WO2013053080A1

WO2013053080A1 - Anti-tumour fusion protein and coding gene and use thereof

Info

Publication number: WO2013053080A1
Application number: PCT/CN2011/001711
Authority: WO
Inventors: 刘志敏; 赵洪亮; 薛冲; 杜济良; 任敏; 夏姗
Original assignee: 中国人民解放军军事医学科学院生物工程研究所
Priority date: 2011-10-12
Filing date: 2011-10-12
Publication date: 2013-04-18

Abstract

Provided in the present invention is an anti-tumour fusion protein, wherein the fusion protein has an Onc protein consisting of 20-123 amino acid residues of SEQ ID ΝΟ：1, an HSA protein consisting of 144-728 amino acid residues of SEQ ID ΝΟ：1, and a 4D5MOCB polypeptide fragment consisting of 739-990 amino acid residues of SEQ ID ΝΟ：1. The present invention also provides the coding gene and the use of the fusion protein.

Description

Anti-tumor fusion protein and coding gene thereof and application thereof

The present invention relates to an anti-tumor fusion protein and its encoding gene and application.

Background technique

Onconase (One) protein is a ribonuclease extracted from the fertilized eggs of the Leopard frog. Unlike endogenous enzymes (such as the human ribonuclease), the activity of One protein is not inhibited by RNase Inhibitor (RI) in the cytoplasm, so it can be degraded after endocytosis RNA in a variety of cytoplasms causes apoptosis in cells. The unique mechanism and target make One protein possible to become a new type of anti-tumor drug.

However, clinical studies have exposed two defects of One protein: (1) short half-life, high renal accumulation, and easily induced dose-limiting nephrotoxicity; (2) poor tumor specificity. One protein lacks a specific cell surface receptor whose endocytosis is dependent on electrostatic interactions. As a highly alkaline protein, One protein is positively charged at physiological pH, and all eukaryotic cells are negatively charged under physiological conditions, and they can interact electrostatically with One protein to engulf it. Cell. Invention disclosure

The invention provides an anti-tumor fusion protein and a gene encoding the same and application.

The fusion protein provided by the present invention is as follows) or (b):

(a) a fusion protein having a One protein, a HAS protein, and a 4D5M0CB polypeptide fragment; the One protein consisting of Sequence 1 of the Sequence Listing from amino acid residues 20 to 123 at the N-terminus;

The HAS protein consists of sequence 1 of the sequence listing from amino acid residues 144 to 728 of the N-terminus; the 4D5M0CB polypeptide fragment consists of sequence 1 of the sequence listing from amino acid residues 739 to 990 of the N-terminus;

(b) a protein derived from sequence 1 in which (a) the fusion protein is subjected to substitution and/or deletion and/or addition of one or several amino acid residues and is associated with plant yellow dwarf resistance.

In order to facilitate the purification of the protein in (a), a label as shown in Table 1 may be attached to the amino terminus or the carboxy terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 in the Sequence Listing.

Table 1 Sequence of labels

Label residue sequence

Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH

FLAG 8 DYKDDDDK

Strep-tag II 8 WSHPQFEK

C-myc 10 EQKLISEEDL

The protein in (b) above may be artificially synthesized, or may be synthesized by first synthesizing the encoded gene. The gene encoding the protein in (b) above may be deleted by one or several amino acid residues in the DNA sequence shown in SEQ ID NO: 2 in the sequence listing, and/or one or several base pairs may be missed. The mutation, and/or the coding sequence of the tag shown in Table 1 at its 5' end and/or 3' end is obtained.

The fusion protein can be specifically as shown in SEQ ID NO:1 of the Sequence Listing.

Among the fusion proteins, One protein (Leopard frog ribonuclease; Onconase, One) acts as an effector molecule to kill tumor cells, HAS protein (human serum albumin; human serum albumin), as a carrier protein to improve One Pharmacokinetics and biodistribution of proteins; 4D5M0CB polypeptide fragments (tumor-directed molecules; single-chain antibody fragments that recognize EpCAM) promote the uptake of One by tumor cells and tissues.

