CN101613410A

CN101613410A - Rnase and toxalbumin membrane transposition structural domain fusion rotein and its production and use

Info

Publication number: CN101613410A
Application number: CN200810039518A
Authority: CN
Inventors: 王庆诚; 沈如凌; 孙瑞林; 费俭; 李俊
Original assignee: Shanghai Southern Biological Research Center; SHANGHAI NANFANGMOSHI BIOLOGICAL SCI-TECH DEV Co Ltd
Current assignee: Shanghai biomodel Polytron Technologies Inc; Shanghai Lab. Animal Research Center
Priority date: 2008-06-25
Filing date: 2008-06-25
Publication date: 2009-12-30
Anticipated expiration: 2028-06-25
Also published as: CN101613410B; WO2009155842A1

Abstract

The invention provides the fusion rotein of rnase (Onc) and bacterium toxalbumin membrane transposition structural domain, the dna sequence dna of this fusion rotein of encoding contains the carrier of this dna sequence dna, contains the host cell of this carrier, prepares the method for this fusion rotein with genetically engineered.Fusion rotein of the present invention had both been possessed the activity of original Onc, had the ability of stronger kill tumor cell again, and more wide spectrum ground is used for antineoplaston.

Description

Rnase and toxalbumin membrane transposition structural domain fusion rotein and its production and use

Technical field

The invention belongs to DNA recombinant technology and biomedicine field.More specifically, the present invention relates to the fusion rotein of rnase and bacterial poison albumen (toxin) membrane transposition structural domain, the encode dna sequence dna of this fusion rotein, the carrier that contains this dna sequence dna, the host cell that contains this carrier, utilize genetic engineering technique to prepare the method for this fusion rotein and the application of this fusion rotein aspect oncotherapy.

Background technology

Rnase (Onconase claims again: P30 albumen, Ranpirnase is called for short Onc) is to separate a kind of nuclease that obtains from the ovocyte of the northern leopard frog (Rana pipiens) and body early embryo, belongs to the RNaseA superfamily.Studies show that Onc enters mammalian cell by endocytosis, the tRNA that in endochylema, optionally degrades, arrestin matter biosynthesizing and then suppress cell proliferation and cause apoptosis.Experiment in vitro shows that Onc has antiproliferative and cytotoxic effect to kinds of tumor cells, as: people's malignant mesothelioma, nonsmall-cell lung cancer, prostate cancer cell, pancreatic cancer cell and leukemia cell etc.Experiment showed, in the body of mouse model that Onc can suppress tumor growth, prolong the mouse survival time, strengthen the effect of multiple antitumor drug.At present, it is clinical that Onc entered for three phases as a kind of medicine of anti-malignant mesothelioma, is a kind of antitumor drug with good prospect.Recently, the U.S. and Australian approved Onconase put on market as non-common medicine (Orphan Drug).

Yet, discover that further different tumour cells are to the susceptibility difference (UlrichArnold﹠amp of Onc; Renate Ulbrich-Hofmann.Natural and engineered ribonucleases aspotential cancer therapeutics.Biotechnol Lett (2006) 28:1615-1622).This has limited the scope of application of Onc in oncotherapy greatly.

Therefore, this area needs further to develop to have better inhibition tumor effect and the stronger antitumor drug of broad spectrum.

Summary of the invention

The object of the present invention is to provide the fusion rotein of rnase and bacterium toxalbumin membrane transposition structural domain, the encode dna sequence dna of this fusion rotein, the carrier that contains this dna sequence dna, the host cell that contains this carrier, utilize genetically engineered to prepare the method for this fusion rotein and the application of this fusion rotein aspect oncotherapy.

In a first aspect of the present invention, a kind of fusion rotein is provided, described fusion rotein comprises:

(1) rnase (Onc);

(2) the proteic membrane transposition structural domain of bacterial poison;

(3) be positioned at the connection peptides between (1) and (2) by 0-50 (preferably be 5-30, better is 10-20) amino acid formation.

In another preference, described rnase is positioned at the aminoterminal of fusion rotein; The proteic membrane transposition structural domain of described bacterial poison is positioned at the carboxyl terminal of fusion rotein.

In another preference, the proteic membrane transposition structural domain of described bacterial poison is positioned at the aminoterminal of fusion rotein, and described rnase is positioned at the carboxyl terminal of fusion rotein.

In another preference, described fusion rotein is connected and is constituted by (1), (3), (2) basically.More preferably, described fusion rotein is connected and is constituted by (1), (3), (2).

In another preference, comprise the restriction enzyme site sequence of at least one intracellular protein enzyme in the sequence of described connection peptides, thereby after in entering born of the same parents (1) is separated with (2).

In another preference, described restriction enzyme site sequence is not present on Yeast Nucleic Acid enzyme sequence or the proteic membrane transposition structural domain sequence of bacterial poison.

In another preference, described intracellular protein enzyme is that specificity is positioned at intracellular proteolytic enzyme.

In another preference, described intracellular enzyme is selected from (but being not limited to): Furin, matrix metalloproteinase, Free-PSA and kethepsin.

In another preference, described fusion rotein is cut by the intracellular enzyme enzyme after entering cell.

In another preference, described cytotoxic protein is selected from (but being not limited to): diphtheria toxin (DT) or Pseudomonas aeruginosa exotoxin A (PE).

In another preference, the membrane transposition structural domain of described diphtheria toxin is:

(a) as the albumen of the aminoacid sequence of 121-308 position among the SEQ ID NO:2; Or

(b) the proteic aminoacid sequence that (a) is limited forms through replacement, disappearance or the interpolation of one or more amino-acid residues, and have protein function that (a) limited by (a) polypeptides derived; And/or

Described rnase is:

(a1) aminoacid sequence shown in 1-104 position among the SEQ ID NO:2 (preferably the aminoacid sequence by 1-104 position among the SEQ IDNO:2 constitutes); Or

(b1) the proteic aminoacid sequence that (a1) is limited forms through replacement, disappearance or the interpolation of one or more amino-acid residues, and have protein function that (a1) limited by (a1) polypeptides derived; And/or

Described connection peptides has the aminoacid sequence shown in the 105-120 position among the SEQ ID NO:2 (preferably the aminoacid sequence by 105-120 position among the SEQ ID NO:2 constitutes).

Preferably, described fusion rotein has the aminoacid sequence shown in the SEQ ID NO:2.

In a second aspect of the present invention, provide a kind of nucleic acid molecule, the described fusion rotein of described nucleic acid molecule encoding.

In another preference, described nucleic acid molecule has the nucleotide sequence shown in the SEQ ID NO:1.

In a third aspect of the present invention, a kind of carrier is provided, it contains described nucleic acid molecule.

