucleotide sequences classifies the subject as at-risk for developing gastric ailments associated with H. pylori infection, the presence of the East Asian cagA allele classifies the subject as at a more heightened risk for developing gastric ailments associated with H. pylori infection than the presence of the cagA nucleotide sequence alone, and the presence of a mutated 23S gene confirms presence of a clarithromycin resistant H. pylori infection in the subject and wherein if the subject is classified as at-risk for developing gastric ailments associated with H. pylori infection, a prophylactic treatment is administered to the subject based on the detected 23S gene sequences.

40. A method of embodiment 39 wherein the 23S gene mutation is a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

41. A method of embodiments 39 or 40 wherein the assessing includes detecting the 16S H. pylori gene with SEQ ID NO: 21.

42. A method of any one of embodiments 39-41 wherein the assessing includes detecting the cagA H. pylori gene with SEQ ID NO: 6 and/or SEQ ID NO: 7. 43. A method of any one of embodiments 39-42 wherein the assessing includes detecting the cagA EPIYA gene allele with SEQ ID NO: 12 and/or SEQ ID NO: 13.

44. A method of any one of embodiments 39-43 wherein the assessing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

45. A method of any one of embodiments 39-44 wherein the assessing includes amplifying of the 16S H. pylori gene with SEQ ID NO: 1 and/or SEQ ID NO: 20.

46. A method of any one of embodiments 39-45 wherein the assessing includes amplifying of the cagA H. pylori gene with SEQ ID NO: 4 and/or SEQ ID NO: 5.

47. A method of any one of embodiments 39-46 wherein the assessing includes amplifying of the cagA EPIYA gene allele with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and/or SEQ ID NO: 1 1.

48. A method of any one of embodiments 39-47 wherein the assessing includes amplifying of the 23S gene sequences with SEQ ID NO: 23 and/or SEQ ID NO: 15.

49. A method of any one of embodiments 39-48 further including directing the monitoring of the subject for the development of gastric ailments associated with H. pylori infection if the detecting reveals the East Asian cagA EPIYA allele.

50. A method of embodiment 49 wherein the monitoring is for the development of stomach cancer.

51. A method of any one of embodiments 39-50 including directing administration of clarithromycin if a 23S gene sequence associated with clarithromycin susceptibility is detected.

52. A method of any one of embodiments 39-51 further including directing administration of a non-clarithromycin antibiotic if a 23S gene sequence associated with clarithromycin resistance is detected.

53. A method of embodiment 52 wherein the non-clarithromycin antibiotic is one or more of Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Loracarbef, Ertapenem, Imipenem, Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cephalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefsulodine, Cefepime, Teicoplanin, Vancomycin, Azithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Aztreonam, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin, Piperacillin, Ticarcillin, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Norfloxacin, Ofloxacin, Trovafloxacin, Mafenide, Prontosil, Sulfacetamide, Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim, Trimethoprim sulfa, Sulfamethoxazole, Co-trimoxazole, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Chloramphenicol, Clindamycin, Ethambutol, Fosfomycin, Furazolidone, Isoniazid, Linezolid, Metronidazole, Mupirocin, Nitrofurantoin, Platensimycin, Pyrazinamide, Quinupristin/Dalfopristin, Rifampin, Spectinomycin, Amphotericin B, Flucanazole, Fluoropyrimidins, Gentamycin, Methicillin, Oxacillin and clavulanic acid.

54. A method of any one of embodiments 39-52 further including directing administration of a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

55. A method of any one of embodiments 3-52 further including directing administration of clarithromycin and a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

56. A method to detect the presence of a clarithromycin-resistant strain of H. pylori in a subject wherein the method includes assessing a sample obtained from the subject for the presence of H. pylori mutated 23S gene sequences associated with clarithromycin resistance using sample partition digital polymerase chain reaction (spdPCR) wherein the method detects the clarithromycin-resistant strain even if present at only 1 % of the total H. pylori population within the subject.

57. A method of embodiment 56 wherein the sample is a stool sample.

58. A method of embodiments 56 or 57 wherein the mutated 23S gene sequences include a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

59. A method of any one of embodiments 56-58 wherein the assessing includes amplifying of the 23S gene sequences with SEQ ID NO: 23 and/or SEQ ID NO: 15.

60. A method of any one of embodiments 56-59 wherein the assessing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

61. A method of any one of embodiments 56-60 including directing administration of clarithromycin if a 23S gene sequence associated with clarithromycin susceptibility is detected.

62. A method of any one of embodiments 56-61 including directing administration of a non- clarithromycin antibiotic if a 23S gene sequence associated with clarithromycin resistance is detected.

63. A method of embodiment 62 wherein the non-clarithromycin antibiotic is one or more of Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Loracarbef, Ertapenem, Imipenem, Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cephalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefsulodine, Cefepime, Teicoplanin, Vancomycin, Azithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Aztreonam, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin, Piperacillin, Ticarcillin, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Norfloxacin, Ofloxacin, Trovafloxacin, Mafenide, Prontosil, Sulfacetamide, Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim, Trimethoprim sulfa, Sulfamethoxazole, Co-trimoxazole, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Chloramphenicol, Clindamycin, Ethambutol, Fosfomycin, Furazolidone, Isoniazid, Linezolid, Metronidazole, Mupirocin, Nitrofurantoin, Platensimycin, Pyrazinamide, Quinupristin/Dalfopristin, Rifampin, Spectinomycin, Amphotericin B, Flucanazole, Fluoropyrimidins, Gentamycin, Methicillin, Oxacillin and clavulanic acid.

64. A method of any one of embodiments 56-62 including directing administration of a non- clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

65. A method of any one of embodiments 56-62 further including directing administration of clarithromycin and a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

66. A method for obtaining quantitative information on the number of H. pylori specific genotypes from a sample including amplifying the sample using sample partition droplet polymerase chain reaction (spdPCR) wherein the amplifying uses a primer set selected from one or more of: (i) SEQ ID NO: 1 and SEQ ID NO: 20; (ii) SEQ ID NO: 4 and SEQ ID NO: 5; (iii) SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 1 1 ; or (iv) SEQ ID NO: 23 and SEQ ID NO: 15 wherein the amplifying provides quantitative information on the number of H. pylori specific genotypes from the sample.

67. A method of embodiment 66 wherein the amplifying uses primers: (i) SEQ ID NO: 1 and SEQ ID NO: 20 to obtain quantitative information regarding the H. pylori 16S gene; (ii) SEQ ID NO: 4 and SEQ ID NO: 5 to obtain quantitative information regarding the H. pylori cagA gene; (iii) SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 1 1 to obtain quantitative information regarding the H. pylori cagA EPIYA allele; and/or (iv) SEQ ID NO: 23 and SEQ ID NO: 15 to obtain quantitative information regarding H. pylori 23S gene sequences.

68. A method of embodiments 66 or 67 further including detecting the amplified H. pylori specific genotypes from the sample using a probe set selected from one or more of: (i) SEQ ID NO: 21 ; (ii) SEQ ID NO: 6 and SEQ ID NO: 7; (iii) SEQ ID NO: 12 and SEQ ID NO: 13; and (iv) SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19. 69. A method of any one of embodiments 66-68 wherein the quantitative information is used to assess bacterial load in the sample.

70. A method of any one of embodiments 66-69 wherein the quantitative information is used to classify a subject as at-risk for an H. py/on-associated gastric ailment and if the subject is classified as at-risk, initiating a prophylactic and/or therapeutic treatment in the subject.

71. A method of embodiment 70 wherein the gastric ailment is gastric ulcers and/or gastric cancers.

72. A method of any one of embodiments 66-71 wherein the quantitative information is used to assess H. pylori susceptibility or resistance to an antibiotic treatment.

73. A method of embodiment 72 wherein the antibiotic treatment is clarithromycin treatment.

74. A method of any one of embodiments 66-73 wherein the sensitivity of the spdPCR is at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91% sensitivity; at least 92% sensitivity; or at least 93%.

75. A method of any one of embodiments 66-74 wherein the sensitivity of the spdPCR is at least 95%, at least 99% or 100%.

76. A kit for a stool-based H. pylori assay wherein the kit includes: primers and probes to amplify and detect: (i) the 16S gene of H. pylori wherein the primers and probes include: SEQ ID NO: 1 , SEQ ID NO: 20, and SEQ ID NO: 21 ; (ii) EPIYA alleles of the cagA gene of H. pylori wherein the primers and probes include: SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, and SEQ ID NO: 13; and (iii) a 23S gene sequence associated with H. pylori clarithromycin resistance wherein the primers and probes include: SEQ ID NO: 23, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

77. A kit of embodiment 76 wherein the kit further includes instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

78. A kit of embodiment 77 wherein the primers and probes and instructions provide for an assay with a sensitivity of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91% sensitivity; at least 92% sensitivity; or at least 93% for all detected genetic sequences.

79. A kit of embodiment 77 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 95%, 99% or 100% for all detected genetic sequences.

80. A kit of any one of embodiments 77-79 wherein the kits direct therapeutic or prophylactic treatment based on detected 16S, EPIYA alleles of cagA, and/or 23S gene sequences. 81. A kit of any one of embodiments 80 wherein detection of 16S genes directs treatment with a therapeutic antibiotic.

82. A kit of embodiments 80 or 81 wherein detection of the East Asian cagA allele directs monitoring of the subject for development of gastric ailments associated with H. pylori infection and initiation of a therapeutic and prophylactic antibiotic treatment in the subject.

83. A kit of any one of embodiments 80-82 wherein detection of a 23S gene sequence associated with clarithromycin susceptibility or resistance directs an antibiotic treatment regimen.

84. A kit for a stool-based H. pylori assay wherein the kit includes primers and probes to amplify and detect: (i) the 16S gene of H. pylori wherein the primers and probes include: SEQ ID NO: 1 , SEQ ID NO: 20, and SEQ ID NO: 21 ; (ii) the cagA gene of H. pylori wherein the primers and probes include: SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, and SEQ ID NO: 7, and (iii) a 23S gene sequence associated with H. pylori clarithromycin resistance wherein the primers and probes include: SEQ ID NO: 23, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

85. A kit of embodiment 84 wherein the kit further includes instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

86. A kit of embodiment 85 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91% sensitivity; at least 92% sensitivity; or at least 93% for all detected genetic sequences.

87. A kit of embodiment 85 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 95%, 99% or 100% for all detected genetic sequences.

88. A kit of any one of embodiments 85-87 wherein the kit directs therapeutic or prophylactic treatment based on detected 16S, cagA, and/or 23S gene sequences.

89. A kit of embodiment 88 wherein detection of 16S genes directs treatment with a therapeutic antibiotic.

90. A kit of embodiments 88 or 89 wherein detection of cagA directs monitoring of the subject for development of gastric ailments associated with H. pylori infection and initiation of a therapeutic and prophylactic antibiotic treatment in the subject.

