WO2013084148A2 - Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 - Google Patents
Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 Download PDFInfo
- Publication number
- WO2013084148A2 WO2013084148A2 PCT/IB2012/056950 IB2012056950W WO2013084148A2 WO 2013084148 A2 WO2013084148 A2 WO 2013084148A2 IB 2012056950 W IB2012056950 W IB 2012056950W WO 2013084148 A2 WO2013084148 A2 WO 2013084148A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- her3
- antibody
- seq
- fragment
- ligand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/24—Drugs for disorders of the endocrine system of the sex hormones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- This invention relates generally to antibodies or fragments thereof that recognize an epitope of of HER3 comprising residues within domain 2 resulting in inhibition of both ligand- dependent and ligand-independent signal transduction and tumor growth; and compositions and methods of use of such antibodies or fragments thereof.
- the human epidermal growth factor receptor 3 (ErbB 3, also known as HER3) is a receptor protein tyrosine kinase and belongs to the epidermal growth factor receptor (EGFR) subfamily of receptor protein tyrosine kinases, which also includes EGFR (HER1, ErbBl), HER2 (ErbB2, Neu), and HER4 (ErbB4) (Plowman et al, (1990) Proc. Natl. Acad. Sci. U.S.A.
- EGFR epidermal growth factor receptor
- the transmembrane receptor HER3 consists of an extracellular ligand- binding domain (ECD), a dimerization domain within the ECD, a transmembrane domain, an intracellular protein tyrosine kinase-like domain (TKD) and a C-terminal phosphorylation domain.
- ECD extracellular ligand- binding domain
- TKD intracellular protein tyrosine kinase-like domain
- C-terminal phosphorylation domain Unlike the other HER family members, the kinase domain of HER3 displays very low intrinsic kinase activity.
- the ligands neuregulin 1 (NRG) or neuregulin 2 bind to the extracellular domain of HER3 and activate receptor-mediated signaling pathway by promoting dimerization with other dimerization partners such as HER2. Heterodimerization results in activation and
- transphosphorylation of HER3's intracellular domain is a means not only for signal diversification but also signal amplification.
- HER3 heterodimerization can also occur in the absence of activating ligands and this is commonly termed ligand-independent HER3 activation.
- HER2 when HER2 is expressed at high levels as a result of gene amplification (e.g. in breast, lung, ovarian or gastric cancer) spontaneous HER2/HER3 dimers can be formed. In this situation the HER2/HER3 is considered the most active ErbB signaling dimer and is therefore highly transforming.
- the invention is based on the discovery of antibodies or fragments thereof that bind to an epitope (linear, non- linear, conformational) of HER3 receptor comprising amino acid residues within domain 2 of HER3. Surprisingly, binding of the antibodies or fragments thereof to an epitope within domain 2 of HER3 blocks both ligand-dependent (e.g. neuregulin) and ligand- independent HER3 signaling pathways.
- ligand-dependent e.g. neuregulin
- the invention pertains to an isolated antibody or fragment thereof that recognizes an epitope of a HER3 receptor, wherein the epitope comprises amino acid residues 208-328 within domain 2 of the HER3 receptor, wherein the antibody or fragment thereof recognizes at least amino acid residue 268 within domain 2, and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand-independent signal transduction.
- the eptiope is selected from the group consisting of a linear epitope, a non-linear epitope, and a conformational epitope.
- the antibody or fragment thereof binds to an inactive state of the HER3 receptor.
- HER3 ligand binding to the ligand binding site fails to activate HER3 signal transduction.
- a HER3 ligand can concurrently bind to the ligand binding site on the HER3 receptor.
- the HER3 ligand is selected from the group consisting of neuregulin 1 (NRG), neuregulin 2, betacellulin, heparin-binding epidermal growth factor, and epiregulin.
- the antibodies or fragments thereof described herein can bind to amino acid residue 268 (within domain 2).
- binding amino acid 268 affects binding in domain 2, thereby blocking antibody or antibody fragment binding.
- the antibody or fragment thereof has a characteristic selected from the group consisting of destabilizing HER3 such that it is susceptale to degradation, accelerating down regulation of cell surface HER3, inhibiting dimerization with other HER receptors, and generating an un-natural HER3 dimer that is susceptible to proteolytic degradation or unable to dimerize with other receptor tyrosine kinases.
- the binding of the antibody or fragment thereof to the HER3 receptor in the absence of a HER3 ligand reduces ligand-independent formation of a HER2- HER3 protein complex in a cell which expresses HER2 and HER3.
- the HER3 receptor fails to dimerize with the HER2 receptor to form a HER2-HER3 protein complex. In one embodiment, the failure to form a HER2-HER3 protein complex prevents activation of signal transduction. In one embodiment, the antibody or fragment thereof inhibits phosphorylation of HER3 as assessed by a HER3 ligand-independent phosphorylation assay. In one embodiment, the HER3 ligand-independent phosphorylation assay uses HER2 amplified cells, wherein the HER2 amplified cells are SK-Br-3 cells and BT-474.
- binding of the antibody or fragment thereof to the HER3 receptor in the presence of a HER3 ligand reduces ligand-dependent formation of a HER2-HER3 protein complex in a cell which expresses HER2 and HER3.
- the HER3 receptor fails to dimerize with the HER2 receptor in the presence of a HER3 ligand to form a HER2- HER3 protein complex.
- the failure to form a HER2-HER3 protein complex prevents activation of signal transduction.
- the antibody or fragment thereof inhibits phosphorylation of HER3 as assessed by HER3 ligand-dependent phosphorylation assay.
- the HER3 ligand-dependent phosphorylation assay uses stimulated MCF7 cells in the presence of neuregulin (NRG).
- the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a humanized antibody, and a synthetic antibody.
- the invention pertains to an isolated antibody or fragment thereof that recognizes a epitope of a HER3 receptor within domain 2 of the HER3 receptor, wherein the epitope comprises amino acid residues 208-328 within domain 2 of the HER3 receptor, wherein the antibody or fragment thereof recognizes at least amino acid residue 268 within domain 2, and wherein the antibody or fragment thereof has a dissociation (KD) of at least 1 x 10 7 M “1 , 10 8 M “1 , 10 9 M “1 , 10 10 M “1 , 10 11 M “1 , 10 12 M “1 , 10 13 M “1 , and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand-independent signal transduction.
- KD dissociation
- the antibody or fragment thereof inhibits phosphorylation of HER3 as measured by an in vitro phosphorylation assay selected from the group consisting of phospho- HER3 and phospho-Akt.
- the antibody or fragment thereof binds to the same epitope as an antibody described in Table 1.
- the isolated antibody or fragment thereof cross-competes with an antibody described in Table 1.
- the fragment of an antibody that selected from the group consisting of; Fab, F(ab 2 )', F(ab) 2 ', scFv, VHH, VH, VL, dAbs.
- the invention pertains to a pharmaceutical composition comprising an antibody or fragment thereof and a pharmaceutically acceptable carrier, wherein the antibody or fragment thereof binds a HER3 receptor comprising amino acid residues 208-328 within domain 2 of the HER3 receptor, wherein the antibody or fragment thereof recognizes at least amino acid residue 268 within domain 2, and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand-independent signal transduction.
- the pharmaceutical composition further comprises an additional therapeutic agent.
- the additional therapeutic agent is selected from the group consisting of an HER1 inhibitor, a HER2 inhibitor, a HER3 inhibitor, a HER4 inhibitor, an mTOR inhibitor and a PI3 Kinase inhibitor.
- the additional therapeutic agent is a HER1 inhibitor selected from the group consisting of Matuzumab (EMD72000),
- HER2 inhibitor selected from the group consisting of Pertuzumab, Trastuzumab, MM-111, neratinib, lapatinib or lapatinib ditosylate /Tykerb®; a HER3 inhibitor selected from the group consisting of, MM- 121, MM-111, IB4C3, 2DID12 (U3 Pharma AG), AMG888 (Amgen), AV-203(Aveo), MEHD7945A
- the additional therapeutic agent is an mTOR inhibitor selected from the group consisting of Temsirolimus/Torisel®, ridaforolimus / Deforolimus, AP23573, MK8669, everolimus /Affinitor®.
- the additional therapeutic agent is a PI3 Kinase inhibitor selected from the group consisting of GDC 0941, BEZ235, BMK120 and BYL719.
- the invention pertains to a method of treating a cancer comprising selecting a subject having an HER3 expressing cancer, administering to the subject an effective amount of a composition comprising an antibody or fragment thereof disclosed in Table 1 , wherein the antibody or fragment thereof recognizes an epitope of a HER3 receptor comprising amino acid residues 208-328 within domain 2 of the HER3 receptor, wherein the antibody or fragment thereof recognizes at least amino acid residue 268 within domain 2, and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand-independent signal transduction.
- the subject is a human and the cancer is selected from the group consisting of breast cancer, colorectal cancer, lung cancer, multiple myeloma, ovarian cancer, liver cancer, gastric cancer, pancreatic cancer, acute myeloid leukemia, chronic myeloid leukemia, osteosarcoma, squamous cell carcinoma, peripheral nerve sheath tumors , schwannoma, head and neck cancer, bladder cancer, esophageal cancer, Barretts esophageal cancer, glioblastoma, clear cell sarcoma of soft tissue, malignant mesothelioma,
- the cancer is breast cancer.
- the invention pertains to an antibody or fragment thereof for use in treating a cancer mediated by a HER3 ligand-dependent signal transduction or ligand-independent signal transduction pathway. In one aspect, the invention pertains to an antibody or fragment thereof for use as a medicament.
- the invention pertains to use of an antibody or fragment thereof for the manufacture of a medicament for the treatment of a cancer mediated by a HER3 ligand-dependent signal transduction or ligand-independent signal transduction pathway selected from the group consisting of of breast cancer, colorectal cancer, lung cancer, multiple myeloma, ovarian cancer, liver cancer, gastric cancer, pancreatic cancer, acute myeloid leukemia, chronic myeloid leukemia, osteosarcoma, squamous cell carcinoma, peripheral nerve sheath tumors , schwannoma, head and neck cancer, bladder cancer, esophageal cancer, Barretts esophageal cancer, glioblastoma, clear cell sarcoma of soft tissue, malignant mesothelioma, neurofibromatosis, renal cancer, melanoma, prostate cancer, benign prostatic hyperplasia (BPH), gynacomastica, and endometriosis.
- Figure 1 Representative MORI 2616 and MORI 2925 SET curves obtained with human
- Figure 2 SK-Br-3 cell binding determination by FACS titration
- Figure 5 HER3 epitope competition by ELISA
- Figure 6 Inhibition of ligand induced HER3 and Akt phosphorylation
- Figure 7 Inhibition of ligand independent HER3 and Akt phosphorylation in HER2 amplified cell lines
- Figure 8 Inhibition of (A) ligand dependent and (B, C) ligand independent cell proliferation; and Figure 9: Data showing in vivo inhibition of tumor growth in BxPC3 (A) and BT474 (B). Detailed Description of the Invention
- signal transduction or “signaling activity” as used herein refers to a biochemical causal relationship generally initiated by a protein-protein interaction such as binding of a growth factor to a receptor, resulting in transmission of a signal from one portion of a cell to another portion of a cell.
- the transmission involves specific phosphorylation of one or more tyrosine, serine, or threonine residues on one or more proteins in the series of reactions causing signal transduction.
- Penultimate processes typically include nuclear events, resulting in a change in gene expression.
- HER3 or "HER3 receptor” also known as "ErbB3” as used herein refers to mammalian HER3 protein and "her3” or “erbB3” refers to mammalian her3 gene.
- the preferred HER3 protein is human HER3 protein present in the cell membrane of a cell.
- the human her3 gene is described in U.S. Pat. No. 5,480,968 and Plowman et ah, (1990) Proc. Natl. Acad. Sci. USA, 87:4905-4909.
- Human HER3 as defined in Accession No. NP 001973 (human), and represented below as SEQ ID NO: 1. All nomenclature is for full length, immature HER3 (amino acids 1-1342). The immature HER3 is cleaved between positions 19 and 20, resulting in the mature HER3 protein (20-1342 amino acids).
- HER3 ligand refers to polypeptides which bind and activate HER3.
- HER3 ligands include, but are not limited to neuregulin 1 (NRG) and neuregulin 2, betacellulin, heparin-binding epidermal growth factor, and epiregulin.
- NRG neuregulin 1
- neuregulin 2 betacellulin
- betacellulin betacellulin
- epiregulin epiregulin
- the term includes biologically active fragments and/or variants of a naturally occurring polypeptide.
- the "HER2-HER3 protein complex” is a noncovalently associated oligomer containing HER2 receptor and the HER3 receptor. This complex can form when a cell expressing both of these receptors is exposed to a HER3 ligand e.g., NRG or when HER2 is active/overexpressed
- HER3 activity or "HER3 activation” refers to an increase in oligomerization (e.g. an increase in HER3 containing complexes), HER3 phosphorylation, conformational rearrangements (for example those induced by ligands), and HER3 mediated downstream signaling.
- stabilization or “stabilized” used in the context of HER3 refers to an antibody or fragment thereof that directly maintains (locks, tethers, holds, preferentially binds, favors) the inactive state or conformation of HER3 without blocking ligand binding to HER3, such that ligand binding is no longer able to activate HER3.
- ligand-dependent signaling refers to the activation of HER3 via ligand. HER3 activation is evidenced by increased heterodimerization and/ or HER3 phosphorylation such that downstream signaling pathways (e.g. PI3K) are activated.
- the antibody or fragment thereof can statistically significantly reduce the amount of
- HER3 in a stimulated cell exposed to an antibody or fragment thereof relative to an untreated (control) cell, as measured using the assays described in the Examples.
- the cell which expresses HER3 can be a naturally occurring cell line (e.g. MCF7) or can be recombinantly produced by introducing nucleic acids encoding HER3 protein into a host cell. Cell stimulation can occur either via the exogenous addition of an activating HER3 ligand or by the endogenous expression of an activating ligand.
- the antibody or fragment thereof which "reduces neregulin-induced HER3 activation in a cell” is one which statistically significantly reduces HER3 tyrosine phosphorylation relative to an untreated (control) cell, as measured using the assays described in the Examples. This can be determined based on HER3 phosphotyrosine levels following exposure of HER3 to NRG and the antibody of interest.
- the cell which expresses HER3 protein can be a naturally occurring cell or cell line (e.g. MCF7) or can be recombinantly produced.
- ligand-independent signaling refers to cellular HER3 activity (e.g phosphorylation) in the absence of a requirement for ligand binding.
- ligand- independent HER3 activation can be a result of HER2 overexpression or activating mutations in HER3 heterodimer partners such as EGFR and HER2.
- the antibody or fragment thereof can statistically significantly reduce the amount of phosphorylated HER3 in a cell exposed to an antibody or fragment thereof relative to an untreated (control) cell.
- the cell which expresses HER3 can be a naturally occurring cell line (e.g. SK-Br-3) or can be recombinantly produced by introducing nucleic acids encoding HER3 protein into a host cell.
- blocks refers to stopping or preventing an interaction or a process, e.g., stopping ligand-dependent or ligand-independent signaling.
