CN101450214B - Transferrin-frog-egg ribonuclease coupler and production method and use thereof - Google Patents
Transferrin-frog-egg ribonuclease coupler and production method and use thereof Download PDFInfo
- Publication number
- CN101450214B CN101450214B CN2007101718921A CN200710171892A CN101450214B CN 101450214 B CN101450214 B CN 101450214B CN 2007101718921 A CN2007101718921 A CN 2007101718921A CN 200710171892 A CN200710171892 A CN 200710171892A CN 101450214 B CN101450214 B CN 101450214B
- Authority
- CN
- China
- Prior art keywords
- ribonuclease
- transferrins
- conjugate
- rana ovum
- transferrin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses a transferrin-frogspawn ribalgilase conjugate which belongs to the biological medicine field. The conjugate includes one transferrin and 1-5 frogspawn ribalgilase. The invention also discloses a method for preparing the conjugate, an use and a pharmaceutical composition containing the conjugate. Many tumour cells high express transferrin receptor, and transferrin is easy to be endocytosis after combining with the receptor, accordingly the conjugate is easy to enter into cytolymph than dissociative frogspawn ribalgilase and has stronger and special ability for killing tumour cell.
Description
Technical field
The invention belongs to field of biological pharmacy, more specifically, the present invention relates to transferrins (Tf)-Rana ovum ribonuclease (Onconase) conjugate and its production and use.
Background technology
The Rana ovum ribonuclease (Onconase claims again: P30 protein, Ranpirnase is called for short Onc) and be isolating a kind of nuclease from the leopard frog (Rana pipiens) oocyte and body early embryo, belong to the RNaseA superfamily.Studies show that Onc enters cell by endocytosis, the tRNA that in endochylema, optionally degrades, Profilin is synthesized and then is suppressed cell proliferation and causes apoptosis.Experiment in vitro shows that Onc has antiproliferative and cytotoxic effect to kinds of tumor cells, as: people's prostate gland cancer cell, pancreatic cancer cell, leukaemia etc.Experiment showed, in the body of mouse model that Onc can suppress tumor growth, prolong the mice time-to-live, strengthen the effect of multiple antitumor drug.
At present, it is clinical that Onc entered for three phases as a kind of medicine of anti-pernicious Leydig's cell tumor, may be a kind of potential antitumor drug with good prospect.But because this albumen is inhuman endogenous binding protein, still can produce certain immunoreation and side reaction (as injury of kidney) when therefore in human body, using, Onc also has certain fragmentation effect for some normal cells simultaneously, overcoming these shortcomings just needs to strengthen the specific killing effect of Onc to tumor cell, improves the efficient that Onc enters tumor cell.Therefore, still need to improve the ability that the Onc specificity enters tumor cell, to reduce its side effect.
Summary of the invention
The object of the present invention is to provide a kind of transferrins (Tf)-Rana ovum ribonuclease (Onconase) conjugate.
Another object of the present invention is to provide the preparation method and the purposes of described transferrin-frog-egg ribonuclease coupler.
In a first aspect of the present invention, a kind of isolating transferrins (Tf)-Rana ovum ribonuclease (Onconase) conjugate is provided, described conjugate contains 1 transferrins and 1-5 with described transferrins link coupled (preferably 2-4; More preferably 2-3) the Rana ovum ribonuclease, the molecular weight of described conjugate is at 89-137KD.
In another preference, described transferrins has the aminoacid sequence shown in the SEQ ID NO:2; Perhaps described Rana ovum ribonuclease has the aminoacid sequence shown in the SEQ ID NO:4.
In another preference, described conjugate makes in order to the below method:
(1) utilize N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester (SPDP) and 2-IminothiolaneHCl (being also referred to as Traut reagent) with transferrins and the coupling mutually of Rana ovum ribonuclease; With
(2) separate the described transferrin-frog-egg ribonuclease coupler of acquisition.
In a second aspect of the present invention, a kind of method for preparing described transferrin-frog-egg ribonuclease coupler is provided, described method comprises:
(1) utilize N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester and 2-IminothiolaneHCl with transferrins and the coupling mutually of Rana ovum ribonuclease; With
(2) separate the described transferrin-frog-egg ribonuclease coupler of acquisition.
In another preference, described method comprises:
(a) transferrins is contacted with N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester, obtain the transferrins of handling through N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester;
(b) the Rana ovum ribonuclease is contacted with 2-IminothiolaneHCl, obtain the Rana ovum ribonucleic acid pheron of handling through 2-IminothiolaneHCl;
(c) the Rana ovum ribonucleic acid pheron of handling through 2-IminothiolaneHCl that transferrins and the step (b) through the processing of N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester that step (a) is obtained obtains mixes, thereby makes transferrins and the coupling mutually of Rana ovum ribonuclease; With
(d) collecting molecular weight is the conjugate of 89-137kD.
In another preference, remove free transferrins and Onc through ion exchange, be the conjugate of 89-137kD thereby collect molecular weight.
In another preference, in step (a), the mol ratio of transferrins and N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester is 1: (5-10).
In another preference, in step (b), the mol ratio of Rana ovum ribonuclease and 2-IminothiolaneHCl is 1: (5-10).
In another preference, in step (c), the proteic mol ratio of handling through 2-IminothiolaneHCl of Rana ovum ribonuclease that transferrins and the step (b) through the processing of N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester that step (a) obtains obtains is 1: (1-4).
In another preference, the proteic mol ratio of handling through 2-IminothiolaneHCl of Rana ovum ribonuclease that transferrins and the step (b) through the processing of N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester that step (a) obtains obtains is 1: 3 approximately.
