CN112386686A - Application of human sDR5-Fc recombinant fusion protein in preparation of acute kidney injury prevention and treatment drugs - Google Patents
Application of human sDR5-Fc recombinant fusion protein in preparation of acute kidney injury prevention and treatment drugs Download PDFInfo
- Publication number
- CN112386686A CN112386686A CN201910750670.8A CN201910750670A CN112386686A CN 112386686 A CN112386686 A CN 112386686A CN 201910750670 A CN201910750670 A CN 201910750670A CN 112386686 A CN112386686 A CN 112386686A
- Authority
- CN
- China
- Prior art keywords
- fusion protein
- sdr5
- seq
- pro
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/1793—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- General Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an application of a human sDR5-Fc recombinant fusion protein in preparing a medicament for preventing and treating acute kidney injury, wherein a nucleotide sequence of an encoded sDR5-Fc recombinant fusion protein has the following characteristics: a) SEQ ID NO: 1 in the sequence listing; or b) a sequence that is identical to SEQ ID NO: 1; or c) a sequence which encodes a protein of the same sequence as the nucleotide sequence of a or b but which differs from the nucleotide sequence of a or b due to the degeneracy of the genetic code; or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2 or the amino acid sequence is shown as SEQ ID NO: 2, and one or more amino acids are substituted, but the biological activity of the sDR5-Fc recombinant fusion protein is not changed; or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. or SEQ ID NO: and 6.
Description
Technical Field
The invention relates to a recombinant protein, in particular to an application of a human sDR5-Fc recombinant fusion protein in preparing a medicament for preventing and treating acute kidney injury.
Background
Acute renal injury (AKI), formerly known as Acute Renal Failure (ARF), is a clinical syndrome that occurs as a result of rapid decline in renal function due to a variety of etiologies. It can occur in patients without kidney disease or based on chronic kidney disease. Compared with ARF, the AKI is proposed to emphasize the importance of early diagnosis and early treatment of the syndrome.
Acute Kidney Injury (AKI) is a clinical syndrome characterized by an acute decline in glomerular filtration rate, and can significantly increase the number of hospitalizations, medical costs, mortality, and other adverse outcomes of patients. In recent years, as the population ages and complications (comorbidity) increase, the incidence of acute renal injury continues to increase, and the disease complexity, hospital stay, and medical expense greatly increase. Large-scale research consistently shows that once acute kidney injury of a severe patient is serious and needs kidney replacement therapy, the death rate of the patient is often up to 50%, the survival patient is combined with chronic kidney diseases, 14% -29% of the patients need to receive long-term kidney replacement therapy, the treatment effect is not ideal at present, and the death rate is still up to 15% -60%. Increasing the prevention and treatment level of AKI is a medical problem that needs to be solved urgently.
The main pathological features of Acute Kidney Injury (AKI) include inflammatory cell infiltration, inflammatory cytokine production, apoptosis, necrosis, and the like. Although relevant studies have made great progress, the pathophysiological mechanisms of AKI remain unclear.
Several common acute kidney injury AKI-inducing factors and pathogenesis are as follows: 1: ischemia reperfusion, ischemia reperfusion injury is the result of injury caused by multiple factors acting together on renal tubular epithelial cells and renal microvasculature. The pathogenesis of AKI is currently recognized as vasoconstriction, oxidative stress, apoptosis and inflammatory stimuli, and ischemia reperfusion injury. 2: AKI can be caused by various operations (such as heart operation, obesity treatment operation, etc.), and particularly, the occurrence of AKI after coronary artery bypass bridging is a common and serious complicationAnd (4) symptoms. AKI caused by operation is mainly prerenal injury, and the pathogenesis of the AKI mainly comprises that the blood flow of kidney is reduced to stimulate renal vasoconstriction, so that endothelial cells are swelled, the adventitia of arteriole between lobules and the adventitia of arteriole entering a sphere is thickened and fibrosis, the activity of vasoconstriction factors such as renin, adenosine, thromboxane, endothelin and the like is increased, and the renal epithelial cells are apoptotic. In addition, during extracorporeal circulation, the contact between blood and the surface of the artificial material in blood vessel, the stress of surgical wound, the activation of neutrophil, endothelial damage and blood coagulation can stimulate body to produce inflammation medium, induce systemic inflammation reaction and speed kidney damage. 3: rhabdomyolysis refers to the destruction of the integrity of the cell membrane of the rhabdomyoid muscle by various factors, and the leakage of the contents into and out of blood, including myoglobin, aldolase, small molecular substances and the like, when the rhabdomyolysis occurs, the AKI pathology is acute tubular necrosis, and the occurrence mechanism comprises tubular obstruction, tubular oxide injury and renal epithelial cell apoptosis. 4: contrast agents, with the widespread use of coronary angiography and percutaneous coronary intervention, are used more frequently and AKI caused by contrast agents is also increased. AKI caused by contrast agents is called contrast nephropathy. Although the pathogenesis of contrast-mediated nephropathy is unclear, there is increasing evidence that its pathogenesis is related to a combination of factors such as renal tubular acidosis, oxidative stress, ischemic injury, apoptosis, and tubular obstruction. 5: drugs, renal injury leads to high filtration and metabolic activity, and most drugs, especially hydrophilic drugs and their metabolites, are excreted through the kidney. This increases the risk of drug-mediated nephrotoxicity. Acute drug-induced renal injury is on the rise in recent years, and at present, most of the drugs are analgesics, gout drugs, aminoglycosides, contrast agents, traditional Chinese medicines and the like, and is also a major risk factor for developing renal diseases. Drug-induced nephrotoxicity accounted for 20% of hospitalized AK patients. Its manifestations include abnormalities in acid and base, electrolyte imbalance, abnormal urine deposits, proteinuria, hematuria, purulent urine, most commonly a decrease in Glomerular Filtration Rate (GFR). The nephrotoxicity caused by the medicine can cause hemodynamic change, glomerular diseases and interstitial nephritis, and the cytotoxicity can directly cause renal tubular cell apoptosis. 6: infection, various kinds of diseases in lifeInfections are common, such as bacteria, viruses, parasites, and fungi. Severe infection can lead to sepsis, sepsis.