- recognition refers to an antibody or fragment thereof that finds and interacts (e.g., binds) with its epitope in domain 2 of HER3.
- an antibody or fragment thereof that interacts with at least one amino acid residue within domain 2 of HER3 (amino acid residues 208-328 of SEQ ID NO: 1).
- HER3 ligand that can bind to a ligand binding site on the HER3 receptor along with the HER3 antibody or fragment thereof. This means that both the antibody and ligand can bind to the HER3 receptor together.
- the HER3 ligand NRG can bind to the HER3 receptor along with the HER3 antibody. Assay to measure concurrent binding of the ligand and antibody are described in the Examples section.
- the term “fails” as used herein refers to an antibody or fragment thereof that does not do a particular event.
- an antibody or fragment thereof that “fails to activate signal transduction” is one that does not trigger signal transduction.
- the term “antibody” as used herein refers to whole antibodies that interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an HER3 epitope and inhibit signal transduction.
- a naturally occurring "antibody” is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
- Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
- the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
- Each light chain is comprised of a light chain variable region
- VL light chain constant region
- the light chain constant region is comprised of one domain, CL.
- CL complementarity determining regions
- FR framework regions
- Each VH and VL is composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
- the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
- antibody includes for example, monoclonal antibodies, human antibodies, humanized antibodies, camelised antibodies, chimeric antibodies, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv), Fab fragments, F (ab') fragments, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above.
- the antibodies can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
- variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity.
- the constant domains of the light chain (CL) and the heavy chain (CHI, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like.
- the N-terminus is a variable region and at the C-terminus is a constant region; the CH3 and CL domains actually comprise the carboxy-terminus of the heavy and light chain, respectively.
- antibody fragment refers to one or more portions of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an HER3 epitope and inhibit signal transduction.
- binding fragments include, but are not limited to, a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F(ab) 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CHI domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment (Ward et al, (1989) Nature 341 :544- 546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
- a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
- F(ab) 2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
- a Fd fragment consisting of the VH and CHI domains
- the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al, (1988) Science 242:423-426; and Huston et al, (1988) Proc. Natl. Acad. Sci. 85:5879-5883).
- single chain Fv single chain Fv
- Such single chain antibodies are also intended to be encompassed within the term "antibody fragment”.
- antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
- Antibody fragments can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, (2005) Nature Biotechnology 23: 1126-1136).
- Antibody fragments can be grafted into scaffolds based on polypeptides such as Fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide monobodies).
- Fn3 Fibronectin type III
- Antibody fragments can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al., (1995) Protein Eng.
- epitope includes any protein determinant capable of specific binding to an immunoglobulin or otherwise interacting with a molecule.
- Epitopic determinants generally consist of chemically active surface groupings of molecules such as amino acids or carbohydrate or sugar side chains and can have specific three-dimensional structural characteristics, as well as specific charge characteristics.
- An epitope may be "linear,” “nonlinear” or “conformational.” In one embodiment, the epitope is within domain 2 of HER3. In one embodiment, the epitope is a linear epitope within domain 2 of HER3. In one
- the epitope is a non-linear epitope within domain 2 of HER3. In another embodiment, the epitope is a conformational epitope comprising amino acids residues within domain 2 of HER3. In one embodiment, the epitope compises at least one of amino acid residue within domain 2 of HER3 (amino acids 208-328 of SEQ ID NO: 1), or a subset thereof. In one embodiment, the epitope compises at least amino acid Lys268 (within domain 2) of SEQ ID NO: 1. Antibodies or fragments thereof described herein can bind to Lys268 within domain 2 of HER3.
- linear epitope refers to an epitope with all of the points of interaction between the protein and the interacting molecule (such as an antibody) occur linearally along the primary amino acid sequence of the protein (i.e., continuous amino acids).
- An epitope can comprises those residues to which the antibody binds.
- non-linear epitope refers to epitope with non-contiguous amino acids that form a three-dimensional structure within a particular domain (e.g., within domain 1, within domain 2, within domain 3, or within domain 4). In one embodiment, the non-linear epitope is within domain 2. The non-linear epitope may also occur between two or more domains (e.g., the interface between domains 3-4). Non-linear epitope also refers to non-contiguous amino acids that are a result of a three-dimensional structure within a particular domain.
- the term “non-linear epitope” refers to epitope with non-contiguous amino acids that form a three-dimensional structure within a particular domain (e.g., within domain 1, within domain 2, within domain 3, or within domain 4). In one embodiment, the non-linear epitope is within domain 2. The non-linear epitope may also occur between two or more domains (e.g., the interface between domains 3-4). Non-linear epitope also refer
- “conformational epitope” refers to an epitope in which discontinuous amino acids that come together in three dimensional configuration involving at least two different domains, such as domain 2 and domain 4; or domain 3 and domain 4 In a conformational epitope, the points of interaction occur across amino acid residues on the protein that are separated from one another. As will be appreciated by one of skill in the art, the space that is occupied by a residue or side chain that creates the shape of a molecule helps to determine what an epitope is.
- antibodies specific for a particular target antigen will preferentially recognize an epitope on the target antigen in a complex mixture of proteins and/or macromolecules.
- Regions of a given polypeptide that include an epitope can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E.Morris, Ed., 1996) Humana Press, Totowa, New Jersey. For example, linear epitopes may be determined by e.g., concurrently
- conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., hydrogen/deuterium exchange, x-ray crystallography and two-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra.
- Antigenic regions of proteins can also be identified using standard antigenicity and hydropathy plots, such as those calculated using, e.g., the Omiga version 1.0 software program available from the Oxford Molecular Group. This computer program employs the Hopp/Woods method, Hopp et al, (1981) Proc. Natl. Acad.
- monoclonal antibody or “monoclonal antibody composition” as used herein refers to polypeptides, including antibodies, antibody fragments, bispecific antibodies, etc. that have substantially identical to amino acid sequence or are derived from the same genetic source. This term also includes preparations of antibody molecules of single molecular composition.
- a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
- human antibody includes antibodies having variable regions in which both the framework and CDR regions are derived from sequences of human origin. Furthermore, if the antibody contains a constant region, the constant region also is derived from such human sequences, e.g., human germline sequences, or mutated versions of human germline sequences or antibody containing consensus framework sequences derived from human framework sequences analysis, for example, as described in Knappik et al., (2000) J Mol Biol 296:57-86).
- immunoglobulin variable domains e.g., CDRs
- CDRs may be defined using well known numbering schemes, e.g., the Kabat numbering scheme, the Chothia numbering scheme, or a combination of Kabat and Chothia (see, e.g., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services (1991), eds. Kabat et al; Lazikani et al, (1997) J. Mol. Bio. 273:927-948); Kabat et al, (1991) Sequences of Proteins of Immunological Interest, 5th edit., NIH Publication no. 91-3242 U.S.
- the human antibodies of the invention may include amino acid residues not encoded by human sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo, or a conservative substitution to promote stability or manufacturing) .
- the phrase "human monoclonal antibody” as used herein refers to antibodies displaying a single binding specificity which have variable regions in which both the framework and CDR regions are derived from human sequences.
- the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic nonhuman animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
- recombinant human antibody includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human
- immunoglobulin genes or a hybridoma prepared therefrom antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene, sequences to other DNA sequences.
- Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences.
- such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the V H and V L regions of the recombinant antibodies are sequences that, while derived from and related to human germline V H and V L sequences, may not naturally exist within the human antibody germline repertoire in vivo.
- Specific binding between two entities means a binding with an equilibrium constant (KA) (k on /k off ) of at least 10 2 M _1 , at least 5xl0 2 M _1 , at least 10 3 M _1 , at least 5xl0 3 M _1 , at least 10 4 M " at least 5xl0 4 M _1 , at least 10 5 M _1 , at least 5xl0 5 M _1 , at least 10 6 M _1 , at least 5xl0 6 M _1 , at least 10 7 M _1 , at least 5xl0 7 M _1 , at least 10 8 M _1 , at least 5xl0 8 M _1 , at least 10 9 M _1 , at least 5xl0 9 M _1 , at least 10 10 M _1 , at least 5xl0 9 M _1 , at least 10 10 M _1 , at least 5xl0 9 M _1 , at least
- an HER3 binding antibody of the invention typically also has a dissociation rate constant (K D ) (k 0ff /k on ) of less than 5xlO "2 M, less than 10 "2 M, less than 5xlO "3 M, less than 10 "3 M, less than 5xlO "4 M, less than 10 "4 M, less than 5xlO "5 M, less than 10 "5 M, less than 5xlO "6 M, less than 10 "6 M, less than 5xlO "7 M, less than 10 "7 M, less than 5xlO "8 M, less than 10 "8 M, less than 5xlO "9 M, less than 10 " 9 M, less than 5xlO "10 M, less than 10 "10 M, less than 10 "10 M, less than
- the antibody or fragment thereof has dissociation constant (Ka) of less than 3000 pM, less than 2500 pM, less than 2000 pM, less than 1500 pM, less than 1000 pM, less than 750 pM, less than 500 pM, less than 250 pM, less than 200 pM, less than 150 pM, less than 100 pM, less than 75 pM, less than 10 pM, less than 1 pM as assessed using a method described herein or known to one of skill in the art (e.g., a BIAcore assay, ELISA, FACS, SET) (Biacore International AB, Uppsala, Sweden).
- Ka dissociation constant
- Kassoc or “Ka”, as used herein, refers to the association rate of a particular antibody-antigen interaction
- ⁇ 8 " or Kd refers to the dissociation rate of a particular antibody-antigen interaction
- KD refers to the dissociation constant, which is obtained from the ratio of Ka to Ka (i.e. IQ/Ka) and is expressed as a molar concentration (M).
- KD values for antibodies can be determined using methods well established in the art. A method for determining the KD of an antibody is by using surface plasmon resonance, or using a biosensor system such as a Biacore® system.
- antibody refers to the strength of interaction between antibody and antigen at single antigenic sites. Within each antigenic site, the variable region of the antibody “arm” interacts through weak non-covalent forces with antigen at numerous sites; the more interactions, the stronger the affinity.
- vidity refers to an informative measure of the overall stability or strength of the antibody-antigen complex. It is controlled by three major factors: antibody epitope affinity; the valence of both the antigen and antibody; and the structural arrangement of the interacting parts. Ultimately these factors define the specificity of the antibody, that is, the likelihood that the particular antibody is binding to a precise antigen epitope.
- valency refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds one target molecule or specific site (i.e, epitope) on a target molecule. When a polypeptide comprises more than one target binding site, each target binding site may specifically bind the same or different molecules (e.g., may bind to different molecules, e.g., different antigens, or different epitopes on the same molecule).
- inhibitorting antibody refers to an antibody that binds with HER3 and inhibits the biological activity of HER3 signaling, e.g., reduces, decreases and/or inhibits HER3 induced signaling activity, e.g., in a phospho-HER3 or phospho-Akt assay. Examples of assays are described in more details in the examples below. Accordingly, an antibody that "inhibits" one or more of these HER3 functional properties (e.g., biochemical,
- an antibody that inhibits HER3 activity effects such a statistically significant decrease by at least 10% of the measured parameter, by at least 50%>, 80%> or 90%>, and in certain embodiments an antibody of the invention may inhibit greater than 95%, 98% or 99% of HER3 functional activity as evidenced by a reduction in the level of cellular HER3 phosphorylation.
- isolated antibody refers to an antibody that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds HER3 is substantially free of antibodies that specifically bind antigens other than HER3).
- An isolated antibody that specifically binds HER3 may, however, have cross- reactivity to other antigens.
- an isolated antibody may be substantially free of other cellular material and/or chemicals.
- conservatively modified variant applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences.
- nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid that encodes a polypeptide is implicit in each described sequence.
- the following eight groups contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
- the term "conservative sequence modifications” are used to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence.
- cross-compete and “cross-competing” are used interchangeably herein to mean the ability of an antibody or fragment thereof to interfere with the binding of other antibodies or fragments thereof to HER3 in a standard competitive binding assay.
- the ability or extent to which an antibody of fragment thereof is able to interfere with the binding of another antibody or fragment thereof to HER3 , and therefore whether it can be said to cross-compete according to the invention, can be determined using standard competition binding assays.
- One suitable assay involves the use of the Biacore technology ⁇ e.g. by using the BIAcore 3000 instrument (Biacore, Uppsala, Sweden)), which can measure the extent of interactions using surface plasmon resonance technology.
- Another assay for measuring cross-competing uses an ELISA-based approach.
- the term "optimized” as used herein refers to a nucleotide sequence has been altered to encode an amino acid sequence using codons that are preferred in the production cell or organism, generally a eukaryotic cell, for example, a cell of Pichia, a cell of Trichoderma, a Chinese Hamster Ovary cell (CHO) or a human cell.
- the optimized nucleotide sequence is engineered to retain completely or as much as possible the amino acid sequence originally encoded by the starting nucleotide sequence, which is also known as the "parental" sequence.
- Standard assays to evaluate the binding ability of the antibodies toward HER3 of various species are known in the art, including for example, ELISAs, western blots and RIAs.
- Suitable assays are described in detail in the Examples.
- the binding kinetics (e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis, or FACS relative affinity (Scatchard).
- Assays to evaluate the effects of the antibodies on functional properties of HER3 are described in further detail in the Examples.
- percent identical in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that are the same.
- Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same ⁇ i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
- the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well known in the art.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol.
- BLAST and BLAST 2.0 algorithms Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402; and Altschul et al., (1990) J. Mol. Biol. 215:403-410, respectively.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra).
- initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
- the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787).
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
- the percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller, (1988) Comput. Appl. Biosci. 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
- the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossom 62 matrix or a
- PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
- another indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below.
- a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
- Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
- nucleic acid is used herein interchangeably with the term “polynucleotide” and refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
- the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
- Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
- nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g. , degenerate codon substitutions) and
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., (1991) Nucleic Acid Res. 19:5081; Ohtsuka et al., (1985) J. Biol. Chem. 260:2605-2608; and Rossolini et al., (1994) Mol. Cell. Probes 8:91-98).
- operably linked refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence.
- a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
- promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis- acting.
- some transcriptional regulatory sequences, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose
- polypeptide and protein are used interchangeably herein to refer to a polymer of amino acid residues.
- the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. Unless otherwise indicated, a particular polypeptide sequence also implicitly encompasses conservatively modified variants thereof.
- subject as used herein includes human and non-human animals. Non-human animals include all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dog, cow, chickens, amphibians, and reptiles. Except when noted, the terms "patient” or “subject” are used herein interchangeably.
- anti-cancer agent refers to any agent that can be used to treat a cell proliferative disorder such as cancer, including cytotoxic agents, chemotherapeutic agents, radiotherapy and radiotherapeutic agents, targeted anti-cancer agents, and immunotherapeutic agents.
- tumor refers to neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
- anti-tumor activity refers to a reduction in the rate of tumor cell proliferation, viability, or metastatic activity. A possible way of showing anti-tumor activity is show a decline in growth rate of abnormal cells that arises during therapy or tumor size stability or reduction. Such activity can be assessed using accepted in vitro or in vivo tumor models, including but not limited to xenograft models, allograft models, MMTV models, and other known models known in the art to investigate anti-tumor activity.