In a third aspect of the present invention, the purposes of described transferrin-frog-egg ribonuclease coupler is provided, be used to prepare the compositions that suppresses tumor.
In another preference, described tumor is the tumor of high expressed TfR.
In a fourth aspect of the present invention, a kind of compositions that suppresses tumor is provided, described compositions contains:
(i) the described transferrin-frog-egg ribonuclease coupler of effective dose; With
(ii) pharmaceutically acceptable carrier.
In a fifth aspect of the present invention, the method that provides a kind of external (preferred non-therapeutic ground) to suppress growth of tumour cell, described method comprise utilizes described transferrin-frog-egg ribonuclease coupler to handle tumor cell.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Figure 115 %SDS-PAGE gel electrophoresis has shown Rana ovum ribonuclease expression and purification effect protein gel figure of the present invention.Wherein,
Swimming lane 6 is the pure product of RNase A (applied sample amount 1.5 μ g).
Fig. 2 (a) 15%SDS-PAGE gel electrophoresis has shown transferrins and Rana ovum ribonuclease coupling effect protein gel figure.Wherein,
Swimming lane 6 is reductive Onc-Tf (applied sample amount 4 μ g);
Swimming lane 7 is the molecular weight of albumen standard.
Fig. 2 (b) 10%SDS-PAGE gel electrophoresis has further shown transferrins and Rana ovum ribonuclease coupling protein molecular weight distribution.Wherein,
Fig. 3 has shown that mtt assay detects and has adopted Tf-Onc conjugate that SPDP and 2-IminothiolaneHCl obtain as coupling agent and Onc to murine myeloma cell SP2/0 cytotoxic effect figure.
Fig. 4 has shown that mtt assay detects and has only adopted Tf-Onc conjugate that SPDP obtains as coupling agent and Onc to murine myeloma cell SP2/0 cytotoxic effect figure.
Fig. 5 has shown that mtt assay detects and has adopted Tf-Onc conjugate that SPDP and 2-IminothiolaneHCl obtain as coupling agent and Onc to human neuroblastoma SH-SY5Y cytotoxic effect figure.
The specific embodiment
Not high at Rana ovum ribonuclease in the present prior art for the specificity of tumor cell, cause and kill and wound some Normocellular defectives, the inventor has made a kind of highly purified transferrin-frog-egg ribonuclease coupler first through extensive studies and selection repeatedly and test.In this conjugate, transferrins can enter into tumor cell by the cell space transhipment effect of TfR mediation, brings the Rana ovum ribonuclease into tumor cell, the effect of performance killing tumor cell.In the conjugate of the present invention, coupling has 1-5 Rana ovum ribonuclease on each transferrin molecules, so molecular size is moderate, is easy to penetrate the cell membrane of tumor cell and enters into cell.Finished the present invention on this basis.
Purport of the present invention is to utilize transferrins as pharmaceutical carrier, and Onc is transported to these surface of tumor cells, can strengthen the endocytosis of Onc, improves its specificity, thereby enlarges the scope of Onc treatment tumor, strengthens drug effect and reduces its side effect.
The present invention is mainly vigorous based on many tumor cell metabolism, the characteristics of high expressed TfR (common tumor cells expression 10,000 to 100,000 TfR1, and TfR1 hangs down expression or has not detected expression on normal cell, referring to ZHONGMING QIAN etc., Targeted drug delivery via thetransferrin receptor-mediated endocytosis pathway.Pharmacol Rev54:561-587,2002), with transferrins and the coupling mutually of Rana ovum ribonuclease, this conjugate is with both biological functions, both can this conjugate be attached to specifically on the tumor cell of high expressed TfR by transferrins, after entering cell by endocytosis, this conjugate utilizes the cytotoxic effect of Rana ovum ribonuclease, cell killing.So this conjugate can be attached on the tumor cell specifically, improve efficient and tumoricidal specificity that the Rana ovum ribonuclease enters tumor cell greatly, strengthen the fragmentation effect to tumor cell, the side effect of minimizing Rana ovum ribonuclease.Conjugate of the present invention is particularly suitable for the tumor treatment of various high expressed TfR types, for example the treatment of (but being not limited to) cerebroma, leukemia etc.
Transferrins
Transferrins (Transferrin, be called for short Tf) is that a kind of molecular weight is about 77kD, can with the bonded glycoprotein of iron ion.The transferrins that combines iron ion can be specifically and its receptor (TransferrinReceptor 1, is called for short TfR1) combination, the intracellular transport of mediation iron ion.TfR1 is high expressed on tumor cell, thereby the more transferrins of Transshipment Permitted enters into tumor cell.
In the present invention, used transferrins can be naturally occurring, such as its can be separated or purification from animal.In addition, described transferrins also can be an artificial preparation, such as producing recombinant transferrin according to the genetic engineering recombinant technique of routine.
Any suitable transferrins all can be used for the present invention.Described transferrins comprises transferrins or its bioactive fragment of total length.Preferably, the aminoacid sequence of described transferrins can be substantially the same with the sequence shown in the SEQ ID NO:2.
The aminoacid sequence of the transferrins that passes through replacement, disappearance or the interpolation of one or more amino acid residues and form is also included among the present invention.Transferrins or its bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence of replacing through aminoacid does not influence its activity or kept the activity of its part.Suitably replacing aminoacid is the technique known of this area, and described technology can be implemented and guarantee not change the biological activity of gained molecule at an easy rate.These technology are recognized those skilled in the art, in general, can not change biological activity basically at the inessential area change single amino acids of a peptide species.See Molecular Biology of The Gene such as Watson, the 4th edition, 1987, The Benjamin/CummingsPub.Co.P224.