In a fourth aspect of the present invention, a kind of genetically engineered cell is provided, described cell contains described carrier; Or be integrated with described nucleic acid molecule in the described cellular genome.

In a fifth aspect of the present invention, a kind of method that produces described fusion rotein is provided, described method comprises:

(A) cultivate described host cell, thereby express described fusion rotein;

(B) isolate described fusion rotein.

In a sixth aspect of the present invention, the purposes of described fusion rotein is provided, be used to prepare the composition that suppresses growth of tumour cell or treatment tumour.Described tumour is selected from (but being not limited to): malignant mesothelioma; Lung cancer; Leukemia; Malignant lymphoma; Myelomatosis; Malignant melanoma; Mammary cancer; Nervous system neoplasm; Liver cancer; Nasopharyngeal carcinoma; The esophageal carcinoma; Cancer of the stomach; Colorectal carcinoma; Prostate cancer; Cervical cancer; Oral carcinoma; Salivary gland tumor; Nasal cavity and paranasal sinus malignant tumour; Laryngocarcinoma; Tumor of ear; Ocular tumor; Thyroid tumor; Mediastinal tumor; The wall of the chest; Pleural tumor; Intestinal tumor; Tumor of biliary tract; Tumour around pancreas and the ampulla; Mesentery and retroperitoneal tumor; Tumor of kidney; Adrenal tumor; Tumor of bladder; Prostate cancer; Tumor of testis; Penile cancer; Carcinoma of endometrium; Malignant tumor of ovary; Malignant trophoblastic tumor; Carcinoma vulvae and carcinoma of vagina; Soft tissue neoplasm; Bone tumor; Or skin and adnexal tumor.

In a seventh aspect of the present invention, a kind of composition that suppresses growth of tumour cell or treatment tumour is provided, described composition contains:

(i) the described fusion rotein of significant quantity; With

(ii) pharmaceutically acceptable carrier.

In another preference, described composition is a pharmaceutical composition.

On the other hand, also provide the method for a kind of inhibition (as vitro inhibition) growth of tumour cell, described method comprises utilizes described fusion rotein to handle tumour cell.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

Fig. 1 has shown the colibacillus expression plasmid pET22b-ONC-DT that contains the ONC-DT antigen-4 fusion protein gene _203-390Synoptic diagram.

Fig. 2 has shown Onc-DT of the present invention _203-390Expression and purification effect protein SDS-PAGE electrophorogram.Wherein,

Swimming lane 1. molecular weight of albumen standards;

Swimming lane 2. is induced preceding bacterial protein;

Swimming lane 3. is induced bacterial protein behind the 3h;

Swimming lane 4. is induced back thalline inclusion body;

Onc-DT behind swimming lane 5. renaturation and the purifying _203-390

Fig. 3 has shown mtt assay survey Onc-DT _203-390Cytotoxic effect figure to murine myeloma cell SP2/0 and human leukaemia cell K562.Wherein,

A:Onc-DT _203-390With Onc the cytotoxic effect of murine myeloma cell SP2/0 is compared.

B:Onc-DT _203-390With Onc the cytotoxic effect of human leukemia cell K562 is compared.

C:Onc-DT _203-390With Onc the cytotoxic effect of human neuroblastoma SH-SY5Y is compared.

D:Onc-DT _203-390With Onc the cytotoxic effect of human acute myeloid leukemia cell strain HL60 is compared.

Embodiment

The inventor is through long term studies and test, first rnase (Onc) gene and the proteic membrane transposition structural domain gene fusion of bacterial poison are in the same place, and in intestinal bacteria, efficiently express the purified fusion rotein that obtains rnase-bacterium toxalbumin membrane transposition structural domain.Described fusion rotein has kept the nuclease of Onc well, ability and antineoplastic broad spectrum that Onc enters cell cytoplasm have been improved again, have the extremely tumor effect more excellent than Onc, toxicity to tumour cell (comprising that some are originally to the insensitive tumour cell of Onc) greatly strengthens (toxicity to different cells can improve 10-1000 respectively doubly), thereby can be used as a kind of antitumor drug of more effective more wide spectrum newly.

The fusion rotein that contains rnase and bacterium toxalbumin membrane transposition structural domain

As used herein, term " fusion rotein of rnase and diphtheria toxalbumin membrane transposition structural domain ", " ONC-DT fusion rotein " etc. are used interchangeably, all refer to merge the albumen that forms by Yeast Nucleic Acid enzyme amino acid sequence and diphtheria toxalbumin membrane transposition structural domain aminoacid sequence, wherein between can have or not have the connection peptides sequence.

The invention provides a kind of fusion rotein, this albumen comprises Onc albumen or its bioactive fragment and bacterium toxalbumin membrane transposition structural domain or its bioactive fragment, and this molecular energy is used to suppress tumour.Preferred, described fusion rotein is a kind of isolating albumen, does not have with other albumen, polypeptide or molecule and gets in touch, and is the purified product cultivated of recombinant host cell or as a kind of extract of purifying.

As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".

Rnase

Any suitable Onc all can be used for preparing fusion rotein of the present invention.Onc among the present invention is meant a peptide species, can enter mammalian cell (particularly tumour cell) by endocytosis, selectivity degraded tRNA in endochylema, or other RNA, thereby arrestin matter is synthetic, and and then suppresses cell proliferation and cause apoptosis.Onc has antiproliferative and cytotoxic effect to kinds of tumor cells.

Onc or bioactive fragment wherein comprise a part of conserved amino acid alternative sequence, and described sequence of replacing through amino acid does not influence its activity.Suitably replacing amino acid is the technique known of this area, and described technology can be implemented and guarantee not change the biological activity of gained molecule at an easy rate.These technology are recognized people, in general, can not change biological activity basically at the inessential area change single amino acids of a peptide species.See Molecular Biology of The Gene such as Watson, the 4th edition, 1987, TheBenjamin/Cummings Pub.Co.P224.Table 1 is some examples of this replacement.

Table 1

The original acid residue	Preservative replacement
The original acid residue	Preservative replacement	??Ala(A)	??Gly；Ser
??Arg(R)	??Lys	??Ala(A)	??Gly；Ser
??Arg(R)	??Lys	??Asn(N)	??Gln；His
??Cys(C)	??Ser	??Asn(N)	??Gln；His
??Cys(C)	??Ser	??Gln(Q)	??Asn
??Glu(E)	??Asp	??Gln(Q)	??Asn
??Glu(E)	??Asp	??Gly(G)	??Ala；Pro
??His(H)	??Asn；Gln	??Gly(G)	??Ala；Pro
??His(H)	??Asn；Gln	??Ile(I)	??Leu；Val
??Leu(L)	??Ile；Val	??Ile(I)	??Leu；Val
??Leu(L)	??Ile；Val	??Lys(K)	??Arg；Gln；Glu
??Met(M)	??Leu；Tyr；Ile	??Lys(K)	??Arg；Gln；Glu
??Met(M)	??Leu；Tyr；Ile	??Phe(F)	??Met；Leu；Tyr
??Ser(S)	??Thr	??Phe(F)	??Met；Leu；Tyr
??Ser(S)	??Thr	??Thr(T)	??Ser
??Trp(W)	??Tyr	??Thr(T)	??Ser
??Trp(W)	??Tyr	??Tyr(Y)	??Trp；Phe
??Val(V)	??Ile；Leu	??Tyr(Y)	??Trp；Phe

The similar replaceability that may also have other, this replaceability often can rule of thumb be determined or be determined according to known conserved sequence.