Patients with sepsis and septic shock develop AKI. The pathogenesis of AKI as a result of infection is complex, where infection stimulates the body to release inflammatory mediators (e.g., interleukin 1, interleukin 6, tumor necrosis factor), abnormally increases platelets, microvascular thrombosis, and inflammation drives platelets to activate neutrophils, thus exacerbating the inflammatory response.
The existing acute kidney injury treatment modes include the following modes: 1: renal replacement therapy for AKI; 2: carrying out dilatation treatment; 3: performing ischemic pretreatment; 4: and (4) performing drug treatment. The drug therapy is as follows, 1: a diuretic; 2: a booster; 3: a vasodilator; 4: a sedative; 5: metabolic intervention; 6: a statin drug. Therefore, the types and curative effects of the existing medicines for treating acute kidney injury are limited, and the medicines are mainly used for symptomatic treatment, so that the development of new therapeutic medicines is urgently needed.
The analysis results of evidence-based medicine show that there is no effective treatment for acute renal injury, and clinicians can only treat the recovery or deterioration of renal function except for maintaining blood pressure and renal perfusion by infusion and avoiding the use of nephrotoxic drugs. The use of diuretics, while potentially increasing urine output, does not alter the course of acute kidney injury and patient prognosis, and may even increase mortality due to delayed dialysis treatment. Timing of infusion replenishment depends on accurate assessment of the fluid volume status of the patient, as fluid overload also increases patient mortality. And all the used medicines are symptomatic treatment, and the fundamental problem of renal tubular epithelial cell apoptosis cannot be solved from the etiology.
The renal tubular epithelial cells can be damaged and even die when suffering from long-term ischemic hypoxia, nephrotoxic drugs, inflammatory reaction and other pathogenic factors. Studies indicate the presence of tubular epithelial apoptosis in AKI. Apoptosis of renal tubular epithelial cells occurs in AKI caused by either ischemia reperfusion injury, nephrotoxic drug action, or sepsis. When renal tubular epithelial cell apoptosis occurs, mitochondrial outer membrane is damaged, apoptosis is induced by high expression of genes for regulating apoptosis signal molecules TNF-alpha, Bax, caspase and the like of mitochondria to induce apoptosis, DNA chain breakage and degradation caused by calcium overload and renal tissue cell functional damage are induced, lipid peroxidation of mitochondrial inner membrane is caused by short-term explosion of ROS, so that mitochondrial inner membrane permeability is increased and membrane potential is reduced, apoptosis inducing factors are released to directly or indirectly induce apoptosis, and meanwhile, inflammatory factors and adhesion factors can further intensify the occurrence of apoptosis. Thus, the occurrence of apoptosis during acute kidney injury exacerbates the functional acute injury of kidney tissue. AKI caused by various causes can be alleviated by inhibiting apoptosis. In the course of acute kidney injury, whatever the pathogenic mechanism, apoptosis of cells must eventually be involved. Death Receptor 5(Death Receptor 5, DR5) is a member of the Tumor Necrosis Factor (TNF) Receptor family, distributed in a variety of normal tissues including the small intestine, heart, lung, liver, skeletal muscle, and kidney; high expression levels in activated peripheral blood lymphocytes, heart, spleen, pancreas, inflammatory tissue, ischemic tissue and some tumor cells. DR5 causes a series of signal cascades after being combined with TRAIL, Caspase-8 is activated, and Caspase-8 triggers cell apoptosis through a non-mitochondria-dependent pathway and a mitochondria-dependent pathway. The human DR5 protein consists of 411 amino acids, with the N-terminal located extracellularly and the C-terminal located intracellularly, with only one transmembrane. Belongs to I type transmembrane protein, wherein 1-55 amino acids are signal peptide, 84-179 amino acids are chain-shaped binding regions containing 2 cysteine-rich repetitive functional regions, 184-206 amino acids are transmembrane regions, and the intracellular region contains a death domain. Soluble DR5(soluble DR5, sDR5) is a soluble form of DR5 without a transmembrane region, and is secreted extracellularly due to the absence of the transmembrane region, which cannot be localized to the cell membrane. sDR5 retains the activity of binding TRAIL ligand, but cannot transmit apoptosis signals to cells, and can block TRAIL-DR 5-mediated apoptosis reaction.
The sDR5-Fc fusion protein is combined with TRAIL molecules, and the combination of endogenous TRAIL and DR5 can be blocked by neutralizing the TRAIL, so that the effect of delaying the apoptosis of renal tubular epithelial cells is achieved, the residual renal tissue with vitality and reversible damage of renal injury is saved, and the treatment time window is prolonged. And the sDR5 is a human body self protein and has the advantages of small toxicity and no immunogenicity, so that the sDR5-Fc fusion protein drug is used as a brand-new target spot for treating acute kidney injury, has clear and novel action mechanism and unique action effect, makes up for the short plate of the current drug, has obvious curative effect and high safety, and has great development potential.