The bioactive fragment of any transferrins can be applied among the present invention.Here, the implication of the bioactive fragment of transferrins is meant that as a peptide species it still can keep all or part of function of the transferrins of total length.Generally, described bioactive fragment keeps the activity of 50% total length transferrins at least.Under preferred condition, described active fragment can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% activity of total length transferrins.
The present invention also can adopt transferrins modified or improvement, such as, can adopt the transferrins of being modified or improveing in order to promote its half-life, effectiveness, metabolism and/or proteic effectiveness.Though described can be to have certain difference with naturally occurring transferrins or gene through transferrins or the gene modified or improve, also can suppress tumor cell, and can not bring other harmful effect or toxicity.That is to say that the version of the biological function of any biological activity that does not influence transferrins or perhaps gene all can be used among the present invention.
Described transferrins can be the approach of buying available from commerce, and as an example of the present invention, described transferrins is available from CALBIOCHEM.
The Rana ovum ribonuclease
Described Rana ovum ribonuclease is a kind of for the useful enzyme of inhibition tumor cell, its tRNA that can in endochylema, optionally degrade, and Profilin is synthesized and then is suppressed cell proliferation and causes apoptosis.
In the present invention, used Rana ovum ribonuclease can be naturally occurring, such as its can be separated or purification from animal.In addition, described Rana ovum ribonuclease also can be an artificial preparation, such as producing reorganization Rana ovum ribonuclease according to the genetic engineering recombinant technique of routine.Preferably, the present invention can adopt the Rana ovum ribonuclease of reorganization.
Any suitable Rana ovum ribonuclease all can be used for the present invention.Described Rana ovum ribonuclease comprises Rana ovum ribonuclease or its bioactive fragment of total length.Preferably, the aminoacid sequence of described Rana ovum ribonuclease can be substantially the same with the sequence shown in the SEQ ID NO:4.
The aminoacid sequence of the Rana ovum ribonuclease that passes through replacement, disappearance or the interpolation of one or more amino acid residues and form is also included among the present invention.Rana ovum ribonuclease or its bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence of replacing through aminoacid does not influence its activity or kept the activity of its part.Suitably replacing aminoacid is the technique known of this area, and described technology can be implemented and guarantee not change the biological activity of gained molecule at an easy rate.These technology are recognized those skilled in the art, in general, can not change biological activity basically at the inessential area change single amino acids of a peptide species.See Molecular Biology of The Gene such as Watson, the 4th edition, 1987, TheBenjamin/Cummings Pub.Co.P224.
The bioactive fragment of any Rana ovum ribonuclease can be applied among the present invention.Here, the implication of the bioactive fragment of Rana ovum ribonuclease is meant that as a peptide species it still can keep all or part of function of the Rana ovum ribonuclease of total length.Generally, described bioactive fragment keeps the activity of 50% total length Rana ovum ribonuclease at least.Under preferred condition, described active fragment can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% activity of total length Rana ovum ribonuclease.
The present invention also can adopt Rana ovum ribonuclease modified or improvement, such as, can adopt the Rana ovum ribonuclease of being modified or improveing in order to prolong its half-life, improve its stability or to strengthen its killing tumor cell ability.Described through modifying or though the Rana ovum ribonuclease or the gene of improvement can be to have certain difference with naturally occurring Rana ovum ribonuclease or gene, also can killing tumor cell, and can not bring other harmful effect or toxicity.That is to say that the version of the biological function of any biological activity that does not influence the Rana ovum ribonuclease or perhaps gene all can be used among the present invention.
As an example of the present invention, described Rana ovum ribonuclease is recombinant expressed, the encoding gene total length 315bp of described Rana ovum ribonuclease, the polypeptide of 104 AA of coding, this gene is shown in SEQ ID NO:3, and its encoded protein is shown in SEQ ID NO:4.
In general described Rana ovum ribonuclease can have following steps by conventional gene engineering method production:
(1). transform or the transduction proper host cell with the recombinant expression carrier that contains Rana ovum ribonucleic acid enzyme coding gene;
(2). the host cell of in proper culture medium, cultivating;
(3). separation, protein purification from culture medium or cell.
Conjugate
The invention provides a kind of transferrin-frog-egg ribonuclease coupler, the molecular weight of described conjugate is at 89-137KD, and coupling has 1-5 Rana ovum ribonuclease on each transferrin molecules.
The inventor finds under study for action, the molecule that cell membrane enters into cell can be passed and certain size must be satisfied, if link coupled Rana ovum enzymatic ribonucleic acid molecule is too much on the transferrins, not only cause molecular structure excessive, also can have influence on combining of TfR on transferrins and the tumor cell membrane, effect is undesirable; If the one or more Rana ovum ribonuclease of a plurality of transferrins couplings then cause molecular volume excessive, be difficult to the penetration rate of blood tube wall and enter in the tumor tissues.Therefore, in the process of preparation conjugate, the conjugate that needs control to obtain contains a transferrins (about 77KD) and 1 or several (preferred 1-5 is individual) Rana ovum ribonuclease (about 12KD), so that conjugate can successfully enter into tumor cell and bring into play the effect of good killing tumor cell.
Consider the size of conjugate and the effectiveness of killing tumor cell, preferably coupling has 2-4 Rana ovum ribonuclease on each transferrin molecules; More preferably coupling has 2-3 Rana ovum ribonuclease on each transferrin molecules.