The bioactive fragment of any Onc can be applied among the present invention.Here, the implication of the bioactive fragment of Onc is meant that as a kind of polypeptide fragment after being connected with toxalbumin membrane transposition structural domain and forming fusion rotein, it still can keep all or part of function of the Onc of total length.Generally, described bioactive fragment keeps the inhibition tumor promotion of 50% total length Onc at least.Under preferred condition, described active fragments can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% inhibition tumor promotion.

The aminoacid sequence of the Onc that forms through replacement, disappearance or the interpolation of one or more (as 1-30, preferably 1-20, better 1-10, further 1-5) amino-acid residue is also included among the present invention.Replacement, disappearance or the interpolation of the one or more amino-acid residues of described process and the Onc that forms also has the activity that suppresses tumour.

The present invention also can adopt Onc modified or improvement, such as, can adopt the Onc that is modified or improve in order to prolong its transformation period, improve its stability or to strengthen its killing tumor cell ability.Described through modifying or though the Onc or the gene of improvement can be to have certain difference with naturally occurring Onc or gene, also can killing tumor cell, and can not bring other detrimentally affect or toxicity.That is to say that the version of the biological function of any biological activity that does not influence Onc or perhaps gene all can be used among the present invention.

In optimal way of the present invention, the aminoacid sequence of described Onc can be substantially the same with the sequence shown in the 1-104 position among the SEQ ID NO:2.Preferably, described Onc has the sequence shown in the 1-104 position among the SEQ ID NO:2; Preferred, described Onc is made of the sequence shown in the 1-104 position among the SEQ ID NO:2.

The bacterium toxalbumin membrane transposition structural domain

The proteic membrane transposition structural domain of bacterial poison of the present invention be a class contratoxin the effective protein domain of endocytosis.Described bacterial poison albumen includes, but is not limited to: DT or PE.Although the membrane transposition structural domain of known DT and PE helps to strengthen the endocytosis of multiple molecule, yet in the past and do not know whether they have effect for the endocytosis of Onc.

As optimal way of the present invention, described bacterial poison albumen is DT, and DT is the bacterial exotoxin that diphtheria corynebacterium produces, and it is made up of three structural domains, and the N end is catalyst structure domain, and the centre is a membrane transposition structural domain, and the C end is the receptors bind structural domain.The acting as of membrane transposition structural domain helps catalyst structure domain to pass the endosome plasma membrane and enters kytoplasm, the cytotoxic effect of performance catalyst structure domain.

DT membrane transposition structural domain or bioactive fragment wherein comprise a part of conserved amino acid alternative sequence, and described sequence of replacing through amino acid may not influence its activity.The example that adoptable a part of amino acid is replaced sees Table 1.The similar replaceability that may also have other, this replaceability often can rule of thumb be determined or be determined according to known conserved sequence.

The bioactive fragment of any DT membrane transposition structural domain can be applied among the present invention.Here, the implication of the bioactive fragment of DT membrane transposition structural domain is meant as a kind of polypeptide fragment, after being connected with Onc and forming fusion rotein, and all or part of function of the DT membrane transposition structural domain that it still can be kept perfectly.Under the normal circumstances, described bioactive fragment keeps the activity of 50% complete DT membrane transposition structural domain at least.Under preferred condition, described active fragments can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% activity.

The aminoacid sequence of the DT membrane transposition structural domain that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form is also included among the present invention.Replacement, disappearance or the interpolation of the one or more amino-acid residues of described process and the DT membrane transposition structural domain that forms also have and help Onc to penetrate the function of tumor cell membrane.

The present invention also can adopt DT membrane transposition structural domain modified or improvement, such as, can adopt the DT membrane transposition structural domain of improveing in order to prolong its transformation period, improve its stability, strengthen the ability of its penetration cell or to strengthen the specificity of its penetration cell.Though described can be to have certain difference with naturally occurring DT membrane transposition structural domain or gene through DT membrane transposition structural domain or the gene modified or improve, also can help the Onc permeates cell membranes, and can not bring other detrimentally affect or toxicity.That is to say that the version of the biological function of any biological activity that does not influence the DT membrane transposition structural domain or perhaps gene all can be used among the present invention.

As optimal way of the present invention, the aminoacid sequence of described DT membrane transposition structural domain can be substantially the same with the sequence shown in the 121-308 position among the SEQ ID NO:2.Preferably, described DT membrane transposition structural domain has the sequence shown in the 121-308 position among the SEQ ID NO:2; Preferred, described DT membrane transposition structural domain is made of the sequence shown in the 121-308 position among the SEQ ID NO:2.

Connect

Can directly be connected between described Onc or its active fragments and bacterium toxalbumin membrane transposition structural domain or its active fragments, perhaps connect by polypeptide connexon (connection peptides).As a kind of preferred mode of the present invention, described Onc or its active fragments are connected by polypeptide connexon (connection peptides) with bacterium toxalbumin membrane transposition structural domain or its active fragments, thereby form fusion rotein.Described connexon comprises 0-50 amino acid; Preferably being 5-30 amino acid, more preferably is 10-20 amino acid.

As optimal way of the present invention, comprise the restriction enzyme site sequence of at least one intracellular enzyme in the sequence of described connection peptides, and this restriction enzyme site sequence is not present on Onc sequence or the bacterium toxalbumin membrane transposition structural domain sequence.Thereby fusion rotein is not digested and enter into efficiently in the cell in the extracellular, in entering into cell after, Onc separates with the bacterium toxalbumin membrane transposition structural domain under the effect of intracellular enzyme.

As a kind of particularly preferred mode of the present invention, described connection peptides is the connection peptides that contains the Furin restriction enzyme site.It is neutral or subalkaline that extracellular environment is generally, and Furin only just plays a role under acidic conditions, after in fusion rotein enters born of the same parents, can in acid vesicle, be cut, thereby make Onc and toxalbumin membrane transposition structural domain be easier to be released in the kytoplasm by the Furin enzyme.Preferred, described connection peptides has the aminoacid sequence shown in the 105-120 position among the SEQ ID NO:2.