91. A kit of any one of embodiments 88-90 wherein detection of a 23S gene sequence associated with clarithromycin susceptibility or resistance directs an antibiotic treatment regimen.

92. A kit of any one of embodiments 84-91 wherein the kit further includes primers and probes to amplify and detect: EPIYA alleles of the cagA gene of H. pylori wherein the primers and probes include: SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, and SEQ ID NO: 13. 93. A kit for a stool-based H. pylori assay wherein the kit includes: primers and probes to amplify and detect: (i) the 16S gene of H. pylori wherein the primers and probes include: SEQ ID NO: 1 , SEQ ID NO: 20, and/or SEQ ID NO: 21 ; (ii) EPIYA alleles of the cagA gene of H. pylori wherein the primers and probes include: SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, and/or SEQ ID NO: 13; and/or (iii) a 23S gene sequence associated with H. pylori clarithromycin resistance wherein the primers and probes include: SEQ ID NO: 23, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

94. A kit of embodiment 93 wherein the kit further includes instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

95. A kit of embodiment 94 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91% sensitivity; at least 92% sensitivity; or at least 93% for all detected genetic sequences.

96. A kit of embodiment 94 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 95%, 99% or 100% for all detected genetic sequences.

97. A kit of any one of embodiments 93-96 wherein the kit directs therapeutic or prophylactic treatment based on detected 16S, EPIYA alleles of the cagA, and/or 23S gene sequences.

98. A kit of embodiment 97 wherein detection of 16S genes directs treatment with a therapeutic antibiotic.

99. A kit of embodiment 97 or 98 wherein detection of the East Asian cagA allele directs monitoring of the subject for development of gastric ailments associated with H. pylori infection and initiation of a therapeutic and prophylactic antibiotic treatment in the subject.

100. A kit of any one of embodiments 97-99 wherein detection of a 23S gene sequence associated with clarithromycin susceptibility or resistance directs an antibiotic treatment regimen.

101. A kit for a stool-based H. pylori assay wherein the kit includes primers and probes to amplify and detect: (i) the 16S gene of H. pylori wherein the primers and probes include: SEQ ID NO: 1 , SEQ ID NO: 20, and/or SEQ ID NO: 21 ; (ii) the cagA gene of H. pylori wherein the primers and probes include: SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and/or SEQ ID NO: 7; and/or (iii) a 23S gene sequence associated with H. pylori clarithromycin resistance wherein the primers and probes include: SEQ ID NO: 23, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

102. A kit of embodiment 101 wherein the kit further includes instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

103. A kit of embodiments 101 or 102 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91 % sensitivity; at least 92% sensitivity; or at least 93% for all detected genetic sequences.

104. A kit of embodiments 101 or 102 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 95%, 99% or 100% for all detected genetic sequences.

105. A kit of any one of embodiments 102-105 wherein the kits direct therapeutic or prophylactic treatment based on detected 16S, cagA, and/or 23S gene sequences.

106. A kit of embodiment 105 wherein detection of 16S genes directs treatment with a therapeutic antibiotic.

107. A kit of embodiments 105 or 106 wherein detection of cagA directs monitoring of the subject for development of gastric ailments associated with H. pylori infection and initiation of a therapeutic and prophylactic antibiotic treatment in the subject.

108. A kit of any one of embodiments 105-107 wherein detection of a 23S gene sequence associated with clarithromycin susceptibility or resistance directs an antibiotic treatment regimen.

109. A kit of any one of embodiments 101-108 wherein the kit further includes primers and probes to amplify and detect: EPIYA alleles of the cagA gene of H. pylori wherein the primers and probes include: SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, and/or SEQ ID NO: 13.

1 10. A kit to detect the presence of a clarithromycin-resistant strain of H. pylori in a subject wherein the kit detects the clarithromycin-resistant strain even if present at only 1 % of the total H. pylori population within the subject wherein the kit includes primers selected from SEQ ID NO: 23 and SEQ ID NO: 15 to amplify H. pylori 23S gene sequences and instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

1 1 1. A kit of embodiment 1 10 wherein the kit further includes probes selected from SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

1 12. A kit of embodiment 1 1 1 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 84% sensitivity; at least 85% sensitivity; at least 86% sensitivity; at least 87% sensitivity; at least 88% sensitivity; at least 89% sensitivity; at least 90% sensitivity; at least 91% sensitivity; at least 92% sensitivity; or at least 93% for all detected genetic sequences.

1 13. A kit of embodiment 1 1 1 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 95%, 99% or 100% for all detected genetic sequences.

1 14. A kit of any one of embodiments 1 10-113 wherein the kit directs administration of clarithromycin if a 23S gene sequence associated with clarithromycin susceptibility is detected. 1 15. A kit of any one of embodiments 1 10-1 14 wherein the kit directs administration of a non- clarithromycin antibiotic if a 23S gene sequence associated with clarithromycin resistance is detected.

1 16. A kit of embodiment 1 15 wherein the non-clarithromycin antibiotic is one or more of Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Loracarbef, Ertapenem, Imipenem, Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cephalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefsulodine, Cefepime, Teicoplanin, Vancomycin, Azithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Aztreonam, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin, Piperacillin, Ticarcillin, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Norfloxacin, Ofloxacin, Trovafloxacin, Mafenide, Prontosil, Sulfacetamide, Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim, Trimethoprim sulfa, Sulfamethoxazole, Co-trimoxazole, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Chloramphenicol, Clindamycin, Ethambutol, Fosfomycin, Furazolidone, Isoniazid, Linezolid, Metronidazole, Mupirocin, Nitrofurantoin, Platensimycin, Pyrazinamide, Quinupristin/Dalfopristin, Rifampin, Spectinomycin, Amphotericin B, Flucanazole, Fluoropyrimidins, Gentamycin, Methicillin, Oxacillin and clavulanic acid.

1 17. A kit of any one of embodiments 1 10-1 16 wherein the kit directs administration of a non- clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

1 18. A kit of any one of embodiments 1 10-117 wherein the kit directs administration of clarithromycin and a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

1 19. A composition including SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and/or SEQ ID NO: 25.

[0083] In any of the proceeding Exemplary Embodiments that reference a sample, the sample can be any tissue or material obtained from a subject that includes genetic sequences (e.g., genes, alleles, gene sequences, oligonucleotides, etc.) and can include e.g. fresh, frozen or fixed gastric tissues, blood, saliva, stool, etc. as is understood by one of ordinary skill in the art. [0084] In any of the embodiments described up to this point, SEQ ID NO: 20 (5' - CGTTAG CTG CATTACTGG AGA - 3') is preferred, but SEQ ID NO: 2 can be used; SEQ ID NO: 21 (5' HEX - AAGCCCTCCAACAACTAGCATCCAT - BHQ1 3') is preferred, but SEQ ID NO: 3 can be used; SEQ ID NO: 6 and/or 7 can be replaced or supplemented with SEQ ID NO: 22 (5' FAM - CTTCCYACATTATGYGCAACKATC - BHQ1 3' wherein Y=C or T and K=G or T); SEQ ID NO: 23 (5' - TCCCGTTAGCAGTGCTAA - 3') is preferred, but SEQ ID NO: 14 can be used; SEQ ID NO: 16 is preferred but can be replaced with SEQ ID NO: 24 (5' HEX - AAG AC G G AAAG AC CC C GT- BHQ1 3'); and SEQ ID NO: 25 (5' FAM - AAGACGGGAAGACCCCGT- BHQ1 3') is preferred, but SEQ ID NO: 17 can be used. HEX: hexachloro-fluorescein, FAM: 6-carboxyfluorescein, BHQ: black hole quencher.

[0085] Example 1 . Stool Collection and DNA Extraction. Stool samples are collected into RNAIater (Ambion), a nucleic acid preservative and stored at -20°C. Samples are then thawed, vortexed, and poured into a microcentrifuge tube before spinning in a centrifuge and removing RNAIater. After RNAIater is removed stool DNA is extracted using the QIAamp DNA Stool Mini Kit (Qiagen) according to the manufacturer's instructions with the lysis step at 95°C.

[0086] Sample Partition PCR. 1 μg stool DNA is used for each ddPCR reaction. The reactions are set up according to BioRad's Droplet Digital PCR instructions.

[0087] Primers and Probes. H. pylori 16S assay. This assay is used to detect the presence of H. pylori infection.

Forward primer: 5' - GCGACCTGCTGGAACATTAC - 3' (SEQ ID NO: 1 )

Reverse primer: 5' - ATGCGTTAGCTGCATTACTGG - 3' (SEQ ID NO: 2)

Probe: 5' HEX- ACCCTGGTAGTCCACGCCCTAAACGA- BHQ1 3' (SEQ ID NO: 3).

In optimized practice of the disclosure, SEQ ID NO: 2 should be replaced with SEQ ID NO: 20 and SEQ ID NO: 3 should be replaced with SEQ ID NO: 21.

[0088] The primers (SEQ ID NO: 1 AND SEQ ID NO: 2) are based on what was used in a publication by MacKay et al., J Clin. Micro., 41 (10), 4589 (2003)). The forward primer is the same. The location of the reverse primer (SEQ ID NO: 2) was shifted 3 base pairs to remove a polymorphic site.

[0089] cagA detection assay. This assay is used to detect whether a subject is infected with an H. pylori strain that has the cagA virulence gene. Strains that carry the cagA gene are associated with increased risk of ulcer and stomach cancer development.

Forward primer: 5' - TGGCTCAAGCTCGTGAAT - 3' (SEQ ID NO: 4)

Reverse primer: 5' - TGGAAAACTTGAACGAATCAGA - 3' (SEQ ID NO: 5)

Probe 1 : 5' FAM - CTTCCCACATTATGCGCAACTATC - BHQ1 3' (SEQ ID NO: 6) Probe 2: 5' FAM - CTTCCTACATTATGCGCAACGATC - BHQ1 3' (SEQ ID NO: 7)

SEQ ID NO. 6 and/or SEQ ID NO: 7 can be replaced or supplemented with SEQ ID NO: 22.

[0090] These primers and probes (SEQ ID NO: 4-7) were designed to work across different H. pylori strains despite the nucleotide variability within this gene. Briefly, cagA gene sequences from 88 H. pylori strains were aligned and manually examined for conserved regions to put the primers and probe. Because the chosen regions are not completely conserved among H. pylori strains, the primers and probes were tested in the ddPCR assay by spiking genomic DNA of various H. pylori strains in to H. pylori -negative stool DNA. The strains that were spiked in were chosen to represent the range of polymorphisms present in the primer and probe sites for this assay. This assay can be multiplexed with the H. pylori 16S assay to detect H. pylori and cagA in one reaction.