The invention relates to a medicinal use of a human soluble death receptor 5 (sDR5-Fc antibody fusion protein (sDR5-Fc)) and particularly relates to an application of a human sDR5-Fc antibody fusion protein as a medicine for treating acute kidney injury. Experiments prove that the human sDR5-Fc antibody fusion protein has weakened damage after being used in a mouse acute kidney injury model, and improves kidney pathological injury. The invention is used as a novel candidate drug for treating acute kidney injury, has specific and rapid action, obvious curative effect and high safety, and has great development potential.
Disclosure of Invention
In order to solve the problems in the background art, the invention aims to provide an application of a human sDR5-Fc recombinant fusion protein, wherein the sDR5-Fc recombinant fusion protein has high biological activity and good stability.
The specific technical scheme is as follows:
the application of the human sDR5-Fc recombinant fusion protein in preparing the medicine for preventing and treating acute kidney injury, wherein the nucleotide sequence for coding the sDR5-Fc recombinant fusion protein has the following steps: a) SEQ ID NO: 1 in the sequence listing; or b) a sequence that is identical to SEQ ID NO: 1; or c) a sequence which encodes a protein of the same sequence as the nucleotide sequence of a or b but which differs from the nucleotide sequence of a or b due to the degeneracy of the genetic code;
or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2 or the amino acid sequence is shown as SEQ ID NO: 2, and one or more amino acids are substituted, but the biological activity of the sDR5-Fc recombinant fusion protein is not changed;
or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. or SEQ ID NO: and 6.
Wherein the degeneracy of the genetic code: it means that most of two bases in several triplet genetic codes for encoding the same amino acid are the same, but the third base is different, for example, ACU, ACC, ACA and ACG are threonine codons, UGU, UGC, UGA and UGG are valine codons, so that if the third base of the codon has point mutation, the translated amino acid species is not influenced.
Further, the nucleotide sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 1 in the sequence listing; the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2, respectively.
Further, the application of the human sDR5-Fc recombinant fusion protein in preparing a medicament for preventing and treating acute kidney injury induced by ischemia-reperfusion (I/R).
Further, the application of the human sDR5-Fc recombinant fusion protein in preparing a medicament for preventing and treating acute kidney injury induced by surgery.
Further, the application of the human sDR5-Fc recombinant fusion protein in preparing a medicament for preventing and treating rhabdomyolysis-induced acute kidney injury.
Further, the application of the human sDR5-Fc recombinant fusion protein in preparing a medicament for preventing and treating contrast agent-induced acute kidney injury.
Further, the application of the human sDR5-Fc recombinant fusion protein in preparing a medicament for preventing and treating medicament-induced acute kidney injury.
Further, the application of the human sDR5-Fc recombinant fusion protein in preparing a medicament for preventing and treating acute kidney injury induced by infection.
Further, the protein sequence, sequence modification and related bioengineering products of the human sDR5-Fc antibody fusion protein are applied to the preparation of the medicine for treating acute kidney injury.
The application of the human sDR5-Fc recombinant fusion protein and the nucleotide sequence in preparing the medicine for preventing and treating acute kidney injury comprises any route capable of achieving a treatment effect, such as subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection, transdermal administration and the like, wherein the administration dose depends on the severity of diseases, the age, the weight, the administration mode and the administration frequency of a patient.
The invention also aims to provide a pharmaceutical composition for preventing and treating acute kidney injury.
The specific technical scheme is as follows:
a pharmaceutical composition for preventing and treating acute kidney injury comprises an active ingredient of an sDR5-Fc recombinant fusion protein, wherein the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2 or the amino acid sequence is shown as SEQ ID NO: 2, and one or more amino acids are substituted, but the biological activity of the sDR5-Fc recombinant fusion protein is not changed; or the amino acid sequence is shown as SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. or SEQ ID NO: and 6.
In some of these embodiments, the pharmaceutical composition is in the form of an injection.
The invention has the beneficial effects that: (1) the human sDR5-Fc recombinant fusion protein has clear and novel action mechanism, unique action effect, obvious curative effect and high safety. (2) Most of the existing medicines for treating acute kidney injury relieve kidney injury, and the existing medicines for treating acute kidney injury are very limited and far from meeting the requirements of patients. In addition, many of the drugs for treating acute kidney injury have undefined action mechanism, poor curative effect and many side effects. The sDR5-Fc antibody fusion protein can block a core signal path of apoptosis, and a TRAIL-DR5 apoptosis signal path is widely existed in acute kidney injury caused by various factors, so that the human sDR5-Fc antibody fusion protein has wide application in treating acute kidney injury. Meanwhile, the human sDR5-Fc antibody fusion protein is derived from the protein of the human body, and the metabolite is amino acid, so the safety is better than other therapeutic drugs, and the fusion protein can be safely combined with other therapeutic drugs, thereby enhancing the curative effect and promoting the rehabilitation. Therefore, the human sDR5-Fc antibody fusion protein has wide application prospect in the field of acute kidney injury. (3) The sDR5-Fc protein has a therapeutic effect in various acute kidney injury models, and the kidney injury is reduced after treatment.