As a kind of preferred mode, described Onc or its active fragments are positioned at the aminoterminal (N end) of fusion rotein; Described toxalbumin membrane transposition structural domain or its active fragments are positioned at the carboxyl terminal (C end) of fusion rotein.Selectively, also interchangeable two kinds of residing positions of albumen, also promptly: described Onc or its active fragments are positioned at the carboxyl terminal of fusion rotein; Described toxalbumin membrane transposition structural domain or its active fragments are positioned at the aminoterminal of fusion rotein.

As another kind of mode, described Onc directly is connected with bacterium toxalbumin membrane transposition structural domain or their active fragments, such as the bacterium toxalbumin membrane transposition structural domain directly is connected with the encoding gene of Onc, amalgamation and expression does not add the amino acid connexon between the two.The inventor's result shows, it is better than the proteic anti-tumor activity that does not add connexon and obtained to add the preferred connexon of the present invention between Onc and the bacterium toxalbumin membrane transposition structural domain.

In addition, selectively, the aminoterminal of described fusion rotein (or carboxyl terminal) also can contain one or more polypeptide fragments, as the albumen label.Any suitable label may be used to the present invention.For example, described label can be FLAG, HA, HA1, c-Myc, 6-His or 8-His etc.These labels can be used for fusion rotein is carried out purifying.

Experimental result proves, the constructed Onc-DT fusion rotein of the present invention greatly strengthens the toxicity of tumour cell (comprising that some are originally to the insensitive cell of Onc).The Onc-DT fusion rotein not only can replace traditional toxalbumin to make up immunotoxin, because Onc itself has the ability of tumor cell, itself also can become an independently cancer therapy drug.Than independent application Onc, the Onc-DT fusion rotein is stronger to the lethality of tumour, and the scope of application is wider.

Nucleic acid molecule

On the other hand, the present invention also provides the isolating nucleic acid of the described fusion rotein of encoding, and also can be its complementary strand.

The suitable dna structure of any coding Onc or its active fragments all is applicable to the present invention.The suitable dna structure of any coding bacterium toxalbumin membrane transposition structural domain or its active fragments also is applicable to the present invention.Hereinafter the sequence of mentioning in the example all is applicable to method of the present invention.

As optimal way of the present invention, the nucleic acid of encoding fusion protein has the nucleotide sequence shown in the SEQ ID NO:1.

The dna sequence dna of code book invention fusion rotein, can the complete sequence synthetic, also the method for available pcr amplification obtains coding Onc and the amino acid whose dna sequence dna of bacterium toxalbumin membrane transposition structural domain, then it is stitched together, and forms the dna sequence dna of code book invention fusion rotein.

Expression vector

After the dna sequence dna that has obtained code book invention fusion rotein, it is connected into suitable expression vector, change proper host cell again over to.By cultivating the host cell after transforming, obtain fusion rotein of the present invention at last by separation and purification.

Therefore, the present invention also provides the carrier of the nucleic acid molecule that comprises encoding said fusion protein.Described carrier also can comprise the expression regulation sequence that links to each other with the series of operations of described nucleic acid molecule, so that described Expression of Fusion Protein.

As used herein, " operability links to each other " or " operationally being connected in " refer to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same linear DNA sequence other parts.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is exactly operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally " operationally be connected in " and mean adjoiningly, then mean in reading frame adjacent for the secretion leader sequence.

In the present invention, any suitable carriers can be used, and is used for the clone of bacterium, fungi, yeast and mammalian cell and the carrier of expression such as some, as Pouwels etc., and cloning vector: described in the laboratory manual (Elsevier latest edition).Can select various carrier known in the art such as commercially available carrier for use.Such as, select commercially available carrier for use, the nucleotide sequence of then code book being invented new fusion rotein operationally is connected in expression regulation sequence, forms protein expression vector.In one embodiment of the invention, described carrier is a prokaryotic vector, as the pET carrier.

Expression vector comprises and is connected with suitable fusion rotein dna sequence dna of transcribing with the translational control sequence, as derives from the gene of Mammals, microorganism, virus or insect.Regulating and controlling sequence can comprise that transcripting promoter, operon, enhanser, ribosome bind site or control transcribes and translation initiation and terminated proper sequence.When the fusion rotein sequence need be regulated functional nucleotide sequence, then connect suitable regulating and controlling sequence.Like this, promoter sequence is connected encoding fusion protein dna sequence dna front end.The ability of duplicating in host cell is usually by the replication initiation point control.The screening-gene that is used for transformant identification also can add expression vector.

In addition, the encoding sequence of the signal peptide of non-natural Onc or bacterium toxalbumin membrane transposition structural domain can be introduced expression vector.For example: signal peptide (secretion guidance) sequence can with merge with the fusion rotein encoding sequence, thereby make the fusion rotein of translation can be secreted into the extracellular.Signal peptide can strengthen host cell to the exocytosis chimeric polyeptides.Signal peptide can be cut from the process that the cell internal secretion is come out at polypeptide.

Host cell

In addition, the reconstitution cell that contains the nucleotide sequence of encoding said fusion protein is also included among the present invention.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.; For example can be Bacillus coli cells (E.coli), as intestinal bacteria HMS174 (DE3) or BL21 (DE3).Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.

In preferred implementation of the present invention, adopt prokaryotic cell prokaryocyte as host cell, behind expression, renaturation, purifying, obtain to have kept good Onc anti-tumor activity and the good fusion rotein of cytolemma penetrance.

Produce the method for fusion rotein

The method of producing fusion rotein also comprises in the present invention.Described method comprises cultivates the reconstitution cell that contains the fusion rotein coding nucleic acid.Described fusion rotein comprises Onc or its activated fragment and bacterium toxalbumin membrane transposition structural domain or its active fragments.Described method can comprise the fusion rotein that allows cell expressing encode, and the renaturation that makes the fusion rotein of expression.In an example, described method also can comprise the separation and/or the purifying of the fusion rotein of renaturation.

Can be the character of basic homogeneous with the above-mentioned fusion rotein purifying for preparing, for example on the SDS-PAGE electrophoresis, be single band.For example, when recombinant protein is secreting, expressing, can adopt commercial ultra-filtration membrane to separate described albumen, for example company such as Millipore, Pellicon product at first will be expressed supernatant and be concentrated.The method that concentrated solution can adopt gel chromatography is purifying in addition further, or adopts the method purifying of ion exchange chromatography.For example anion-exchange chromatography (DEAE etc.) or cation-exchange chromatography.Gel matrix can be the matrix that agarose, dextran, polymeric amide etc. are usually used in protein purification.Q-or SP-group are ideal ion-exchange groups comparatively.At last, also available hydroxyapatite adsorption chromatography, metal chelate chromatography, hydrophobic interaction chromatography and RPLC methods such as (RP-HPLC) is to the further refining purifying of above-mentioned purified product.Above-mentioned all purification steps can utilize different combinations, finally make purity of protein reach basic homogeneous.