[0091] cagA EPIYA typing assay. The cagA gene can be grouped into the Western allele type and the East Asian allele type based on the EPIYA amino acid motif at the C-terminus of the protein. The Western cagA alleles have an EPIYA-C motif and the East Asian cagA alleles have an EPIYA-D motif. Strains having the East Asian cagA type are associated with increased risk for stomach cancer development. This assay is used to type the H. pylori cagA virulence gene as either Western type or East Asian type.

Forward primer 1 : 5' - TCAGTTAGCCCTGAACC - 3' (SEQ ID NO: 8)

Forward primer 2: 5' - TCAACTAGCCCTGAACC - 3' (SEQ ID NO: 9)

Reverse primer 1 : 5' - GCCCTACCTTACTGAGAT - 3' (SEQ ID NO: 10)

Reverse primer 2: 5' - GAAAGCCCTACTTTACTGAG - 3' (SEQ ID NO: 11 )

Probe 1 : 5' HEX - TCCGCCGAGATCATCAATCGTAGC - BHQ1 3' (SEQ ID NO: 12)

Probe 2: 5' FAM - AAGCCTGCTTGATTTGCCTCATCAAA - BHQ1 3' (SEQ ID NO: 13)

[0092] The primers and probes were designed to work across different H. pylori strains despite the nucleotide variability within this gene. Briefly, cagA gene sequences from 88 H. pylori strains (including 13 strains with East Asian cagA) were aligned and manually examined for conserved regions to put the primers that would amplify the EPIYA-C or EPIYA-D encoding region of the cagA gene. The alignment was also manually examined for a region to put the EPIYA-C probe that was unique to the EPIYA-C motif but conserved among the Western cagA and a region to put the EPIYA-D probe that was unique to the EPIYA-D motif but conserved among East Asian cagA. This part of the assay design was difficult because the nucleotide sequence that distinguishes between the EPIYA-C motif and EPIYA-D motif is only around 24 base pairs long, so the location of the probe was restricted. Because the chosen regions are not completely conserved among H. pylori strains, the primers and probes were tested in the ddPCR assay by spiking genomic DNA of various H. pylori strains in to H. pylori -negative stool DNA. The strains that were spiked in were chosen to represent the range of polymorphisms present in the primer and probe sites for this assay.

[0093] Clarithromycin resistance assay. This assay is used to detect the presence of clarithromycin resistant H. pylori. Clarithromycin resistance is primarily due to one of three point mutations in the 23S gene. The currently disclosed methods, kits and compositions identify the presence of the following potential 23S mutations: position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

[0094] This assay quantifies the number and ratio of clarithromycin sensitive and resistant H. pylori in a sample.

Forward primer: 5' - TATTCCCGTTAGCAGTGCT - 3' (SEQ ID NO: 14)

Reverse primer: 5' - AGATGGGAGCTGTCTCAAC - 3' (SEQ ID NO: 15)

Probe 1 : 5' HEX - AAGACGGAAAGACCCCGTG - BHQ1 3' (SEQ ID NO: 16)

Probe 2: 5' FAM - ACGGGAAGACCCCGT - BHQ1 3' (SEQ ID NO: 17)

Probe 3: 5' FAM - AAGACGGAGAGACCCCGT - BHQ1 3' (SEQ ID NO: 18)

Probe 4: 5' FAM - AAGACGGCAAGACCCCGT - BHQ1 3' (SEQ ID NO: 19)

In optimized practice of the disclosure, SEQ ID NO: 14 should be replaced with SEQ ID NO: 23; and SEQ ID NO: 17 should be replaced with SEQ ID NO: 25.

[0095] The reverse primer is in the same location as that used in a stool-based clarithromycin resistance test developed by Schabereiter-Gurtner et al. {J. Clin. Micro., 42(10), 4512 (2004)), but is three base pairs shorter to adjust the melting temperature. The forward primer (SEQ ID NO: 4) was designed to a region of the 23S gene that is more specific to H. pylori than what has previously been used.

[0096] Results. H. pylori 16S assay. The H. pylori 16S assay was tested by spiking H. pylori genomic DNA in to H. pylori -negative stool DNA (FIG. 1 ) as well as testing on 13 H. py/on^'-positive stool samples collected from patients at Harborview Medical Center (Table 2). The stool samples from Harborview patients were tested for H. pylori using the H. pylori stool antigen test.

[0097] FIG. 1 shows 16S ddPCR amplitude plots for H. pylori -negative stool sample spiked with H. py/or/^'-positive genomic DNA. Each dot represents one droplet. Dots above the threshold (set at 3000) are positive for H. pylori 16S. Dots below the threshold are negative for H. pylori 16S. Expected copies per μΙ is shown on the left and measured copies per μΙ (Ch2-Conc.) and absolute number of positive (pos.) and negative (neg.) droplets are shown in the title of each plot. [0098] The disclosed new ddPCR method is more sensitive and reproducible than the conventional PCR method for detection of H. pylori infection and has the added benefit of quantitation (Table 2).

Table 2. Comparison of stool-based assays for detecting H. pylori 16S by testing 13 stool samples positive for H. pylori by the stool antigen test. For the conventional PCR assay, a positive PCR is marked with an X.

Conventional PCR Droplet digital PCR

Hp+ individual PCR positive copies per μg stool DNA

1 H 33.5

20H 21.2

27H 82.6

37H 20.7

44H X 160.6

9/13 (69%) 13/13 (100%)

[0099] cagA detection and cagA EPIYA typing assays. This assay was tested by spiking H. pylori genomic DNA of 6 North American and 8 Japanese strains in to H. pylori -negative stool DNA. The 6 North American strains were determined to have Western type cagA and the 8 Japanese strains were determined to have East Asian type cagA by sequencing of the cagA gene. The strains that were spiked in were chosen to represent the range of polymorphisms present in the primer and probe sites for these assays. All 14 strains were correctly identified as having the cagA virulence gene using the cagA ddPCR assay and 13/14 (93%) of the strains were correctly typed as either having a Western cagA allele or an East Asian cagA allele by the cagA EPIYA typing ddPCR assay. One East Asian cagA strain was tested negative for both allele types (Table 3). Table 3. Detection and typing of the cagA virulence gene using the stool-based ddPCR assay. An X indicates detection by the ddPCR assay.

Spiked

strain cagA EPIYA-C EPIYA-D

Oki388 X X

E_t W_tasese_r Oki421 X X

c Oki472 X X

w

< Oki508 X X

Oki573 X X

Oki633 X

Oki674 X X

Oki684 X X

Em33-1 X X

Em34-3 X X

Em42-3 X X

Em44-1 X X

Em47-1 X X

Em7-1 X X

14/14 13/14

(100%) (93%)

[0100] FIG. 2 shows spdPCR (here, ddPCR™) amplitude plots for the multiplexed 16S and cagA gene assay. H. py/or/^'-negative stool DNA was spiked with genomic DNA of two different H. pylori strains (Oki573 and Em47-1 ) having the cagA gene. Each dot represents one droplet. Dots above the threshold (set at 3000) in the left side panel (16S probe) are positive for H. pylori 16S rRNA gene. Dots above the threshold (set at 6000) in the right side panel (cagA probes) are positive for the H. pylori cagA gene. Dots below the thresholds are negative for H. pylori. Measured copies per μΙ (Ch2-Conc, Ch1-Conc.) and absolute number of positive (pos.) and negative (neg.) droplets are shown in the title of each plot. The concentration of 16S copies is expected to be twice that of cagA copies because there are two copies of the 16S gene and only one copy of the cagA gene in the H. pylori genome.

[0101] FIG. 3 shows spdPCR (here, ddPCR™) amplitude plots for the cagA EPIYA typing assay. H. py/or/^'-negative stool DNA was spiked with genomic DNA of two different H. pylori strains: Oki573 having an East Asian type cagA gene and Em47-1 having a Western type cagA gene. Each dot represents one droplet. Dots above the threshold (set at 2000) in the left side panel (EPIYA-D Probe) are positive for an East Asian type allele of the cagA gene. Dots above the threshold (set at 2000) in the right side panel (EPIYA-C Probe) are positive for a Western type allele of the cagA gene. Dots below the thresholds are negative for H. pylori. Measured copies per μΙ (Ch2-Conc, Ch1-Conc.) and absolute number of positive (pos.) and negative (neg.) droplets are shown in the title of each plot.

[0102] Clarithromycin resistance assay. This assay was tested by spiking H. pylori genomic DNA of a clarithromycin-sensitive strain and an isogenic clarithromycin-resistant strain having one of the 23S point mutations in to H. py/on^'-negative stool DNA. The genomic DNA of the two strains was spiked in at different ratios to test the sensitivity of the assay to detect subpopulations of clarithromycin resistant H. pylori. The currently available stool-based real-time PCR method for detecting clarithromycin resistance fails to detect clarithromycin-resistant mutants when the mutant population is at or below 10% of the population, which is likely responsible for the lower than desirable sensitivity of the assay (73% sensitivity). However, the disclosed stool-based ddPCR method can detect clarithromycin-resistant mutants at least down to 1 % of the population.

[0103] FIG. 4 shows ddPCR amplitude plots for the clarithromycin resistance assay. H. pylori genomic DNA of a clarithromycin-sensitive strain and an isogenic clarithromycin-resistant strain having one of the 23S point mutations were spiked in to H. py/on^'-negative stool DNA at different ratios indicated on the left side of the figure. Each dot represents one droplet. Dots above the threshold (set at 3000) in the amplitude plots in the left panel (probe detecting clarithromycin sensitivity) are positive for clarithromycin-sensitive H. pylori. Dots above the threshold (set at 3500) in the amplitude plots in the right panel (probes detecting clarithromycin resistance) are positive for clarithromycin-resistant H. pylori. Dots below the thresholds in both the left and right panels are negative for H. pylori. Measured copies per μΙ (Ch2-Conc, Ch1-Conc.) and absolute number of positive (pos.) and negative (neg.) droplets are shown in the title of each plot.

[0104] FIG. 5 shows the fractional abundance of clarithromycin-resistant mutant H. pylori DNA detected by ddPCR for a range of clarithromycin-sensitive to clarithromycin-resistant mutant DNA ratios. H. py/or/^'-negative stool DNA was spiked with H. pylori genomic DNA of a clarithromycin-sensitive and an isogenic clarithromycin-resistant mutant at the ratios listed on the x-axis. Genome copy number of clarithromycin-sensitive and clarithromycin-resistant mutant H. pylori was quantified using the ddPCR assay. Bars indicate Poisson 95% confidence limits for duplicate wells.