Drawings
FIG. 1 is a gene agarose gel electrophoresis of sDR 5-Fc;
FIG. 2 is a DR5-Fc recombinant fusion protein (ZJ501-5) Dot Blot assay;
FIG. 3 is a non-reducing electrophoresis image of 8% SDS-PAGE;
FIG. 4 is a SEC-HPLC analysis chart after purification of ZJ 501-5;
FIG. 5 is a TIC graph of ZJ501-5 after reduction;
FIG. 6 is a mass spectrum of data from ZJ501-5 after treatment with Biopharmalynx software;
FIG. 7 is a standard curve for the detection of commercial Trail killing activity;
FIG. 8 is a standard curve for biological detection of a commercial DR5-Fc fusion protein;
FIG. 9 is a ZJ501-5 standard curve for bioactivity detection;
FIG. 10 is a graph showing the results of blocking TRAIL-induced hepatocyte apoptosis by the human sDR5-Fc recombinant fusion protein in example 4; wherein: a is the result of apoptosis of HepG2 cells induced by TRAIL with different concentrations; b is the result of different concentrations of human sDR5-Fc recombinant fusion protein blocking TRAIL to induce HepG2 apoptosis; c is the morphology of TRAIL-induced apoptotic HepG2 cells; d is a HepG2 cell morphology diagram of the human sDR5-Fc recombinant fusion protein for blocking TRAIL-induced apoptosis;
FIG. 11 is a graph showing the results of the survival rate of human sDR5-Fc antibody fusion protein in example 5 for acute renal injury of the ischemia-reperfusion (I/R) type;
FIG. 12 is a graph showing the results of IL-6 detection of the inflammatory factor TNF-a in serum induced by the human sDR5-Fc antibody fusion protein in acute kidney injury treated with the drug of example 6;
FIG. 13 is a graph showing the results of IL-6 assay of the human sDR5-Fc antibody fusion protein in example 7 in the treatment of the inflammatory factor TNF-a in serum of acute renal injury with sepsis syndrome.
Detailed Description
The present invention is further illustrated by the following examples, but the scope of the present invention is not limited thereto.
The sDR5-Fc protein produced by the company is used in the invention.
Example 1: design and recombination of recombinant human DR5-Fc expression sequence
After long-term experience accumulation, the inventor constructs a recombinant fusion protein, carries out fusion of human DR5 and Fc in various ways, and mass spectrometry results show that most target proteins are sheared by 11 amino acids at the N end (ITQQDLAPQQR), and finally screens out a common signal peptide of the fusion protein to remove an intermediate connecting sequence and 18 amino acids at the N end, namely sDR5-Fc (ZJ 501-5). The plasmid was transiently transfected, and the expression supernatant was purified for mass spectrometry and activity analysis.
DNA sequence of ZJ 501-5:
atgggtgtactgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagcatgtccagcccctcagagggattgtgtccacctggacaccatatctcagaagacggtagagattgcatctcctgcaaatatggacaggactatagcactcactggaatgacctccttttctgcttgcgctgcaccaggtgtgattcaggtgaagtggagctaagtccctgcaccacgaccagaaacacagtgtgtcagtgcgaagaaggcaccttccgggaagaagattctcctgagatgtgccggaagtgccgcacagggtgtcccagagggatggtcaaggtcggtgattgtacaccctggagtgacatcgaatgtgtccacaaagaagagcccaaatcttgtgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga(SEQ ID NO.1)
amino acid sequence of ZJ 501-5:
MGVLLTQRTLLSLVLALLFPSMASMSSPSEGLCPPGHHISEDGRDCISCKYGQDYSTHWNDLLFCLRCTRCDSGEVELSPCTTTRNTVCQCEEGTFREEDSPEMCRKCRTGCPRGMVKVGDCTPWSDIECVHKEEPKSCDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK(SEQ ID NO.2)
the gene sequence of sDR5-Fc (ZJ501-5) is connected to pL101 eukaryotic expression vector by conventional technical means such as enzyme digestion and connection, and is identified by Hind3 and EcoR1 double enzyme digestion. The agarose gel electrophoresis shows that the target fragment of about 1300bp and the pL101 vector fragment of about 9kb can be seen, the double digestion verification result is shown in figure 1 after the vector is constructed.
Example 2: expression and physicochemical property detection of human sDR5-Fc recombinant protein
CHO.K1 cells were transiently transfected with sDR5-Fc/pL101 plasmid using Lipofectamine2000, and 48 hours later, the supernatant was collected for Dot Blot detection, which was positive, as shown in FIG. 2.
Recovery of CHO. K1-S cells at 5X 105Resuspending at 10 ml/ml, followed by FreeStyleTMCHO Expression Medium serum-free Medium, adding Glutamine with final concentration of 8mmol/L, culturing at 37 deg.C under 8% CO2The cultivation was carried out by shaking the incubator at 120 rpm. When the number of cells is>1×106Passaging at/ml, adding liquid to 30ml, maintaining cell number 2-5 × 105/ml, for each subsequent passage and maintaining the density to 2-5X 105K1-S, CHO, three passages or more.
One day before transfection, cell density was adjusted to 5-6X 10 after shake flask counting5100 ml/ml, placed at 37 ℃ in 8% CO2The cells were cultured in a shaking incubator at 120rpm, and transfection was carried out the next day.
CHO.K1-S is counted and the activity rate is calculated on the same day of transfection, and the density should be 1.2-1.5X 106Per ml, rate of activity>95 percent. Adjusting the density to 1 × 10630 ml/portion was added to a 100ml shake flask for further use.
Mix FreeStyle by gentle inversionTMMAX Reagent four times, 37.5ul FreeStyle is takenTMMAX Reagent 0.6ml OPTIpro was addedTMTo the SFM dilution, 0.6ml of OPTIpro was added simultaneously to 37.5ug of plasmidTMMixing the two solutions in SFM diluent, and standing at room temperature for 10-20 min.