Genes encoding the fusion proteins are also within the scope of the invention.

The gene may specifically be a DNA molecule of the following (1) or (2) or (3) or (4):

(1) a DNA molecule having a gene, a gene and a 4D5M0CB gene; the One gene is as shown in the sequence 2 of the sequence listing from nucleotides 58 to 369 at the 5' end; the gene is as in sequence 2 of the sequence listing From nucleotides 430 to 2184 of the 5' end; the gene is shown as sequence 2 of the sequence listing from nucleotides 2215 to 2970 at the 5' end;

(2) a DNA molecule as shown in Sequence 2 of the Sequence Listing;

(3) a DNA molecule which hybridizes under stringent conditions to a DNA sequence defined by (1) or (2) and which encodes the fusion protein;

(4) A DNA molecule having 90% or more homology with the DNA sequence defined by (1) or (2) and encoding the fusion protein.

The above stringent conditions may be to hybridize and wash the membrane in a solution of 0.1XSSPE (or 0.1XSSC) and 0.1% SDS at 65 °C.

A recombinant expression vector, expression cassette, transgenic cell line or recombinant strain containing the gene is within the scope of the present invention.

The recombinant expression vector may specifically insert the gene into the yeast expression vector PPIC9. The recombinant plasmid obtained by cloning the site.

The recombinant strain may specifically be a recombinant strain obtained by introducing the recombinant expression vector into yeast. The yeast is preferably Pichia pastoris. The Pichia pastoris may specifically be Pichia pastoris, preferably Pichia pastoris GS 115 hi s4 (Mut ⁺ hi s- ) NRRLY-15851.

The present invention also contemplates a method of preparing the fusion protein by culturing the recombinant bacterium to obtain the protein.

In the method, methanol may be induced for 2-4 days in the process of culturing the recombinant bacteria. The methanol induction time is preferably 72 hours. The concentration of the methanol in the culture system is preferably 0.5% by volume.

The use of the fusion protein in the preparation of the following products is also within the scope of the invention: a tumor cell growth inhibitor and/or a cancer therapeutic drug and/or a cancer preventive drug. The tumor cells may be colon cancer cells and/or melanoma cells. The cancer can be colon cancer and/or melanoma. The colon cancer cells are preferably HT29 cells. The melanoma cell is preferably A375 cells. The colon cancer is preferably colon cancer caused by HT29 cells. The melanoma is preferably a melanoma caused by A375 cells.

The present invention also protects a product whose active ingredient is the fusion protein; the product is a tumor cell growth inhibitor and/or a cancer therapeutic drug and/or a cancer preventive drug. The tumor cells may be colon cancer cells and/or melanoma cells. The cancer can be colon cancer and/or melanoma. The colon cancer cells are preferably HT29 cells. The melanoma cell is preferably A375 cells. The colon cancer is preferably colon cancer caused by HT29 cells. The melanoma is preferably a melanoma caused by A375 cells.

The protein can be used to inhibit tumor cell growth and/or treat cancer and/or prevent cancer. The tumor cells may be colon cancer cells and/or melanoma cells. The cancer can be colon cancer and/or melanoma. The colon cancer cells are preferably HT29 cells. The melanoma cell is preferably A375 cells. The colon cancer is preferably colon cancer caused by HT29 cells. The melanoma is preferably a melanoma caused by A375 cells.

The product can be used to inhibit tumor cell growth and/or treat cancer and/or prevent cancer. . The cancer can be colon cancer and/or melanoma. The colon cancer cells are preferably HT29 cells. The melanoma cell is preferably A375 cells. The colon cancer is preferably colon cancer caused by HT29 cells. The melanoma is preferably a melanoma caused by A375 cells. One or more pharmaceutically acceptable carriers may also be added to the above products as needed. The carrier includes conventional diluents, excipients, fillers, binders, wetting agents, disintegrating agents, absorption enhancers, surfactants, adsorption carriers and the like in the pharmaceutical field.