[0105] Example 2. Quantitative detection and genotyping of Helicobacter pylori from stool using droplet digital PCR reveals marked variation in bacterial loads that correlates with bacterial virulence gene carriage in a Costa Rican asymptomatic population.

[0106] A new, non-invasive method for detection, quantification, and cagA genotyping of H. pylori from stool samples that uses ddPCR was developed. This method was tested using a collection of matched serum and stool samples from asymptomatic volunteers in Costa Rica, a country with an H. pylori prevalence of 78% and one of the highest incidence and mortality rates of stomach cancer. Development of non-invasive methods to genotype H. pylori facilitate previously difficult molecular epidemiology studies including studies to track transmission of specific H. pylori strains in a population and to examine H. pylori -host genetic interactions in disease progression.

[0107] Materials and Methods. Study populations and specimen collection. Stool and serum samples were collected from 50 Costa Rican volunteers as part of a larger study of the human microbiome that included 150 volunteers. The 150 volunteers were chosen by random selection of household number using census data and invited to participate in the study. The 50 volunteers whose samples were analyzed in this study included men and women. Stool samples were collected into RNAIater nucleic acid preservative (Ambion) and placed in a thermos with dry ice prior to delivery to the study clinic. Blood was collected at the study clinic and the serum was separated and frozen in aliquots. Samples were collected within 24 hours of each other and only collected when the individual had not been on antibiotic treatment for at least six weeks. The study protocols and procedures for the protection of human subjects were approved by the Institutional Review Board of the National Cancer Institute and informed consent was obtained from each participant or participant's guardian.

[0108] Stool samples were collected from 29 outpatients seen in clinics at Harborview Medical Center for a variety of medical reasons. Stools were tested for H. pylori antigen and deidentified leftover specimens were provided for this study. Patients ranged in age from 1 to 68 years (median 27). Specimens were held at 4°C before division into ~1 ml aliquots, which were frozen at -75°C. Formed stools were emulsified in a sufficient quantity of molecular grade water to facilitate aliquot distribution.

[0109] H. pylori and CagA IgG ELISA. Serum samples from the Costa Rican participants were analyzed for H. pylori antibodies using the Wampole Helicobacter pylori IgG ELISA II Test System and for CagA antibodies using the CagA IgG ELISA Kit (Alpco).

[0110] Stool DNA extraction. Stool samples were stored at -20°C until DNA extraction was performed. Prior to stool DNA extraction, the sample was thawed, vortexed, transferred to a microcentrifuge tube, and then centrifuged to remove the RNAIater. Unless otherwise noted, stool DNA was extracted using the QIAamp Stool DNA Mini Kit (Qiagen) according to the manufacturer's instructions, with the lysis step performed at 95°C. Other stool DNA extraction methods were performed on a stool sample from an H. p /or/^'-positive volunteer to determine which method yielded the greatest amount of H. pylori DNA. These other methods included 1 ) the QIAamp Stool DNA Mini Kit according to the manufacturer's instructions with the lysis step at 70°C, 2) the QIAamp Stool DNA Mini Kit according to the manufacturer's instructions with the addition of 1 minute of bead beating with 0.1 mm silica/zirconia beads of the stool sample in the lysis buffer prior to incubation at 95°C, and 3) a phenol/chloroform/isoamyl alcohol extraction with bead beating (Moeller et al., Gut Microbes, 4: 403-8, 2013).

[0111] Primer and probe design. The primer and probe sequences for all assays are listed in Table 4.

Table 4. Primers and probes used for droplet digital PCR (ddPCR) assays to detect and genotype H. pylori from stool.

ddPCR Primer or probe

assay name SEQ ID NO:

H. pylori

16S HPF SEQ ID NO: 1

HPR SEQ ID NO: 20

Hp16S_HEX SEQ ID NO: 21

cagA

detection cagA F SEQ ID NO: 4

cagA_R SEQ ID NO: 5

cagA_FAM SEQ ID NO: 22

cagA

EPIYA SEQ ID NO: 8

typing EPIYA_F1

EPIYA_F2 SEQ ID NO: 9

EPIYA_R1 SEQ ID NO: 10

EPIYA_R2 SEQ ID NO: 1 1

EPIYA-C_HEX SEQ ID NO: 12

EPIYA-D FAM SEQ ID NO: 13

[0112] Droplet Digital PCR. Droplet digital PCR was performed according to the manufacturer's instructions with each 20 μΙ reaction containing 1x ddPCR Supermix for Probes (BioRad), 900 nM of each primer (Table 4), 250 nM of each probe (Table 4), and 10 μΙ stool DNA. For the Costa Rican stool DNA samples, the concentration was adjusted to 100 ng/μΙ prior to ddPCR reaction setup so that 1 μg stool DNA was analyzed per reaction. Droplets were generated using the QX200 Droplet Generator (BioRad). Reactions were subject to thermal cycling with the following conditions: 95°C for 10 minutes, then 45 cycles of 94°C for 30 seconds and 55°C for 1 minute, followed by 98°C for 10 minutes. Droplets were then analyzed for fluorescent amplitude using the QX200 Droplet Reader (BioRad). Data was analyzed using the QuantaSoft software version 1.6.6 (BioRad) and thresholds were set manually. Two 20 μΙ reactions were run for each stool sample, and the results of each reaction were combined.

[0113] Statistical Analysis. Differences in H. pylori load as measured by the H. pylori 16S ddPCR assay were compared using the Wilcoxon rank-sum test. Statistical analyses were performed using SAS version 9.4 (SAS Institute Inc.). [0114] Results. Development and optimization of stool-based ddPCR assay to detect H. pylori. While it is possible to amplify H. pylori DNA from stool DNA using multiple rounds of conventional PCR, this is often not reproducible for a given sample, leading to inconsistent results. To adapt previously reported H. pylori 16S primers for use with ddPCR, a probe that is specific to the H. pylori 16S gene was designed. To first test the performance of the ddPCR assay to detect the H. pylori 16S gene amongst a complex background of stool DNA, 10-fold dilutions of known quantities of H. pylori strain G27 genomic DNA, as determined by a NanoDrop spectrophotometer (Thermo Scientific), were spiked into stool DNA from an H. py/on^'-negative volunteer. As shown in FIG. 6, there is a clear separation between droplets containing H. pylori 16S and droplets negative for H. pylori 16S, and the assay correctly quantifies the amount of H. pylori genomes spiked down to the lowest amount tested (one H. pylori genome per μg stool DNA).

[0115] As H. pylori is present at low abundance in stool, different methods for stool DNA extraction were tested to determine which method yielded the greatest amount of H. pylori DNA. Four different methods were performed on a stool sample from an H. py/or/^'-positive volunteer, and the amount of H. pylori DNA in the sample was quantified using the H. pylori 16S ddPCR assay (Table 5). Protocols including bead beating yielded decreased H. pylori DNA per μg stool DNA as compared to protocols that did not include bead beating. Lysis temperature did not affect the yield of H. pylori DNA. The performance of the H. pylori 16S ddPCR assay on stool samples stored in RNAIater nucleic acid preservative and exposed to days of storage at room temperature and cycles of freezing and thawing (Table 5) was also tested. Cycles of freezing and thawing did not affect the yield of H. pylori DNA. Storage in RNAIater nucleic acid preservative at room temperature for two or three days resulted in a slight, but not statistically significant, decrease in H. pylori load.

Table 5. Yield of total DNA and H. pylori DNA from stool for various stool DNA extraction methods, storage conditions, and time points of collection for one H. py/on^'-positive volunteer

176 1.21 14 (9 - 20)

Qiagen kit, 70°C lysis 106 1.6 30 (21 - 42)

65 1.5 46 (31 - 62)

Phenol/Chloroform/lso 26 0.2 15 (4 - 42) amyl alcohol with bead

beating 13 0 0 (0 - 52) frozen upon Qiagen kit, 95°C lysis 193 5.6 58 (48 - 68) collection, one

freeze/thaw

cycle 203 5.2 51 (41 - 62) frozen upon 81 (61 -

2

collection 69 2.8 104)

(20 mos 1 day room 1 14 (92 - later) temperature 93 5.3 135)

Qiagen kit, 95°C lysis

2 days room

temperature 105 2.7 52 (40 - 67)

3 days room

temperature 114 2.6 46 (35 - 60)

[0116] Development of stool-based ddPCR assay to detect and EPIYA type the H. pylori cagA gene. Presence of the strain-variable cagA gene and specific cagA allelic variations are associated with increased risk of peptic ulcers and gastric cancer, making it an important target of molecular epidemiology studies. Unlike the H. pylori 16S gene, the cagA gene exhibits extensive nucleotide diversity among H. pylori strains making the design of universal primers and probes for this gene more challenging. To assess the compatibility of the cagA ddPCR primers and probes with a globally representative sample of H. pylori strains, the polymorphisms present within the primer and probe regions for 37 H. pylori strains described in Olbermann et al. (PLoS Genet, 6: e1001069, 2010) were examined and the ability of the cagA ddPCR assays to detect cagA and distinguish between EPIYA types in strains having some of these polymorphisms were tested. Genomic DNA of six North American strains (EPIYA-C) (Talarico et al., J Clin Microbiol, 47: 1680-8, 2009) and eight Japanese H. pylori strains (EPIYA-D) (Matsunari et al., J Clin Microbiol, 50: 876-83, 2012), as well as two fully sequenced European strains (EPIYA-C), 26695 (Tomb et al., Nature, 388: 539-47, 1997) and G27 (Baltrus et al., J Bacteriol, 191 : 447-8, 2009) were spiked into H. py/on-negative stool DNA. The cagA detection ddPCR assay detected the cagA gene for 15 (94%) of the 16 strains tested. The cagA gene was not detected for strain Em7- 1 even though this strain has the same sequence at the cagA primer and probe sites as strain 26695, which was positive by the cagA ddPCR assay (Table 6). The cagA EPIYA type (either EPIYA-C or EPIYA-D) was correctly determined for 15 (94%) of the 16 strains tested. Neither EPIYA motif was detected for Japanese strain Oki633. This could be due to the strain having two polymorphisms within the EPIYA-D probe site (Table 6). The ddPCR amplitude plots for the cagA detection and EPIYA typing assays for two of the spiked strains, Em47-1 (EPIYA-C) and Oki573 (EPIYA-D), are shown in FIG. 8.

Table 6. Comparison of results of stool-based H. pylori ddPCR assay detection and H. pylori load with results of H. pylori serum test (samples from 50 Costa Rican volunteers) and H. pylori stool antigen test (samples from 29 patients at a U.S. hospital).