The incubated mixture was added to the prepared CHO. K1-S cell shake flask, incubated at 37 ℃ for 7 days in 8% CO2 shaking incubator 120rpm, and the product was purified by affinity column and subjected to SDS-PAGE, SEC-HPLC and mass spectrometry.
A mass spectrometry step:
1. firstly, putting the sample replacement buffer solution into 50mM NH4FA (pH6.6), and detecting the concentration of the sample replacement buffer solution;
2. carrying out enzyme digestion on each sample by using Ides;
3. adding DTT to reduce disulfide bonds;
4. and (4) carrying out mass spectrum sample injection analysis.
See SDS-PAGE (FIG. 3), SEC-HPLC after purification of ZJ501-5 (FIG. 4) (protein purity 99.47%), and TIC after reduction of ZJ501-5 (FIG. 5) and mass spectra of ZJ501-5 data after treatment with Biopharmalynx software (FIG. 6). The ratio of N-terminal cleavages was analyzed according to FIGS. 5 and 6, see the following table, where M (O) indicates that one more methionine was added to the N-terminus of the corresponding protein and oxidized, and S-S indicates that disulfide bonds were formed. O represents the first amino acid oxidized. And the results of subtracting one amino acid from the N-terminal and subtracting two amino acids from the N-terminal are obtained by analyzing after the data are imported into the database in the graph of 5 and 6.
The ratio of N-terminal shear bodies is shown in the table
The results showed that ZJ501-5 was 99% pure, and only a slight amount of N-terminally cleaved one amino acid and two amino acid variants appeared, in a proportion of 1.11%, with only about 0.11% of the N-terminally cleaved two amino acid variants present.
ZJ501-5 is a target protein with uniform N-terminal obtained by removing an unstable sequence at the N-terminal on the basis of proteins ZJ501-1, ZJ501-2, ZJ501-3 and ZJ 501-4. The N-terminal cleavant ratios of the ZJ501-1, ZJ501-2, ZJ501-3, ZJ501-4, and ZJ501-5 proteins are shown in the following table.
| Sample name | Temperature of | N-terminal cutter% |
| ZJ501-1 | 37℃ | 31.35 |
| ZJ501-2 | 37℃ | 34.72 |
| ZJ501-3 | 37℃ | 48.69 |
| ZJ501-4 | 37℃ | 51.66 |
| ZJ501-5 | 37℃ | 1.11 |
As can be seen from the above, the ZJ501-5 protein has the highest drug stability.
The sequences of the proteins ZJ501-1, ZJ501-2, ZJ501-3 and ZJ501-4 are as follows:
ZJ501-1
MEQRGQNAPAASGARKRHGPGPREARGARPGPRVPKTLVLVVAAVLLLVSAESALITQQDLAPQQRAAPQQKRSSPSEGLCPPGHHISEDGRDCISCKYGQDYSTHWNDLLFCLRCTRCDSGEVELSPCTTTRNTVCQCEEGTFREEDSPEMCRKCRTGCPRGMVKVGDCTPWSDIECVHKEGSSNTKVDKKVEPKSCDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK(SEQ ID NO.3)
ZJ501-2
MEQRGQNAPAASGARKRHGPGPREARGARPGPRVPKTLVLVVAAVLLLVSAESALITQQDLAPQQRAAPQQKRSSPSEGLCPPGHHISEDGRDCISCKYGQDYSTHWNDLLFCLRCTRCDSGEVELSPCTTTRNTVCQCEEGTFREEDSPEMCRKCRTGCPRGMVKVGDCTPWSDIECVHKEEPKSCDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK(SEQ ID NO.4)
ZJ501-3
MGVLLTQRTLLSLVLALLFPSMASMITQQDLAPQQRAAPQQKRSSPSEGLCPPGHHISEDGRDCISCKYGQDYSTHWNDLLFCLRCTRCDSGEVELSPCTTTRNTVCQCEEGTFREEDSPEMCRKCRTGCPRGMVKVGDCTPWSDIECVHKEEPKSCDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK(SEQ ID NO.5)
ZJ501-4 amino acid sequence (Signal peptide-target sequence)
MGVLLTQRTLLSLVLALLFPSMASMAAPQQKRSSPSEGLCPPGHHISEDGRDCISCKYGQDYSTHWNDLLFCLRCTRCDSGEVELSPCTTTRNTVCQCEEGTFREEDSPEMCRKCRTGCPRGMVKVGDCTPWSDIECVHKEEPKSCDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK(SEQ ID NO.6)。
Example 3: characterization of biological Activity of ZJ501-5
(1) Detection method for establishing commercialized Trail killing activity
Collecting Jurkat cells in logarithmic growth phase, counting, re-suspending cells with 10% FCS RPMI-1640/DMEM, and adjusting cell density to 8 x 104/ml, 100 ul/well into 96-well cell culture plate, and placing at 37 deg.C and 8%Culturing in carbon dioxide incubator for 20-24 hr.
Commercial Trail was resuspended at a final concentration of 500-. The diluted sample was added to a 96-well cell culture plate at 100 ul/well and placed in an incubator for 18-22 hours. Adding 20 ul/well of a freshly prepared 20:1 mixed MTS/PMS chromogenic solution, continuously incubating and culturing for 3-4 hours in an incubator, and detecting the A490-A630 value of the solution by using a microplate reader.
Standard curves were fitted using M5 analytical software: the abscissa is the concentration of the sample, the ordinate is A490-A630, A4-parameter equation regression model is selected, and the curve is in an inverse S shape. The software automatically calculated EC50 at 8.382ng/ml and EC90 at 27.65 ng/ml.
