CN103667512A - Primer for rapidly detecting drug tolerance of pertussis bordelella erythrocin from specimen and detection method - Google Patents
Primer for rapidly detecting drug tolerance of pertussis bordelella erythrocin from specimen and detection method Download PDFInfo
- Publication number
- CN103667512A CN103667512A CN201310743682.0A CN201310743682A CN103667512A CN 103667512 A CN103667512 A CN 103667512A CN 201310743682 A CN201310743682 A CN 201310743682A CN 103667512 A CN103667512 A CN 103667512A
- Authority
- CN
- China
- Prior art keywords
- bordetella pertussis
- primer
- sample
- nucleic acid
- pertussis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer for rapidly detecting the drug tolerance of pertussis bordelella erythrocin from a specimen and a detection method. The primer includes variable areas on both sides of a locus 2047 specific to a pertussis bordelella 23S rRNA (ribosomal Robonucleic Acid) gene. According to the primer, the technical problems of incapability of carrying out antibiotic susceptibility test, high time consumption of the antibiotic susceptibility test and the like due to incapability of successfully culturing the pertussis bordelella existing in the prior art are solved.
Description
Technical field
The invention belongs to field of biochemistry detection, the clinical labororatory's detection method that relates to a kind of pathogenic bacterium, relate in particular to and a kind ofly do not rely on that pathogenicbacteria separation cultivates, for the erythromycin resistance of bordetella pertussis being carried out from sample primer and the detection method of rapid detection.
Technical background
Whooping cough is a kind of transmissible disease causing that infected by bordetella pertussis, and crowd all can infect at each age.Bordetella pertussis is a kind of gram negative bacilli, and vitro culture nutritional requirement is higher, is obligate aerobic a kind of severe bacteria.The bordetella pertussis separation and Culture rate of report is extremely low clinically, even can be lower than 10%, and provide report required time and grow (7 days-10 days); And in the research of the majority of China, the bordetella pertussis separation and Culture rate of reporting is " zero ".Research thinks, in some vaccine high coverage rates countries, pertussal morbidity is along with greatly reducing has appearred in the high coverage rate of vaccine, and in recent years, pertussal morbidity but presents the trend rising year by year, and this phenomenon is called " Whooping cough reproduction ".
Erythromycin is the first-selected microbiotic of the infection for the treatment of Whooping cough and Close contacts's drug prophylaxis.And the antibiotic sensitivity test of conventional sense bordetella pertussis need to have successful clinical samples bordetella pertussis separation and Culture just can complete.But because bordetella pertussis growth is comparatively slow, even if there is the clinical strains that can be used for antibiotic sensitivity test, complete the time that bordetella pertussis antibiotic susceptibility test also needs a few days.
The first erythromycin-resistant bordetella pertussis in the whole world is early than within 1994, being found in the U.S., U.S. afterwards, France and China all have indivedual relevant reports in succession successively, and China recent years has the successfully report of bordetella pertussis separation and Culture of 6 examples, and all 6 strain bacteriums all show as erythromycin-resistant.Prompting is different with other country, and the erythromycin of China or macrolide antibiotics resistance bordetella pertussis infect may be comparatively general.
Current research shows, bordetella pertussis erythromycin-resistant phenomenon is relevant with a nucleotide site sudden change in its genome 23S rRNA gene V district, i.e. A2047G.Many pieces of reports afterwards have all confirmed to occur in the bordetella pertussis of erythromycin or macrolide antibiotics resistance, and the A2047G sudden change that all finds that there is 23S rRNA gene occurs.
And the method detecting about bordetella pertussis erythromycin resistance in current all documents of delivering comprises agar dilution, disk diffusion method and the E-test method that following two classes (1) are conventional; (2) pcr amplification to bordetella pertussis 23S rRNA gene V district, and by order-checking, restriction fragment enzyme, cut rear electrophoresis and observe and high resolving power solubility curve technical Analysis.
And the method that above bordetella pertussis erythromycin resistance detection is used all has a maximum defect, must obtain bordetella pertussis bacterial strain just can complete, and the extremely low separation and Culture rate of bordetella pertussis often causes this experiment to complete.