Can utilize the affinity column of the specific antibody, acceptor or the part that contain Onc or bacterium toxalbumin membrane transposition structural domain that the amalgamation polypeptide of expressing is carried out purifying.According to the characteristic of employed affinity column, can utilize conventional method, as the amalgamation polypeptide of method elution of bound on affinity column such as high-salt buffer, change pH.

The nucleic acid of recombinant protein and this recombinant protein of encoding can utilize the appropriate means preparation, for example, chemosynthesis, recombinant expressed, or it merges application.Referring to John Wiley﹠amp; Sons, " the Current Protocols in Molecular Biology " that Inc published in 2000, and " the Molecular Coning:A Laboratory Manual " of Cold Spring Harbor LaboratoryPress1989 publication.In an example, the nucleotide sequence of encoding fusion protein utilizes the round pcr preparation, and method is referring to (Protein Eng.5 (8): 827-29 such as Prodromou; 1992) treatise.

The purposes of fusion rotein

The fusion rotein of Onc of the present invention and bacterium toxalbumin membrane transposition structural domain can be used for preparing the composition that suppresses tumour.Fusion rotein of the present invention not only has and good kills the knubble biological activity, and it is stronger to enter the simple Onc of energy the force rate of tumour cell kytoplasm, thereby has the extremely tumor effect more excellent than Onc, thereby can be used for developing a kind of more effective antitumor thing.

Fusion rotein of the present invention has the more function of the inhibition tumour cell of wide spectrum than simple Onc.By specific examples of the present invention as seen, described fusion rotein all has excellent inhibition effect for myeloma cell, leukemia cell, neuroblastoma, acute myeloid leukemia cell.

Therefore, " tumour " of the present invention can be polytype, for example can include, but is not limited to: malignant mesothelioma; Lung cancer; Leukemia; Malignant lymphoma; Myelomatosis; Malignant melanoma; Mammary cancer; Nervous system neoplasm; Liver cancer; Nasopharyngeal carcinoma; The esophageal carcinoma; Cancer of the stomach; Colorectal carcinoma; Prostate cancer; Cervical cancer; Oral carcinoma; Salivary gland tumor; Nasal cavity and paranasal sinus malignant tumour; Laryngocarcinoma; Tumor of ear; Ocular tumor; Thyroid tumor; Mediastinal tumor; The wall of the chest; Pleural tumor; Intestinal tumor; Tumor of biliary tract; Tumour around pancreas and the ampulla; Mesentery and retroperitoneal tumor; Tumor of kidney; Adrenal tumor; Tumor of bladder; Prostate cancer; Tumor of testis; Penile cancer; Carcinoma of endometrium; Malignant tumor of ovary; Malignant trophoblastic tumor; Carcinoma vulvae and carcinoma of vagina; Soft tissue neoplasm; Bone tumor; Or skin and adnexal tumor.

When being used to suppress mammal tumor, but the administration of described fusion rotein general, perhaps topical, the decision of factors such as the kind of concrete visual tumour, growth site, progress degree.

Composition

The present invention also provides a kind of composition, and described composition contains: (i) fusion rotein of the Onc of the present invention of significant quantity (as 0.0001-1000uM) and bacterium toxalbumin membrane transposition structural domain; (ii) pharmaceutically acceptable carrier.Described composition is pharmaceutical composition normally, is used to suppress growth of tumour cell or treatment tumour.

As used herein, the composition of " pharmaceutically acceptable " is applicable to people and/or Mammals and does not have excessive bad side reaction (as toxicity, stimulation and transformation reactions), promptly has the material of rational benefit/risk ratio.Term " pharmaceutically acceptable carrier " refers to be used for the treatment of the carrier of agent administration, comprises various vehicle and thinner.This term refers to some medicament carriers like this: they itself are not necessary activeconstituents, and do not have undue toxicity after using.Suitable carriers is well known to those of ordinary skill in the art.(Mack Pub.Co. can find proving absolutely about pharmaceutically acceptable carrier in N.J.1991) at Remington ' s Pharmaceutical Sciences.Acceptable carrier can contain liquid on combination of traditional Chinese medicine is learned, as water, salt solution, glycerine and sorbyl alcohol.In addition, also may there be complementary material in these carriers, as lubricant, glidant, wetting agent or emulsifying agent, pH buffer substance and stablizer, as albumin etc.

Described composition can be made the various formulations that are suitable for the Mammals administration, described formulation includes but not limited to: injection, capsule, tablet, emulsion, suppository and sprays.

In use, be safe and effective amount of the present invention to be had fusion rotein be applied to Mammals (as the people), wherein this safe and effective amount is usually at least about 1 microgram/kg body weight, and in most of the cases be no more than about 10 mg/kg body weight, preferably this dosage is about 1 microgram/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.

Composition of the present invention can be directly used in killing tumor cell.In addition, also can unite use with other therapeutical agent or assistant agent simultaneously.

Major advantage of the present invention is:

(1) provides and prepares the fusion rotein of Onc and bacterium toxalbumin membrane transposition structural domain first, the good knitting ground of verified bacterium toxalbumin membrane transposition structural domain and Onc has kept the nuclease of Onc, significantly improve Onc again and entered ability and antineoplastic broad spectrum of cell cytoplasm, have than Onc more excellent kill tumor effect, the toxicity of tumour cell (comprising that some are originally to the insensitive tumour cell of Onc) is greatly strengthened.

(2) growth that fusion rotein of the present invention can known kinds of tumors, all available for the many tumours of treatment, broad spectrum is better.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that cited embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Unreceipted concrete experiment condition in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: the laboratory manual third edition (ColdSpring Harbor Laboratory Press, 2001) condition described in, or the condition of advising according to manufacturer.

Embodiment 1Onc-DT _203-390The structure of the synthetic and colibacillus expression plasmid of fusion gene

For the ease of Onc-DT _203-390Be discharged into kytoplasm from endosome, connection peptides with one section 16 the amino acid whose furin of containing restriction enzyme site couples together Onc and DT, the dna sequence dna of furin-DT is that full gene is synthetic, for the ease of PCR Onc and furin-DT sequence are coupled together, added 25 Onc terminal bases sequences at furin 5 ' end when full gene is synthetic.Full gene composition sequence is seen SEQ ID NO:3.Gene order according to Onc and DT has designed and synthesized following a pair of primer:

Onc-DT-U(SEQ?ID?NO：4)：

5’CCCAGGACTGGCTGACTTTCCA?3’；

Onc-DT-L(SEQ?ID?NO：5)：

5’GGGTCGACTTATTCCGGACCACCAGAAGC?3’。

Wherein, Onc-DT-U is the encoding sequence of Onc maturation protein N end; Onc-DT-L adds the reverse complementary sequence of terminator codon and SalI restriction enzyme site for DT C end encoding sequence.