(see fig. 7).
(2) Method for establishing commercial DR5-Fc fusion protein biological activity detection
Collecting Jurkat cells in logarithmic growth phase, counting, re-suspending cells with 10% FCS RPMI-1640/DMEM, and adjusting cell density to 8 x 104Perml, 100 ul/well into 96-well cell culture plate, and culturing in 8% carbon dioxide incubator at 37 deg.C for 20-24 hr.
EC90 for commercial Trail killing activity was calculated by adding Trail to the complete culture broth containing actinomycin D (final concentration 0.03ug/ml) at a final concentration of EC90, and diluting commercial DR5-Fc (R & D systems) at a multiple ratio of 10ng/ml to 15 concentrations with the complete culture broth containing actinomycin D and Trail of EC 90. The diluted sample was added to a 96-well cell culture plate at 100 ul/well and placed in culture medium for 18-22 hours.
20ul of freshly prepared 20:1 mixed MTS/PMS chromogenic solution was added per well and incubation continued for 3-4 hours in the incubator. The A490-A630 value is detected by a microplate reader.
Results of bioactivity test of commercial DR5-Fc fusion protein (R & D systems Co.): standard curves were fitted using M5 analytical software: the abscissa is the concentration of the sample, the ordinate is A490-A630, A4-parameter equation regression model is selected, and the curve is in a positive "S" shape. Three different experiments were performed to compare the variation of EC 50. EC50 was 71.82 ng/ml. See fig. 8.
(3) Method for detecting biological activity and relative activity of ZJ501-5
The procedure was as in (2), with the sample ZJ501-5(SEQ ID NO.2) and the reference sample commercially available as DR5-Fc (R & D systems). Experiments were performed in triplicate for two different operators, and the relative biological activity (%) calculated for each experiment ZJ501-5 was commercial DR5-Fc EC 50/sample DR5-Fc EC50 x 100. The variation between different operators and experimental batches was compared.
The invention relates to a ZJ501-5 biological activity detection and relative activity result: the average of ZJ501-5 EC50 was 20.25ng/ml, the average of the commercial DR5-Fc EC50 was 71.82ng/ml, and the relative biological activity of ZJ501-5 was 355%, (see FIG. 9).
Example 4: sDR5-Fc blockade of TRAIL-induced hepatocyte apoptosis
The procedure was as in (1) and (2) of example 3, the target cells were HepG2 cells, the sample was ZJ501-5(SEQ ID NO.2), and the reference was commercially available DR5-Fc (R & D systems).
It was found experimentally (see fig. 10) that the human sDR5-Fc recombinant fusion protein was able to efficiently block TRAIL-induced hepatocyte apoptosis and that the biological activity of ZJ501-5 (EC50 ═ 5.7ng/ml) was nearly 5-fold higher than that of rdl sDR5-Fc protein (EC50 ═ 27.6ng/ml) in HepG2 cells.
Example 5: treatment of acute renal injury of the ischemia-reperfusion (I/R) type by human sDR5-Fc antibody fusion protein
32 male rats with the weight of 180-220 g and SPF Wistar rats are randomly divided into a group A, a group B, a group C and a group D, and each group comprises 8 rats. Group A is a model group, 10% chloral hydrate is applied for abdominal cavity injection anesthesia, the abdominal cavity is opened along the leucorrhea line between the xiphoid process and the pubic symphysis, the kidney is found, the bilateral renal artery is clamped by a non-invasive artery clamp for 45min, then the clamp is removed, the perfusion is recovered, the abdominal cavity is closed, after 1 hour of reperfusion, the tail vein is injected with 10ml/kg of normal saline, and the feeding is carried out quietly; the modeling procedures of groups B, C and D were the same as those of group A, and 3mg/kg, 9mg/kg and 27mg/kg of SDR5-Fc (ZJ501-5 of the present invention) were administered to groups B, C and D, respectively, after 1 hour of reperfusion. After each group is operated for 24 hours, the submaxillary vein is used for blood collection, the blood is centrifuged for 10min at the temperature of 4 ℃ at 3000r/min, and serum is stored in a refrigerator with the temperature of 80 ℃ below zero for standby. Serological detection: serum creatinine and urea nitrogen, results are shown in table 1. The survival rate of rats was counted, and the results are shown in FIG. 11.
TABLE 1 variation of serum creatinine/urea nitrogen (Cr/BUN) levels (x. + -.s) in rats
Experimental findings (see fig. 11 and table 1): after the kidney ischemia reperfusion injury operation, the urea nitrogen and creatinine of a rat are remarkably increased and the death rate is remarkably reduced after the human sDR5-Fc antibody fusion protein is administered, wherein the effect of the sDR5-Fc with the dosage of 9mg/kg is most remarkable. The human sDR5-Fc antibody fusion protein was shown to be able to reduce kidney injury.
Example 6: human sDR5-Fc antibody fusion protein for treating drug-induced acute kidney injury
24 male, 6-8 weeks, 18-22g SPF BALB/C mice were acclimatized for one week after purchase, and each mouse was injected intraperitoneally with cisplatin at a dose of 20mg/kg for 3 consecutive days. After establishing the AKI model for 1 week, the AKI model was randomly divided into four groups of 6 individuals, each group A was a model group, and each of groups B, C and D was a treatment group, in which 3mg/kg, 9mg/kg and 27mg/kg of tail vein injection sDR5-Fc (ZJ501-5 of the present invention) were administered. Collecting blood from submaxillary vein after 24 hr, centrifuging at 3000r/min and 4 deg.C for 10min, and storing serum in-80 deg.C refrigerator. Sample treatment: serological detection: serum creatinine and urea nitrogen, results are shown in Table 2, and results are shown in FIG. 12, in which serum inflammatory factors TNF-a and IL-6 are detected.