And 23S rRNA gene is to have certain conservative property between bacteria genus, the also target gene of the Molecular Identification of some bacteriums of Chang Zuowei, therefore from be mixed with the sample of other unknown nucleic acid, this gene of direct-detection has certain feasibility in theory.Therefore, the key of specific PCR is the design of Auele Specific Primer.And after successfully specific PCR increases, the subsequent detection of doing for the molecular mechanism of its erythromycin-resistant, can directly judge the erythromycin resistance of the bordetella pertussis in sample fast.
Summary of the invention
In order to solve the bordetella pertussis existing in background technology, cannot successfully cultivate and cause its its antibiotic sensitivity test to carry out, and its antibiotic sensitivity test carry out the technical problems such as comparatively consuming time, the invention provides a kind of primer and detection method that can directly detect the erythromycin resistance of the bordetella pertussis infecting in sample fast.
Technical solution of the present invention is: the invention provides a kind ofly for the erythromycin resistance of infected bordetella pertussis being carried out from sample the primer of rapid detection, its special character is: described primer comprises the Variable Area of 2047 both sides, site for bordetella pertussis 23S rRNA gene.
The nucleotide sequence of above-mentioned primer is:
1505F:5 '-GGCACGAGCGAGCAAGTCTC-3 ', and
2118R:5’-TCTGGCGACTCGAGTTCTGC-3’。
The method that bordetella pertussis erythromycin resistance is detected based on primer as above, its special character is: said method comprising the steps of:
1) gather bordetella pertussis nucleic acid positive sample;
2) adopt the 23S rRNA gene of the resulting bordetella pertussis nucleic acid of primer pair step 1) as claimed in claim 2 positive sample to carry out pcr amplification, obtain amplification;
3) to step 2) resulting amplified production carries out electrophoresis, and tentatively judge whether that according to electrophoresis result amplification is to bordetella pertussis 23S rRNA gene.
Above-mentioned steps 3) also comprise afterwards:
4) to step 2) amplified production that obtains carries out DNA sequencing, obtains sequencing result;
5) whether the bordetella pertussis nucleic acid positive sample compare according to the resulting sequencing result of step 4) and wild-type bordetella pertussis, determining step 1) collecting contains the bordetella pertussis to erythromycin-resistant.
Above-mentioned steps 1) specific implementation is:
1.1) gather the Nasopharyngeal swabs sample of clinical Whooping cough suspected case;
1.2) by step 1.1) the Nasopharyngeal swabs sample of the clinical Whooping cough suspected case that collects is positioned in 0.5ml physiological saline and extracts DNA;
1.3) by PCR detecting step 1.2) IS481 gene and the ptx-Pr gene of resulting DNA;
1.4) if step 1.3) resulting two kinds of genes are all positive, and are considered as bordetella pertussis nucleic acid positive sample.
The specific implementation of carrying out pcr amplification above-mentioned steps 2) is:
PCR reaction system: the primer as claimed in claim 2 that comprises 25 μ l Hotstar Taqmaster mix, 1M Betaine, 5 μ l bordetella pertussis nucleic acid positive sample DNA and 0.5 μ M; Described PCR reaction system is totally 50 μ l;
PCR reaction conditions is: thermal cycle conditions be 95 ℃ 15 minutes, 94 ℃ of 35 circulations 1 minute, 64 ℃ 1 minute, 72 ℃ 1 minute, finally extend 72 ℃ 10 minutes.
A kind of application when the erythromycin resistance of bordetella pertussis is detected that includes primer as mentioned above.
Advantage of the present invention is:
The invention provides a kind of for the erythromycin resistance of bordetella pertussis being carried out from sample primer and the detection method of rapid detection, the feature of the method is can make up bordetella pertussis be difficult to cultivate and cannot complete erythromycin-resistant experiment, its core is design and the application of the primer that detects of the PCR of bordetella pertussis erythromycin-resistant dependency gene, and PCR system and thermal cycle conditions in PCR method has usable range more widely, so that the method can directly apply in the sample that includes some unknown DNA, can specific amplification arrive bordetella pertussis erythromycin-resistant dependency gene: 23S rRNA gene also passes through the erythromycin resistance that further analysis judges the bordetella pertussis (nucleic acid) that sample is contained.Epidemiological analysis for clinical detection bordetella pertussis erythromycin resistance and bordetella pertussis erythromycin resistance is with a wide range of applications.The present invention is by the Auele Specific Primer of design, direct-detection analyze the bordetella pertussis 23S rRNA gene 2047 site Nucleotide that patient infects from Whooping cough patient Nasopharyngeal swabs sample, can directly be applied to fast in the sample of all bordetella pertussis nucleic acid positives, and overcome traditional experiment method cannot complete erythromycin-sensitive test shortcoming because pathogenic bacteria cannot obtain, for understanding bordetella pertussis erythromycin-resistant rate, provide strong technique means.