- malignancy refers to a non-benign tumor or a cancer.
- cancer refers to a malignancy characterized by deregulated or uncontrolled cell growth.
- exemplary cancers include: carcinomas, sarcomas, leukemias, and lymphomas.
- carcinomas e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original tumor
- secondary malignant tumors e.g., those arising from metastasis, the migration of tumor cells to secondary sites that are different from the site of the original tumor.
- HER receptors have an extracellular ligand-binding domain, a single trans-membrane domain and a cytoplasmic tyrosine kinase-containing domain.
- the intracellular tyrosine kinase domain of HER receptors is highly conserved, although the kinase domain of HER3 contains substitutions of critical amino acids and therefore lacks kinase activity (Guy et al., (1994): PNAS 91, 8132-8136).
- Ligand-induced dimerisation of the HER receptors induces activation of the kinase, receptor transphosphorylation on tyrosine residues in the C-terminal tail, followed by recruitment and activation of intracellular signalling effectors (Yarden and Sliwkowski, (2001) Nature Rev 2, 127-137; Jorissen et al, (2003) Exp Cell Res 284, 31-53.
- the crystal structures of the extracellular domains of HERs have provided some insight into the process of ligand-induced receptor activation (Schlessinger, (2002) Cell 110, 669-672).
- the extracellular domain of each HER receptor consists of four subdomains: Subdomain I and III cooperate in forming the ligand-binding site, whereas subdomain II (and perhaps also subdomain IV) participates in receptor dimerisation via direct receptor-receptor interactions.
- a ⁇ hairpin in subdomain II interacts with the dimerisation loop of the partner receptor, mediating receptor dimerisation (Garrett et al, (2002) Cell 110, 763-773; Ogiso et al, (2002) Cell 110, 775-787).
- the dimerisation loop is engaged in intramolecular interactions with subdomain IV, which prevents receptor dimerisation in the absence of ligand (Cho and Leahy, (2002) Science 297, 1330-1333;
- HER2 has a conformation that resembles the ligand-activated state of HER 1 with a protruding
- HER receptor crystal structures provide a model for HER receptor homo- and heterodimerisation, the background for the prevalence of some HER homo- and heterodimers over others (Franklin et al, (2004) Cancer Cell 5, 317-328) as well as the role of each of the domain in receptor dimerisation and autoinhibition (Burgess et al, (2003) Mol Cell 12, 541- 552; Mattoon et al, (2004) PNAS101, 923-928) remains somewhat unclear.
- the present invention provides an additional class of antibodies or fragments thereof that bind a linear, non- linear, or conformational epitope within domain 2 of HER3. These antibodies or fragments thereof interact with HER3 to inhibit both ligand dependent and ligand independent signal transduction.
- crystals of HER3 may be prepared by expressing a nucleotide sequence encoding HER3 or a variant thereof in a suitable host cell, and then crystallising the purified protein(s) in the presence of the relevant HER3 targeted Fab.
- the HER3 polypeptide contains the extracellular domain (amino acids 20 to 640 of the human polypeptide (SEQ ID NO: 1) or a truncated version thereof, preferably comprising amino acids 20-640) but lacks the extracellular domain (amino acids 20 to 640 of the human polypeptide (SEQ ID NO: 1) or a truncated version thereof, preferably comprising amino acids 20-640) but lacks the extracellular domain (amino acids 20 to 640 of the human polypeptide (SEQ ID NO: 1) or a truncated version thereof, preferably comprising amino acids 20-640) but lacks the extracellular domain (amino acids 20 to 640 of the human polypeptide (SEQ ID NO: 1) or a t
- HER3 polypeptides may also be produced as fusion proteins, for example to aid in extraction and purification.
- fusion protein partners include glutathione-S-transferase (GST), histidine (HIS), hexahistidine (6HIS), GAL4 (DNA binding and/or transcriptional activation domains) and beta-galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences.
- the proteins may be purified and/or concentrated, for example by
- the protein(s) may be crystallised using techniques described herein. Commonly, in a crystallisation process, a drop containing the protein solution is mixed with the crystallisation buffer and allowed to equilibrate in a sealed container. Equilibration may be achieved by known techniques such as the "hanging drop” or the “sitting drop” method. In these methods, the drop is hung above or sitting beside a much larger reservoir of crystallization buffer and equilibration is reached through vapor diffusion. Alternatively, equilibration may occur by other methods, for example under oil, through a semi-permeable membrane, or by free- interface diffusion (See e.g., Chayen et al., (2008) Nature Methods 5, 147 - 153.
- the structure may be solved by known X-ray diffraction techniques.
- Many techniques use chemically modified crystals, such as those modified by heavy atom derivatization to approximate phases.
- a crystal is soaked in a solution containing heavy metal atom salts, or organometallic compounds, e.g., lead chloride, gold thiomalate, thimerosal or uranyl acetate, which can diffuse through the crystal and bind to the surface of the protein.
- the location(s) of the bound heavy metal atom(s) can then be determined by X-ray diffraction analysis of the soaked crystal.
- the patterns obtained on diffraction of a monochromatic beam of X-rays by the atoms (scattering centres) of the crystal can be solved by mathematical equations to give mathematical coordinates.
- the diffraction data are used to calculate an electron density map of the repeating unit of the crystal.
- Another method of obtaining phase information is using a technique known as molecular replacement. In this method, rotational and translational alogrithms are applied to a search model derived from a related structure, resulting in an approximate orientation for the protein of interest (See Rossmann, (1990) Acta Crystals A 46, 73-82).
- the electron density maps are used to establish the positions of the individual atoms within the unit cell of the crystal (Blundel et al., (1976) Protein Crystallography, Academic Press).
- the approximate domain boundaries of extracellular domain of HER3 are as follows; domain 1 : amino acids 20-207; domain 2: amino acids 208-328; domain 3: amino acids 329-498; and domain 4: amino acids 499-642.
- the three-dimensional structure of HER3 and the antibody allows the identification of target binding sites for potential HER3 modulators.
- Preferred target binding sites are those involved in the activation of HER3.
- the target binding site is located within domain 2 of HER3.
- an antibody or fragment thereof which binds to domain 2 can, for example, modulate HER3 activation by modifying the relative position of the domain relative to itself or other HER3 domains.
- binding an antibody or fragment thereof to amino acid residues within domain 2 may cause the protein to adopt a configuraton that prevents activation or prevent dimerisation with dimerizing partners (e.g., HER2).
- the antibody or fragment thereof recognize a specific conformational state of HER3 such that the antibody or fragment thereof prevents HER3 from interacting with a co-receptor (including, but not limited to, HER1, HER2 and HER4). In some embodiments, the antibody or fragment thereof prevents HER3 from interacting with a co- receptor by stabilizing the HER3 receptor in an inactive or closed state. In some
- the antibody or fragment thereof may stabilize the HER3 receptor by binding to amino acid residues within domain 2 of HER3.
- the antibody or fragment thereof binds to human HER3 protein having an epitope comprising HER3 amino acid residues within domain 2 (amino acids 208-328 of SEQ ID NO: 1), or a subset thereof.
- the antibody or fragment thereof binds to amino acids within or overlapping amino acid residue within domain 2 (amino acids 208-328 of SEQ ID NO: 1).
- the antibody or fragment thereof described herein can bind to Lys 268 within domain 2 of HER3.
- the antibody or fragment thereof binds to a linear epitope within domain 2 of HER3.
- the antibody or fragment thereof binds to a non- linear epitope within domain 2 of HER3.
- the antibody or fragment thereof binds to a conformational epitope within domain 2 of HER3.
- the antibody or fragment thereof binds to the epitope in domain 2 of HER3 such that the dimerization loop within domain 2 of HER3 is unavailable for dimerization with a co-receptor.
- the failure to form homo- or heterodimers results in failure to activate signal transduction.
- the antibody or fragment thereof can binds to an epitope in domain 2 in either the active or inactive state of HER3.
- the antibody or fragment thereof binds an epitope in domain 2 of HER3 receptor, where binding of the antibody or fragment thereof to the HER3 receptor allows dimerization with a co-receptor to form an inactive receptor-receptor complex.
- the formation of the inactive receptor-receptor complex prevents activation of ligand-independent signal transduction.
- HER3 may exists in an inactive state, however the overexpression of HER2 causes HER2-HER3 complex formation, however these resulting complexes are inactive and prevent activation of ligand- independent signal transduction.
- the domain(s)/region(s) containing residues that are in contact with or are buried by an antibody can be identified by mutating specific residues in HER3 (e.g., a wild-type antigen) and determining whether antibody or fragment thereof can bind the mutated or variant HER3 protein or measure changes of affinity from wild-type.
- residues that play a direct role in binding or that are in sufficiently close proximity to the antibody such that a mutation can affect binding between the antibody and antigen can be identified. From a knowledge of these amino acids, the domain(s) or region(s) of the antigen (HER3) that contain residues in contact with the antibody or covered by the antibody can be elucidated.
- Mutagenesis using known techniques such as alanine-scanning can help define functionally relevant epitopes.
- Mutagenesis utilizing an arginine/glutamic acid scanning protocol can also be employed (see, e.g., Nanevicz et ah, (1995), J. Biol. Chem. 270(37):21619-21625 and Zupnick et al, (2006), J. Biol. Chem. 281(29):20464-20473).
- arginine and glutamic acids are substituted (typically individually) for an amino acid in the wild-type polypeptide because these amino acids are charged and bulky and thus have the potential to disrupt binding between an antigen binding protein and an antigen in the region of the antigen where the mutation is introduced.
- Arginines that exist in the wild-type antigen are replaced with glutamic acid.
- a variety of such individual mutants can be obtained and the collected binding results analyzed to determine what residues affect binding.
- a series of mutant HER3 antigens can be created, with each mutant antigen having a single mutation.
- Binding of each mutant HER3 antigen with various HER3 antibodies or fragments thereof can be measured and compared to the ability of the selected an antibody or fragments thereof to bind wild-type HER3 (SEQ ID NO: 1). Examples of such mutants are shown below in the Examples section, e.g., Lys 268 Als mutant.
- an alteration (for example a reduction or increase) in binding between an antibody or fragment thereof and a mutant or variant HER3 as used herein means that there is a change in binding affinity (e.g., as measured by known methods such as Biacore testing or the bead based assay described below in the examples), EC50, and/or a change (for example a reduction) in the total binding capacity of the antigen binding protein (for example, as evidenced by a decrease in B max in a plot of antigen binding protein concentration versus antigen concentration).
- a significant alteration in binding indicates that the mutated residue is involved in binding to the antibody or fragment thereof.
- a significant reduction in binding means that the binding affinity, EC50, and/or capacity between an antibody or fragments thereof and a mutant HER3 antigen is reduced by greater than 10%, greater than 20%, greater than 40%, greater than 50%, greater than 55%, greater than 60%, greater than 65%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90% or greater than 95% relative to binding between the an antibody or fragment thereof and a wild type HER3 (e.g., SEQ ID NO: 1).
- a wild type HER3 e.g., SEQ ID NO: 1
- binding of an antibody or fragments thereof is significantly reduced or increased for a mutant HER3 protein having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations as compared to a wild-type HER3 protein (e.g., SEQ ID NO: 1).
- variant forms are referenced with respect to the wild-type sequence shown in SEQ ID NO: 1, it will be appreciated that in an allelic or splice variants of HER3 the amino acids could differ. Antibodies or fragments thereof showing significantly altered binding (e.g., lower or higher binding) for such allelic forms of HER3 are also contemplated.
- the structure of the CDRs contribute to a paratope, through which an antibody is able to bind to an epitope.
- the shape of such a paratope may be determined in a number of ways.
- Traditional structural examination approaches can be used, such as NMR or x-ray crystallography. These approaches can examine the shape of the paratope alone, or while it is bound to the epitope.
- molecular models may be generated in silico.
- a structure can be generated through homology modeling, aided with a commercial package, such as Insightll modeling package from Accelrys (San Diego, Calif).
- the result is that one is able to estimate where and how the epitope interacts with the paratope.
- only a fragment, or variant, of the epitope is used to assist in determining the relevant interactions.
- the entire epitope is used in the modeling of the interaction between the paratope and the epitope.
- one is able to predict which residues are the most important in the interaction between the epitope and the paratope.
- one is able to readily select which residues to change in order to alter the binding characteristics of the antibody. For instance, it may be apparent from the docking models that the side chains of certain residues in the paratope may sterically hinder the binding of the epitope, thus altering these residues to residues with smaller side chains may be beneficial.
- One can determine this in many ways. For example, one may simply look at the two models and estimate interactions based on functional groups and proximity. Alternatively, one may perform repeated pairings of epitope and paratope, as described above, in order to obtain more favorable energy interactions.
- the models determined above can be tested through various techniques. For example, the interaction energy can determined with the programs discussed above in order to determine which of the variants to further examine. Also, coulumbic and van der Waals interactions are used to determine the interaction energies of the epitope and the variant paratopes. Also site directed mutagenesis is used to see if predicted changes in antibody structure actually result in the desired changes in binding characteristics. Alternatively, changes may be made to the epitope to verify that the models are correct or to determine general binding themes that may be occurring between the paratope and the epitope.
- any modification may also have additional side effects on the activity of the antibody. For instance, while any alteration predicted to result in greater binding, may induce greater binding, it may also cause other structural changes which might reduce or alter the activity of the antibody. The determination of whether or not this is the case is routine in the art and can be achieved in many ways. For example, the activity can be tested through an ELISA test. Alternatively, the samples can be tested through the use of a surface plasmon resonance device.
- the present invention provides antibodies that recognize an epitope within domain 2of HER3.
- the invention is based on the surprising finding that a class of antibodies against HER3, block both ligand-dependent and ligand-independent HER3 signal transduction pathways.
- a class of antibodies that bind to an epitope within domain 2 of HER3 is disclosed in Table 1.
- the antibodies inhibit both ligand-dependent and ligand-independent HER3 signalling.
- the antibodies bind to HER3 and do not block HER ligand binding to the ligand binding site (i.e. both ligand and antibody can bind HER3 concurrently).