TABLE 2 comparison of creatinine (Cr) and urea nitrogen (BUN) levels (x. + -.s) between groups of mice
Experimental findings (see fig. 12 and table 2): compared with the group A, the blood creatinine and urea nitrogen levels of the groups B, C and D are obviously increased, the kidney injury is reduced (P is less than 0.05), the concentrations of TNF-a and IL-6 in serum are obviously reduced, and the inflammation is reduced (P is less than 0.05).
Example 7: treatment of sepsis type acute kidney injury with human sDR5-Fc antibody fusion protein
Male, SPF grade, 6-8 weeks, 18-22g, C57BL/6 mice 24, divided into 4 groups, 6 per group, 4 groups intraperitoneally injected with 20mg/kg LPS, randomly divided into four groups, group a as model group, group B, C, D as treatment group and tail vein injection sDR5-Fc (invention ZJ501-5)3mg/kg, 9mg/kg and 27mg/kg, respectively. Collecting blood from submaxillary vein after 24 hr, centrifuging at 3000r/min and 4 deg.C for 10min, and storing serum in-80 deg.C refrigerator. Serological detection: the results of the measurement of the blood creatinine and urea nitrogen contents are shown in Table 3, and the results of the measurement of the concentrations of the inflammatory factors TNF-a and IL-6 are shown in FIG. 13.
TABLE 3 comparison of creatinine and urea nitrogen levels (x. + -.s) between groups of mice
Experimental findings (see fig. 13 and table 3): compared with the group A, the blood creatinine and urea nitrogen levels of the groups B, C and D are obviously increased, the kidney injury is reduced (P is less than 0.05), the concentrations of TNF-a and IL-6 in serum are obviously reduced, and the inflammation is reduced. (P < 0.05).
SEQUENCE LISTING
<110> Shenzhen Zhongke Aishen medicine Limited
Application of <120> human sDR5-Fc recombinant fusion protein in preparation of medicine for preventing and treating acute kidney injury
<130> CP11901854C
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 1101
<212> DNA
<213> Artificial sequence
<400> 1
atgggtgtac tgctcacaca gaggacgctg ctcagtctgg tccttgcact cctgtttcca 60
agcatggcga gcatgtccag cccctcagag ggattgtgtc cacctggaca ccatatctca 120
gaagacggta gagattgcat ctcctgcaaa tatggacagg actatagcac tcactggaat 180
gacctccttt tctgcttgcg ctgcaccagg tgtgattcag gtgaagtgga gctaagtccc 240
tgcaccacga ccagaaacac agtgtgtcag tgcgaagaag gcaccttccg ggaagaagat 300
tctcctgaga tgtgccggaa gtgccgcaca gggtgtccca gagggatggt caaggtcggt 360
gattgtacac cctggagtga catcgaatgt gtccacaaag aagagcccaa atcttgtgac 420
aaaactcaca catgcccacc gtgcccagca cctgaactcc tggggggacc gtcagtcttc 480
ctcttccccc caaaacccaa ggacaccctc atgatctccc ggacccctga ggtcacatgc 540
gtggtggtgg acgtgagcca cgaagaccct gaggtcaagt tcaactggta cgtggacggc 600
gtggaggtgc ataatgccaa gacaaagccg cgggaggagc agtacaacag cacgtaccgt 660
gtggtcagcg tcctcaccgt cctgcaccag gactggctga atggcaagga gtacaagtgc 720
aaggtctcca acaaagccct cccagccccc atcgagaaaa ccatctccaa agccaaaggg 780
cagccccgag aaccacaggt gtacaccctg cccccatccc gggatgagct gaccaagaac 840
caggtcagcc tgacctgcct ggtcaaaggc ttctatccca gcgacatcgc cgtggagtgg 900
gagagcaatg ggcagccgga gaacaactac aagaccacgc ctcccgtgct ggactccgac 960
ggctccttct tcctctacag caagctcacc gtggacaaga gcaggtggca gcaggggaac 1020
gtcttctcat gctccgtgat gcatgaggct ctgcacaacc actacacgca gaagagcctc 1080
tccctgtctc cgggtaaatg a 1101
<210> 2
<211> 366
<212> PRT
<213> Artificial sequence
<400> 2
Met Gly Val Leu Leu Thr Gln Arg Thr Leu Leu Ser Leu Val Leu Ala
1 5 10 15
Leu Leu Phe Pro Ser Met Ala Ser Met Ser Ser Pro Ser Glu Gly Leu
20 25 30
Cys Pro Pro Gly His His Ile Ser Glu Asp Gly Arg Asp Cys Ile Ser
35 40 45
Cys Lys Tyr Gly Gln Asp Tyr Ser Thr His Trp Asn Asp Leu Leu Phe
50 55 60
Cys Leu Arg Cys Thr Arg Cys Asp Ser Gly Glu Val Glu Leu Ser Pro
65 70 75 80
Cys Thr Thr Thr Arg Asn Thr Val Cys Gln Cys Glu Glu Gly Thr Phe
85 90 95
Arg Glu Glu Asp Ser Pro Glu Met Cys Arg Lys Cys Arg Thr Gly Cys
100 105 110
Pro Arg Gly Met Val Lys Val Gly Asp Cys Thr Pro Trp Ser Asp Ile
115 120 125
Glu Cys Val His Lys Glu Glu Pro Lys Ser Cys Asp Lys Thr His Thr
130 135 140
Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe
145 150 155 160
Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro
165 170 175
Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val
180 185 190
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr
195 200 205
Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val
210 215 220
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys
225 230 235 240
Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser
245 250 255
Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro
260 265 270
Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val
275 280 285