H. pylori or CaqA serum test³ H. pylori stool anti en test negative negative

H. pylori c ddPCR positive n=37 n=13 positive n= 12 n=17 positive 31 (84%) 0 12 (100%) 5 (29%) median copies H. pylori

16S per μg stool DNA 8.4 (1-452) N/A 22.3 (1 .1-121 ) 1.1 (0.5-3.5) (range)

negative 6 (16%) 13 (100%) 0 12 (71 %) ^aPositive= positive for H. pylori or CagA serum antibody test, Negative=negative for both

[0117] Validation of ddPCR assays using population-based and clinical samples. The stool- based ddPCR assays were tested using a collection of 50 matched serum and stool samples from 50 Costa Rican volunteers. Of these 50, 32 (64%) were H. py/o/7-positive based on the serum test to detect H. pylori antibodies and 25 (50%) were positive for H. pylori having a cagA gene based on the serum test to detect CagA antibodies. Five of the volunteers were negative for H. pylori antibodies but positive for CagA antibodies. The stool-based H. pylori 6S ddPCR assay detected H. pylori in the stool of 27 (84%) of the participants positive for H. pylori antibodies by serum test and 31 (84%) of the 37 participants positive for H. pylori or CagA antibodies by the serum test. Of the 18 participants negative for H. pylori antibodies by the serum test, 14 (78%) were negative for the H. pylori 16S ddPCR assay and four were positive. These four that were positive by H. pylori 16S ddPCR assay were also positive for CagA antibodies by serum test indicating that they did indeed have H. pylori infection (Table 6).

[0118] Of the 25 participants serum positive for CagA antibodies, 21 (84%) were positive for the cagA detection ddPCR assay and 22 (88%) were positive for the cagA EPIYA typing ddPCR assay, with all samples having a cagA gene encoding the EPIYA-C motif. Of the 25 participants serum negative for CagA antibodies, 16 (64%) were negative for the cagA detection ddPCR assay and 21 (84%) were negative for the cagA EPIYA typing ddPCR assay (Table 7). Of the 25 stool samples from participants with serum positive for CagA antibodies, five were negative for one or both of the cagA ddPCR assays (Table 7). For four of these samples, the negative ddPCR results are likely due to low H. pylori loads in the stool. The other sample had a high H. pylori load (452 H. pylori 16S copies per μg stool DNA) and was positive for the cagA EPIYA ddPCR assay. This sample showed a distinct population of droplets above the negative droplets but below the threshold set for this assay. When the threshold is lowered to include this intermediate fluorescence population of droplets, the cagA copy number goes from 0 to 76 cagA copies per μg stool DNA, similar to the 92 cagA copies per μg stool DNA detected by the cagA EPIYA typing ddPCR assay for this sample. Three samples from participants serum negative for CagA antibodies were positive for both cagA ddPCR assays, indicating that these samples are likely truly positive for the cagA gene.

Table 7. Comparison of stool-based cagA gene ddPCR and CagA serum antibody assays for 50 Costa Rican volunteers

CagA serum test

positive negative

cagA ddPCR assay n=25 n=25

cagA gene ddPCR

positive 21 (84%) 9 (36%) negative 4 (16%) 16 (64%)

cagA EPIYA typing ddPCR

positive 22 (88%) 4 (16%) negative 3 (12%) 21 (84%)

both cagA ddPCR assays

positive for both 20 (80%) 3 (12%) positive for cagA gene ddPCR, negative

1 (4%) 6 (24%)

for EPIYA typing ddPCR

negative for cagA gene ddPCR, positive

for EPIYA typing ddPCR

negative for both

)

[0119] The stool-based H. pylori 16S ddPCR assay was further tested using a collection of 29 stool samples from patients at a U.S. hospital for which the H. pylori stool antigen test was performed. Of the 29 stool samples, 12 were H. py/or/^'-positive and 17 were H. py/on^'-negative by stool antigen test. Of the 12 that were H. py/or/^'-positive, all 12 (100%) were positive for the H. pylori 16S ddPCR assay. Of the 17 samples that were H. pylori negative by stool antigen test, 12 (71 %) were negative by H. pylori 16S ddPCR assay and five were positive (Table 6). The five samples that were positive for the H. pylori 16S ddPCR assay but negative for the H. pylori stool antigen assay had H. pylori loads in the lower half of the range, which may have been below the detection limit for the stool antigen assay. Furthermore, three of these five patients had a history of H. pylori infection.

[0120] Load of H. pylori in the stool varies and is correlated with serum CagA antibody status. For the 31 Costa Rican stool samples positive for H. pylori by ddPCR, there was a two log range of H. pylori load in the stool (median 8.4, range 1 - 452 H. pylori copies per μg stool DNA). Of the 17 U.S. stool samples that were positive by H. pylori 16S ddPCR assay, the load of H. pylori in the stool varied between 0.5 to 120.9 copies H. pylori 16S per μg stool DNA, with a median of 13.6 (Table 6). The H. pylori 16S ddPCR assay was performed a second time for the 50 Costa Rican samples, and the copy number data was highly reproducible, with a correlation coefficient of 0.98 (FIG. 7A). To assess the within-person variability of H. pylori load in the stool, a stool sample was collected from an H. py/ori-positive volunteer at two different time points 20 months apart, and H. pylori load was quantified using the H. pylori 16S ddPCR assay. There was a slight increase in H. pylori load at the second collection time point (Table 5).

[0121] It is not known whether the load in the stool is correlated with the load in the stomach or whether other factors such as level of inflammation, disease state, or bacterial genetic factors are involved. To assess the potential role of the cagA virulence gene in load of H. pylori in the stool, the H. pylori 16S copy number per μg stool DNA was compared between Costa Rican volunteers positive for CagA antibodies and negative for CagA antibodies. There was a statistically significant increase in H. pylori load in the stool of volunteers positive for CagA antibodies compared with volunteers negative for CagA antibodies [median H. pylori 16S copy number per μg stool DNA (range) CagA positive: 11.2 (0 - 443), CagA negative: 1.6 (0 - 30); Wilcoxon rank-sum test p-value: 0.009] (FIG. 7B).

[0122] Discussion. The interplay between environment, host genotype, and H. pylori strain differences that lead to a wide range of disease outcomes including asymptomatic gastritis, peptic ulcers, and gastric cancer as well as possible protective effects against esophageal cancer and asthma are not well understood. Non-invasive tests to detect and genotype H. pylori will facilitate previously difficult molecular epidemiology studies to examine the distribution of specific H. pylori genes and alleles in a population and their role in differences in disease outcome. While there are well established non-invasive tests for detecting H. pylori infection (urea breath test, serology test, stool antigen test), these tests do not provide genotypic information about the H. pylori strain. H. pylori DNA can be obtained from stool of an infected individual, but its low relative abundance and the presence of PCR inhibitors in stool make detection and genotyping of /-/, pylori technically challenging. A new non-invasive method for detection, quantification, and genotyping of H. pylori from stool samples using ddPCR that is sensitive and reproducible and minimizes risk of false positives from contamination by eliminating the need for multiple rounds of PCR is described by the current disclosure. These assays can quantify the load of H. pylori in the stool as well as detect the cagA virulence gene and distinguish between Western and East Asian alleles of the gene.

[0123] The sensitivity and specificity of the stool-based ddPCR assay to detect H. pylori infection depended on the H. pylori test that was used for the comparison, either serology or stool antigen test. These two tests detect different biological processes of H. pylori infection (antibody response to H. pylori and H. pylori shedding into the stool) so it is not surprising that the stool- based H. pylori ddPCR assay would compare differently to these two tests. For the Costa Rican samples, the H. pylori 16S ddPCR assay was compared to the H. pylori serology test and had a sensitivity of 84% and a specificity of 78%. However, serology tests for H. pylori can have false positives due to antibodies still being present after infection has been cleared and false negatives due to a person not having a strong antibody response to the H. pylori antigen employed by the test. This was seen in these samples for the five serum samples that were positive for CagA antibodies but negative for H. pylori antibodies. When the serology results for both H. pylori and CagA were taken into account, the specificity of the assay was in fact 100%. Of the six individuals who were positive for either H. pylori or CagA antibodies but were negative for H. pylori 16S ddPCR stool assay, two were positive by ddPCR stool assay upon repeat testing and both had low copy numbers of H. pylori 16S, indicating that they were near the limit of detection for this assay. For the samples from the U.S. hospital, the H. pylori 16S ddPCR assay was compared to the stool antigen assay and had a sensitivity of 100% and a specificity of 71 %. The higher sensitivity for this sample set is likely due to both tests detecting H. pylori that is shed into the stool. The five samples that were positive for the H. pylori 16S ddPCR assay but negative for the H. pylori stool antigen assay had low H. pylori loads, which may have been below the detection limit for the stool antigen assay. Three of these five patients also had a history of H. pylori infection, supporting the positive results by H. pylori 16S ddPCR assay.

[0124] The ddPCR assays were also used to quantitatively assess different stool DNA extraction methods and stool sample storage conditions. It was found that the H. pylori DNA was robust to cycles of freezing and thawing and storage at ambient temperatures in RNAIater preservative, making it possible to conduct epidemiologic studies in which immediate freezing of the sample is not feasible. It was also found that stool DNA extraction methods that employ bead beating to lyse the bacterial cells yielded less H. pylori 16S copies per μg stool DNA than those without bead beating. H. pylori lyses fairly easily, so the decrease in the relative proportion of H. pylori in samples that underwent bead beating was likely due to an increase in the yield of DNA from difficult to lyse bacterial species in the stool.

[0125] Aside from detection of H. pylori infection, ddPCR assays to detect the H. pylori cagA gene and distinguish between different alleles of this gene, which are associated with differences in gastric cancer risk were also developed. The cagA detection ddPCR assay and the cagA EPIYA typing ddPCR assay have similar sensitivities for detection of the cagA gene (84% and 88%, respectively), but the specificity is higherforthe cagA EPIYA typing ddPCR assay (84% compared to 64% for the cagA detection ddPCR assay). The cagA EPIYA typing ddPCR assay can be used for both detection and allele typing of cagA although it will not detect cagA allele types that encode neither an EPIYA-C nor an EPIYA-D motif. However, these allele types make up less than 3% of cagA allele types.

[0126] All 26 of the Costa Rican stool samples that were positive for the cagA gene by the cagA EPIYA typing ddPCR assay had the Western type of the gene encoding an EPIYA-C motif. While this result cannot be confirmed by the serum CagA antibody test, which does not distinguish between cagA allele types, this result is expected based on analysis of the cagA allele types of 33 H. pylori strains from Costa Rica, all of which had a Western type cagA gene (Xia et al., PLoS One, 4: e7736, 2009). Furthermore, an analysis of the geographical origin of 24 H. pylori strains from Costa Rica characterized 21 as belonging to the hpEurope group and three as belonging to the hspWAfrica group (Molina-Castro et al., Gut Microbes, 5: 517-21 , 2014), which would be expected to have cagA genes encoding an EPIYA-C motif. H. pylori strains of Amerindian origin have an EPIYA-DC motif, which has characteristics of both the EPIYA-C and EPIYA-D motifs (Duncan et al., J Bacteriol, 194: 1593-604, 2012). The cagA EPIYA typing assay would characterize the cagA gene of these strains as encoding an EPIYA-C motif.