- Table 1 Examples of HER3 Antibodies that bind to domain 2 of HER3 i MOR12509
- SEQ ID NO: 40 Chain CACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAA
- SEQ ID NO: 56 DNA VH GCCTGAAAGCGAGCGATACCGCGATGTATTATTGCGCGCGTGTTCATATCATCCAGCCGCCGTC TGCTTGGTCTTACAACGCTATGGATGTTTGGGGCCAAGGCACCCTGGTGACTGTTAGCTCA
- SEQ ID NO: 80 Chain CACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAA
- SEQ ID NO: 236 DNA VH TGCTTGGTCTTACAACGCTATGGATGTTTGGGGCCAAGGCACCCTGGTGACTGTTAGCTCA
- SEQ ID NO: 237 DNA VL ATTATTGCCAGCAGTCTATCACTGAACTGTTCACCTTTGGCCAGGGCACGAAAGTTGAAATTAAA
- SEQ ID NO: 276 DNA VH GCCTGAAAGCGAGCGATACCGCGATGTATTATTGCGCGCGTGTTCATATCATCCAGCCGCCGTC TGCTTGGTCTTACAACGCTATGGATGTTTGGGGCCAAGGCACCCTGGTGACTGTTAGCTCA
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Oncology (AREA)
- Epidemiology (AREA)
- Endocrinology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201280068798.2A CN104105709A (zh) | 2011-12-05 | 2012-12-04 | 抗her3的结构域ii的表皮生长因子受体3(her3)抗体 |
| EA201491107A EA201491107A1 (ru) | 2011-12-05 | 2012-12-04 | Антитела к рецептору эпидермального фактора роста 3 (her3), направленные на домен ii her3 |
| MX2014006733A MX2014006733A (es) | 2011-12-05 | 2012-12-04 | Anticuerpos para el receptor del factor de crecimiento epidermico 3 (her3) dirigidos al dominio ii del her3. |
| SG11201402739YA SG11201402739YA (en) | 2011-12-05 | 2012-12-04 | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 |
| JP2014545418A JP2015500829A (ja) | 2011-12-05 | 2012-12-04 | 上皮細胞増殖因子受容体3(her3)のドメインiiに対するher3の抗体 |
| AU2012349736A AU2012349736A1 (en) | 2011-12-05 | 2012-12-04 | Antibodies for epidermal growth factor receptor 3 (HER3) directed to domain II of HER3 |
| IN4373CHN2014 IN2014CN04373A (enExample) | 2011-12-05 | 2012-12-04 | |
| KR1020147018339A KR20140103135A (ko) | 2011-12-05 | 2012-12-04 | Her3의 도메인 ii에 대해 지시된 표피 성장 인자 수용체 3 (her3)에 대한 항체 |
| EP12823094.3A EP2788382A2 (en) | 2011-12-05 | 2012-12-04 | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 |
| BR112014013568A BR112014013568A8 (pt) | 2011-12-05 | 2012-12-04 | anticorpos para o receptor do fator de crescimento epidermal 3 (her3) direcionados para o domínio ii do her3 |
| CA2857601A CA2857601A1 (en) | 2011-12-05 | 2012-12-04 | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 |
| IL232951A IL232951A0 (en) | 2011-12-05 | 2014-06-02 | Antibodies against the her3 receptor that bind to its domain ii |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161566905P | 2011-12-05 | 2011-12-05 | |
| US61/566,905 | 2011-12-05 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013084148A2 true WO2013084148A2 (en) | 2013-06-13 |
| WO2013084148A3 WO2013084148A3 (en) | 2013-08-15 |
Family
ID=47681974
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2012/056950 Ceased WO2013084148A2 (en) | 2011-12-05 | 2012-12-04 | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 |
Country Status (17)
| Country | Link |
|---|---|
| US (1) | US20130273029A1 (enExample) |
| EP (1) | EP2788382A2 (enExample) |
| JP (1) | JP2015500829A (enExample) |
| KR (1) | KR20140103135A (enExample) |
| CN (1) | CN104105709A (enExample) |
| AR (1) | AR089084A1 (enExample) |
| AU (1) | AU2012349736A1 (enExample) |
| BR (1) | BR112014013568A8 (enExample) |
| CA (1) | CA2857601A1 (enExample) |
| EA (1) | EA201491107A1 (enExample) |
| IL (1) | IL232951A0 (enExample) |
| IN (1) | IN2014CN04373A (enExample) |
| MX (1) | MX2014006733A (enExample) |
| SG (1) | SG11201402739YA (enExample) |
| TW (1) | TW201328707A (enExample) |
| UY (1) | UY34486A (enExample) |
| WO (1) | WO2013084148A2 (enExample) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015173250A1 (en) * | 2014-05-14 | 2015-11-19 | F. Hoffmann-La Roche Ag | Anti-her3 antibodies binding to the beta-hairpin of her3 |
| WO2015173248A1 (en) * | 2014-05-14 | 2015-11-19 | F. Hoffmann-La Roche Ag | Her3/her2 bispecific antibodies binding to the beta-hairpin of her3 and domain ii of her2 |
| WO2016059600A1 (en) | 2014-10-17 | 2016-04-21 | Novartis Ag | Combination of ceritinib with an egfr inhibitor |
| US9725512B2 (en) | 2012-11-08 | 2017-08-08 | Hoffmann-La Roche Inc. | HER3 antibodies binding to the beta-hairpin of HER3 |
| US9725511B2 (en) | 2012-11-08 | 2017-08-08 | Hoffmann-La Roche Inc. | Anti-HER3/HER4 antibodies binding to the beta-hairpin of HER3 and the beta-hairpin of HER4 |
| EP3539990A1 (en) | 2014-07-16 | 2019-09-18 | Dana-Farber Cancer Institute, Inc. | Her3 inhibition in low-grade serous cancers |
| WO2019185164A1 (en) * | 2018-03-29 | 2019-10-03 | Hummingbird Bioscience Holdings Pte. Ltd. | Her3 antigen-binding molecules |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PH12013500333A1 (en) | 2010-08-20 | 2013-04-22 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
| TW201328706A (zh) | 2011-12-05 | 2013-07-16 | Novartis Ag | 表皮生長因子受體3(her3)之抗體 |
| USD912097S1 (en) | 2019-06-03 | 2021-03-02 | Yeti Coolers, Llc | Ice pack |
| CN110760003A (zh) * | 2019-09-10 | 2020-02-07 | 广东药科大学 | 一种抗her3单链抗体的制备方法 |
| GB201913079D0 (en) * | 2019-09-11 | 2019-10-23 | Hummingbird Bioscience Holdings Pte Ltd | Treatment and prevention of cancer using her3 antigen-binding molecules |
| WO2023021319A1 (en) * | 2021-08-19 | 2023-02-23 | Oncoquest Pharmaceuticals Inc. | Monoclonal antibodies against her2/neu and uses thereof |
| AU2024238028A1 (en) * | 2023-03-17 | 2025-09-04 | Biocytogen Pharmaceuticals (Beijing) Co., Ltd. | Anti-her3 and anti-met antibodies and uses thereof |
Citations (144)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US4526938A (en) | 1982-04-22 | 1985-07-02 | Imperial Chemical Industries Plc | Continuous release formulations |
| EP0154316A2 (en) | 1984-03-06 | 1985-09-11 | Takeda Chemical Industries, Ltd. | Chemically modified lymphokine and production thereof |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| EP0307434A1 (en) | 1987-03-18 | 1989-03-22 | Medical Res Council | CHANGED ANTIBODIES. |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4880078A (en) | 1987-06-29 | 1989-11-14 | Honda Giken Kogyo Kabushiki Kaisha | Exhaust muffler |
| US4881175A (en) | 1986-09-02 | 1989-11-14 | Genex Corporation | Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides |
| EP0367166A1 (en) | 1988-10-31 | 1990-05-09 | Takeda Chemical Industries, Ltd. | Modified interleukin-2 and production thereof |
| EP0399666A1 (en) | 1989-04-29 | 1990-11-28 | Delta Biotechnology Limited | Fusion proteins containing N-terminal fragments of human serum albumin |
| EP0401384A1 (en) | 1988-12-22 | 1990-12-12 | Kirin-Amgen, Inc. | Chemically modified granulocyte colony stimulating factor |
| EP0413622A1 (en) | 1989-08-03 | 1991-02-20 | Rhone-Poulenc Sante | Albumin derivatives with therapeutic functions |
| WO1991005548A1 (en) | 1989-10-10 | 1991-05-02 | Pitman-Moore, Inc. | Sustained release composition for macromolecular proteins |
| US5013653A (en) | 1987-03-20 | 1991-05-07 | Creative Biomolecules, Inc. | Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage |
| WO1991006570A1 (en) | 1989-10-25 | 1991-05-16 | The University Of Melbourne | HYBRID Fc RECEPTOR MOLECULES |
| US5091513A (en) | 1987-05-21 | 1992-02-25 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| WO1992003918A1 (en) | 1990-08-29 | 1992-03-19 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5112946A (en) | 1989-07-06 | 1992-05-12 | Repligen Corporation | Modified pf4 compositions and methods of use |
| US5128326A (en) | 1984-12-06 | 1992-07-07 | Biomatrix, Inc. | Drug delivery systems based on hyaluronans derivatives thereof and their salts and methods of producing same |
| US5132405A (en) | 1987-05-21 | 1992-07-21 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| WO1992019244A2 (en) | 1991-05-01 | 1992-11-12 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | A method for treating infectious respiratory diseases |
| WO1993012227A1 (en) | 1991-12-17 | 1993-06-24 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| WO1993015200A1 (fr) | 1992-01-31 | 1993-08-05 | Rhone-Poulenc Rorer S.A. | Polypeptides antithrombotiques, antagonistes de la liaison du vwf aux plaquettes et/ou au sous-endothelium |
| WO1993015199A1 (fr) | 1992-01-31 | 1993-08-05 | Rhone-Poulenc Rorer S.A. | Nouveaux polypeptides biologiquement actifs, leur preparation et composition pharmaceutique les contenant |
| US5258498A (en) | 1987-05-21 | 1993-11-02 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
| WO1994004678A1 (en) | 1992-08-21 | 1994-03-03 | Casterman Cecile | Immunoglobulins devoid of light chains |
| EP0368684B1 (en) | 1988-11-11 | 1994-03-09 | Medical Research Council | Cloning immunoglobulin variable domain sequences. |
| US5336603A (en) | 1987-10-02 | 1994-08-09 | Genentech, Inc. | CD4 adheson variants |
| US5349053A (en) | 1990-06-01 | 1994-09-20 | Protein Design Labs, Inc. | Chimeric ligand/immunoglobulin molecules and their uses |
| US5359046A (en) | 1990-12-14 | 1994-10-25 | Cell Genesys, Inc. | Chimeric chains for receptor-associated signal transduction pathways |
| WO1994025585A1 (en) | 1993-04-26 | 1994-11-10 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5374548A (en) | 1986-05-02 | 1994-12-20 | Genentech, Inc. | Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor |
| WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
| US5399331A (en) | 1985-06-26 | 1995-03-21 | The Liposome Company, Inc. | Method for protein-liposome coupling |
| US5416016A (en) | 1989-04-03 | 1995-05-16 | Purdue Research Foundation | Method for enhancing transmembrane transport of exogenous molecules |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5447851A (en) | 1992-04-02 | 1995-09-05 | Board Of Regents, The University Of Texas System | DNA encoding a chimeric polypeptide comprising the extracellular domain of TNF receptor fused to IgG, vectors, and host cells |
| US5476786A (en) | 1987-05-21 | 1995-12-19 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US5476996A (en) | 1988-06-14 | 1995-12-19 | Lidak Pharmaceuticals | Human immune system in non-human animal |
| US5480968A (en) | 1989-12-01 | 1996-01-02 | The United States Of America As Represented By The Department Of Health And Human Services | Isolated polypeptide erbB-3, related to the epidermal growth factor receptor and antibody thereto |
| WO1996004388A1 (en) | 1994-07-29 | 1996-02-15 | Smithkline Beecham Plc | Novel compounds |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| WO1996020698A2 (en) | 1995-01-05 | 1996-07-11 | The Board Of Regents Acting For And On Behalf Of The University Of Michigan | Surface-modified nanoparticles and method of making and using same |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
| WO1997013852A1 (en) | 1995-10-10 | 1997-04-17 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5622929A (en) | 1992-01-23 | 1997-04-22 | Bristol-Myers Squibb Company | Thioether conjugates |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5641870A (en) | 1995-04-20 | 1997-06-24 | Genentech, Inc. | Low pH hydrophobic interaction chromatography for antibody purification |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| WO1997032572A2 (en) | 1996-03-04 | 1997-09-12 | The Penn State Research Foundation | Materials and methods for enhancing cellular internalization |
| WO1997034631A1 (en) | 1996-03-18 | 1997-09-25 | Board Of Regents, The University Of Texas System | Immunoglobin-like domains with increased half lives |
| US5677425A (en) | 1987-09-04 | 1997-10-14 | Celltech Therapeutics Limited | Recombinant antibody |
| US5679377A (en) | 1989-11-06 | 1997-10-21 | Alkermes Controlled Therapeutics, Inc. | Protein microspheres and methods of using them |
| WO1997044013A1 (en) | 1996-05-24 | 1997-11-27 | Massachusetts Institute Of Technology | Aerodynamically light particles for pulmonary drug delivery |
| US5714350A (en) | 1992-03-09 | 1998-02-03 | Protein Design Labs, Inc. | Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region |
| WO1998023289A1 (en) | 1996-11-27 | 1998-06-04 | The General Hospital Corporation | MODULATION OF IgG BINDING TO FcRn |
| WO1998024884A1 (en) | 1996-12-02 | 1998-06-11 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1998031346A1 (en) | 1997-01-16 | 1998-07-23 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| US5789650A (en) | 1990-08-29 | 1998-08-04 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5831012A (en) | 1994-01-14 | 1998-11-03 | Pharmacia & Upjohn Aktiebolag | Bacterial receptor structures |
| US5834252A (en) | 1995-04-18 | 1998-11-10 | Glaxo Group Limited | End-complementary polymerase reaction |
| US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
| US5855913A (en) | 1997-01-16 | 1999-01-05 | Massachusetts Instite Of Technology | Particles incorporating surfactants for pulmonary drug delivery |