The product of the present invention can be prepared into various forms such as an injection solution, a tablet, a powder, a granule, a capsule, and an oral solution. The products of the above various dosage forms can be prepared according to a conventional method in the field of pharmacy.

The above fusion protein is generally administered in an amount of 500-1000 μg of fusion protein per adult per administration, once every 14-28 days for a course of 3 to 12 months.

DRAWINGS

Figure 1 shows the expression of the fusion gene in Pichia pastoris; M is the marker; 2 is the supernatant.

Figure 2 shows the purified ft7c-^S4-4Z^ (electropherogram of 9 fusion protein; M is marker; 2 is the purified Onc-HSA-4D5M0CB fusion protein.

Figure 3 shows the in vitro antitumor biological activity of the 0nc_HSA-4D5M0CB fusion protein and One protein; A is HT29 cells; B is A375 cells.

Figure 4 Toxicity and antitumor activity of 0nc-HSA-4D5M0CB fusion protein and One protein in tumor-bearing nude mice.

The best way to implement the invention

The following examples are provided to facilitate a better understanding of the invention but are not intended to limit the invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. In the quantitative tests in the following examples, three replicate experiments were set, and the results were averaged.

DNA restriction endonucleases, T ₄ DNA ligase, polymerase, respectively, available from GIBC0-BRL, Pharmac ia, Bi o-Labs Limited and Sino-American Biotechnology. The PCR amplification kit is a product of the Swedish Pharmacia company. The DNA sequence analysis kit is a USB product of the United States. The casein hydrolysate is a product of the German MERK company. Bacto-yeast extract is a product of Di Fco Corporation of the United States. For PCR amplification, a PCR amplification kit (product of Pharmacia, Sweden) was used.

Yeast expression vector PPIC9: purchased from Invi trogen, Catalog no. K1710-01. Pichia pastoris GS 115 hi s4 (Mut ⁺ hi s- ) NRRLY-15851: purchased from Inv i trogen, Catalog no. K1710-01.

HT29 cells (human colon cancer cells, EpCAM positive): purchased from ATCC, catalog number HTB-38. A375 cells (human melanoma cells, EpCAM negative): purchased from ATCC, catalog number CRL-1619.

Balb/c nude mouse: purchased from the Experimental Animal Center of the Academy of Military Medical Sciences.

1 M PBS buffer was obtained by mixing 132 ml of ₁ M K ₂ HP0 ₄ buffer and 868 ml of ₁ M KH ₂ P0 ₄ buffer; pH 6.0.

The nucleotide sequences of the primers in the examples (all synthesized by Shanghai Biotech) are as follows (5 ' → 3 '):

CC (underlined BamHI restriction recognition site); ACCACAACTACCGACGCCAACGAAGTG;

TCTGACGCTCACAAGTCTGAAGTTGCT;

4D5R: TTGAATTCTTAGGAGGAAACGGTCAACAAGGT (underlined EcoRI enzyme to identify another ij site). Example 1. Preparation of 0nc-HSA-4D5M0CB fusion protein

1. Acquisition of 0nc-HSA-4D5M0CB fusion protein gene and construction of recombinant expression vector 1. Sequence of synthetic sequence listing 2 respectively, shown in nucleotides 1 to 369 at the 5' end

The gene encoding the One protein (ft?c gene; 369 bp), the sequence of the sequence 2 from the 5' end of the 430 to 2184 nucleotides of the HAS protein coding gene (AS gene; 1755 bp), sequence listing 2 The gene encoding the 4D5M0CB polypeptide fragment shown by nucleotides 2215 to 2970 at the 5' end is i 4D5M0CB^576bp).

2. Using the gene as a template, PCR amplification was performed under the guidance of the primer OncF and the primer OncR to obtain a PCR amplification product.