With Onc-DT-U and Onc-DT-L is primer, the mixture that contains Onc gene segment and furin-DT gene segment is a template, with high-fidelity DNA polymerase pcr amplification Onc-DT gene order, product is cut with the SalI enzyme after gel-purified, and the insertion segment that obtains Onc-DT is reclaimed in the rubber tapping of 1% agarose gel electrophoresis.Plasmid pET22b (+) (Novagen) is cut with BalI and SalI enzyme respectively, and the carrier segment that obtains pET22b is reclaimed in 1% agarose gel electrophoresis rubber tapping, will insert segment and be connected with the T4DNA ligase enzyme with the carrier segment and obtain pET22b-Onc-DT _203-390Plasmid, the synoptic diagram of this recombinant plasmid is seen Fig. 1.

Embodiment 2Onc-DT _203-390Expression of Fusion Protein

With the expression plasmid transformed into escherichia coli BL21 (DE3) that makes up, the mono-clonal of choosing overnight is in 50ml LB substratum, in 37 ℃ of overnight incubation.Be cultured to A by 1: 20 switching 1L TB substratum in 37 ℃ next day ₆₀₀=2.0, add IPTG concentration and induced 3.5 hours to 0.5mM, 4 ℃, the centrifugal collection thalline of 6000rpm * 10min, thalline are used for next step inclusion body and collect and purifying.

Embodiment 3 inclusion bodys are collected and washing

The thalline of collecting is suspended among the damping fluid SSB_A (pH 8.0 for 20mM Tris-HCl, 10mM EDTA), with the broken thalline of ultrasonic disruption instrument; 4 ℃, 12000rpm * 10min is centrifugal, collects inclusion body; WIBB (20mM Tris-HCl, the 1M Guanidinium hydrochloride, 65mM DTT, 2mM EDTA, pH 8.0) the suspension inclusion body, and stirring is spent the night, and 4 ℃, 12000rpm * 10min collects inclusion body.

Embodiment 4 albumen become renaturation

The solubilization of inclusion bodies that 1L bacterium liquid is obtained is in 6ml DIBB (65mM DTT, 2mM EDTA, pH 8.0 for 20mM Tris-HCl, 7M Guanidinium hydrochloride), and behind the inflated with nitrogen, stirring is spent the night; 4 ℃, 12000rpm * 15min, centrifugal collection supernatant is 10mg/ml with protein quantification to concentration; 1ml inclusion body solution slowly is diluted to 200ml RB (the 0.9mM Sleep-promoting factor B, 1mM EDTA, pH 9.0 for 0.5M Arginine-HCl, 20mM Tris-HCl), 4 ℃, the centrifugal precipitation of abandoning of 12000rpm * 30min; 4 ℃ of renaturation are after 36～48 hours in renaturation buffer RB, desalt with dialyzate (1mM EDTA, pH 9.0 for 0.5M urea, 20mM Tris-HCl) dialysis.Protein solution be stored in 4 ℃ standby.

Embodiment 5 protein purifications

The protein solution that renaturation is good quantitatively back is gone up the reinforcing yin essence ion exchange column.

(1) chromatography column is that (2 * 2cm pharmacia), uses 20mM Tris-HCl to Q-Sepharose, 1mMEDTA, pH 9.0 balances, flow velocity 1ml/min.With 30 column volumes of 1M NaCl wash-out and abandon, will go up sample effluent liquid pH and transfer to 10.0 standby.

(2) chromatography column is Q-Sepharose (2 * 2cm, pharmacia), use 20mM Tris-HCl, 1mMEDTA, pH 10.0 balances are used 0.4M Nacl then, 20 column volumes of flow velocity 1ml/min wash-out, 20 column volumes of 1M NaCl wash-out and substep are collected, and Coomassie brilliant blue G250 detects the sample that contains target protein.Collection contains proteic sample and uses dialyzate 20mM Tris-HCl, and 1mM EDTA is after pH 10.0 desalts, standby.

(3) the quantitative reinforcing yin essence ion exchange column of crossing of the sample solution after will desalting.Chromatography column be prepacked column MonoQ (HR5/5,1ml, pharmacia), moving phase be LB2 (20mM Tris-HCl, l mM EDTA, pH10.0) and WB2 (1mM EDTA, pH 10.0 for 1M NaCl, 20mM Tris-HCl), flow velocity 1ml/min.

Elution process: 30 column volumes of 0-100%WB wash-out and substep are collected the protein peak that collection place is equivalent to locate about 30%.

Onc-DT of the present invention _203-390Proteic expression and purification effect protein gelatin collection of illustrative plates is seen Fig. 2.

Embodiment 6Onc-DT _203-390Proteic cytotoxic assay

1.Onc-DT _203-390Cytotoxic assay to myeloma cell SP2/0

Myelomatosis SP2/0 cell (available from Shanghai life science institute of Chinese Academy of Sciences cell bank) is incubated at and contains 10% calf serum, and penicillin (100 units/ml), in RPMI 1640 (GIBICO) substratum of Streptomycin sulphate (100 μ g/ml).96 orifice plates are cultivated, and every hole adds 90 μ l nutrient solutions (5 * 10 ⁴Cell/ml), CO ₂(5%) cultivate in the incubator after 1 hour, by the concentration gradient of setting add protein sample (be respectively Onc (preparation method referring to: onconase is to the inside and outside growth-inhibiting effect of B16 melanoma cell; Shen Ruling, Sun Ruilin, Wang Qingcheng, Ou Ling, Fei Jian; The cytobiology magazine, 2007 29 6 phases of volume: 901-904) and the Onc-DT of aforementioned preparation _203-390(being dissolved among the PBS) 10 μ l, control group adds PBS, cultivates after 72 hours, and mtt assay detects cell survival rate.

Onc-DT _203-390With Onc to the cytotoxic effect comparative result of myeloma cell SP2/0 as shown in Figure 3A.As seen Onc-DT _203-390IC ₅₀Be about 2 * 10 ^-8Mol/L; The IC of Onc ₅₀Greater than 8 * 10 ^-6Mol/L illustrates Onc-DT _203-390Toxicity to tumour cell obviously strengthens about 400 times than Onc.