Accompanying drawing explanation
Fig. 1 is the Partial Fragment gene sequencing result of the bordetella pertussis 23S rRNA of erythromycin-resistant;
Fig. 2 is the Partial Fragment gene sequencing result of direct-detection bordetella pertussis 23S rRNA from clinical samples;
Fig. 3 is bordetella pertussis erythromycin-resistant experiment E-Test result;
Fig. 4 is that the present invention uses PCR method specificity and clinical samples application result.
Embodiment
The invention provides a kind ofly for the erythromycin resistance of bordetella pertussis being carried out from sample the primer of rapid detection, this primer comprises the Variable Area of 2047 both sides, site for bordetella pertussis 23S rRNA gene.
The nucleotide sequence of primer is:
1505F:5 '-GGCACGAGCGAGCAAGTCTC-3 ', and
2118R:5’-TCTGGCGACTCGAGTTCTGC-3’。
The method that the erythromycin resistance to bordetella pertussis based on primer as above detects, the method comprises the following steps:
1) gather bordetella pertussis nucleic acid positive sample:
1.1) gather the Nasopharyngeal swabs sample of clinical Whooping cough suspected case;
1.2) by step 1.1) the Nasopharyngeal swabs sample of the clinical Whooping cough suspected case that collects is positioned in 0.5ml physiological saline and extracts DNA;
1.3) by PCR detecting step 1.2) IS481 gene and the ptx-Pr gene of resulting DNA;
1.4) if step 1.3) resulting two kinds of genes are all positive, and are considered as bordetella pertussis nucleic acid positive sample.
2) adopt the 23S rRNA gene of the resulting bordetella pertussis nucleic acid of primer pair step 1) as claimed in claim 2 positive sample to carry out pcr amplification, obtain amplification:
The specific implementation of carrying out pcr amplification is:
PCR reaction system: the primer as claimed in claim 2 that comprises 25 μ l HotstarTaqmaster mix, 1M Betaine, 5 μ l bordetella pertussis nucleic acid positive sample DNA and 0.5 μ M; Described PCR reaction system is totally 50 μ l;
PCR reaction conditions is: thermal cycle conditions be 95 ℃ 15 minutes, 94 ℃ of 35 circulations 1 minute, 64 ℃ 1 minute, 72 ℃ 1 minute, finally extend 72 ℃ 10 minutes.
3) to step 2) resulting amplified production carries out electrophoresis, and according to the preliminary determining step 1 of electrophoresis result) in sample whether successfully amplification to bordetella pertussis 23S rRNA gene.
4) to step 2) amplified production that obtains carries out DNA sequencing, obtains sequencing result;
5) whether the bordetella pertussis nucleic acid positive sample compare according to the resulting sequencing result of step 4) and wild-type bordetella pertussis, determining step 1) collecting belongs to the bordetella pertussis to erythromycin-resistant.
Meanwhile, the present invention also provides a kind of application when bordetella pertussis erythromycin resistance is detected that includes primer as mentioned above, detection kit for example, the various detections application such as Test paper.
Design of primers principle of the present invention is:
Select the respiratory tract bacterium 23S rRNA genes such as bordetella pertussis, escherichia coli, streptococcus pneumoniae, greyish white Neisseria, by software, compare, select the Variable Area of bordetella pertussis 23S rRNA gene 2047 both sides, site, with the inconsistent zone design primer of base of various bacteria, especially note the specificity of a primer 3 ' terminal number base, primer length 20bp left and right.