The present invention also provides the purposes of described transferrin-frog-egg ribonuclease coupler, is used for the compositions that preparation suppresses tumor (tumor cell).Preferably, described tumor is the tumor of high expressed TfR; Tumor TfR expression is high more, and the effect of conjugate of the present invention is good more.
The preparation method of conjugate
The inventor finds under study for action, single SPDP that adopts prepares transferrin-frog-egg ribonuclease coupler as coupling agent, and the conjugate randomness of acquisition is big, structure differs, and the molecular weight size differences is bigger, be unfavorable for purification, and conjugate to enter into the ratio of tumor cell low.
The inventor has carried out long term studies and improvement, has found a kind of method for preparing satisfactory transferrin-frog-egg ribonuclease coupler, and described method comprises:
(1) utilize N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester (SPDP) and 2-IminothiolaneHCl with transferrins and the coupling mutually of Rana ovum ribonuclease; With
(2) separate the described transferrin-frog-egg ribonuclease coupler of acquisition.
As optimal way of the present invention, described method comprises:
(a) transferrins is contacted with N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester (SPDP), obtain the transferrins of handling through N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester;
(b) the Rana ovum ribonuclease is contacted with 2-IminothiolaneHCl, obtain the Rana ovum ribonucleic acid pheron of handling through 2-IminothiolaneHCl;
(c) the Rana ovum ribonucleic acid pheron of handling through 2-IminothiolaneHCl that transferrins and the step (b) through the processing of N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester that step (a) is obtained obtains mixes, thereby makes transferrins and the coupling mutually of Rana ovum ribonuclease; With
(d) collecting molecular weight is the conjugate of 89-137kD.
Transferrins is handled the back with N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester carry out coupling with the Rana ovum ribonucleic acid pheron of handling through 2-Iminothiolane, most coupled product molecular weight size that its result obtains also is to contain 1 transferrin molecules (about 77KD) and 1-5 Rana ovum enzymatic ribonucleic acid molecule (1 about 12KD of Rana ovum enzymatic ribonucleic acid molecule) in the most conjugate at 89-137KD.This conjugate has the ability of good ability that enters tumor cell and good killing tumor cell.And described conjugate also helps follow-up purification because Stability Analysis of Structures and molecular weight are in the certain limit than the concentrated area.
As optimal way of the present invention, during coupling agent treatment, the mol ratio of transferrins and coupling agent N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester is 1: (5-10), the mol ratio of Rana ovum ribonuclease and coupling agent 2-IminothiolaneHCl is 1: (5-10), handling according to this ratio can be at the even more ideal coupled product of final acquisition.
As optimal way of the present invention, in step (c), the proteic mol ratio of handling through 2-Iminothiolane of Rana ovum ribonuclease that transferrins and the step (b) through the processing of N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester that step (a) obtains obtains is 1: (2-4); Preferred mol ratio is 1: 3 approximately.
As optimal way of the present invention, after adopting SPDP to handle transferrins,, can adopt conventional purification process to carry out purification in order to remove impurity and to keep treated transferrins, described purification process includes but not limited to: chromatography, dialysis.In addition, after adopting 2-IminothiolaneHCl to handle the Rana ovum ribonuclease or through the transferrins of coupling agent treatment with give birth to coupling reaction through the Rana ovum ribonuclease hybrid concurrency of coupling agent treatment after also can carry out purification to obtain purer intermediate product or product.
As optimal way of the present invention, in step (d), adopt the strong cation exchange chromatography to remove free transferrins and Onc, be the conjugate of 89-137kD thereby collect molecular weight.Described ion-exchange process yield height, purity height.
The evaluation of coupled product can be adopted this area technology commonly used, and for example electrophoresis judges by the position and the size of observing electrophoretic band whether the conjugate that is obtained is needed.
Pharmaceutical composition
The present invention also provides a kind of compositions that suppresses tumor, and described compositions contains: (i) transferrin-frog-egg ribonuclease coupler of the present invention of effective dose (as 0.00001-50uM); (ii) pharmaceutically acceptable carrier.
As used herein, the composition of " pharmaceutically or acceptable on the bromatology " is applicable to people and/or mammal and does not have excessive bad side reaction (as toxicity, stimulation and allergy), promptly has the material of rational benefit/risk ratio.Term " pharmaceutically acceptable carrier " refers to be used for the treatment of the carrier of agent administration, comprises various excipient and diluent.This term refers to some medicament carriers like this: they itself are not necessary active component, and do not have undue toxicity after using.Suitable carriers is well known to those of ordinary skill in the art.(Mack Pub.Co. can find proving absolutely about pharmaceutically acceptable carrier in N.J.1991) at Remington ' s Pharmaceutical Sciences.Acceptable carrier can contain liquid on combination of Chinese medicine is learned, as water, saline, glycerol and sorbitol.In addition, also may there be complementary material in these carriers, as lubricant, fluidizer, wetting agent or emulsifying agent, pH buffer substance and stabilizing agent, as albumin etc.
Described compositions can be made the various dosage forms that are suitable for the mammal administration, described dosage form includes but not limited to: injection, capsule, tablet, Emulsion, suppository.
Compositions of the present invention can be directly used in killing tumor cell.In addition, also can unite use with other therapeutic agent or adjuvant simultaneously.
Major advantage of the present invention is:
(1) in the conjugate of the present invention, transferrins can be brought the Rana ovum ribonuclease into tumor cell by the pinocytosis of TfR mediation, has strengthened kill capability and the specificity of Rana ovum ribonuclease for tumor cell.
(2) in the conjugate of the present invention, coupling has 1-5 Rana ovum ribonuclease on each transferrin molecules, so molecular size is moderate, is easy to penetrate the cell membrane of tumor cell and enters into cell.