3. Using the gene as a template, PCR amplification was carried out under the guidance of the primer HSAF and the primer HSAR to obtain a PCR amplification product.

4. At the same time, the PCR amplification product of step 2 and the PCR amplification product of step 3 were used as a template, and PCR amplification was carried out under the guidance of primer OncF and primer HSAR to obtain a PCR amplification product. PCR amplification reaction system (50 μΐ): PCR amplification product 1μ 1 of step 2, PCR amplification product 1μ 1 of step 3, primer OncF 2μ 1 , primer HSAR 2μ 1 , dNTP 1μ 1 , 10x pfu enzyme buffer 5 μl of liquid, 1 μl of pfu enzyme, and 37 μl of distilled water.

The reaction conditions for PCR amplification were as follows: 94 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 4 minutes for a total of 3Q cycles.

5. Using the PCR amplification product of step 4 as a template, PCR amplification was carried out under the guidance of primer OncF and primer HSAR to obtain a PCR amplification product.

6. Using the ^^ gene as a template, PCR amplification was carried out under the guidance of primer 4D5F and primer 4D5R to obtain a PCR amplification product.

7. At the same time, the PCR amplification product of step 5 and the PCR amplification product of step 6 are used as a template, and PCR amplification is carried out under the guidance of OncF and primer 4D5R to obtain a PCR amplification product.

PCR amplification reaction system (50 μ ΐ): PCR amplification product 1 μ 1 of step 5, PCR amplification product 1 μ 1 of step 6, primer OncF 2μ 1 , primer 4D5R 2μ 1 , dNTP 1μ 1 , 10χ pfu enzyme buffer 5 μl of liquid, 1 μl of pfu enzyme, and 37 μl of distilled water.

The reaction conditions for PCR amplification were as follows: 94 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 5 minutes for a total of 3Q cycles.

8. The PCR amplification product of step 7 was digested with restriction endonucleases BamHI and EcoRI to obtain a digested product.

9. The yeast expression vector pPIC9 was digested with restriction endonuclease BamHI and EcoRI, and the vector backbone (about 7700 bp) was recovered.

10. The restriction enzyme product of step 8 is ligated with the vector backbone of step 9, to obtain a recombinant plasmid 0nc-HSA-4D5M0CB/pPIC9 _o DNA sequence analysis kit (USB product of the United States). Recombinant plasmid 0nc-HSA-4D5M0CB/pPIC9 Sequencing was performed. The sequencing results showed that the 0nc-HSA-4D5M0CB fusion gene shown in SEQ ID NO: 2 of the sequence listing was inserted between the BamHI and EcoRI cleavage sites of the yeast expression vector pPIC9.

In the fusion gene shown in Sequence 2 of the Sequence Listing, nucleotides 1 to 57 from the 5' end are the coding genes of the signal peptide, nucleotides 58 to 369 are the i3⁄4c gene, and nucleotides 430 to 2184. For the gene, the nucleotides 2215 to 2970 are the 4D5M0CB gene.

Sequence 1 of the fusion gene coding sequence shown in Sequence 2 of the Sequence Listing The 0nc-HSA-4D5M0CB fusion protein is shown.

In the 0nc-HSA-4D5M0CB fusion protein shown in SEQ ID NO: 1, the amino acid residues from positions 1 to 19 of the N-terminus are the signal peptide, and the amino acid residues at positions 20 to 123 are the One protein, and the amino acid residues 144 to 728 are The HAS protein, amino acid residues 739 to 990 are 4D5M0CB polypeptide fragments.

11. The sequence 2 of the sequence listing was inserted between the BamHI and EcoRI cleavage sites of the yeast expression vector PPIC9 from the nucleotides 1 to 369 of the 5' end to obtain the recombinant plasmid 0nc/pPIC9 (control plasmid). ).