Primer specificity detects: use designed primer respectively the Nasopharyngeal swabs sample of escherichia coli, streptococcus aureus, streptococcus pneumoniae and hemophilus influenzae and bordetella pertussis nucleic acid feminine gender to be increased, result is all negative, its result is referring to Fig. 4, in Fig. 4, swimming lane 1-4 is respectively streptococcus pneumoniae ATCC700670, escherichia coli ATCC25922, streptococcus aureus ATCC25923, hemophilus influenzae.Swimming lane 5-7 is respectively clinical bordetella pertussis strain isolated bp12030, bp12072, bp12152.Swimming lane 12-14 is respectively bp12030, bp12072, the corresponding clinical Nasopharyngeal swabs sample of bp12152 bacterial strain.Swimming lane 8-11 and 15-17 are respectively clinical Nasopharyngeal swabs sample, and wherein swimming lane 9,10 is the Nasopharyngeal swabs sample of the bordetella pertussis nucleic acid positive, and other sample bordetella pertussis nucleic acid is negative.Swimming lane M is 100bp DNAMarker.
Collection of specimens and bordetella pertussis detection of nucleic acids: the Nasopharyngeal swabs sample that gathers clinical Whooping cough suspected case, be positioned in 0.5ml physiological saline, extract after DNA, PCR method detects bordetella pertussis IS481 and ptx-Pr gene, and the two kinds of gene tests all positive are considered as bordetella pertussis nucleic acid positive sample.
The PCR of the 23S rRNA gene of specimen dna detects: according to announced bordetella pertussis 23S rRNA gene, in its variable region, design primer 1505F:GGCACGAGCGAGCAAGTCTC and 2118R:TCTGGCGACTCGAGTTCTGC, PCR reaction system (50 μ l) comprises 25 μ l Hotstar Taqmaster mix (Qiagen), 1M Betaine (Sigma), the pair of primers of 0.5 μ M and 5 μ l specimen dnas, thermal cycle conditions be 95 ℃ 15 minutes, 94 ℃ of 35 circulations 1 minute, 64 ℃ 1 minute, 72 ℃ 1 minute, finally extend 72 ℃ 10 minutes.The YuMJ Research(U.S.) PTC200PCR amplification instrument completes pcr amplification.
The DNA sequencing of the 23S rRNA gene PCR product of specimen dna: 1505F checks order with primer.
In Whooping cough infected patient Nasopharyngeal swabs sample, bordetella pertussis 23S rRNA gene 2047 site Nucleotide are determined: by comparing with issued wild-type, determine the Nucleotide of clinical samples result.2047 sites are the G bordetella pertussis of erythromycin-resistant that represented patient infection.
The application verification of method:
Applicant successfully isolates 11 strain bordetella pertussis August altogether in 2012-2013 from the Nasopharyngeal swabs sample of clinical Whooping cough suspected case, and antibiotic sensitivity test shows, 9 strains are erythromycin resistant isolates (Fig. 3), and 2 strains are erythromycin-sensitive strain.And the 23S rRNA gene 2047 of the corresponding Nasopharyngeal swabs sample of 9 strain persister and its bacterial strain has all occurred that G has replaced the sudden change of A.The 23S rRNA gene 2047 of the corresponding Nasopharyngeal swabs sample of all the other 2 strain erythromycin-sensitive strains and its bacterial strain is not undergone mutation, and is A.Be the method pass through that bacterium colony PCR checks order and the result of corresponding sample PCR order-checking in full accord, partial results is shown in Fig. 4.
Fig. 2 has embodied from clinical samples direct-detection bordetella pertussis 23S rRNA gene and order-checking (Partial Fragment) sample 1 is consistent with wild-type, is sensitive strain; All the other samples are persister.
Sample to the part bordetella pertussis nucleic acid positive carries out this PCR detection and order-checking, and sequencing result occurs (Fig. 1, wherein, framework Nucleotide is 2047 sites) without bimodal or assorted peak, and comparison result is consistent with bordetella pertussis.And the sample of bordetella pertussis nucleic acid feminine gender does not amplify respective segments, partial results is shown in Fig. 4.
Claims (7)
1. for the erythromycin resistance of infected bordetella pertussis being carried out from sample a primer for rapid detection, it is characterized in that: described primer comprises the Variable Area of 2047 both sides, site for bordetella pertussis 23S rRNA gene.