[0127] Using droplet digital PCR to detect H. pylori in the stool also allows for absolute quantitation of H. pylori load in the stool, information that is not obtained by other stool-based methods. Because these assays give quantitative results, it was possible to observe that there is a two log range of H. pylori loads among those who are infected and that the load of H. pylori in the stool is significantly higher in people who are infected with a strain harboring the cagA virulence gene. Density of H. pylori infection in the stomach also varies among infected individuals, and a higher H. pylori load in the stomach among individuals infected with a cagA- positive strain has been previously reported (Belda et al., Clin Microbiol Infect, 18: E251-3, 2012).

[0128] In conclusion, a sensitive and reproducible method to non-invasively detect and genotype H. pylori as well as measure bacterial load from stool samples is described. This noninvasive method to genotype H. pylori from both symptomatic and asymptomatic individuals allows future studies of H. pylori biomarkers of transmission and pathogenesis. Further understanding of the host and bacterial factors involved in H. py/or/^'-associated disease development can inform strategies for tailored treatment decisions to reduce disease burden. This is particularly relevant to H. pylori since infection confers risk for some diseases and protection against others.

[0129] Example 3. Clarithromycin resistance assay. An assay was developed to detect three of the most common mutations in the H. pylori 23S gene that confer resistance to the antibiotic clarithromycin. This assay was tested for use with stool samples and formalin-fixed, paraffin- embedded (FFPE) gastric tissues.

[0130] The stool-based clarithromycin resistance assay was tested by spiking H. pylori genomic DNA of a clarithromycin-sensitive wild-type strain and three isogenic clarithromycin- resistant strains in to H. py/o/7-negative stool DNA. The genomic DNA of each strain was spiked individually and also at different ratios to test the sensitivity of the assay to detect subpopulations of clarithromycin resistant H. pylori. The amplitude plots for the strains tested individually (FIG. 9) shows that the clarithromycin resistance assay correctly distinguishes between wild-type and clarithromycin-resistant mutants. Before the current disclosure, the available stool-based realtime PCR method for detecting clarithromycin resistance failed to detect clarithromycin-resistant mutants when the mutant population was at or below 10% of the population, which was likely responsible for the lower than desirable sensitivity of the assay (73% sensitivity). However, the disclosed stool-based ddPCR method can detect clarithromycin-resistant mutants at least down to 1% of the population (FIG. 10).

[0131] The clarithromycin resistance assay was first tested on FFPE mouse gastric tissues. Briefly, stomachs were harvested from uninfected C57BL/6 mice, opened along the lesser curvature, and divided in half. Approximately 10⁷ H. pylori in liquid media were added to the lumen side of each half stomach and incubated for 30 minutes before fixation. A clarithromycin-sensitive wild-type strain and three isogenic clarithromycin-resistant strains were added to the mouse half- stomachs individually and in different ratios. The disclosed clarithromycin resistance assay (see Example 1 , with directed Sequence substitutions (e.g., SEQ ID NO: 14→ 23; and SEQ ID NO: 17→ 25) correctly distinguished between wild-type and mutant and detected the correct ratios of wild-type and mutant bacteria for all the conditions tested. The copies of 23S per μΙ detected by the clarithromycin resistance assay agreed with the copies of H. pylori 16S per μΙ detected by ddPCR (Table 8). Table 8. Copies per μΙ of wild-type and mutant 23S DNA in comparison to copies per μΙ of H. pylori 16S detected by ddPCR for formalin-fixed, paraffin-embedded (FFPE) mouse gastric tissues.

copies per ul

23s

H. pylon Strain 23s WT 23s Mutant Total 16s

WT 98 0 98 94

A2143G 0 103 103 94

A2142G 0 29 29 30.7

A2 42C 0 69 69 69

1 :1 WT:A2143G 16.9 1 1.6 28.5 32.8

1 :1 WT:A2142G 19.5 15.7 35.2 39

1 :1 WT:A2142C 8.1 4.3 12.4 16.6

10:1

WT:A2143G 37 3.2 40.2 46.7

[0132] The clarithromycin resistance assay was further tested on archived FFPE gastric tissues from nine H. py/on-positive patients at a local hospital. The clarithromycin resistance assay detected H. pylori 23S in seven of the nine samples tested. The copies of 23S per μΙ detected by the clarithromycin resistance assay agreed with the copies of H. pylori 16S per μΙ detected by ddPCR, indicating that the clarithromycin resistance assay is specifically detecting the 23S gene of H. pylori (Table 9).

[0133] Table 9. Copies per μΙ of wild-type and mutant 23S DNA in comparison to copies per μΙ of H. pylori 16S detected by ddPCR for archived formalin-fixed, paraffin-embedded (FFPE) gastric tissues from nine H. py/on-positive patients at a local hospital.

copies per ul

23s 23s

Patient WT Mut 16s

1 123 0.39 not done

2 85 0.09 not done

3 0 0 not done

4 68 0.28 1 15

5 31 .5 0.08 33.2

6 0 0.1 0.09

7 0 0 0.36

8 19.5 0 12.4

9 5.9 0 3.9

[0134] As will be understood by one of ordinary skill in the art, each embodiment disclosed herein can comprise, consist essentially of or consist of its particular stated element, step, ingredient or component. Thus, the terms "include" or "including" should be interpreted to recite: "comprise, consist of, or consist essentially of." As used herein, the transition term "comprise" or "comprises" means includes, but is not limited to, and allows for the inclusion of unspecified elements, steps, ingredients, or components, even in major amounts. The transitional phrase "consisting of" excludes any element, step, ingredient or component not specified. The transition phrase "consisting essentially of" limits the scope of the embodiment to the specified elements, steps, ingredients or components and to those that do not materially affect the embodiment. As used herein, a material effect would cause a statistically-significant reduction in assay sensitivity in identifying H. pylori cagA EPIYA allele and/or H. pylori antibiotic resistance.

[0135] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. When further clarity is required, the term "about" has the meaning reasonably ascribed to it by a person skilled in the art when used in conjunction with a stated numerical value or range, i.e. denoting somewhat more or somewhat less than the stated value or range, to within a range of ±20% of the stated value; ±19% of the stated value; ±18% of the stated value; ±17% of the stated value; ±16% of the stated value; ±15% of the stated value; ±14% of the stated value; ±13% of the stated value; ±12% of the stated value; ±1 1 % of the stated value; ±10% of the stated value; ±9% of the stated value; ±8% of the stated value; ±7% of the stated value; ±6% of the stated value; ±5% of the stated value; ±4% of the stated value; ±3% of the stated value; ±2% of the stated value; or ±1% of the stated value.

[0136] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0137] The terms "a," "an," "the" and similar referents used in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention .

[0138] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. It is anticipated that one or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain the group as modified thus fulfilling the written description for all groupings used in the appended claims.

[0139] Certain embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0140] Furthermore, numerous references have been made to patents, printed publications, journal articles and other written text throughout this specification (referenced materials herein). Each of the referenced materials are individually incorporated herein by reference in their entirety for their referenced teaching.

[0141] In closing, it is to be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the present invention. Other modifications that can be employed are within the scope of the invention. Thus, by way of example, but not of limitation, alternative configurations of the present invention can be utilized in accordance with the teachings herein. Accordingly, the present invention is not limited to that precisely as shown and described.

[0142] The particulars shown herein are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of various embodiments of the invention . I n this regard, no attempt is made to show structural details of the invention in more detail than is necessary for the fundamental understanding of the invention, the description taken with the drawings and/or examples making apparent to those skilled in the art how the several forms of the invention can be embodied in practice.

[0143] Definitions and explanations used in the present disclosure are meant and intended to be controlling in any future construction unless clearly and unambiguously modified in the following examples or when application of the meaning renders any construction meaningless or essentially meaningless. In cases where the construction of the term would render it meaningless or essentially meaningless, the definition should be taken from Webster's Dictionary, 3^rd Edition or a dictionary known to those of ordinary skill in the art, such as the Oxford Dictionary of S/ochemistry and Molecular Biology (Ed. Anthony Smith, Oxford University Press, Oxford, 2004).

Claims

CLAIMS What is claimed is:

1. A method to assess: (a) H. pylori infection, (b) H. pylori virulence, (c) risk of gastric ailments associated with H. pylori infection and (d) H. pylori clarithromycin susceptibility or resistance in a subject comprising: analyzing a stool sample obtained from the subject for: the 16S H. pylori gene to assess presence or absence of H. pylori infection; analyzing the cagA H. pylori gene to asses H. pylori virulence; analyzing the cagA EPIYA gene allele to assess risk of gastric ailments associated with H. pylori infection; and analyzing H. pylori 23S gene sequences to assess H. pylori clarithromycin susceptibility or resistance wherein the analyzing is performed using sample partition digital polymerase chain reaction (spdPC ) and wherein presence of the 16S gene in the sample confirms H. pylori infection in the subject; presence of the cagA gene confirms infection with a virulent H. pylori strain in the subject; presence of the East Asian cagA EPIYA allele confirms increased risk of gastric ailments associated with H. pylori infection in the subject and presence of a mutated 23S gene confirms presence of a clarithromycin resistant H. pylori infection in the subject.

2. A method of claim 1 wherein the analyzing includes amplifying the 16S H. pylori gene with SEQ ID NO: 1 and SEQ ID NO: 20.

3. A method of claim 1 wherein the analyzing includes detecting the 16S H. pylori gene with SEQ ID NO: 21.

4. A method of claim 1 wherein the analyzing includes amplifying the cagA H. pylori gene with SEQ ID NO: 4 and SEQ ID NO: 5.

5. A method of claim 1 wherein the analyzing includes detecting the cagA H. pylori gene with SEQ ID NO: 6, SEQ ID NO: 7, and/or SEQ ID NO: 22.

6. A method of claim 1 wherein the analyzing includes amplifying the cagA EPIYA gene allele with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11.

7. A method of claim 1 wherein the analyzing includes detecting the cagA EPIYA gene allele with SEQ ID NO: 12 and SEQ ID NO: 13.

8. A method of claim 1 wherein the analyzing includes amplifying the 23S gene sequences with SEQ ID NO: 23; and SEQ ID NO: 15.

9. A method of claim 1 wherein the analyzing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

10. A method of claim 1 wherein the analyzing of each assayed gene, gene allele or gene sequence occurs with a sensitivity of at least 84%.