Second, the expression of the fusion gene in Pichia pastoris

1. The recombinant plasmid 0nc-HSA-4D5M0CB/pPIC9 was transformed into Pichia pastoris GS115 hi s4 (Mut ⁺ hi s- ) LY-15851 by yeast protoplast transformation method to obtain recombinant bacteria.

2. Pick the recombinant strain from step 1 and inoculate 4 ml liquid BMGY medium (1% yeast extract, 2% tryptone, 1·34% ΥΝΒ, 4 X 10 ⁵ % biotin, 1% glycerol, lOOmM ρΗ6 . 0 potassium phosphate buffer), shake at 12 ° C for 10 hours at 30 ° C (12-24 hours).

3. Take 1ml of the bacterial solution from step 2 and transfer it to 50ml liquid BMGY medium. Continue to shake.

18 hours (18-24 hours), get the seed solution.

4. Transfer 40 ml of the seed solution to 1000 ml of liquid BMGY medium, continue to shake at 30 ° C, 200 rpm for 24 hours (24-30 hours), centrifuge at 5000 rpm for 5 min, and collect the precipitate.

5. The precipitate of step 4 was treated with 200 ml of liquid BMMY medium (1% yeast extract, 2% tryptone, 1. 34% YNB, 4 X 10 - ⁵ % biotin, 0.5% methanol, 100 mM pH 6. 5%) The amount of methanol in the medium is 0.5% by volume. The suspension is incubated at 30 ° C for 1 hr. .

6. Centrifuge the bacteria in step 5 at 10,000 rpm for 20 min at 10,000 rpm and collect the supernatant.

7. The supernatant collected in step 6 was subjected to non-reducing SDS-PAGE electrophoresis, and the results are shown in Fig. 1. The results indicate that the fusion gene can be efficiently secreted and expressed by Pichia pastoris.

Separation and purification of 0nc-HSA-4D5M0CB fusion protein

1. Adjust the pH of the supernatant obtained in the second step of step 2 to 6.0, dilute 5 times with distilled water, and perform preliminary purification (cation exchange chromatography) with S Sepharose F. F.

The equilibration buffer used for the cation exchange chromatography was 20 mM phosphate buffer of pH 6.0, and the elution buffer was 20 mM pH 6.0 buffer containing 1 M NaCl. The XK50/30 column was used with a column volume of 500 ml. Elution process: Equilibration buffer was used at the initial time, elution buffer was used at the end of the elution, and a mixture of equilibration buffer and elution buffer was used during the elution ( During the elution process, the volume ratio of the elution buffer in the mixture is linearly increased, and the volume ratio of the equilibration buffer in the mixture is linearly reduced. A total of 10 columns are eluted from the initial time to the end time. volume.

The post-column solution in the range of 60-70% (volume ratio) of the elution buffer was collected.

2. The post-column solution collected in step 1 was purified by Phenyl Sepharose HP hydrophobic chromatography.

The equilibration buffer used for hydrophobic chromatography was 20 mM pH 6.0 buffer containing 1 M (NH ₄ ) ₂ S0 ₄ , and the elution buffer was 20 mM _P H6.0 phosphate buffer.

The XK50/30 column was used with a column volume of 500 ml. Elution process: Equilibration buffer was used at the initial time, elution buffer was used at the end of the elution, and a mixture of equilibration buffer and elution buffer was used during the elution ( During the elution process, the volume ratio of the elution buffer in the mixture is linearly increased, and the volume ratio of the equilibration buffer in the mixture is linearly reduced. A total of 10 columns are eluted from the initial time to the end time. volume.

The post-column solution in the range of 30-40% (volume ratio) of the elution buffer was collected.

3. The post-column solution collected in step 2 was further purified by Superde _X 200 molecular sieve to obtain a final product.

The buffer used for the molecular sieve was 20 mM phosphate buffer pH 6.0.

The XK50/950 column was used and the volume of the column was 1500 ml. The post-column solution from 700 mL to 800 mL was collected starting from the addition of buffer.