(3) conjugate of the present invention is not mixed with substantially without link coupled free transferrins and Rana ovum ribonuclease, has guaranteed that the effect of medicine is produced by conjugate of the present invention fully.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
1. express the structure of Onc plasmid
According to the sequence shown in the SEQ ID NO:3, complete sequence synthesizes the proteic coded sequence of Onc, and design two ends primer is as follows:
5 ' primer is: CCCAGGACTGGCTGACTTTCCA (SEQ ID NO:5);
3 ' primer is: AAAGTCGACTCAGCAAGAACCAACACC (SEQ ID NO:6);
With aforementioned synthetic gene order is template, with SEQ ID NO:5 and SEQ ID NO:6 is primer, carry out pcr amplification, amplified production between the MscI and SalI site of pET22b (+) carrier (Novagen), obtains expressing the expression plasmid of Onc through SalI enzyme action rear clone.
2.Onc protein expression
With the expression plasmid transformed into escherichia coli BL21 (DE3) of aforementioned structure, the monoclonal of choosing overnight is in 50ml LB culture medium, in 37 ℃ of overnight incubation.Be cultured to OD by 1: 20 switching 1L TB culture medium in 37 ℃ next day
600=2.0, add IPTG concentration and induced 3.5 hours to 0.5mM, centrifugal 10 minutes of 4 ℃, 6000rpm are collected thalline, and thalline is used for next step inclusion body and collects and purification.
3. inclusion body washing
With the thalline of collecting be suspended in buffer SSB_A (20mM Tris-HCl, 10mM EDTA, pH8.0) in, with the broken thalline of ultrasonic disruption instrument; 4 ℃, centrifugal 10 minutes of 12000rpm collects inclusion body; WIBB1 (20mM Tris-HCl, pH 8.0,10mM EDTA, 2%Triton X-100 and 2M carbamide, pH 8.0) and solution suspension inclusion body, the vibration washing, 4 ℃, centrifugal 10 minutes of 12000rpm collects inclusion body, and it is inferior to repeat this step 3; WIBB2 (pH 8.0 for 20mM Tris-HCl, 10mM EDTA) solution suspension inclusion body, vibration washing (available low power ultrasound ripple helps and washes), centrifugal 10 minutes of 4 ℃, 12000rpm are collected inclusion body; Repeat this step 2-3 time.
4. solubilization of inclusion bodies and renaturation
The solubilization of inclusion bodies that 1L bacterium liquid is obtained is in 6ml DIBB (10mM DTT, 10mM EDTA, pH 8.0 for 20mM Tris-HCl, 7M guanidine hydrochloride) solution, and the inflated with nitrogen room temperature is placed 5h; 4 ℃, 12000rpm * 15min, centrifugal collection supernatant is 20mg/ml with protein quantification to concentration; 1ml inclusion body solution is diluted to rapidly in 50ml DB (20mM acetic acid) solution, 4 ℃, the centrifugal precipitation of abandoning of 12000rpm * 30min; Remove denaturant with the DB dialysis; In solution, add 20 * RB (the 3.0mM reduced glutathion, the 0.6mM oxidized form of glutathione, pH 8.0 for 100mM Tris-AcOH, 100mM NaCl), and regulate pH=8.0,4 ℃, the centrifugal precipitation of removing of 12000rpm * 30min; 4 ℃ of renaturation are 36～48 hours in renaturation buffer RB solution, and 4 ℃, 12000 change 20min removes the albumen precipitation that renaturation process produces; After supernatant dialysis is desalted, protein solution be stored in 4 ℃ standby.
5. cation exchange column chromatography purification
The protein solution that renaturation is good quantitatively back is gone up strong cat ion exchange column.
(1) chromatographic column is that (2 * 2cm, Pharmacia), mobile phase is LB (10mM phosphate buffer (pH6.0)) and WB (1M NaCl, 10mM phosphate buffer (pH6.0)) to SP Sepharose, flow velocity 1ml/min.
Elution process: 30 column volumes of 100%WB eluting and substep are collected, and Coomassie brilliant blue G250 detects and contains proteic sample.After collection contains proteic sample and desalts with dialysis solution 10mM phosphate buffer (pH6.0), standby.
(2) the quantitative strong cat ion exchange column of crossing of the sample solution after will desalting.Chromatographic column is that (pharmacia), mobile phase is LB (10mM phosphate buffer (pH6.0)) and WB (1MNaCl, 10mM phosphate buffer (pH6.0)) to prepacked column MonoS, flow velocity 1ml/min for HR5/5,1ml.
Elution process: 20 column volumes of 0-100%WB eluting and substep are collected, and collect the protein peak that is equivalent to locate about 20%.
The product in each stage in the preparation Onc protein process (comprise and induce preceding bacterial protein (swimming lane 1), induce bacterial protein (swimming lane 2) after 2.5 hours, induce behind back thalline inclusion body (swimming lane 3), renaturation and the purification Onc (swimming lane 4) etc.) is carried out conventional 15%SDS-PAGE electrophoretic analysis, and the result as shown in Figure 1.
A. adopt SPDP and 2-Iminothiolane to carry out coupling
1.Tf (available from CALBIOCHEM, lot number is Cat:616397, and is Powdered, its aminoacid sequence such as SEQ ID NO:2) being dissolved in PBS (pH7.4), to make it final concentration be 20mg/ml, every ml adds 50 μ l (being equivalent to 10 times of amounts according to the about Tf of mol ratio) 50mM SPDP, and quick mixing is behind the reaction 30min, with desalting column HiTrap Desalting (5 * 5ml, Pharmacia) separate, mobile phase is PBS (pH7.4), and substep is collected, the 10%SDS-PAGE testing result, it is standby to reserve the egg product sample.