| US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US5874299A (en) | 1990-08-29 | 1999-02-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5877397A (en) | 1990-08-29 | 1999-03-02 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5885793A (en) | 1991-12-02 | 1999-03-23 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| WO1999015154A1 (en) | 1997-09-24 | 1999-04-01 | Alkermes Controlled Therapeutics, Inc. | Methods for fabricating polymer-based controlled release preparations |
| WO1999016873A1 (de) | 1997-09-26 | 1999-04-08 | Arne Skerra | Anticaline |
| WO1999020253A1 (en) | 1997-10-23 | 1999-04-29 | Bioglan Therapeutics Ab | Encapsulation method |
| US5912015A (en) | 1992-03-12 | 1999-06-15 | Alkermes Controlled Therapeutics, Inc. | Modulated release from biocompatible polymers |
| US5916597A (en) | 1995-08-31 | 1999-06-29 | Alkermes Controlled Therapeutics, Inc. | Composition and method using solid-phase particles for sustained in vivo release of a biologically active agent |
| US5934272A (en) | 1993-01-29 | 1999-08-10 | Aradigm Corporation | Device and method of creating aerosolized mist of respiratory drug |
| US5939598A (en) | 1990-01-12 | 1999-08-17 | Abgenix, Inc. | Method of making transgenic mice lacking endogenous heavy chains |
| WO1999045962A1 (en) | 1998-03-13 | 1999-09-16 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5958708A (en) | 1992-09-25 | 1999-09-28 | Novartis Corporation | Reshaped monoclonal antibodies against an immunoglobulin isotype |
| US5969108A (en) | 1990-07-10 | 1999-10-19 | Medical Research Council | Methods for producing members of specific binding pairs |
| WO1999054342A1 (en) | 1998-04-20 | 1999-10-28 | Pablo Umana | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
| US5985309A (en) | 1996-05-24 | 1999-11-16 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| WO1999066903A2 (en) | 1998-06-24 | 1999-12-29 | Advanced Inhalation Research, Inc. | Large porous particles emitted from an inhaler |
| US6019968A (en) | 1995-04-14 | 2000-02-01 | Inhale Therapeutic Systems, Inc. | Dispersible antibody compositions and methods for their preparation and use |
| US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| WO2000042072A2 (en) | 1999-01-15 | 2000-07-20 | Genentech, Inc. | Polypeptide variants with altered effector function |
| US6121022A (en) | 1995-04-14 | 2000-09-19 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6162963A (en) | 1990-01-12 | 2000-12-19 | Abgenix, Inc. | Generation of Xenogenetic antibodies |
| US6165745A (en) | 1992-04-24 | 2000-12-26 | Board Of Regents, The University Of Texas System | Recombinant production of immunoglobulin-like domains in prokaryotic cells |
| US6172197B1 (en) | 1991-07-10 | 2001-01-09 | Medical Research Council | Methods for producing members of specific binding pairs |
| WO2001004144A2 (de) | 1999-07-13 | 2001-01-18 | Scil Proteins Gmbh | Design von beta-faltblatt-proteinen mit spezifischen bindungseigenschaften |
| WO2001005950A2 (en) | 1999-07-20 | 2001-01-25 | Morphosys Ag | Methods for displaying (poly)peptides/proteins on bacteriophage particles via disulfide bonds |
| US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
| WO2001014424A2 (en) | 1999-08-24 | 2001-03-01 | Medarex, Inc. | Human ctla-4 antibodies and their uses |
| US6277375B1 (en) | 1997-03-03 | 2001-08-21 | Board Of Regents, The University Of Texas System | Immunoglobulin-like domains with increased half-lives |
| US6291158B1 (en) | 1989-05-16 | 2001-09-18 | Scripps Research Institute | Method for tapping the immunological repertoire |
| WO2001077137A1 (en) | 2000-04-12 | 2001-10-18 | Human Genome Sciences, Inc. | Albumin fusion proteins |
| US6316024B1 (en) | 1996-10-11 | 2001-11-13 | Sequus Pharmaceuticals, Inc. | Therapeutic liposome composition and method of preparation |
| EP1176195A1 (en) | 1999-04-09 | 2002-01-30 | Kyowa Hakko Kogyo Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
| US6350466B1 (en) | 1994-08-05 | 2002-02-26 | Targesome, Inc. | Targeted polymerized liposome diagnostic and treatment agents |
| WO2002043478A2 (en) | 2000-11-30 | 2002-06-06 | Medarex, Inc. | Transgenic transchromosomal rodents for making human antibodies |
| WO2002092780A2 (en) | 2001-05-17 | 2002-11-21 | Diversa Corporation | Novel antigen binding molecules for therapeutic, diagnostic, prophylactic, enzymatic, industrial, and agricultural applications, and methods for generating and screening thereof |
| WO2003002609A2 (en) | 2001-06-28 | 2003-01-09 | Domantis Limited | Dual-specific ligand and its use |
| WO2003006007A1 (en) | 2001-07-11 | 2003-01-23 | Research & Innovation Soc.Coop. A R.L. | Use of compounds as functional antagonists to the central cannabinoid receptors |
| WO2003035835A2 (en) | 2001-10-25 | 2003-05-01 | Genentech, Inc. | Glycoprotein compositions |
| WO2003048731A2 (en) | 2001-12-03 | 2003-06-12 | Abgenix, Inc. | Antibody categorization based on binding characteristics |
| WO2003064383A2 (en) | 2002-02-01 | 2003-08-07 | Ariad Gene Therapeutics, Inc. | Phosphorus-containing compounds & uses thereof |
| US20030153043A1 (en) | 1997-05-21 | 2003-08-14 | Biovation Limited | Method for the production of non-immunogenic proteins |
| US20030157579A1 (en) | 2002-02-14 | 2003-08-21 | Kalobios, Inc. | Molecular sensors activated by disinhibition |
| WO2003074679A2 (en) | 2002-03-01 | 2003-09-12 | Xencor | Antibody optimization |
| US20030198971A1 (en) | 2002-04-18 | 2003-10-23 | Kalobios, Inc. | Reactivation-based molecular interaction sensors |
| WO2004003019A2 (en) | 2002-06-28 | 2004-01-08 | Domantis Limited | Immunoglobin single variant antigen-binding domains and dual-specific constructs |
| US6696245B2 (en) | 1997-10-20 | 2004-02-24 | Domantis Limited | Methods for selecting functional polypeptides |
| US6703199B1 (en) | 1997-06-12 | 2004-03-09 | Research Corporation Technologies, Inc. | Artificial antibody polypeptides |
| WO2004058821A2 (en) | 2002-12-27 | 2004-07-15 | Domantis Limited | Dual specific single domain antibodies specific for a ligand and for the receptor of the ligand |
| US6765087B1 (en) | 1992-08-21 | 2004-07-20 | Vrije Universiteit Brussel | Immunoglobulins devoid of light chains |
| US20040161738A1 (en) | 2000-05-26 | 2004-08-19 | Arumugam Muruganandam | Single-domain brain-targeting antibody fragments derived from llama antibodies |
| EP0616640B1 (en) | 1991-12-02 | 2004-09-01 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US20040175756A1 (en) | 2001-04-26 | 2004-09-09 | Avidia Research Institute | Methods for using combinatorial libraries of monomer domains |
| WO2004081026A2 (en) | 2003-06-30 | 2004-09-23 | Domantis Limited | Polypeptides |
| EP1012280B1 (en) | 1997-06-11 | 2004-11-10 | Borean Pharma A/S | Trimerising module |
| US6818418B1 (en) | 1998-12-10 | 2004-11-16 | Compound Therapeutics, Inc. | Protein scaffolds for antibody mimics and other binding proteins |
| WO2004101790A1 (en) | 2003-05-14 | 2004-11-25 | Domantis Limited | A process for recovering polypeptides that unfold reversibly from a polypeptide repertoire |
| WO2004106368A1 (de) | 2003-05-28 | 2004-12-09 | Scil Proteins Gmbh | Generierung künstlicher bindungsproteine auf der grundlage von ubiquitin-proteinen |
| US6838254B1 (en) | 1993-04-29 | 2005-01-04 | Conopco, Inc. | Production of antibodies or (functionalized) fragments thereof derived from heavy chain immunoglobulins of camelidae |
| US20050008625A1 (en) | 2003-02-13 | 2005-01-13 | Kalobios, Inc. | Antibody affinity engineering by serial epitope-guided complementarity replacement |
| US20050048512A1 (en) | 2001-04-26 | 2005-03-03 | Avidia Research Institute | Combinatorial libraries of monomer domains |
| US20050053973A1 (en) | 2001-04-26 | 2005-03-10 | Avidia Research Institute | Novel proteins with targeted binding |
| WO2005028443A2 (en) | 2003-09-15 | 2005-03-31 | Wyeth A Corporation Of The State Of Delaware, Usa | Protein tyrosine kinase enzyme inhibitors |
| US20050255552A1 (en) | 2004-01-20 | 2005-11-17 | Kalobios, Inc. | Antibody specificity transfer using minimal essential binding determinants |
| US20060008844A1 (en) | 2004-06-17 | 2006-01-12 | Avidia Research Institute | c-Met kinase binding proteins |
| US20060115470A1 (en) | 2002-11-08 | 2006-06-01 | Ablynx N. V. | Camelidae antibodies against imminoglobulin e and use thereof for the treatment of allergic disorders |
| WO2006079372A1 (en) | 2005-01-31 | 2006-08-03 | Ablynx N.V. | Method for generating variable domain sequences of heavy chain antibodies |
| WO2006122806A2 (en) | 2005-05-20 | 2006-11-23 | Novartis Ag | 1,3-dihydro-imidazo [4,5-c] quinolin-2-ones as lipid kinase inhibitors |
| WO2007059782A1 (en) | 2005-11-28 | 2007-05-31 | Genmab A/S | Recombinant monovalent antibodies and methods for production thereof |
| WO2009036082A2 (en) | 2007-09-12 | 2009-03-19 | Genentech, Inc. | Combinations of phosphoinositide 3-kinase inhibitor compounds and chemotherapeutic agents, and methods of use |
| WO2009055730A1 (en) | 2007-10-25 | 2009-04-30 | Genentech, Inc. | Process for making thienopyrimidine compounds |
| US20090304721A1 (en) | 2005-09-07 | 2009-12-10 | Medlmmune, Inc | Toxin conjugated eph receptor antibodies |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AR056857A1 (es) * | 2005-12-30 | 2007-10-24 | U3 Pharma Ag | Anticuerpos dirigidos hacia her-3 (receptor del factor de crecimiento epidérmico humano-3) y sus usos |
| KR20090031897A (ko) * | 2006-06-12 | 2009-03-30 | 리셉터 바이오로직스 인크 | 전-세포 표면 수용체-특이적 치료제 |
| MY150993A (en) * | 2007-10-05 | 2014-03-31 | Verastem Inc | Pyrimidine substituted purine derivatives |
| AU2010242914B2 (en) * | 2009-04-29 | 2014-11-13 | Trellis Bioscience, Llc | Improved antibodies immunoreactive with heregulin-coupled HER3 |
| ES2566602T3 (es) * | 2010-04-09 | 2016-04-14 | Aveo Pharmaceuticals, Inc. | Anticuerpos anti-ErbB3 |
| PH12013500333A1 (en) * | 2010-08-20 | 2013-04-22 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
-
2012
- 2012-12-04 US US13/693,339 patent/US20130273029A1/en not_active Abandoned
- 2012-12-04 EA EA201491107A patent/EA201491107A1/ru unknown
- 2012-12-04 BR BR112014013568A patent/BR112014013568A8/pt not_active Application Discontinuation
- 2012-12-04 MX MX2014006733A patent/MX2014006733A/es unknown
- 2012-12-04 AU AU2012349736A patent/AU2012349736A1/en not_active Abandoned
- 2012-12-04 JP JP2014545418A patent/JP2015500829A/ja active Pending
- 2012-12-04 SG SG11201402739YA patent/SG11201402739YA/en unknown
- 2012-12-04 CN CN201280068798.2A patent/CN104105709A/zh active Pending
- 2012-12-04 UY UY0001034486A patent/UY34486A/es not_active Application Discontinuation
- 2012-12-04 EP EP12823094.3A patent/EP2788382A2/en not_active Withdrawn
- 2012-12-04 IN IN4373CHN2014 patent/IN2014CN04373A/en unknown
- 2012-12-04 KR KR1020147018339A patent/KR20140103135A/ko not_active Withdrawn
- 2012-12-04 TW TW101145502A patent/TW201328707A/zh unknown
- 2012-12-04 WO PCT/IB2012/056950 patent/WO2013084148A2/en not_active Ceased
- 2012-12-04 CA CA2857601A patent/CA2857601A1/en not_active Abandoned
- 2012-12-05 AR ARP120104558A patent/AR089084A1/es unknown
-
2014
- 2014-06-02 IL IL232951A patent/IL232951A0/en unknown
Patent Citations (175)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US4526938A (en) | 1982-04-22 | 1985-07-02 | Imperial Chemical Industries Plc | Continuous release formulations |
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| EP0154316A2 (en) | 1984-03-06 | 1985-09-11 | Takeda Chemical Industries, Ltd. | Chemically modified lymphokine and production thereof |
| US5128326A (en) | 1984-12-06 | 1992-07-07 | Biomatrix, Inc. | Drug delivery systems based on hyaluronans derivatives thereof and their salts and methods of producing same |
| US5399331A (en) | 1985-06-26 | 1995-03-21 | The Liposome Company, Inc. | Method for protein-liposome coupling |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US5374548A (en) | 1986-05-02 | 1994-12-20 | Genentech, Inc. | Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor |
| US4881175A (en) | 1986-09-02 | 1989-11-14 | Genex Corporation | Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides |
| US5455030A (en) | 1986-09-02 | 1995-10-03 | Enzon Labs, Inc. | Immunotheraphy using single chain polypeptide binding molecules |
| US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
| US5624821A (en) | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
| US5648260A (en) | 1987-03-18 | 1997-07-15 | Scotgen Biopharmaceuticals Incorporated | DNA encoding antibodies with altered effector functions |
| EP0307434A1 (en) | 1987-03-18 | 1989-03-22 | Medical Res Council | CHANGED ANTIBODIES. |
| US5013653A (en) | 1987-03-20 | 1991-05-07 | Creative Biomolecules, Inc. | Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage |
| US5132405A (en) | 1987-05-21 | 1992-07-21 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US5482858A (en) | 1987-05-21 | 1996-01-09 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| US5476786A (en) | 1987-05-21 | 1995-12-19 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US5091513A (en) | 1987-05-21 | 1992-02-25 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US5258498A (en) | 1987-05-21 | 1993-11-02 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| US4880078A (en) | 1987-06-29 | 1989-11-14 | Honda Giken Kogyo Kabushiki Kaisha | Exhaust muffler |