4. The non-reduced SDS-PAGE electrophoresis of the post-column solution collected in step 3 is shown in Figure 2. The results showed that the purified 0nc-HSA-4D5M0CB fusion protein was obtained.

The supernatant obtained in step 6 of step 2 can be purified to obtain about 100 mg of the 0nc-HSA-4D5M0CB fusion protein.

Fourth, the preparation of One protein

The recombinant plasmid 0nc/pPIC9 was used instead of the recombinant plasmid 0nc-HSA-4D5M0CB/pPIC9 to carry out the steps 2 and 3, respectively, to obtain a purified One protein. Example 2. In vitro antitumor activity of 0nc-HSA-4D5M0CB fusion protein The in vitro antitumor activity of the 0nc-HSA-4D5M0CB fusion protein was determined by the proliferation inhibition method. 2000 cells (HT29 cells or A375 cells) were added to each well of a 96-well plate, and then different concentrations of the 0nc-HSA-4D5M0CB fusion protein prepared in Example 1 (or the One protein prepared in Example 1) were added at 37 ° C. After 4 days of culture, viable cells were detected by MTT staining. Three replicates were performed, and five replicate wells were set for each concentration in each test, and the results were averaged.

The results of the cells are shown in Table 2, Table 3 and Figure 3.

Table 2 Inhibition of HT29 cells by 0nc-HSA-4D5M0CB fusion protein

Table 3 Inhibition of A375 cells by 0nc-HSA-4D5M0CB fusion protein

The results showed that the 0nc-HSA-4D5M0CB fusion protein had significant inhibitory effects on A375 cells and HT29 cells, and the effect was better than that of One protein, especially for HT29 cells. Example 3 Toxicity and Antitumor Activity of 0nc-HSA-4D5M0CB Fusion Egg in Mice Each Balb/c nude mouse was subcutaneously inoculated with 1.0 X X ^{6 6} HT29 cells, until the tumor grew to reach (about 20 ³ ) Divided into three groups (10 in each group) and administered as follows:

Group 1 (One group): Each nude mouse was intraperitoneally injected with 50 One protein per day, each injection volume was 0.3 ml (adjusted volume with 1 M PBS buffer); continuous injection for 4 days; second group (0nc -HSA-4D5M0CB group): Each nude mouse was intraperitoneally injected 300 μg per day.

0nc-HSA-4D5M0CB fusion protein (300 μg 0nc-HSA-4D5M0CB fusion protein, the content of One protein is about 30 μg), each injection volume is 0.3 ml (volume adjusted with 1M PBS buffer); continuous Injection for 4 days.

The third group (PBS group): Each nude mouse was intraperitoneally injected with 1 M PBS buffer per day, each injection volume was 0.3 ml; continuous injection for 4 days;

Nude mouse weighing and tumor volume measurements were performed daily from the first day of dosing.

The body weight change (mean) of each group of nude mice from the first day of administration is shown in Figure 4A and Table 4. Table 4 Average body weight (g) of each group of nude mice from the first day of administration

The tumor volume (mean) of each group of nude mice from the first day of administration is shown in Figure 4B and Table 5. Table 5 Mean tumor volume (cubic mm) of each group of nude mice from the first day of dosing

The 0nc-HSA-4D5M0CB fusion protein had significant tumor suppressor activity, and the tumor growth inhibition rate was 67% on day 18 (after 2 weeks of the last treatment).