2. primer according to claim 1, is characterized in that: the nucleotide sequence of described primer is:
1505F:5 '-GGCACGAGCGAGCAAGTCTC-3 ', and
2118R:5’-TCTGGCGACTCGAGTTCTGC-3’。
3. the method that the erythromycin resistance to bordetella pertussis based on primer as claimed in claim 2 detects, is characterized in that: said method comprising the steps of:
1) collect bordetella pertussis nucleic acid positive sample;
2) adopt the 23S rRNA gene of the resulting bordetella pertussis nucleic acid of primer pair step 1) as claimed in claim 2 positive sample to carry out pcr amplification, obtain amplification;
3) to step 2) resulting amplified production carries out electrophoresis, and tentatively judge whether that according to electrophoresis result amplification is to bordetella pertussis 23S rRNA gene.
4. method according to claim 3, is characterized in that: after described step 3), also comprise:
4) to step 2) amplified production that obtains carries out DNA sequencing, obtains sequencing result;
5) whether the bordetella pertussis nucleic acid positive sample compare according to the resulting sequencing result of step 4) and wild-type bordetella pertussis, determining step 1) collecting contains the bordetella pertussis to erythromycin-resistant.
5. according to the method described in claim 3 or 4, it is characterized in that: the specific implementation of described step 1) is:
1.1) gather the Nasopharyngeal swabs sample of clinical Whooping cough suspected case;
1.2) by step 1.1) the Nasopharyngeal swabs sample of the clinical Whooping cough suspected case that collects is positioned in 0.5ml physiological saline and extracts DNA;
1.3) by PCR detecting step 1.2) IS481 gene and the ptx-Pr gene of resulting DNA;
1.4) if step 1.3) resulting two kinds of genes are all positive, and are considered as bordetella pertussis nucleic acid positive sample.
6. method according to claim 5, is characterized in that: the specific implementation of carrying out pcr amplification described step 2) is:
PCR reaction system: the primer as claimed in claim 2 that comprises 25 μ l Hotstar Taqmaster mix, 1M Betaine, 5 μ l bordetella pertussis nucleic acid positive sample DNA and 0.5 μ M; Described PCR reaction system is totally 50 μ l;
PCR reaction conditions is: thermal cycle conditions be 95 ℃ 15 minutes, 94 ℃ of 35 circulations 1 minute, 64 ℃ 1 minute, 72 ℃ 1 minute, finally extend 72 ℃ 10 minutes.
7. the application when bordetella pertussis erythromycin resistance is detected that includes primer as claimed in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310743682.0A CN103667512A (en) | 2013-12-27 | 2013-12-27 | Primer for rapidly detecting drug tolerance of pertussis bordelella erythrocin from specimen and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310743682.0A CN103667512A (en) | 2013-12-27 | 2013-12-27 | Primer for rapidly detecting drug tolerance of pertussis bordelella erythrocin from specimen and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103667512A true CN103667512A (en) | 2014-03-26 |
Family
ID=50306282
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310743682.0A Pending CN103667512A (en) | 2013-12-27 | 2013-12-27 | Primer for rapidly detecting drug tolerance of pertussis bordelella erythrocin from specimen and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667512A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113088577A (en) * | 2020-01-08 | 2021-07-09 | 广东和信健康科技有限公司 | Method and kit for simultaneously detecting bordetella pertussis and drug-resistant mutation sites thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013136818A1 (en) * | 2012-03-15 | 2013-09-19 | 財団法人ヒューマンサイエンス振興財団 | Method and kit for detecting macrolide antibiotic-resistant mutant bacterium |
-
2013
- 2013-12-27 CN CN201310743682.0A patent/CN103667512A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013136818A1 (en) * | 2012-03-15 | 2013-09-19 | 財団法人ヒューマンサイエンス振興財団 | Method and kit for detecting macrolide antibiotic-resistant mutant bacterium |
Non-Patent Citations (7)
| Title |
|---|
| BARTKUS JM,ET AL,: "Identification of a mutation associated with erythromycin resistance in Bordetella pertussis: implication for surveillance of antimicrobial resistance", 《JCM》 * |