2.Onc-DT _203-390Cytotoxic assay to human leukemia cell K562

Human leukemia cell K562 (available from Shanghai life science institute of Chinese Academy of Sciences cell bank) is incubated at and contains 10% calf serum, and penicillin (100 units/ml), in DMEM (GIBICO) substratum of Streptomycin sulphate (100 μ g/ml).96 orifice plates are cultivated, and every hole adds 90 μ l nutrient solutions (5 * 10 ⁴Cell/ml), CO ₂(5%) cultivate in the incubator after 12 hours, adding protein sample by the concentration gradient of setting (is respectively Onc albumen and Onc-DT _203-390Albumen) 10 μ l, control group adds PBS, cultivates after 72 hours, and mtt assay detects cell survival rate.

Onc-DT _203-390With Onc the cytotoxic effect of human leukemia cell K562 is compared shown in Fig. 3 B.As seen Onc-DT _203-390IC ₅₀Be about 2.5 * 10 ^-8Mol/L; The IC of Onc ₅₀Be about 1 * 10 ^-6Mol/L; Onc-DT is described _203-390Toxicity to tumour cell strengthens about 40 times than Onc.

3.Onc-DT _203-390Cytotoxic assay to human neuroblastoma SH-SY5Y

Neuroblastoma SH-SY5Y (available from Shanghai life science institute of Chinese Academy of Sciences cell bank) is incubated at and contains 10% foetal calf serum, and penicillin (100 units/ml), in DMEM (GIBICO) substratum of Streptomycin sulphate (100 μ g/ml).96 orifice plates are cultivated, and every hole adds 90 μ l nutrient solutions (5 * 10 ⁴Cell/ml), CO ₂(5%) cultivate in the incubator after 12 hours, adding protein sample by the concentration gradient of setting (is respectively Onc and Onc-DT _203-390) 10 μ l, control group adds PBS, cultivates after 72 hours, and mtt assay detects cell survival rate.

Onc-DT _203-390With Onc the cytotoxic effect of human neuroblastoma SH-SY5Y is compared shown in Fig. 3 C.Onc-DT _203-390IC ₅₀Be about 3 * 10 ^-7Mol/L; The IC of Onc ₅₀Greater than 8 * 10 ^-6Mol/L; Onc-DT is described _203-390Toxicity to tumour cell strengthens about 27 times than Onc.

4.Onc-DT _203-390Cytotoxic assay to human acute myeloid leukemia cell strain HL60

Human acute myeloid leukemia cell strain HL60 (available from Chinese Academy of Sciences's Shanghai life science institute's biological chemistry and cell institute) is incubated at and contains 10% calf serum, penicillin (100 units/ml), in RPMI 1640 (GIBICO) substratum of Streptomycin sulphate (100 μ g/ml).96 orifice plates are cultivated, and every hole adds 90 μ l nutrient solutions (5 * 10 ⁴Cell/ml), CO ₂(5%) cultivate in the incubator after 12 hours, adding protein sample by the concentration gradient of setting (is respectively ONC and Onc-DT _203-390) 10 μ l, control group adds PBS, cultivates after 72 hours, and mtt assay detects cell survival rate.

Onc-DT _203-390With Onc the cytotoxic effect of human acute myeloid leukemia cell strain HL60 is compared shown in Fig. 3 D.As seen Onc-DT _203-390IC ₅₀Be about 3 * 10 ^-7Mol/L; The IC of Onc ₅₀Greater than 1 * 10 ^-5Mol/L; Onc-DT _203-390Toxicity to tumour cell strengthens about 33 times than Onc.

Embodiment 7Onc-DT membrane spaning domain fusion rotein variant

For the ease of purifying, the inventor has also prepared N and has held the fusion rotein that contains 6His-tag.The conversion of recombinant vectors, expression are with embodiment 2-4.

The fusion rotein that the method that adopts embodiment 6 obtains after to purifying carries out cytotoxic assay, found that the fusion rotein that has His-tag approaches aforementioned Onc-DT to the toxicity of tumour cell _203-390

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.,

Model animals research centre, south, Shanghai

＜120〉rnase and diphtheria toxalbumin membrane transposition structural domain fusion rotein and its production and use