The toxicity of the 0nc-HSA-4D5M0CB fusion protein and One protein in mice was based on the decrease in body weight of mice. The maximum dose at which the weight loss does not exceed 25% is defined as the maximum tolerated dose (MTD). The maximal tolerated dose (MTD) of the 0nc-HSA_4D5M0CB fusion protein was significantly increased; the MTD of One protein was 13.2 mg/kg, and the MTD of the 0nc-HSA-4D5M0CB fusion protein was 80 mg/kg. Under the conditions of the maximum tolerated dose, Onconase showed no anti-tumor activity, while the 0nc_HSA-4D5M0CB fusion protein had significant anti-tumor activity. Industrial application

The present invention fuses the existing One protein with the HAS protein and the 4D5M0CB polypeptide fragment, and the HAS protein functions to increase the molecular weight, improve the pharmacokinetics and biodistribution, and the 4D5M0CB polypeptide fragment increases the specificity and selectivity for the tumor cells. . Compared with the existing One protein, the pharmacokinetic and biological distribution of the 0nc-HSA-4D5M0CB fusion protein provided by the present invention is remarkably improved, and tumor targeting is significantly increased. At the same time, the antitumor activity of tumor-bearing mice at the same toxic dose was significantly improved, showing a good application prospect. The fusion protein of the invention has the advantages of high safety and good curative effect, high expression, easy purification, short production cycle, large scale of production and low cost, and has important application prospects and practical significance.

Claims

Rights request

1. The fusion protein is as follows) or (b):

(b) a protein derived from sequence 1 in which the fusion protein of (a) is substituted and/or deleted and/or added by one or several amino acid residues and which is associated with antitumor activity.

The fusion protein according to claim 1, wherein the fusion protein is as shown in SEQ ID NO:1 of the sequence listing.

3. A gene encoding the fusion protein of claim 1 or 2.

The gene according to claim 3, wherein the gene is a DNA molecule of the following (1) or (2) or (3) or (4):

(2) a DNA molecule as shown in Sequence 2 of the Sequence Listing;

A recombinant expression vector, expression cassette, transgenic cell line or recombinant strain comprising the gene of claim 3 or 4.

The recombinant expression vector according to claim 5, wherein the recombinant expression vector is a recombinant plasmid obtained by inserting the gene of claim 2 or 3 into a multiple cloning site of the yeast expression vector pPIC9.

7. The recombinant strain according to claim 5, wherein: said recombinant strain is a right to be The recombinant expression vector obtained by introducing the recombinant expression vector of 4 or 5 into yeast is preferably Pichia pastoris.

The recombinant strain according to claim 7, wherein the Pichia pastoris is Pichia pastoris, preferably Pichia pastoris GS115 hi s4 (Mut ⁺ hi s-) NRRLY-15851 .

9. A method of preparing the fusion protein of claim 1 which is to cultivate claim 5 or 7 or

The recombinant strain of 8 is obtained to obtain the fusion protein.

5%。 The concentration of the methanol in the culture system is preferably 0. 5%. Volume percent.

11. Use of the fusion protein of claim 1 in the manufacture of a tumor cell growth inhibitor and/or a cancer therapeutic and/or a cancer preventive.

12. The use according to claim 11, wherein: the tumor cells are colon cancer cells and/or melanoma cells; and the cancer is colon cancer and/or melanoma;

The colon cancer cells are preferably HT29 cells; the melanoma cells are preferably A375 cells; the colon cancer is preferably colon cancer caused by HT29 cells; and the melanoma is preferably melanoma caused by A375 cells.

A product comprising the fusion protein of claim 1; the product being a tumor cell growth inhibitor and/or a cancer therapeutic drug and/or a cancer prevention drug.

The product according to claim 13, wherein: the tumor cells are colon cancer cells and/or melanoma cells; and the cancer is colon cancer and/or melanoma;

15. Use of a fusion protein according to claim 1 for inhibiting tumor cell growth and/or treating cancer and/or preventing cancer.

16. The use according to claim 15, wherein: the tumor cells are colon cancer cells and/or melanoma cells; and the cancer is colon cancer and/or melanoma;

17. Use of a product according to claim 13 or 14 for inhibiting tumor cell growth and/or treating cancer and/or preventing cancer.

18. The use according to claim 17, wherein: the tumor cells are colon cancer cells and/or melanoma cells; and the cancer is colon cancer and/or melanoma;