| US5677425A (en) | 1987-09-04 | 1997-10-14 | Celltech Therapeutics Limited | Recombinant antibody |
| US5336603A (en) | 1987-10-02 | 1994-08-09 | Genentech, Inc. | CD4 adheson variants |
| US5476996A (en) | 1988-06-14 | 1995-12-19 | Lidak Pharmaceuticals | Human immune system in non-human animal |
| US5698767A (en) | 1988-06-14 | 1997-12-16 | Lidak Pharmaceuticals | Human immune system in non-human animal |
| US5403484A (en) | 1988-09-02 | 1995-04-04 | Protein Engineering Corporation | Viruses expressing chimeric binding proteins |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5571698A (en) | 1988-09-02 | 1996-11-05 | Protein Engineering Corporation | Directed evolution of novel binding proteins |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| EP0367166A1 (en) | 1988-10-31 | 1990-05-09 | Takeda Chemical Industries, Ltd. | Modified interleukin-2 and production thereof |
| EP0368684B1 (en) | 1988-11-11 | 1994-03-09 | Medical Research Council | Cloning immunoglobulin variable domain sequences. |
| EP0401384A1 (en) | 1988-12-22 | 1990-12-12 | Kirin-Amgen, Inc. | Chemically modified granulocyte colony stimulating factor |
| US5693762A (en) | 1988-12-28 | 1997-12-02 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US6180370B1 (en) | 1988-12-28 | 2001-01-30 | Protein Design Labs, Inc. | Humanized immunoglobulins and methods of making the same |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5416016A (en) | 1989-04-03 | 1995-05-16 | Purdue Research Foundation | Method for enhancing transmembrane transport of exogenous molecules |
| EP0399666A1 (en) | 1989-04-29 | 1990-11-28 | Delta Biotechnology Limited | Fusion proteins containing N-terminal fragments of human serum albumin |
| US6291158B1 (en) | 1989-05-16 | 2001-09-18 | Scripps Research Institute | Method for tapping the immunological repertoire |
| US5112946A (en) | 1989-07-06 | 1992-05-12 | Repligen Corporation | Modified pf4 compositions and methods of use |
| EP0413622A1 (en) | 1989-08-03 | 1991-02-20 | Rhone-Poulenc Sante | Albumin derivatives with therapeutic functions |
| WO1991005548A1 (en) | 1989-10-10 | 1991-05-02 | Pitman-Moore, Inc. | Sustained release composition for macromolecular proteins |
| WO1991006570A1 (en) | 1989-10-25 | 1991-05-16 | The University Of Melbourne | HYBRID Fc RECEPTOR MOLECULES |
| US5679377A (en) | 1989-11-06 | 1997-10-21 | Alkermes Controlled Therapeutics, Inc. | Protein microspheres and methods of using them |
| US5480968A (en) | 1989-12-01 | 1996-01-02 | The United States Of America As Represented By The Department Of Health And Human Services | Isolated polypeptide erbB-3, related to the epidermal growth factor receptor and antibody thereto |
| US6114598A (en) | 1990-01-12 | 2000-09-05 | Abgenix, Inc. | Generation of xenogeneic antibodies |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US5939598A (en) | 1990-01-12 | 1999-08-17 | Abgenix, Inc. | Method of making transgenic mice lacking endogenous heavy chains |
| US6162963A (en) | 1990-01-12 | 2000-12-19 | Abgenix, Inc. | Generation of Xenogenetic antibodies |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5580717A (en) | 1990-05-01 | 1996-12-03 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5349053A (en) | 1990-06-01 | 1994-09-20 | Protein Design Labs, Inc. | Chimeric ligand/immunoglobulin molecules and their uses |
| US5969108A (en) | 1990-07-10 | 1999-10-19 | Medical Research Council | Methods for producing members of specific binding pairs |
| US5789650A (en) | 1990-08-29 | 1998-08-04 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1992003918A1 (en) | 1990-08-29 | 1992-03-19 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5877397A (en) | 1990-08-29 | 1999-03-02 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5874299A (en) | 1990-08-29 | 1999-02-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5359046A (en) | 1990-12-14 | 1994-10-25 | Cell Genesys, Inc. | Chimeric chains for receptor-associated signal transduction pathways |
| WO1992019244A2 (en) | 1991-05-01 | 1992-11-12 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | A method for treating infectious respiratory diseases |
| US5290540A (en) | 1991-05-01 | 1994-03-01 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | Method for treating infectious respiratory diseases |
| US6172197B1 (en) | 1991-07-10 | 2001-01-09 | Medical Research Council | Methods for producing members of specific binding pairs |
| US5885793A (en) | 1991-12-02 | 1999-03-23 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US6582915B1 (en) | 1991-12-02 | 2003-06-24 | Medical Research Council | Production of anti-self bodies from antibody segment repertories and displayed on phage |
| US6555313B1 (en) | 1991-12-02 | 2003-04-29 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US6544731B1 (en) | 1991-12-02 | 2003-04-08 | Medical Research Council | Production of anti-self antibodies from antibody segment repertories and displayed on phage |
| US6593081B1 (en) | 1991-12-02 | 2003-07-15 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US6521404B1 (en) | 1991-12-02 | 2003-02-18 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| EP0616640B1 (en) | 1991-12-02 | 2004-09-01 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| WO1993012227A1 (en) | 1991-12-17 | 1993-06-24 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5622929A (en) | 1992-01-23 | 1997-04-22 | Bristol-Myers Squibb Company | Thioether conjugates |
| WO1993015200A1 (fr) | 1992-01-31 | 1993-08-05 | Rhone-Poulenc Rorer S.A. | Polypeptides antithrombotiques, antagonistes de la liaison du vwf aux plaquettes et/ou au sous-endothelium |
| WO1993015199A1 (fr) | 1992-01-31 | 1993-08-05 | Rhone-Poulenc Rorer S.A. | Nouveaux polypeptides biologiquement actifs, leur preparation et composition pharmaceutique les contenant |
| US5714350A (en) | 1992-03-09 | 1998-02-03 | Protein Design Labs, Inc. | Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region |
| US6350861B1 (en) | 1992-03-09 | 2002-02-26 | Protein Design Labs, Inc. | Antibodies with increased binding affinity |
| US5912015A (en) | 1992-03-12 | 1999-06-15 | Alkermes Controlled Therapeutics, Inc. | Modulated release from biocompatible polymers |
| US5447851B1 (en) | 1992-04-02 | 1999-07-06 | Univ Texas System Board Of | Dna encoding a chimeric polypeptide comprising the extracellular domain of tnf receptor fused to igg vectors and host cells |
| US5447851A (en) | 1992-04-02 | 1995-09-05 | Board Of Regents, The University Of Texas System | DNA encoding a chimeric polypeptide comprising the extracellular domain of TNF receptor fused to IgG, vectors, and host cells |
| US6165745A (en) | 1992-04-24 | 2000-12-26 | Board Of Regents, The University Of Texas System | Recombinant production of immunoglobulin-like domains in prokaryotic cells |
| US5759808A (en) | 1992-08-21 | 1998-06-02 | Vrije Universiteit Brussel | Immunoglobulins devoid of light chains |
| WO1994004678A1 (en) | 1992-08-21 | 1994-03-03 | Casterman Cecile | Immunoglobulins devoid of light chains |
| US6765087B1 (en) | 1992-08-21 | 2004-07-20 | Vrije Universiteit Brussel | Immunoglobulins devoid of light chains |
| US5958708A (en) | 1992-09-25 | 1999-09-28 | Novartis Corporation | Reshaped monoclonal antibodies against an immunoglobulin isotype |
| US5934272A (en) | 1993-01-29 | 1999-08-10 | Aradigm Corporation | Device and method of creating aerosolized mist of respiratory drug |
| WO1994025585A1 (en) | 1993-04-26 | 1994-11-10 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US6838254B1 (en) | 1993-04-29 | 2005-01-04 | Conopco, Inc. | Production of antibodies or (functionalized) fragments thereof derived from heavy chain immunoglobulins of camelidae |
| WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
| US5831012A (en) | 1994-01-14 | 1998-11-03 | Pharmacia & Upjohn Aktiebolag | Bacterial receptor structures |
| US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
| US5830721A (en) | 1994-02-17 | 1998-11-03 | Affymax Technologies N.V. | DNA mutagenesis by random fragmentation and reassembly |
| US5811238A (en) | 1994-02-17 | 1998-09-22 | Affymax Technologies N.V. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
| WO1996004388A1 (en) | 1994-07-29 | 1996-02-15 | Smithkline Beecham Plc | Novel compounds |
| US6350466B1 (en) | 1994-08-05 | 2002-02-26 | Targesome, Inc. | Targeted polymerized liposome diagnostic and treatment agents |
| WO1996020698A2 (en) | 1995-01-05 | 1996-07-11 | The Board Of Regents Acting For And On Behalf Of The University Of Michigan | Surface-modified nanoparticles and method of making and using same |
| US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US6019968A (en) | 1995-04-14 | 2000-02-01 | Inhale Therapeutic Systems, Inc. | Dispersible antibody compositions and methods for their preparation and use |
| US6121022A (en) | 1995-04-14 | 2000-09-19 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US5834252A (en) | 1995-04-18 | 1998-11-10 | Glaxo Group Limited | End-complementary polymerase reaction |
| US5641870A (en) | 1995-04-20 | 1997-06-24 | Genentech, Inc. | Low pH hydrophobic interaction chromatography for antibody purification |
| US5916597A (en) | 1995-08-31 | 1999-06-29 | Alkermes Controlled Therapeutics, Inc. | Composition and method using solid-phase particles for sustained in vivo release of a biologically active agent |
| WO1997013852A1 (en) | 1995-10-10 | 1997-04-17 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5985320A (en) | 1996-03-04 | 1999-11-16 | The Penn State Research Foundation | Materials and methods for enhancing cellular internalization |
| WO1997032572A2 (en) | 1996-03-04 | 1997-09-12 | The Penn State Research Foundation | Materials and methods for enhancing cellular internalization |
| WO1997034631A1 (en) | 1996-03-18 | 1997-09-25 | Board Of Regents, The University Of Texas System | Immunoglobin-like domains with increased half lives |
| WO1997044013A1 (en) | 1996-05-24 | 1997-11-27 | Massachusetts Institute Of Technology | Aerodynamically light particles for pulmonary drug delivery |
| US5985309A (en) | 1996-05-24 | 1999-11-16 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| US5874064A (en) | 1996-05-24 | 1999-02-23 | Massachusetts Institute Of Technology | Aerodynamically light particles for pulmonary drug delivery |
| US6316024B1 (en) | 1996-10-11 | 2001-11-13 | Sequus Pharmaceuticals, Inc. | Therapeutic liposome composition and method of preparation |
| WO1998023289A1 (en) | 1996-11-27 | 1998-06-04 | The General Hospital Corporation | MODULATION OF IgG BINDING TO FcRn |
| WO1998024884A1 (en) | 1996-12-02 | 1998-06-11 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1998031346A1 (en) | 1997-01-16 | 1998-07-23 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| US5855913A (en) | 1997-01-16 | 1999-01-05 | Massachusetts Instite Of Technology | Particles incorporating surfactants for pulmonary drug delivery |
| US6277375B1 (en) | 1997-03-03 | 2001-08-21 | Board Of Regents, The University Of Texas System | Immunoglobulin-like domains with increased half-lives |
| US20030153043A1 (en) | 1997-05-21 | 2003-08-14 | Biovation Limited | Method for the production of non-immunogenic proteins |
| EP1012280B1 (en) | 1997-06-11 | 2004-11-10 | Borean Pharma A/S | Trimerising module |
| US6703199B1 (en) | 1997-06-12 | 2004-03-09 | Research Corporation Technologies, Inc. | Artificial antibody polypeptides |
| WO1999015154A1 (en) | 1997-09-24 | 1999-04-01 | Alkermes Controlled Therapeutics, Inc. | Methods for fabricating polymer-based controlled release preparations |
| US5989463A (en) | 1997-09-24 | 1999-11-23 | Alkermes Controlled Therapeutics, Inc. | Methods for fabricating polymer-based controlled release devices |
| WO1999016873A1 (de) | 1997-09-26 | 1999-04-08 | Arne Skerra | Anticaline |
| US6696245B2 (en) | 1997-10-20 | 2004-02-24 | Domantis Limited | Methods for selecting functional polypeptides |
| WO1999020253A1 (en) | 1997-10-23 | 1999-04-29 | Bioglan Therapeutics Ab | Encapsulation method |
| WO1999045962A1 (en) | 1998-03-13 | 1999-09-16 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
| WO1999054342A1 (en) | 1998-04-20 | 1999-10-28 | Pablo Umana | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
| WO1999066903A2 (en) | 1998-06-24 | 1999-12-29 | Advanced Inhalation Research, Inc. | Large porous particles emitted from an inhaler |
| US6818418B1 (en) | 1998-12-10 | 2004-11-16 | Compound Therapeutics, Inc. | Protein scaffolds for antibody mimics and other binding proteins |
| WO2000042072A2 (en) | 1999-01-15 | 2000-07-20 | Genentech, Inc. | Polypeptide variants with altered effector function |
| EP1176195A1 (en) | 1999-04-09 | 2002-01-30 | Kyowa Hakko Kogyo Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
| WO2001004144A2 (de) | 1999-07-13 | 2001-01-18 | Scil Proteins Gmbh | Design von beta-faltblatt-proteinen mit spezifischen bindungseigenschaften |