<130>080999

<160>5

<170>PatentIn?version?3.3

<210>1

<211>924

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉fusion gene

<400>1

caggactggc?tgactttcca?gaaaaaacat?atcactaaca?ctcgtgacgt?tgactgcgac????60

aacatcatgt?ctactaacct?gttccattgc?aaagacaaaa?acactttcat?ctactctcgt???120

ccggaaccgg?ttaaagctat?ctgcaaaggt?atcatcgctt?ctaaaaacgt?tctgactact???180

tctgaattct?acctgtctga?ctgcaacgtt?acttctcgtc?cgtgcaaata?caaactgaaa???240

aaatctacta?acaaattctg?cgttacttgc?gaaaaccagg?ctccggttca?tttcgttggt???300

gttggttctt?gctgcgctgg?taaccgtgtt?cgtcgttctg?ttggttcttc?tctgtcttgc???360

atcaacctgg?attgggatgt?tatccgtgat?aaaactaaga?ccaagatcga?gtctctgaaa???420

gagcacggcc?cgatcaaaaa?caaaatgagc?gaaagcccga?acaaaactgt?atctgaggaa???480

aaagctaaac?agtacctgga?agaatttcac?cagactgcac?tggagcaccc?ggaactgtct???540

gaactgaaaa?ccgttactgg?taccaacccg?gtattcgctg?gtgctaacta?cgcggcgtgg???600

gcagtaaacg?ttgctcaggt?tatcgatagc?gaaactgctg?ataacctgga?aaagactact???660

gctgctctgt?ctatcctgcc?gggtatcggt?agcgtaatgg?gcattgcaga?cggtgccgtt???720

caccataaca?ctgaagagat?cgtggcacag?tctatcgctc?tgtcctctct?gatggttgct???780

caggctattc?cgctggtagg?tgagctggtt?gatattggtt?tcgctgcata?caactttgta???840

gagagcatta?tcaacctgtt?tcaggtagtt?cacaactctt?acaaccgtcc?ggcgtactct???900

ccgggtcaca?aaactcagcc?gttt??????????????????????????????????????????924

<210>2

<211>308

<212>PRT

＜213〉artificial sequence

<220>

<221>MISC_FEATURE

＜223〉fusion rotein

<400>2

Gln?Asp?Trp?Leu?Thr?Phe?Gln?Lys?Lys?His?Ile?Thr?Asn?Thr?Arg?Asp

1???????????????5???????????????????10??????????????????15

Val?Asp?Cys?Asp?Asn?Ile?Met?Ser?Thr?Asn?Leu?Phe?His?Cys?Lys?Asp

20??????????????????25??????????????????30

Lys?Asn?Thr?Phe?Ile?Tyr?Ser?Arg?Pro?Glu?Pro?Val?Lys?Ala?Ile?Cys

35??????????????????40??????????????????45

Lys?Gly?Ile?Ile?Ala?Ser?Lys?Asn?Val?Leu?Thr?Thr?Ser?Glu?Phe?Tyr

50??????????????????55??????????????????60

Leu?Ser?Asp?Cys?Asn?Val?Thr?Ser?Arg?Pro?Cys?Lys?Tyr?Lys?Leu?Lys

65??????????????????70??????????????????75??????????????????80

Lys?Ser?Thr?Asn?Lys?Phe?Cys?Val?Thr?Cys?Glu?Asn?Gln?Ala?Pro?Val

85??????????????????90??????????????????95

His?Phe?Val?Gly?Val?Gly?Ser?Cys?Cys?Ala?Gly?Asn?Arg?Val?Arg?Arg

100?????????????????105?????????????????110

Ser?Val?Gly?Ser?Ser?Leu?Ser?Cys?Ile?Asn?Leu?Asp?Trp?Asp?Val?Ile

115?????????????????120?????????????????125

Arg?Asp?Lys?Thr?Lys?Thr?Lys?Ile?Glu?Ser?Leu?Lys?Glu?His?Gly?Pro

130?????????????????135?????????????????140

Ile?Lys?Asn?Lys?Met?Ser?Glu?Ser?Pro?Asn?Lys?Thr?Val?Ser?Glu?Glu

145?????????????????150?????????????????155?????????????????160

Lys?Ala?Lys?Gln?Tyr?Leu?Glu?Glu?Phe?His?Gln?Thr?Ala?Leu?Glu?His

165?????????????????170?????????????????175

Pro?Glu?Leu?Ser?Glu?Leu?Lys?Thr?Val?Thr?Gly?Thr?Asn?Pro?Val?Phe

180?????????????????185?????????????????190

Ala?Gly?Ala?Asn?Tyr?Ala?Ala?Trp?Ala?Val?Asn?Val?Ala?Gln?Val?Ile

195?????????????????200?????????????????205

Asp?Ser?Glu?Thr?Ala?Asp?Asn?Leu?Glu?Lys?Thr?Thr?Ala?Ala?Leu?Ser

210?????????????????215?????????????????220

Ile?Leu?Pro?Gly?Ile?Gly?Ser?Val?Met?Gly?Ile?Ala?Asp?Gly?Ala?Val

225?????????????????230?????????????????235?????????????????240

His?His?Asn?Thr?Glu?Glu?Ile?Val?Ala?Gln?Ser?Ile?Ala?Leu?Ser?Ser

245?????????????????250?????????????????255

Leu?Met?Val?Ala?Gln?Ala?Ile?Pro?Leu?Val?Gly?Glu?Leu?Val?Asp?Ile

260?????????????????265?????????????????270

Gly?Phe?Ala?Ala?Tyr?Asn?Phe?Val?Glu?Ser?Ile?Ile?Asn?Leu?Phe?Gln

275?????????????????280?????????????????285

Val?Val?His?Asn?Ser?Tyr?Asn?Arg?Pro?Ala?Tyr?Ser?Pro?Gly?His?Lys

290?????????????????295?????????????????300

Thr?Gln?Pro?Phe

305

<210>3

<211>589

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉fusion gene

<400>3

ttctgttggt?tcttctctgt?cttgcatcaa?cctggattgg?gatgttatcc?gtgataaaac???60

taagaccaag?atcgagtctc?tgaaagagca?cggcccgatc?aaaaacaaaa?tgagcgaaag??120

cccgaacaaa?actgtatctg?aggaaaaagc?taaacagtac?ctggaagaat?ttcaccagac??180

tgcactggag?cacccggaac?tgtctgaact?gaaaaccgtt?actggtacca?acccggtatt??240

cgctggtgct?aactacgcgg?cgtgggcagt?aaacgttgct?caggttatcg?atagcgaaac??300

tgctgataac?ctggaaaaga?ctactgctgc?tctgtctatc?ctgccgggta?tcggtagcgt??360

aatgggcatt?gcagacggtg?ccgttcacca?taacactgaa?gagatcgtgg?cacagtctat??420

cgctctgtcc?tctctgatgg?ttgctcaggc?tattccgctg?gtaggtgagc?tggttgatat??480

tggtttcgct?gcatacaact?ttgtagagag?cattatcaac?ctgtttcagg?tagttcacaa??540

ctcttacaac?cgtccggcgt?actctccggg?tcacaaaact?cagccgttt??????????????589

<210>4

<211>22

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>4

cccaggactg?gctgactttc?ca????????????????????????????????????????????22

<210>5

<211>29

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>5

gggtcgactt?at?tccggacc?accagaagc????????????????????????????????????29

Claims

1. a fusion rotein is characterized in that, described fusion rotein comprises:

(1) rnase;

(2) the proteic membrane transposition structural domain of bacterial poison;

(3) be positioned at the connection peptides that constitutes by 0-50 amino acid between (1) and (2).

2. fusion rotein as claimed in claim 1 is characterized in that, comprises the restriction enzyme site sequence of at least one intracellular protein enzyme in the sequence of described connection peptides, thereby after in entering born of the same parents (1) is separated with (2).

Preferably, described intracellular enzyme is selected from: Furin, matrix metalloproteinase, Free-PSA and kethepsin.

3. fusion rotein as claimed in claim 1 is characterized in that, described cytotoxic protein is selected from: diphtheria toxin or Pseudomonas aeruginosa exotoxin A.

4. fusion rotein as claimed in claim 3 is characterized in that, the membrane transposition structural domain of described diphtheria toxin is:

Described rnase is:

(a1) aminoacid sequence shown in 1-104 position among the SEQ ID NO:2; Or

Described connection peptides has the aminoacid sequence shown in the 105-120 position among the SEQ ID NO:2.

5. a nucleic acid molecule is characterized in that, arbitrary described fusion rotein among the described nucleic acid molecule encoding claim 1-4.

Preferably, described nucleic acid molecule has the nucleotide sequence shown in the SEQ ID NO:1.

6. a carrier is characterized in that, it contains the described nucleic acid molecule of claim 5.

7. a genetically engineered cell is characterized in that,

Described cell contains the described carrier of claim 6;

Or be integrated with the described nucleic acid molecule of claim 5 in the described cellular genome.

8. a method that produces the described fusion rotein of claim 1 is characterized in that, described method comprises:

(A) cultivate the described host cell of claim 7, thereby express the described fusion rotein of claim 1;

(B) isolate described fusion rotein.

9. the purposes of arbitrary described fusion rotein among the claim 1-4 is characterized in that, is used to prepare the composition that suppresses growth of tumour cell or treatment tumour.

One kind suppress growth of tumour cell or the treatment tumour composition, it is characterized in that described composition contains:

(i) arbitrary described fusion rotein among the claim 1-4; With

(ii) pharmaceutically acceptable carrier.