| DITTE M. DRAGSTED，ET AL: "Comparison of culture and PCR for detection of Bordetella pertussis and Bordetella parapertussis under routine laboratory conditions", 《JOURNAL OF MEDICAL MICROBIOLOGY》 * |
| Q. ZHANG, ET: "High-resolution melting analysis for the detection of two erythromycin-resistant Bordetella pertussis strains carried by healthy schoolchildren in China", 《CLIN MICROBIOL INFECT》 * |
| Z. WANG,ET AL: "High prevalence of erythromycin-resistant Bordetella pertussis in Xi’an, China", 《CLIN MICROBIOL INFECT》 * |
| ZENGGUO WANG, ET AL: "Appearance of macrolide-resistant bordetella pertussis strains in China", 《ANTIMICROB. AGENTS CHEMOTHER.》 * |
| 姚咏明，盛志勇: "《脓毒症防治学》", 31 December 2008, 科学技术文献出版社 * |
| 张明珠等: "培养法和PCR法对检测3种口腔常见微生物的比较研究", 《昆明医学院学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113088577A (en) * | 2020-01-08 | 2021-07-09 | 广东和信健康科技有限公司 | Method and kit for simultaneously detecting bordetella pertussis and drug-resistant mutation sites thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lawson et al. | Large-scale survey of Campylobacter species in human gastroenteritis by PCR and PCR–enzyme-linked immunosorbent assay | |
| Branda et al. | Performance of the Vitek MS v2. 0 system in distinguishing Streptococcus pneumoniae from nonpneumococcal species of the Streptococcus mitis group | |
| CN103421898A (en) | Triple real-time fluorescent PCR (polymerase chain reaction) detection primer, detection probe, detection kit and detection method for methicillin-resistant staphylococcus aureus | |
| Anochie et al. | Recent advances in the diagnosis of Mycobacterium tuberculosis | |
| CN111154900B (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| CN104212901A (en) | Composition for detecting drug resistance of staphylococcus aureus | |
| CN111485028A (en) | Fluorescent quantitative PCR method for detecting tilapia streptococcus agalactiae and corresponding kit | |
| CN104232783B (en) | Quick detection method for cow brucella attenuated vaccine strain A19 | |
| CN113699257A (en) | Specificity detection target spot and constant temperature detection method of Burkholderia cepacia complex | |
| CN103667512A (en) | Primer for rapidly detecting drug tolerance of pertussis bordelella erythrocin from specimen and detection method | |
| TWI504751B (en) | Sequence, technique platform, and method for detecting clostridium difficile ribotype 027 | |
| Li et al. | Gas chromatography–mass spectrometry method for rapid identification and differentiation of Burkholderia pseudomallei and Burkholderia mallei from each other, Burkholderia thailandensis and several members of the Burkholderia cepacia complex | |
| CN104846067A (en) | Duplex PCR detection kit and detection method for Listeria monocytogenes and Enterococcus faecium | |
| CN103421892A (en) | Multiple real-time fluorescent PCR method for identifying the drug-resistant mutation of macrolides and for identifying Campylobacter jejuni | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| KR101261292B1 (en) | Method and kit for identification of Mycobacterium sp. using real-time PCR | |
| CN108048586A (en) | A kind of detection method of ox kind Brucella sp attenuated vaccine strain S19 | |
| Nagdev et al. | Comparison of real-time PCR and conventional PCR assay using IS6110 region of Mycobacterium tuberculosis for efficient diagnosis of tuberculous meningitis and pulmonary tuberculosis | |
| CN111676300A (en) | Fluorescent quantitative PCR method for detecting toxigenic chlamydia pneumoniae and corresponding kit | |
| CN103820560B (en) | A kind of Primer composition for detecting mycobacterium tuberculosis and application thereof | |
| CN110358851B (en) | Nucleic acid sequence, primer, method and kit for detecting bacillus cereus | |
| CN116064866B (en) | Kit, primer, method and application for detecting Burkholderia cepacia group | |
| Wang et al. | Toxicity-based typing of clostridioides difficile by loop-mediated isothermal amplification (LAMP) in critically ill patients | |
| CN107287315A (en) | Detection kit, detection method and application for Shigella | |
| CN114214446B (en) | Bacillus strain horizontal identification method based on high-throughput sequencing technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140326 |