1 1. A method of claim 1 wherein the analyzing of at least one assayed gene, gene allele or gene sequence occurs with a sensitivity of at least 93%, at least 99% or 100%.

12. A method of claim 1 wherein the gastric ailment is one or more of gastric ulcers and/or gastric cancers.

13. A method of claim 1 wherein the gastric ailment is stomach cancer.

14. A method of claim 1 wherein the 23S gene mutation is a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

15. A method to assess: (a) H. pylori infection, (b) H. pylori virulence, (c) risk of gastric ailments associated with H. pylori infection and/or (d) H. pylori clarithromycin susceptibility or resistance in a subject comprising: analyzing a stool sample obtained from the subject for: the 16S H. pylori gene to assess presence or absence of H. pylori infection; the cagA H. pylori gene to asses H. pylori virulence; the cagA EPIYA gene allele to assess risk of gastric ailments associated with H. pylori infection; and/or the H. pylori 23S gene sequence to assess H. pylori clarithromycin susceptibility or resistance wherein the analyzing is performed using sample partition digital polymerase chain reaction (spdPCR) and wherein presence of the 16S gene in the sample confirms H. pylori infection in the subject; presence of the cagA gene confirms infection with a virulent H. pylori strain in the subject; presence of the East Asian cagA EPIYA allele confirms increased risk of gastric ailments associated with H. pylori infection in the subject and/or presence of a mutated 23S gene confirms presence of a clarithromycin resistant H. pylori infection in the subject.

16. A method of claim 15 wherein the analyzing includes amplifying the 16S H. pylori gene with SEQ ID NO: 1 and SEQ ID NO: 20.

17. A method of claim 15 wherein the analyzing includes detecting the 16S H. pylori gene with SEQ ID NO: 21.

18. A method of claim 15 wherein the analyzing includes amplifying the cagA H. pylori gene with SEQ ID NO: 4 and SEQ ID NO: 5.

19. A method of claim 15 wherein the analyzing includes detecting the cagA H. pylori gene with SEQ ID NO: 6, SEQ ID NO: 7, and/or SEQ ID NO: 22.

20. A method of claim 15 wherein the analyzing includes amplifying the cagA EPIYA gene allele with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11.

21. A method of claim 15 wherein the analyzing includes detecting the cagA EPIYA gene allele with SEQ ID NO: 12 and SEQ ID NO: 13.

22. A method of claim 15 wherein the analyzing includes amplifying the 23S gene sequences with SEQ ID NO: 23 and SEQ ID NO: 15.

23. A method of claim 15 wherein the analyzing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

24. A method of claim 15 wherein the analyzing of each assayed gene, gene allele or gene sequence occurs with a sensitivity of at least 84%.

25. A method of claim 15 wherein the analyzing of at least one assayed gene, gene allele or gene sequence occurs with a sensitivity of at least 93%, at least 99% or 100%.

26. A method of claim 15 wherein the gastric ailment is one or more of gastric ulcers and/or gastric cancers.

27. A method of claim 15 wherein the gastric ailment is stomach cancer.

28. A method of claim 15 wherein the 23S gene mutation is a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

29. A method to detect (a) risk of gastric ailments associated with H. pylori infection and (b) H. pylori clarithromycin susceptibility or resistance in a subject having an H. pylori infection comprising analyzing a stool sample obtained from the subject to assess the sample for the presence of (i) cagA EPIYA H. pylori gene alleles to detect risk of gastric ailments associated with H. pylori infection and (ii) H. pylori 23S gene sequences to detect H. pylori clarithromycin susceptibility or resistance wherein presence of the East Asian cagA allele confirms increased risk of gastric ailments associated with H. pylori infection in the subject and/or presence of a mutated 23S gene confirms presence of a clarithromycin resistant H. pylori infection in the subject.

30. A method of claim 29 wherein the 23S gene mutation is a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

31. A method of claim 29 wherein the analyzing includes amplifying the cagA EPIYA gene allele with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11 using spdPCR.

32. A method of claim 29 wherein the analyzing includes detecting the cagA EPIYA gene allele with SEQ ID NO: 12 and SEQ ID NO: 13.

33. A method of claim 29 wherein the analyzing includes amplifying the 23S gene sequences with SEQ ID NO: 23 and SEQ ID NO: 15 using spdPCR.

34. A method of claim 29 wherein the analyzing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

35. A method of claim 29 wherein the analyzing of each assayed gene allele or gene sequence occurs with a sensitivity of at least 84%.

36. A method of claim 29 wherein the analyzing of at least one assayed gene allele or gene sequence occurs with a sensitivity of at least 93%, at least 99% or 100%.

37. A method of claim 29 wherein the gastric ailment is one or more of gastric ulcers and/or gastric cancers.

38. A method of claim 29 wherein the gastric ailment is stomach cancer.

39. A method for both identifying a subject as at-risk for developing gastric ailments associated with H. pylori infection and directing a course of antibiotic treatment comprising using sample partition digital polymerase chain reaction (spdPCR) to assess the presence of nucleotide sequences found in a stool sample of the subject for (i) the 16S gene of H. pylori, (ii) the cagA gene of H. pylori, (ii) the cagA EPIYA gene allele of H. pylori and/or (Hi) H. pylori 23S gene sequences associated with H. pylori clarithromycin susceptibility or resistance wherein the presence of H. pylori 16S nucleotide sequences confirms infection with H. pylori, the presence of H. pylori cagA nucleotide sequences classifies the subject as at-risk for developing gastric ailments associated with H. pylori infection, the presence of the East Asian cagA allele classifies the subject as at a more heightened risk for developing gastric ailments associated with H. pylori infection than the presence of the cagA nucleotide sequence alone, and the presence of a mutated 23S gene confirms presence of a clarithromycin resistant H. pylori infection in the subject and wherein if the subject is classified as at-risk for developing gastric ailments associated with H. pylori infection, a prophylactic treatment is administered based on the detected 23S gene sequences.

40. A method of claim 39 wherein the 23S gene mutation is a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

41. A method of claim 39 wherein the assessing includes detecting the 16S H. pylori gene with SEQ ID NO: 21.

42. A method of claim 39 wherein the assessing includes detecting the cagA H. pylori gene with SEQ ID NO: 6, SEQ ID NO: 7, and/or SEQ ID NO: 22.

43. A method of claim 39 wherein the assessing includes detecting the cagA EPIYA gene allele with SEQ ID NO: 12 and/or SEQ ID NO: 13.

44. A method of claim 39 wherein the assessing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

45. A method of claim 39 wherein the assessing includes amplifying of the 16S H. pylori gene with SEQ ID NO: 1 and SEQ ID NO: 20.

46. A method of claim 39 wherein the assessing includes amplifying of the cagA H. pylori gene with SEQ ID NO: 4 and/or SEQ ID NO: 5.

47. A method of claim 39 wherein the assessing includes amplifying of the cagA EPIYA gene allele with SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and/or SEQ ID NO: 1 1.

48. A method of claim 39 wherein the assessing includes amplifying of the 23S gene sequences with SEQ ID NO: 23 and SEQ ID NO: 15.

49. A method of claim 39 further comprising directing the monitoring of the subject for the development of gastric ailments associated with H. pylori infection if the detecting reveals the East Asian cagA EPIYA allele.

50. A method of claim 49 wherein the monitoring is for the development of stomach cancer.

51. A method of claim 39 comprising directing administration of clarithromycin if a 23S gene sequence associated with clarithromycin susceptibility is detected.

52. A method of claim 39 further comprising directing administration of a non-clarithromycin antibiotic if a 23S gene sequence associated with clarithromycin resistance is detected.

53. A method of claim 39 wherein the non-clarithromycin antibiotic is one or more of Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Loracarbef, Ertapenem, Imipenem, Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cephalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefsulodine, Cefepime, Teicoplanin, Vancomycin, Azithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Aztreonam, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin, Piperacillin, Ticarcillin, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Norfloxacin, Ofloxacin, Trovafloxacin, Mafenide, Prontosil, Sulfacetamide, Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim, Trimethoprim sulfa, Sulfamethoxazole, Co-trimoxazole, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Chloramphenicol, Clindamycin, Ethambutol, Fosfomycin, Furazolidone, Isoniazid, Linezolid, Metronidazole, Mupirocin, Nitrofurantoin, Platensimycin, Pyrazinamide, Quinupristin/Dalfopristin, Rifampin, Spectinomycin, Amphotericin B, Flucanazole, Fluoropyrimidins, Gentamycin, Methicillin, Oxacillin and clavulanic acid.

54. A method of claim 39 further comprising directing administration of a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

55. A method of claim 39 further comprising directing administration of clarithromycin and a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

56. A method to detect the presence of a clarithromycin-resistant strain of H. pylori in a subject wherein the method comprises assessing a sample obtained from the subject for the presence of H. pylori mutated 23S gene sequences associated with clarithromycin resistance using sample partition digital polymerase chain reaction (spdPCR) wherein the method detects the clarithromycin-resistant strain even if present at only 1 % of the total H. pylori population within the subject.

57. A method of claim 56 wherein the sample is a stool sample.

58. A method of claim 56 wherein the mutated 23S gene sequences comprise a position 2142 adenine (A) to guanine (G) or A to cytosine (C) mutation; and/or a position 2143 A to G mutation.

59. A method of claim 56 wherein the assessing includes amplifying of the 23S gene sequences with SEQ ID NO: 23; and SEQ ID NO: 15.

60. A method of claim 56 wherein the assessing includes detecting the 23S gene sequences with SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

61. A method of claim 56 comprising directing administration of clarithromycin if a 23S gene sequence associated with clarithromycin susceptibility is detected.

62. A method of claim 56 comprising directing administration of a non-clarithromycin antibiotic if a 23S gene sequence associated with clarithromycin resistance is detected.

63. A method of claim 56 wherein the non-clarithromycin antibiotic is one or more of Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Loracarbef, Ertapenem, Imipenem, Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cephalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefsulodine, Cefepime, Teicoplanin, Vancomycin, Azithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Aztreonam, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin, Piperacillin, Ticarcillin, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Norfloxacin, Ofloxacin, Trovafloxacin, Mafenide, Prontosil, Sulfacetamide, Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim, Trimethoprim sulfa, Sulfamethoxazole, Co-trimoxazole, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Chloramphenicol, Clindamycin, Ethambutol, Fosfomycin, Furazolidone, Isoniazid, Linezolid, Metronidazole, Mupirocin, Nitrofurantoin, Platensimycin, Pyrazinamide, Quinupristin/Dalfopristin, Rifampin, Spectinomycin, Amphotericin B, Flucanazole, Fluoropyrimidins, Gentamycin, Methicillin, Oxacillin and clavulanic acid.