2. will being dissolved in 20mM phosphate buffer (pH6.0) through the Onc of aforementioned preparation and purification albumen, to make it final concentration be 1mg/ml, add 16.67 μ l 50mM 2-IminothiolaneHCl (Promega, be equivalent to be about 10 times of amounts of 0nc) according to mol ratio, quick mixing, react after 1 hour, micromolecule is removed in dialysis.
3.Onc and Tf mixes both according to mole ratio 3: 1,4 ℃ are spent the night.
4. molecular sieve column Superdex75 10/300GL (Pharmacia) on the sample after spending the night, mobile phase is 20mM NaHPO
4, pH6.0 separates and removes small molecular protein, stays the high molecular weight protein mixture standby.
Ion exchange column Mono S on the high molecular weight protein mixture (HR5/5,1ml, Pharmacia).Mono S is with 10mM phosphate buffer (pH6.0) balance, and with 0-1M NaCl gradient elution, flow velocity 1ml/min separates and removes unreacted Tf, eluting conjugate, and concentrated coupled product simultaneously.
6. reduction handles with reduction that sample carries out 15%SDS-PAGE and 10%SDS-PAGE identifies: with the equal-volume ratio with sample respectively and go back original reagent (0.1M Tris-HCL (pH6.8); 20% glycerol; 4%SDS; 0.005% (W/V) bromophenol blue; The 10%2-mercaptoethanol) and non-reduced reagent (0.1M Tris-HCL (pH6.8); 20% glycerol; 4%SDS; 0.005% (W/V) bromophenol blue) is mixed and made into the protein electrophoresis sample and carries out the electrophoresis evaluation.
Testing result is seen Fig. 2, and Fig. 2 (a) is the 15%SDS-PAGE gel electrophoresis, and swimming lane 1 is the pure product of non-reducing Onc; Swimming lane 2 is the pure product of non-reducing Tf; Swimming lane 3 is non-reducing Onc-Tf; Swimming lane 4 is the pure product of reductive Onc; Swimming lane 5 is the pure product of reductive Tf; Swimming lane 6 is reductive Onc-Tf; Swimming lane 7 is the molecular weight of albumen standard.Fig. 2 (b) is that the 10%SDS-PAGE gel electrophoresis further shows transferrins and Rana ovum ribonuclease coupling protein molecular weight distribution.
B. single employing SPDP carries out coupling
In the present embodiment, only adopt SPDP coupling Tf and Onc albumen.
Method is as described above diluted Tf and Onc albumen respectively and to be mixed with the protein solution that concentration is 20mg/ml and 1mg/ml, and transfers pH to 7.4 standby.
1, each sample 1ml with respectively with the excessive SPDP reaction of 10 times of molecules, mixing obtains Onc-PDP fast, micromolecule was removed in dialysis after room temperature was placed 30min.
2, add final concentration and be 2mM DTT reduction Onc-PDP, room temperature is placed 1h; Remove DTT with pH6.0 PBS dialysis.
3, BCA measures albumen, by mole ratio 3: 1 Onc is mixed with Tf, and 4 ℃ are spent the night.
Aforementioned coupled product is detected, and testing result shows that this kind coupling method obtains high polymer (between promptly a plurality of (more than 2) Tf molecule, link coupled situation between perhaps a plurality of (more than 2) Tf molecules and a plurality of (more than 1) Onc) large percentage.
Embodiment 3Onc-Tf and Onc compare the cytotoxic effect of myeloma cell SP2/0
A. adopt the prepared conjugate of A item among the embodiment 2
Myeloma SP2/0 cell (available from ATCC) is incubated at and contains 10% calf serum, and penicillin (100 units/ml), in streptomycin (100 μ g/ml) RPMI 1640 (GIBICO) culture medium.96 orifice plates are cultivated, and every hole adds 90 μ l culture fluid (5 * 10
4Cell/ml), CO
2(5%) cultivates in the incubator after 12 hours, remove culture fluid, and after washing once with the PBS of pre-cooling, add 90 μ l serum-free mediums (penicillin (100 units/ml), streptomycin (100 μ g/ml) RPMI 1640).Add protein sample (the prepared Onc-Tf conjugate of A item among the embodiment 2) 10 μ l by the Concentraton gradient of setting, matched group adds PBS, cultivates after 2 hours, adds equal-volume 20% calf serum.After cultivating 70 hours subsequently, conventional mtt assay detects cell survival rate.
The result as shown in Figure 3, visible Onc-Tf significantly is better than Onc to myeloma cell's toxic action, and is higher 2000 times than Onc.
B. adopt the prepared conjugate of B item among the embodiment 2
Myeloma SP2/0 cell culture is in containing 10% calf serum, and penicillin (100 units/ml), in streptomycin (100 μ g/ml) RPMI 1640 (GIBICO) culture medium.96 orifice plates are cultivated, and every hole adds 90 μ l culture fluid (5 * 10
4Cells/ml), CO
2(5%) cultivate 12h in the incubator after, remove culture fluid, and after washing once with the PBS of pre-cooling, add 90 μ l serum-free mediums (penicillin (100 units/ml), streptomycin (100 μ g/ml) RPMI 1640).Add protein sample (the prepared Onc-Tf conjugate of B item among pure product of Onc that prepare among the embodiment 1 and the embodiment 2) 10 μ l by the Concentraton gradient of setting, matched group adds PBS, cultivates after 2 hours, adds equal-volume 20% calf serum.After cultivating 70h subsequently, conventional mtt assay detects cell survival rate.