| WO2001005950A2 (en) | 1999-07-20 | 2001-01-25 | Morphosys Ag | Methods for displaying (poly)peptides/proteins on bacteriophage particles via disulfide bonds |
| WO2001014424A2 (en) | 1999-08-24 | 2001-03-01 | Medarex, Inc. | Human ctla-4 antibodies and their uses |
| WO2001077137A1 (en) | 2000-04-12 | 2001-10-18 | Human Genome Sciences, Inc. | Albumin fusion proteins |
| US20040161738A1 (en) | 2000-05-26 | 2004-08-19 | Arumugam Muruganandam | Single-domain brain-targeting antibody fragments derived from llama antibodies |
| WO2002043478A2 (en) | 2000-11-30 | 2002-06-06 | Medarex, Inc. | Transgenic transchromosomal rodents for making human antibodies |
| US20040175756A1 (en) | 2001-04-26 | 2004-09-09 | Avidia Research Institute | Methods for using combinatorial libraries of monomer domains |
| US20050048512A1 (en) | 2001-04-26 | 2005-03-03 | Avidia Research Institute | Combinatorial libraries of monomer domains |
| US20050053973A1 (en) | 2001-04-26 | 2005-03-10 | Avidia Research Institute | Novel proteins with targeted binding |
| WO2002092780A2 (en) | 2001-05-17 | 2002-11-21 | Diversa Corporation | Novel antigen binding molecules for therapeutic, diagnostic, prophylactic, enzymatic, industrial, and agricultural applications, and methods for generating and screening thereof |
| WO2003002609A2 (en) | 2001-06-28 | 2003-01-09 | Domantis Limited | Dual-specific ligand and its use |
| WO2003006007A1 (en) | 2001-07-11 | 2003-01-23 | Research & Innovation Soc.Coop. A R.L. | Use of compounds as functional antagonists to the central cannabinoid receptors |
| WO2003035835A2 (en) | 2001-10-25 | 2003-05-01 | Genentech, Inc. | Glycoprotein compositions |
| WO2003048731A2 (en) | 2001-12-03 | 2003-06-12 | Abgenix, Inc. | Antibody categorization based on binding characteristics |
| WO2003064383A2 (en) | 2002-02-01 | 2003-08-07 | Ariad Gene Therapeutics, Inc. | Phosphorus-containing compounds & uses thereof |
| US20030157579A1 (en) | 2002-02-14 | 2003-08-21 | Kalobios, Inc. | Molecular sensors activated by disinhibition |
| WO2003074679A2 (en) | 2002-03-01 | 2003-09-12 | Xencor | Antibody optimization |
| US20030198971A1 (en) | 2002-04-18 | 2003-10-23 | Kalobios, Inc. | Reactivation-based molecular interaction sensors |
| WO2004003019A2 (en) | 2002-06-28 | 2004-01-08 | Domantis Limited | Immunoglobin single variant antigen-binding domains and dual-specific constructs |
| US20060115470A1 (en) | 2002-11-08 | 2006-06-01 | Ablynx N. V. | Camelidae antibodies against imminoglobulin e and use thereof for the treatment of allergic disorders |
| WO2004058821A2 (en) | 2002-12-27 | 2004-07-15 | Domantis Limited | Dual specific single domain antibodies specific for a ligand and for the receptor of the ligand |
| US20050008625A1 (en) | 2003-02-13 | 2005-01-13 | Kalobios, Inc. | Antibody affinity engineering by serial epitope-guided complementarity replacement |
| WO2004101790A1 (en) | 2003-05-14 | 2004-11-25 | Domantis Limited | A process for recovering polypeptides that unfold reversibly from a polypeptide repertoire |
| WO2004106368A1 (de) | 2003-05-28 | 2004-12-09 | Scil Proteins Gmbh | Generierung künstlicher bindungsproteine auf der grundlage von ubiquitin-proteinen |
| WO2004081026A2 (en) | 2003-06-30 | 2004-09-23 | Domantis Limited | Polypeptides |
| WO2005028443A2 (en) | 2003-09-15 | 2005-03-31 | Wyeth A Corporation Of The State Of Delaware, Usa | Protein tyrosine kinase enzyme inhibitors |
| WO2005035572A2 (en) | 2003-10-08 | 2005-04-21 | Domantis Limited | Antibody compositions and methods |
| US20070065440A1 (en) | 2003-10-08 | 2007-03-22 | Domantis Limited | Antibody compositions and methods |
| US20090148434A1 (en) | 2003-10-08 | 2009-06-11 | Domantis Limted | Antibody Compositions and Methods |
| US20050255552A1 (en) | 2004-01-20 | 2005-11-17 | Kalobios, Inc. | Antibody specificity transfer using minimal essential binding determinants |
| US20060008844A1 (en) | 2004-06-17 | 2006-01-12 | Avidia Research Institute | c-Met kinase binding proteins |
| WO2006079372A1 (en) | 2005-01-31 | 2006-08-03 | Ablynx N.V. | Method for generating variable domain sequences of heavy chain antibodies |
| WO2006122806A2 (en) | 2005-05-20 | 2006-11-23 | Novartis Ag | 1,3-dihydro-imidazo [4,5-c] quinolin-2-ones as lipid kinase inhibitors |
| US20090304721A1 (en) | 2005-09-07 | 2009-12-10 | Medlmmune, Inc | Toxin conjugated eph receptor antibodies |
| WO2007059782A1 (en) | 2005-11-28 | 2007-05-31 | Genmab A/S | Recombinant monovalent antibodies and methods for production thereof |
| WO2009036082A2 (en) | 2007-09-12 | 2009-03-19 | Genentech, Inc. | Combinations of phosphoinositide 3-kinase inhibitor compounds and chemotherapeutic agents, and methods of use |
| WO2009055730A1 (en) | 2007-10-25 | 2009-04-30 | Genentech, Inc. | Process for making thienopyrimidine compounds |
Non-Patent Citations (211)
| Title |
|---|
| "Cancer Chemotherapy and Biotherapy", 2001, LIPPINCOTT, WILLIAMS & WILKINS |
| "Controlled Drug Bioavailability, Drug Product Design and Performance", 1984, WILEY |
| "Epitope Mapping Protocols in Methods in Molecular Biology", vol. 66, 1996, HUMANA PRESS |
| "Goodman and Gilman's The Pharmacological Basis of Therapeutics", vol. 10, 2001, MCGRAW-HILL |
| "Medical Applications of Controlled Release", 1974, CRC PRES. |
| "Monoclonal Antibodies and Peptide Therapy in Autoimmune Diseases", 1993, MARCEL DEKKER |
| "Monoclonal Antibodies For Cancer Detection And Therapy", 1985, ACADEMIC PRESS, article "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", pages: 303 - 16 |
| "Monoclonal Antibodies, Cytokines and Arthritis", 1991, MARCEL DEKKER |
| "PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS |
| "PCR Technology: Principles and Applications for DNA Amplification", 1992, FREEMAN PRESS |
| "Pharmaceutical Dosage Forms: Disperse Systems", 1990, MARCEL DEKKER |
| "Pharmaceutical Dosage Forms: Parenteral Medications", 1993, MARCEL DEKKE |
| "Pharmaceutical Dosage Forms: Tablets", 1990, MARCEL DEKKER |
| "Pharmacotherapeutics for Advanced Practice:A Practical Approach", 2001, LIPPINCOTT, WILLIAMS & WILKINS |
| "Remington's Pharmaceutical Sciences and Introduction to Pharmaceutical Dosage Forms", 1995, MACK PUB. CO. |
| ALIMANDI ET AL., ONCOGENE, vol. 10, 1995, pages 1813 - 1821 |
| AL-LAZIKANI ET AL., J. MOL. BIOL., vol. 273, 1997, pages 927 - 948 |
| ALLEN, NAT. REV. CANCER, vol. 2, 2002, pages 750 - 763 |
| ALT ET AL., FEBS LETTERS, vol. 454, 1999, pages 90 - 94 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., J.MOL. BIOL., vol. 215, 1990, pages 403 - 10 |
| ALTSCHUL ET AL., NUC. ACIDS RES., vol. 25, 1977, pages 3389 - 3402 |
| AMON ET AL.: "Monoclonal Antibodies And Cancer Therapy", 1985, ALAN R. LISS, INC., article "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", pages: 243 - 56 |
| ASHKENAZI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 10535 - 10539 |
| BAERT ET AL., NEW ENGL. J. MED., vol. 348, 2003, pages 601 - 608 |
| BATZER ET AL., NUCLEIC ACID RES., vol. 19, 1991, pages 5081 |
| BEAUCAGE ET AL., TETRA. LETT., vol. 22, 1981, pages 1859 |
| BENIAMINOVIT ET AL., NEW ENGL. J. MED., vol. 342, 2000, pages 613 - 619 |
| BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426 |
| BITTNER ET AL., METH. ENZYMOL., vol. 153, 1987, pages 516 |
| BLOEMAN ET AL., FEBS LETT., vol. 357, 1995, pages 140 |
| BLUNDEL ET AL.: "Protein Crystallography", 1976, ACADEMIC PRESS |
| BOUYAN ET AL., PNAS, vol. 102, 2005, pages 15024 - 15029 |
| BRENNAN ET AL., SCIENCE, vol. 229, 1985, pages 81 - 83 |
| BRENT ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 2003 |
| BRISCOE ET AL., AM. J. PHYSIOL., vol. 1233, 1995, pages 134 |
| BROOKS ET AL., J. COMP. CHEM., vol. 4, 1983, pages 187 |
| BROWN ET AL., METH. ENZYMOL., vol. 68, 1979, pages 109 |
| BUCHWALD ET AL., SURGERY, vol. 88, 1980, pages 507 |
| BURGESS ET AL., MOL CELL, vol. 12, 2003, pages 541 - 552 |
| CHAYEN ET AL., NATURE METHODS, vol. 5, 2008, pages 147 - 153 |
| CHEN ET AL., EMBO J., vol. 12, 1993, pages 821 - 830 |
| CHEN ET AL., INTERNATIONAL IMMUNOLOGY, vol. 5, 1993, pages 647 - 656 |
| CHEUNG ET AL., VIROLOGY, vol. 176, 1990, pages 546 - 552 |
| CHO ET AL., NATURE, vol. 421, 2003, pages 756 - 760 |
| CHO; LEAHY, SCIENCE, vol. 297, 2002, pages 1330 - 1333 |
| CHOI ET AL., NATURE GENETICS, vol. 4, 1993, pages 117 - 123 |
| CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917 |
| CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877 - 883 |
| CLEEK ET AL., PRO. INT'L. SYMP. CONTROL. REL. BIOACT. MATER., vol. 24, 1997, pages 853 - 854 |
| CORTEZ-RETAMOZO ET AL., INT J CANCER, vol. 89, 2002, pages 456 - 62 |
| COX ET AL., EUR. J IMMUNOL., vol. 24, 1994, pages 827 - 836 |
| CREIGHTON, PROTEINS, 1984 |
| DEFAZIO ET AL., CANCER, vol. 87, 2000, pages 487 - 498 |
| DENARDO ET AL., CLIN CANCER RES., vol. 4, no. 10, 1998, pages 2483 - 90 |
| DENT: "Good Laboratory and Good Clinical Practice", 2001, URCH PUBL. |
| DIMASI ET AL., J MOL BIOL., vol. 393, 2009, pages 672 - 692 |
| DUMOULIN ET AL., NATURE, vol. 424, 2003, pages 783 - 788 |
| DURING ET AL., ANN. NEUROL., vol. 25, 1989, pages 351 |
| E. MEYERS; W. MILLER, COMPUT. APPL. BIOSCI., vol. 4, 1988, pages 11 - 17 |
| ECKERT ET AL., PCR METHODS AND APPLICATIONS, vol. 1, 1991, pages 17 |
| ELLIOT; O'HARE, CELL, vol. 88, 1997, pages 223 |
| EPSTEIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 3688 - 3692 |
| FERGUSON ET AL., MOL CELL, vol. 12, 2003, pages 541 - 552 |
| FISHWILD ET AL., NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 845 - 851 |
| FRANKLIN ET AL., CANCER CELL, vol. 5, 2004, pages 317 - 328 |
| FRIGUET ET AL., J IMMUNOL METHODS, vol. 77, 1985, pages 305 - 19 |
| GARRETT ET AL., CELL, vol. 110, 2002, pages 763 - 773 |
| GARRETT ET AL., MOL CELL, vol. 11, 2003, pages 495 - 505 |
| GENNARO: "Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOTT, WILLIAMS, AND WILKINS |
| GENTZ ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 821 - 824 |
| GEYSEN ET AL., MOL. IMMUNOL., vol. 23, 1986, pages 709 - 715 |
| GEYSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 8, 1984, pages 3998 - 4002 |
| GEYSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 78 - 182 |
| GHOSH ET AL., NEW ENGL. J. MED., vol. 348, 2003, pages 24 - 32 |
| GLENNIE ET AL., J. IMMUNOL., vol. 139, 1987, pages 2367 - 2375 |
| GOODSON, MEDICAL APPLICATIONS OF CONTROLLED RELEASE, vol. 2, 1984, pages 115 - 138 |
| GUY ET AL., PNAS, vol. 91, 1994, pages 8132 - 8136 |
| HAENEL ET AL., ANAL BIOCHEM, vol. 339, 2005, pages 182 - 84 |
| HANSSON ET AL., J. MOL. BIOL., vol. 287, 1999, pages 265 - 76 |
| HARAYAMA, TRENDS BIOTECHNOL., vol. 16, no. 2, 1998, pages 76 - 82 |
| HARDING; LONBERG, ANN. N. Y. ACAD. SCI., vol. 764, 1995, pages 536 - 546 |
| HARDMAN ET AL.: "Goodman and Gilman's The Pharmacological Basis of Therapeutics", 2001, MCGRAW-HILL |
| HARRINGTON ET AL., NAT GENET, vol. 15, 1997, pages 345 |
| HELLSTROM ET AL.: "Controlled Drug Delivery", 1987, MARCEL DEKKER, INC., article "Antibodies For Drug Delivery", pages: 623 - 53 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915 |
| HEROLD ET AL., NEW ENGL. J. MED., vol. 346, 2002, pages 1692 - 1698 |
| HOLLIGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448 |
| HOLLINGER; HUDSON, NATURE BIOTECHNOLOGY, vol. 23, 2005, pages 1126 - 1136 |
| HOPP ET AL., PROC. NATL. ACAD. SCI USA, vol. 78, 1981, pages 3824 - 3828 |
| HOWARD ET AL., J. NEUROSURG., vol. 7 1, 1989, pages 105 |
| HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883 |
| HUSTON ET AL., PROC. NATL. ACAD. SCI., vol. 85, 1988, pages 5879 - 5883 |
| HWANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 4030 - 4034 |
| J. J. KILLION; I. J. FIDLER, IMMUNOMETHODS, vol. 4, 1994, pages 273 |
| JENNY BOSTROM ET AL., SCIENCE, vol. 323, 2009, pages 1610 - 1614 |
| JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525 |
| JORISSEN ET AL., EXP CELL RES, vol. 284, 2003, pages 31 - 53 |
| K. KEINANEN; M. L. LAUKKANEN; 1994, FEBS LETT., vol. 346, pages 123 |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NIH PUBLICATION NO. 91-3242 |
| KABAT; CHOTHIA: "Sequences of Proteins of Immunological Interest", 1991, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES |
| KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5787 |
| KARPOVSKY ET AL., J. EXP. MED., vol. 160, 1984, pages 1686 |
| KIRKLAND ET AL., J. IMMUNOL., vol. 137, 1986, pages 3614 - 3619 |
| KNAPPIK ET AL., J MOL BIOL, vol. 296, 2000, pages 57 - 86 |
| KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495 |
| KRAUS ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 86, 1989, pages 9193 - 9197 |
| KRAUS ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 90, 1993, pages 2900 - 2904 |
| KUROIWA ET AL., NATURE BIOTECHNOLOGY, vol. 20, 2002, pages 889 - 894 |
| KYTE ET AL., J.MOI. BIOL., vol. 157, 1982, pages 105 - 132 |
| LAM ET AL., PROC. INT'L. SYMP. CONTROL REL. BIOACT. MATER., vol. 24, 1997, pages 759 - 760 |