64. A method of claim 56 comprising directing administration of a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

65. A method of claim 56 further comprising directing administration of clarithromycin and a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

66. A method for obtaining quantitative information on the number of H. pylori specific genotypes from a sample comprising amplifying the sample using sample partition droplet polymerase chain reaction (spdPCR) wherein the amplifying uses a primer set selected from one or more of: (i) SEQ ID NO: 1 and SEQ ID NO: 20; (ii) SEQ ID NO: 4 and SEQ ID NO: 5; (iii) SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 1 1 ; or (iv) SEQ ID NO: 23 and SEQ ID NO: 15 wherein the amplifying provides quantitative information on the number of H. pylori specific genotypes from the sample.

67. A method of claim 66 wherein the amplifying uses primers: (i) SEQ ID NO: 1 and SEQ ID NO: 20 to obtain quantitative information regarding the H. pylori 16S gene; (ii) SEQ ID NO: 4 and SEQ ID NO: 5 to obtain quantitative information regarding the H. pylori cagA gene; (iii) SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 1 1 to obtain quantitative information regarding the H. pylori cagA EPIYA allele; and/or (iv) SEQ ID NO: 23 and SEQ ID NO: 15 to obtain quantitative information regarding H. pylori 23S gene sequences.

68. A method of claim 66 further comprising detecting the amplified H. pylori specific genotypes from the sample using a probe set selected from one or more of: (i) SEQ ID NO: 21 ; (ii) SEQ ID NO: 6, SEQ ID NO: 7, and/or SEQ ID NO: 22; (iii) SEQ ID NO: 12 and SEQ ID NO: 13; and (iv) SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

69. A method of claim 66 wherein the quantitative information is used to assess bacterial load in the sample.

70. A method of claim 66 wherein the quantitative information is used to classify a subject as at-risk for an H. py/or/^'-associated gastric ailment and if the subject is classified as at-risk, initiating a prophylactic and/or therapeutic treatment in the subject.

71. A method of claim 70 wherein the gastric ailment is gastric ulcers and/or gastric cancers.

72. A method of claim 66 wherein the quantitative information is used to assess H. pylori susceptibility or resistance to an antibiotic treatment.

73. A method of claim 72 wherein the antibiotic treatment is clarithromycin treatment.

74. A method of claim 66 wherein the sensitivity of the spdPCR is at least 84%.

75. A method of claim 66 wherein the sensitivity of the spdPCR is at least 93%, at least 99% or 100%.

76. A kit for a stool-based H. pylori assay wherein the kit comprises: primers and probes to amplify and detect: (i) the 16S gene of H. pylori wherein the primers and probes comprise: SEQ ID NO: 1 , SEQ ID NO: 20, and SEQ ID NO: 21 ; (ii) EPIYA alleles of the cagA gene of H. pylori wherein the primers and probes comprise: SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, and SEQ ID NO: 13; and (iii) a 23S gene sequence associated with H. pylori clarithromycin resistance wherein the primers and probes comprise: SEQ ID NO: 23, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

77. A kit of claim 76 wherein the kit further comprises instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

78. A kit of claim 77 wherein the primers and probes and instructions provide for an assay with a sensitivity of at least 84% for all detected genetic sequences.

79. A kit of claim 77 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 93%, 99% or 100% for all detected genetic sequences.

80. A kit of claim 77 wherein the kits direct therapeutic or prophylactic treatment based on detected 16S, EPIYA alleles of cagA, and/or 23S gene sequences.

81. A kit of claim 80 wherein detection of 16S genes directs treatment with a therapeutic antibiotic.

82. A kit of claim 80 wherein detection of the East Asian cagA allele directs monitoring of the subject for development of gastric ailments associated with H. pylori infection and initiation of a therapeutic and prophylactic antibiotic treatment in the subject.

83. A kit of claim 80 wherein detection of a 23S gene sequence associated with clarithromycin susceptibility or resistance directs an antibiotic treatment regimen.

84. A kit for a stool-based H. pylori assay wherein the kit comprises primers and probes to amplify and detect: (i) the 16S gene of H. pylori wherein the primers and probes include: SEQ ID NO: 1 , SEQ ID NO: 20, and SEQ ID NO: 21 ; (ii) the cagA gene of H. pylori wherein the primers and probes include: SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; and (iii) a 23S gene sequence associated with H. pylori clarithromycin resistance wherein the primers and probes include: SEQ ID NO: 23, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

85. A kit of claim 84 wherein the kit further comprises instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

86. A kit of claim 85 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 84% for all detected genetic sequences.

87. A kit of claim 85 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 93%, 99% or 100% for all detected genetic sequences.

88. A kit of claim 85 wherein the kit directs therapeutic or prophylactic treatment based on detected 16S, cagA, and/or 23S gene sequences.

89. A kit of claim 88 wherein detection of 16S genes directs treatment with a therapeutic antibiotic.

90. A kit of claim 88 wherein detection of cagA directs monitoring of the subject for development of gastric ailments associated with H. pylori infection and initiation of a therapeutic and prophylactic antibiotic treatment in the subject.

91. A kit of claim 88 wherein detection of a 23S gene sequence associated with clarithromycin susceptibility or resistance directs an antibiotic treatment regimen.

92. A kit of claim 84 wherein the kit further comprises primers and probes to amplify and detect: EPIYA alleles of the cagA gene of H. pylori wherein the primers and probes comprise: SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, and SEQ ID NO: 13.

93. A kit for a stool-based H. pylori assay wherein the kit comprises: primers and probes to amplify and detect: (i) the 16S gene of H. pylori wherein the primers and probes comprise: SEQ ID NO: 1 , SEQ ID NO: 20, and SEQ ID NO: 21 ; (ii) EPIYA alleles of the cagA gene of H. pylori wherein the primers and probes comprise: SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, and/or SEQ ID NO: 13; and/or (iii) a 23S gene sequence associated with H. pylori clarithromycin resistance wherein the primers and probes comprise: SEQ ID NO: 23, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

94. A kit of claim 93 wherein the kit further comprises instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

95. A kit of claim 94 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 84% for all detected genetic sequences.

96. A kit of claim 94 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 93%, 99% or 100% for all detected genetic sequences.

97. A kit of claim 93 wherein the kit directs therapeutic or prophylactic treatment based on detected 16S, EPIYA alleles of the cagA, and/or 23S gene sequences.

98. A kit of claim 97 wherein detection of 16S genes directs treatment with a therapeutic antibiotic.

99. A kit of claim 97 wherein detection of the East Asian cagA allele directs monitoring of the subject for development of gastric ailments associated with H. pylori infection and initiation of a therapeutic and prophylactic antibiotic treatment in the subject.

100. A kit of claim 97 wherein detection of a 23S gene sequence associated with clarithromycin susceptibility or resistance directs an antibiotic treatment regimen.

101. A kit for a stool-based H. pylori assay wherein the kit comprises primers and probes to amplify and detect: (i) the 16S gene of H. pylori wherein the primers and probes comprise: SEQ ID NO: 1 , SEQ ID NO: 20, and SEQ ID NO: 21 (ii) the cagA gene of H. pylori wherein the primers and probes include: SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and/or SEQ ID NO: 7; and/or (iii) a 23S gene sequence associated with H. pylori clarithromycin resistance wherein the primers and probes include: SEQ ID NO: 23, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and/or SEQ ID NO: 19.

102. A kit of claim 101 wherein the kit further comprises instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

03. A kit of claim 102 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 84% for all detected genetic sequences.

04. A kit of claim 102 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 93%, 99% or 100% for all detected genetic sequences.

105. A kit of claim 102 wherein the kits direct therapeutic or prophylactic treatment based on detected 16S, cagA, and/or 23S genes.

106. A kit of claim 105 wherein detection of 16S genes directs treatment with a therapeutic antibiotic.

107. A kit of claim 105 wherein detection of cagA directs monitoring of the subject for development of gastric ailments associated with H. pylori infection and initiation of a therapeutic and prophylactic antibiotic treatment in the subject.

108. A kit of claim 105 wherein detection of a 23S gene sequence associated with clarithromycin susceptibility or resistance directs an antibiotic treatment regimen.

109. A kit of claim 101 wherein the kit further comprises primers and probes to amplify and detect: EPIYA alleles of the cagA gene of H. pylori wherein the primers and probes comprise: SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, and/or SEQ ID NO: 13.

1 10. A kit to detect the presence of a clarithromycin-resistant strain of H. pylori in a subject wherein the kit detects the clarithromycin-resistant strain even if present at only 1 % of the total H. pylori population within the subject wherein the kit comprises primers selected from SEQ ID NO: 23; and SEQ ID NO: 15 to amplify H. pylori 23S gene sequences and instructions to amplify and detect the sequences using sample partition digital polymerase chain reaction (spdPCR).

1 1 1. A kit of claim 1 10 wherein the kit further comprises probes selected from SEQ ID NO: 16, SEQ ID NO: 25, SEQ ID NO: 18, and SEQ ID NO: 19.

1 12. A kit of claim 11 1 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 84% for all detected genetic sequences.

1 13. A kit of claim 11 1 wherein the primers, probes and instructions provide for an assay with a sensitivity of at least 93%, 99% or 100% for all detected genetic sequences.

1 14. A kit of claim 1 10 wherein the kit directs administration of clarithromycin if a 23S gene sequence associated with clarithromycin susceptibility is detected.

1 15. A kit of claim 1 10 wherein the kit directs administration of a non-clarithromycin antibiotic if a 23S gene sequence associated with clarithromycin resistance is detected.

1 16. A kit of claim 1 15 wherein the non-clarithromycin antibiotic is one or more of Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Streptomycin, Tobramycin, Loracarbef, Ertapenem, Imipenem, Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cephalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefsulodine, Cefepime, Teicoplanin, Vancomycin, Azithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Aztreonam, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin, Piperacillin, Ticarcillin, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Norfloxacin, Ofloxacin, Trovafloxacin, Mafenide, Prontosil, Sulfacetamide, Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim, Trimethoprim sulfa, Sulfamethoxazole, Co-trimoxazole, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Chloramphenicol, Clindamycin, Ethambutol, Fosfomycin, Furazolidone, Isoniazid, Linezolid, Metronidazole, Mupirocin, Nitrofurantoin, Platensimycin, Pyrazinamide, Quinupristin/Dalfopristin, Rifampin, Spectinomycin, Amphotericin B, Flucanazole, Fluoropyrimidins, Gentamycin, Methicillin, Oxacillin and clavulanic acid.

1 17. A kit of claim 1 10 wherein the kit directs administration of a non-clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

1 18. A kit of claim 110 wherein the kit directs administration of clarithromycin and a non- clarithromycin antibiotic if 23S gene sequences associated with clarithromycin susceptibility and clarithromycin resistance are detected.

1 19. A composition comprising SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and/or SEQ ID NO: 25.