The result shows with the Onc-Tf conjugate of the described method preparation of B item only high about 10 times than Onc to myeloma cell's toxic action as shown in Figure 4.
Embodiment 4Onc-Tf and Onc compare the cytotoxic effect of neuroblastoma SH-SY5Y
Neuroblastoma SH-SY5Y (ATCC) is incubated at and contains 10% hyclone, and penicillin (100 units/ml), in streptomycin (100 μ g/ml) DMEM (GIBICO) culture medium.96 orifice plates are cultivated, and every hole adds 90 μ l culture fluid (5 * 10
4Cell/ml), CO
2(5%) cultivate 12h in the incubator after, remove culture fluid, and after washing once with the PBS of pre-cooling, add 90 μ l serum-free mediums (penicillin (100 units/ml), streptomycin (100 μ g/ml) DMEM).Add protein sample (the prepared Onc-Tf conjugate of A item among pure product of Onc that prepare among the embodiment 1 and the embodiment 2) 10 μ l by the Concentraton gradient of setting, matched group adds PBS, cultivates after 2 hours, adds equal-volume 20% hyclone.After cultivating 70h subsequently, mtt assay detects cell survival rate.
The result as shown in Figure 5, visible Onc-Tf significantly is better than Onc to the toxic action of neuroblastoma, and is higher 100 times than Onc at least.
The Onc-Tf conjugate 1ml that A item among the embodiment 2 is obtained is formulated in the conventional normal saline of 100ml, obtains to contain the compositions of Onc-Tf conjugate.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
Claims (7)
1. an isolating transferrin-frog-egg ribonuclease coupler is characterized in that, described conjugate contains 1 transferrins and 1-5 and the link coupled Rana ovum ribonuclease of described transferrins, and the molecular weight of described conjugate is at 89-137KD;
Described conjugate makes in order to the below method:
(a) transferrins is contacted with N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester, the transferrins that acquisition is handled through N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester, wherein the mol ratio of transferrins and N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester is 1: (5-10);
(b) the Rana ovum ribonuclease is contacted with 2-IminothiolaneHCl, obtain the Rana ovum ribonucleic acid pheron through the 2-IminothiolaneHCl processing, wherein the mol ratio of Rana ovum ribonuclease and 2-IminothiolaneHCl is 1: (5-10);
(c) the Rana ovum ribonuclease of handling through 2-IminothiolaneHCl that transferrins of handling through N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester that step (a) is obtained and step (b) obtain is with mol ratio 1: (1-4) mix, thereby make transferrins and the coupling mutually of Rana ovum ribonuclease; With
(d) collecting molecular weight is the conjugate of 89-137kD.
2. conjugate as claimed in claim 1 is characterized in that, described transferrins has the aminoacid sequence shown in the SEQ ID NO:2; Perhaps
Described Rana ovum ribonuclease has the aminoacid sequence shown in the SEQ ID NO:4.
3. a method for preparing the described transferrin-frog-egg ribonuclease coupler of claim 1 is characterized in that, described method comprises:
(a) transferrins is contacted with N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester, the transferrins that acquisition is handled through N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester, wherein the mol ratio of transferrins and N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester is 1: (5-10);
(b) the Rana ovum ribonuclease is contacted with 2-IminothiolaneHCl, obtain the Rana ovum ribonucleic acid pheron through the 2-IminothiolaneHCl processing, wherein the mol ratio of Rana ovum ribonuclease and 2-IminothiolaneHCl is 1: (5-10);
(c) the Rana ovum ribonuclease of handling through 2-IminothiolaneHCl that transferrins of handling through N-hydroxy-succinamide 3-(2-pyridine dithio base) propionic ester that step (a) is obtained and step (b) obtain is with mol ratio 1: (1-4) mix, thereby make transferrins and the coupling mutually of Rana ovum ribonuclease; With
(d) collecting molecular weight is the conjugate of 89-137kD.
4. the purposes of the described transferrin-frog-egg ribonuclease coupler of claim 1 is characterized in that, is used to prepare the compositions that suppresses tumor.
5. purposes as claimed in claim 4 is characterized in that, described tumor is the tumor of high expressed TfR.
6. a compositions that suppresses tumor is characterized in that, described compositions contains:
(i) the described transferrin-frog-egg ribonuclease coupler of the claim 1 of effective dose; With
(ii) pharmaceutically acceptable carrier.