| LANGER ET AL., J. BIOMED. MATER. RES., vol. 15, 1981, pages 167 - 277 |
| LANGER, CHEM. TECH., vol. 12, 1982, pages 98 - 105 |
| LANGER, SCIENCE, vol. 249, 1990, pages 1527 - 1533 |
| LAUWEREYS ET AL., EMBO J, vol. 17, 1998, pages 3512 - 3520 |
| LAZIKANI ET AL., J. MOL. BIO., vol. 273, 1997, pages 927 - 948 |
| LEVY ET AL., SCIENCE, vol. 228, 1985, pages 190 |
| LIPSKY ET AL., NEW ENGL. J. MED., vol. 343, 2000, pages 1594 - 1602 |
| LIU ET AL., J. NEUROL. NEUROSURG. PSYCH., vol. 67, 1999, pages 451 - 456 |
| LIU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 8648 |
| LONBERG ET AL., NATURE, vol. 368, no. 6474, 1994, pages 856 - 859 |
| LONBERG: "Handbook of Experimental Pharmacology", vol. 113, 1994, pages: 49 - 101 |
| LONBERG; HUSZAR, INTERN. REV. IMMUNOL., vol. 13, 1995, pages 65 - 93 |
| LORENZO; BLASCO, BIOTECHNIQUES, vol. 24, no. 2, 1998, pages 308 - 313 |
| LU ET AL., JBC, vol. 279, 2004, pages 2856 - 2865 |
| LU ET AL., JBC, vol. 280, 2005, pages 19665 - 19672 |
| MARVIN ET AL., ACTA PHARMACOLOGICA SINICA, vol. 26, 2005, pages 649 - 658 |
| MARVIN ET AL., CURR OPIN DRUG DISC DEVELOP, vol. 9, 2006, pages 184 - 193 |
| MATTILA ET AL., NUCLEIC ACIDS RES., vol. 19, 1991, pages 967 |
| MATTOON ET AL., PNAS, vol. 101, 2004, pages 923 - 928 |
| MAYNARD ET AL.: "A Handbook of SOPs for Good Clinical Practice", 1996, INTERPHARM PRESS |
| MICHAELSON ET AL., MABS, vol. 1, 2009, pages 128 - 141 |
| MILGROM ET AL., NEW ENGL. J. MED., vol. 341, 1999, pages 1966 - 1973 |
| MOLDENHAUER ET AL., SCAND. J. IMMUNOL., vol. 32, 1990, pages 77 - 82 |
| MOREL ET AL., MOLEC. IMMUNOL., vol. 25, 1988, pages 7 - 15 |
| MORRISON ET AL., NATURE BIOTECH., vol. 15, 1997, pages 159 - 163 |
| NAIDU ET AL., BR. J. CANCER, vol. 78, 1988, pages 1385 - 1390 |
| NANEVICZ ET AL., J. BIOL. CHEM., vol. 270, no. 37, 1995, pages 21619 - 21625 |
| NARANG ET AL., METH. ENZYMOL., vol. 68, 1979, pages 90 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453 |
| NING ET AL., RADIOTHERAPY & ONCOLOGY, vol. 39, 1996, pages 179 - 189 |
| OGISO ET AL., CELL, vol. 110, 2002, pages 775 - 787 |
| OHTSUKA ET AL., J. BIOL. CHEM., vol. 260, 1985, pages 2605 - 2608 |
| OWAIS ET AL., ANTIMICROB. AGENTS CHEMOTHER., vol. 39, 1995, pages 180 |
| PASTAN; KREITMAN, CURR. OPIN. INVESTIG. DRUGS, vol. 3, 2002, pages 1089 - 1091 |
| PATTEN ET AL., CURR. OPINION BIOTECHNOL., vol. 8, 1997, pages 724 - 33 |
| PAULUS, BEHRING INS. MITT. NO. 78, 1985, pages 118 - 132 |
| PAYNE, CANCER CELL, vol. 3, 2003, pages 207 - 212 |
| PEARSON; LIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PETERSON ET AL., BIOCONJUG. CHEM., vol. 10, no. 4, 1999, pages 553 - 7 |
| PIEHLER ET AL., J IMMUNOL METHODS, vol. 201, 1997, pages 189 - 206 |
| PLESCHBERGER ET AL., BIOCONJUGATE CHEM, vol. 14, 2003, pages 440 - 448 |
| PLOWMAN ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 87, 1990, pages 4905 - 4909 |
| PLOWMAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 4905 - 4909 |
| POLJAK ET AL., STRUCTURE, vol. 2, 1994, pages 1121 - 1123 |
| PORTIELJI ET AL., CANCER IMMUNOL. IMMUNOTHER., vol. 52, 2003, pages 133 - 144 |
| PRASSLER ET AL., IMMUNOTHERAPY, vol. 1, 2009, pages 571 - 583 |
| QUEEN ET AL., IMMUNOL. REV., vol. 89, 1986, pages 49 - 68 |
| QUEEN ET AL., PROC. NATL. ACAD., U.S.A., vol. 86, 1989, pages 10029 - 10033 |
| RANADE, J. CLIN. PHARMACOL., vol. 29, 1989, pages 685 |
| RANGER; PEPPAS, J. MACROMOL. SCI. REV. MACROMOL. CHEM., vol. 23, 1983, pages 61 |
| RIECHMANN ET AL., NATURE, vol. 332, 1998, pages 323 - 327 |
| ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143 |
| ROSSMANN, ACTA CRYSTALS A, vol. 46, 1990, pages 73 - 82 |
| ROSSOLINI ET AL., MOL. CELL. PROBES, vol. 8, 1994, pages 91 - 98 |
| SAITO ET AL., ADV. DRUG DELIV. REV., vol. 55, 2003, pages 199 - 215 |
| SAUDEK ET AL., N. ENGL. J. MED., vol. 321, 1989, pages 574 |
| SCHARF ET AL., RESULTS PROBL. CELL DIFFER., vol. 20, 1994, pages 125 |
| SCHLESSINGER, CELL, vol. 110, 2002, pages 669 - 672 |
| SCHREIER ET AL., J. BIOL. CHEM., vol. 269, 1994, pages 9090 |
| SEFTON: "CRC Crit. Ref Biomed. Eng.", vol. 14, 1987, pages: 20 |
| SENTER; SPRINGER, ADV. DRUG DELIV. REV., vol. 53, 2001, pages 247 - 264 |
| SHEN ET AL., J IMMUN METHODS, vol. 218, 2007, pages 65 - 74 |
| SHIELDS ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 26733 - 26740 |
| SHIELDS ET AL., J. BIOL. CHEN., vol. 276, 2001, pages 6591 - 6604 |
| SIDMAN ET AL., BIOPOLYMERS, vol. 22, 1983, pages 547 - 556 |
| SLAMON ET AL., NEW ENGL. J. MED., vol. 344, 2001, pages 783 - 792 |
| SMITH, ANNU. REV. MICROBIOL., vol. 49, pages 807 |
| SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1970, pages 482C |
| SONG ET AL., PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 50, 1995, pages 372 - 397 |
| STAHLI ET AL., METHODS IN ENZYMOLOGY, vol. 9, 1983, pages 242 - 253 |
| STIJLEMANS ET AL., J BIOL CHEM, vol. 279, 2004, pages 1256 - 1261 |
| TAYLOR ET AL., INTERNATIONAL IMMUNOLOGY, 1994, pages 579 - 591 |
| TAYLOR ET AL., NUCLEIC ACIDS RESEARCH, vol. 20, 1992, pages 6287 - 6295 |
| THORPE ET AL., IMMUNOL. REV., vol. 62, 1982, pages 119 - 58 |
| THORPE ET AL.: "Monoclonal Antibodies 84: Biological And Clinical Applications", 1985, article "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", pages: 475 - 506 |
| TOMIZUKA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 722 - 727 |
| TOMLINSON ET AL., J. FOL. BIOL., vol. 227, 1992, pages 776 - 798 |
| TOMOYUKI IGAWA ET AL., NATURE BIOTECHNOLOGY, vol. 28, 2010, pages 1203 - 1207 |
| TRAIL ET AL., CANCER IMMUNOL. IMMUNOTHER., vol. 52, 2003, pages 328 - 337 |
| TUAILLON ET AL., J. IMMUNOL., vol. 152, 1994, pages 2912 - 2920 |
| TUAILLON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, 1993, pages 3720 - 3724 |
| UMANA, NAT. BIOTECH., vol. 17, 1999, pages 176 - 180 |
| UMEZAWA ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 153, 1988, pages 1038 |
| VIL ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 11337 - 11341 |
| VIMEKAS ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 5600 - 5607 |
| WADDLETON ET AL., ANAL. BIOCHEM., vol. 309, 2002, pages 150 - 157 |
| WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546 |
| WAWRZYNCZAK: "Antibody Therapy", 1996, BIOS SCIENTIFIC PUB. LTD |
| WEINER; KOTKOSKIE: "Excipient Toxicity and Safety", 2000, MARCEL DEKKER, INC. |
| WILSON ET AL., CELL, vol. 37, 1984, pages 767 |
| WINNACKER: "FROM GENES TO CLONES", 1987, VCH PUBLISHERS |
| WU ET AL., NAT BIOTECHNOL., vol. 11, 2007, pages 1290 - 1297 |
| YANG ET AL., NEW ENGL. J. MED., vol. 349, 2003, pages 427 - 434 |
| YARDEN; SLIWKOWSKI, NATURE REV, vol. 2, 2001, pages 127 - 137 |
| ZAPATA ET AL., PROTEIN ENG., vol. 8, 1995, pages 1057 - 1062 |
| ZHENG ET AL., J. IMMUNOL., vol. 154, 1995, pages 5590 - 5600 |
| ZIMMERMAN, NUCL. MED. BIOL., vol. 26, no. 8, 1999, pages 943 - 50 |
| ZUO ET AL., PROTEIN ENGINEERING, vol. 13, 2000, pages 361 - 367 |
| ZUPNICK ET AL., J. BIOL. CHEM., vol. 281, no. 29, 2006, pages 20464 - 20473 |
Cited By (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9725512B2 (en) | 2012-11-08 | 2017-08-08 | Hoffmann-La Roche Inc. | HER3 antibodies binding to the beta-hairpin of HER3 |
| US10626177B2 (en) | 2012-11-08 | 2020-04-21 | Hoffmann-La Roche Inc. | HER3 antigen binding proteins binding to the beta-hairpin of HER3 |
| US10364290B2 (en) | 2012-11-08 | 2019-07-30 | Hoffmann-La Roche Inc. | Anti-HER3/HER4 antibodies binding to the beta-hairpin of HER3 and the beta-hairpin of HER4 |
| JP2018068298A (ja) * | 2012-11-08 | 2018-05-10 | エフ・ホフマン−ラ・ロシュ・アクチェンゲゼルシャフト | Her3のベータヘアピン及びher4のベータヘアピンに結合する抗her3/her4抗原結合タンパク質 |
| US9725511B2 (en) | 2012-11-08 | 2017-08-08 | Hoffmann-La Roche Inc. | Anti-HER3/HER4 antibodies binding to the beta-hairpin of HER3 and the beta-hairpin of HER4 |
| CN106459207A (zh) * | 2014-05-14 | 2017-02-22 | 豪夫迈·罗氏有限公司 | 结合HER3β‑发夹的抗HER3抗体 |
| JP2017521050A (ja) * | 2014-05-14 | 2017-08-03 | エフ・ホフマン−ラ・ロシュ・アクチェンゲゼルシャフト | Her3のベータヘアピンに結合する抗her3抗体 |
| JP2017517252A (ja) * | 2014-05-14 | 2017-06-29 | エフ・ホフマン−ラ・ロシュ・アクチェンゲゼルシャフト | Her3のベータヘアピン及びher2のドメインiiに結合するher3/her2二重特異性抗体 |
| CN106459207B (zh) * | 2014-05-14 | 2020-07-10 | 豪夫迈·罗氏有限公司 | 结合HER3β-发夹的抗HER3抗体 |
| US9783611B2 (en) | 2014-05-14 | 2017-10-10 | Hoffman-La Roche Inc. | Anti-HER3 antibodies binding to the beta-hairpin of HER3 |
| CN106255705A (zh) * | 2014-05-14 | 2016-12-21 | 豪夫迈·罗氏有限公司 | 结合HER3β‑发夹和HER2域II的HER3/HER2双特异性抗体 |
| US10808038B2 (en) | 2014-05-14 | 2020-10-20 | Hoffmann-La Roche Inc. | HER3/HER2 bispecific antibodies binding to the beta-hairpin of HER3 and domain II of HER2 |
| WO2015173250A1 (en) * | 2014-05-14 | 2015-11-19 | F. Hoffmann-La Roche Ag | Anti-her3 antibodies binding to the beta-hairpin of her3 |
| WO2015173248A1 (en) * | 2014-05-14 | 2015-11-19 | F. Hoffmann-La Roche Ag | Her3/her2 bispecific antibodies binding to the beta-hairpin of her3 and domain ii of her2 |
| EP3539990A1 (en) | 2014-07-16 | 2019-09-18 | Dana-Farber Cancer Institute, Inc. | Her3 inhibition in low-grade serous cancers |
| WO2016059600A1 (en) | 2014-10-17 | 2016-04-21 | Novartis Ag | Combination of ceritinib with an egfr inhibitor |
| WO2019185878A1 (en) * | 2018-03-29 | 2019-10-03 | Hummingbird Bioscience Holdings Pte. Ltd. | Her3 antigen-binding molecules |
| US10662241B1 (en) | 2018-03-29 | 2020-05-26 | Hummingbird Bioscience Holdings Pte. Ltd. | HER3 antigen-binding molecules |
| WO2019185164A1 (en) * | 2018-03-29 | 2019-10-03 | Hummingbird Bioscience Holdings Pte. Ltd. | Her3 antigen-binding molecules |
| KR20200139725A (ko) * | 2018-03-29 | 2020-12-14 | 허밍버드 바이오사이언스 홀딩스 피티이. 엘티디. | Her3 항원 결합 분자 |
| CN112513095A (zh) * | 2018-03-29 | 2021-03-16 | 蜂鸟生物科技控股私人有限公司 | Her3抗原结合分子 |
| JP2021510535A (ja) * | 2018-03-29 | 2021-04-30 | ハミングバード・バイオサイエンス・ホールディングス・プライベート・リミテッド | Her3抗原結合性分子 |
| EP3851458A1 (en) * | 2018-03-29 | 2021-07-21 | Hummingbird Bioscience Holdings Limited | Her3 antigen-binding molecules |
| JP2022118731A (ja) * | 2018-03-29 | 2022-08-15 | ハミングバード・バイオサイエンス・プライベート・リミテッド | Her3抗原結合性分子 |
| JP7118331B2 (ja) | 2018-03-29 | 2022-08-16 | ハミングバード・バイオサイエンス・プライベート・リミテッド | Her3抗原結合性分子 |
| US11780933B2 (en) | 2018-03-29 | 2023-10-10 | Hummingbird Bioscience Pte. Ltd. | HER3 antigen-binding molecules |
| KR102593409B1 (ko) | 2018-03-29 | 2023-10-26 | 허밍버드 바이오사이언스 피티이. 엘티디. | Her3 항원 결합 분자 |
| JP7545437B2 (ja) | 2018-03-29 | 2024-09-04 | ハミングバード・バイオサイエンス・プライベート・リミテッド | Her3抗原結合性分子 |
| JP2024164153A (ja) * | 2018-03-29 | 2024-11-26 | ハミングバード・バイオサイエンス・プライベート・リミテッド | Her3抗原結合性分子 |
| AU2019240905B2 (en) * | 2018-03-29 | 2025-06-12 | Hummingbird Bioscience Pte. Ltd. | HER3 antigen-binding molecules |
Also Published As
| Publication number | Publication date |
|---|---|
| US20130273029A1 (en) | 2013-10-17 |
| MX2014006733A (es) | 2015-05-12 |
| IN2014CN04373A (enExample) | 2015-09-04 |
| AR089084A1 (es) | 2014-07-30 |
| CA2857601A1 (en) | 2013-06-13 |
| EA201491107A1 (ru) | 2014-11-28 |
| WO2013084148A3 (en) | 2013-08-15 |
| EP2788382A2 (en) | 2014-10-15 |
| IL232951A0 (en) | 2014-07-31 |
| SG11201402739YA (en) | 2014-06-27 |
| JP2015500829A (ja) | 2015-01-08 |
| UY34486A (es) | 2013-07-31 |
| CN104105709A (zh) | 2014-10-15 |
| TW201328707A (zh) | 2013-07-16 |
| BR112014013568A2 (pt) | 2017-06-13 |
| KR20140103135A (ko) | 2014-08-25 |
| BR112014013568A8 (pt) | 2017-06-13 |
| AU2012349736A1 (en) | 2014-06-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2018201967B2 (en) | Antibodies for epidermal growth factor receptor 3 (HER3) | |
| US10077317B2 (en) | Antibodies for epidermal growth factor receptor 3 (HER3) | |
| US20130273029A1 (en) | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 | |
| EP2788381A2 (en) | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3 | |
| HK1182118B (en) | Antibodies for epidermal growth factor receptor 3 (her3) | |
| HK1182118A (en) | Antibodies for epidermal growth factor receptor 3 (her3) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| ENP | Entry into the national phase |
Ref document number: 2857601 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 232951 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2014545418 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2014/006733 Country of ref document: MX |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012823094 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012823094 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2012349736 Country of ref document: AU Date of ref document: 20121204 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20147018339 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201491107 Country of ref document: EA |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12823094 Country of ref document: EP Kind code of ref document: A2 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014013568 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014013568 Country of ref document: BR Kind code of ref document: A2 Effective date: 20140604 |