7. the method for an external non-therapeutic ground inhibition growth of tumour cell is characterized in that, described method comprises utilizes the described transferrin-frog-egg ribonuclease coupler of claim 1 to handle tumor cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101718921A CN101450214B (en) | 2007-12-06 | 2007-12-06 | Transferrin-frog-egg ribonuclease coupler and production method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101718921A CN101450214B (en) | 2007-12-06 | 2007-12-06 | Transferrin-frog-egg ribonuclease coupler and production method and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101450214A CN101450214A (en) | 2009-06-10 |
| CN101450214B true CN101450214B (en) | 2011-10-26 |
Family
ID=40732811
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007101718921A Active CN101450214B (en) | 2007-12-06 | 2007-12-06 | Transferrin-frog-egg ribonuclease coupler and production method and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101450214B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107513107B (en) * | 2016-06-15 | 2022-03-15 | 上海南方模式生物科技股份有限公司 | Anti-tumor fusion protein and preparation method and application thereof |
| CN109942715A (en) * | 2019-04-02 | 2019-06-28 | 河南师范大学 | A kind of recombination fusion protein of targeting therapy on tumor and its preparation method and application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5529775A (en) * | 1988-04-06 | 1996-06-25 | Alfacell Corporation | Compositions comprising ONCONASE(™) and cisplatin, melphalan, or doxorubicin HCl |
| US20030099629A1 (en) * | 1999-03-11 | 2003-05-29 | Immunomedics, Inc. | Recombinant onconase and chemical conjugates and fusion proteins of recombinant onconase |
| CN1229498C (en) * | 1996-02-21 | 2005-11-30 | 美国国有卫生与人类服务部 | Recombinant ribonuclease proteins |
| CN1762489A (en) * | 2005-06-16 | 2006-04-26 | 广西医科大学 | Tf-SOD conjugate and its preparation process |
| CN1876682A (en) * | 2006-07-07 | 2006-12-13 | 广西医科大学 | Transferin (Tf)- nerve growth factor (NGF) conjugate preparation method |
-
2007
- 2007-12-06 CN CN2007101718921A patent/CN101450214B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5529775A (en) * | 1988-04-06 | 1996-06-25 | Alfacell Corporation | Compositions comprising ONCONASE(™) and cisplatin, melphalan, or doxorubicin HCl |
| CN1229498C (en) * | 1996-02-21 | 2005-11-30 | 美国国有卫生与人类服务部 | Recombinant ribonuclease proteins |
| US20030099629A1 (en) * | 1999-03-11 | 2003-05-29 | Immunomedics, Inc. | Recombinant onconase and chemical conjugates and fusion proteins of recombinant onconase |
| CN1762489A (en) * | 2005-06-16 | 2006-04-26 | 广西医科大学 | Tf-SOD conjugate and its preparation process |
| CN1876682A (en) * | 2006-07-07 | 2006-12-13 | 广西医科大学 | Transferin (Tf)- nerve growth factor (NGF) conjugate preparation method |
Non-Patent Citations (2)
| Title |
|---|
| 张桂红 等.牛蛙核糖核酸梅的表达和鉴定及功能检测.《肿瘤防治杂志》.2005,第12卷(第23期),1761-1763. * |
| 许国峰.核酸酶Onconase抗肿瘤研究.《中国优秀硕士学位论文数据库》.2004,6-8,18-22,32,43. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101450214A (en) | 2009-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11622998B2 (en) | Anti-inflammatory peptides and composition comprising the same | |
| Arnold et al. | Natural and engineered ribonucleases as potential cancer therapeutics | |
| TW565568B (en) | Compositions and methods for stimulating megakaryocyte growth and differentiation | |
| DK173560B1 (en) | Recombinant pseudomonas exotoxin comprising ADP ribosylating activity and lacking all or part of domain II from d | |
| CN106632682A (en) | Fusion protein IFN-ELP and application thereof | |
| Shin et al. | Recombinant TAT–gelonin fusion toxin: Synthesis and characterization of heparin/protamine‐regulated cell transduction | |
| JP2004528266A (en) | Composition for drug delivery | |
| DE69731463T2 (en) | RECOMBINANT RIBONUCLEASE PROTEINS | |
| KR20230017804A (en) | RHFGF21 fusion proteins, polynucleotides encoding RHFGF21 fusion proteins, compositions comprising RHFGF21 fusion proteins, and uses of RHFGF21 fusion proteins | |
| CN101450214B (en) | Transferrin-frog-egg ribonuclease coupler and production method and use thereof | |
| CN101003788A (en) | Anti tumor translocation peptide of scorpion, preparation method and application | |
| CN103805621A (en) | Novel preparation technology of targeting antitumor fusion protein LPO (lipid peroxidation) | |
| US20160222362A1 (en) | Target-Specific Double-Mutant Fusion Protein and Preparation Process Therefor | |
| CN102803500A (en) | Immunoregulatory peptides and methods of use | |
| US20030099629A1 (en) | Recombinant onconase and chemical conjugates and fusion proteins of recombinant onconase | |
| Cao et al. | Intracellular localization and sustained prodrug cell killing activity of TAT-HSVTK fusion protein in hepatocelullar carcinoma cells | |
| CN101613410B (en) | Rnase and toxalbumin membrane transposition structural domain fusion rotein and its production and use | |
| Ben-Yehudah et al. | Linker-based GnRH-PE chimeric proteins inhibit cancer growth in nude mice | |
| CN103865899B (en) | There is VEGFR 2the fusion toxin of/KDR receptor-specific and encoding gene thereof and application | |
| Ilinskaya et al. | Why ribonucleases induce tumor cell death | |
| Linardou et al. | Deoxyribonuclease I (DNase I) A novel approach for targeted cancer therapy | |
| DE69730967T2 (en) | HUMAN DNASE II | |
| CN107513107A (en) | Antineoplastic amalgamation protein and its preparation method and application | |
| CN100365022C (en) | Fusion toxin protein and uses thereof | |
| ES2241268T3 (en) | RECOMBINANT ONCONASE AND RECOMBINATING ONCONASE FUSION PROTEINS. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 201203 Shanghai city Pudong Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee after: Shanghai Lab. Animal Research Center Patentee after: Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd. Address before: 201203 Shanghai city Pudong Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee before: Shanghai Southern Biological Research Center Patentee before: Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd. |
|
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 201203 Shanghai city Pudong Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee after: Shanghai Lab. Animal Research Center Patentee after: Shanghai biomodel Polytron Technologies Inc Address before: 201203 Shanghai city Pudong Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee before: Shanghai Lab. Animal Research Center Patentee before: Shanghai Biomodel Organism Science & Technology Co.,Ltd. |