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly
290 295 300
Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp
305 310 315 320
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp
325 330 335
Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His
340 345 350
Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys
355 360 365
<210> 3
<211> 425
<212> PRT
<213> Artificial sequence
<400> 3
Met Glu Gln Arg Gly Gln Asn Ala Pro Ala Ala Ser Gly Ala Arg Lys
1 5 10 15
Arg His Gly Pro Gly Pro Arg Glu Ala Arg Gly Ala Arg Pro Gly Pro
20 25 30
Arg Val Pro Lys Thr Leu Val Leu Val Val Ala Ala Val Leu Leu Leu
35 40 45
Val Ser Ala Glu Ser Ala Leu Ile Thr Gln Gln Asp Leu Ala Pro Gln
50 55 60
Gln Arg Ala Ala Pro Gln Gln Lys Arg Ser Ser Pro Ser Glu Gly Leu
65 70 75 80
Cys Pro Pro Gly His His Ile Ser Glu Asp Gly Arg Asp Cys Ile Ser
85 90 95
Cys Lys Tyr Gly Gln Asp Tyr Ser Thr His Trp Asn Asp Leu Leu Phe
100 105 110
Cys Leu Arg Cys Thr Arg Cys Asp Ser Gly Glu Val Glu Leu Ser Pro
115 120 125
Cys Thr Thr Thr Arg Asn Thr Val Cys Gln Cys Glu Glu Gly Thr Phe
130 135 140
Arg Glu Glu Asp Ser Pro Glu Met Cys Arg Lys Cys Arg Thr Gly Cys
145 150 155 160
Pro Arg Gly Met Val Lys Val Gly Asp Cys Thr Pro Trp Ser Asp Ile
165 170 175
Glu Cys Val His Lys Glu Gly Ser Ser Asn Thr Lys Val Asp Lys Lys
180 185 190
Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro
195 200 205
Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys
210 215 220
Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val
225 230 235 240
Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr
245 250 255
Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu
260 265 270
Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His
275 280 285
Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys
290 295 300
Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln
305 310 315 320
Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu
325 330 335
Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
340 345 350
Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn
355 360 365
Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu
370 375 380
Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val
385 390 395 400
Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln
405 410 415
Lys Ser Leu Ser Leu Ser Pro Gly Lys
420 425
<210> 4
<211> 414
<212> PRT
<213> Artificial sequence
<400> 4
Met Glu Gln Arg Gly Gln Asn Ala Pro Ala Ala Ser Gly Ala Arg Lys
1 5 10 15
Arg His Gly Pro Gly Pro Arg Glu Ala Arg Gly Ala Arg Pro Gly Pro
20 25 30
Arg Val Pro Lys Thr Leu Val Leu Val Val Ala Ala Val Leu Leu Leu
35 40 45
Val Ser Ala Glu Ser Ala Leu Ile Thr Gln Gln Asp Leu Ala Pro Gln
50 55 60
Gln Arg Ala Ala Pro Gln Gln Lys Arg Ser Ser Pro Ser Glu Gly Leu
65 70 75 80
Cys Pro Pro Gly His His Ile Ser Glu Asp Gly Arg Asp Cys Ile Ser
85 90 95
Cys Lys Tyr Gly Gln Asp Tyr Ser Thr His Trp Asn Asp Leu Leu Phe
100 105 110
Cys Leu Arg Cys Thr Arg Cys Asp Ser Gly Glu Val Glu Leu Ser Pro
115 120 125
Cys Thr Thr Thr Arg Asn Thr Val Cys Gln Cys Glu Glu Gly Thr Phe
130 135 140
Arg Glu Glu Asp Ser Pro Glu Met Cys Arg Lys Cys Arg Thr Gly Cys
145 150 155 160
Pro Arg Gly Met Val Lys Val Gly Asp Cys Thr Pro Trp Ser Asp Ile
165 170 175
Glu Cys Val His Lys Glu Glu Pro Lys Ser Cys Asp Lys Thr His Thr
180 185 190
Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe
195 200 205
Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro
210 215 220
Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val
225 230 235 240
Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr
245 250 255
Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val
260 265 270
Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys
275 280 285
Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser
290 295 300
Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro
305 310 315 320
Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val
325 330 335
Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly
340 345 350
Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp
355 360 365
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp
370 375 380
Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His
385 390 395 400
Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys
405 410
<210> 5
<211> 384
<212> PRT
<213> Artificial sequence
<400> 5
Met Gly Val Leu Leu Thr Gln Arg Thr Leu Leu Ser Leu Val Leu Ala
1 5 10 15
Leu Leu Phe Pro Ser Met Ala Ser Met Ile Thr Gln Gln Asp Leu Ala
20 25 30
Pro Gln Gln Arg Ala Ala Pro Gln Gln Lys Arg Ser Ser Pro Ser Glu
35 40 45
Gly Leu Cys Pro Pro Gly His His Ile Ser Glu Asp Gly Arg Asp Cys
50 55 60
Ile Ser Cys Lys Tyr Gly Gln Asp Tyr Ser Thr His Trp Asn Asp Leu
65 70 75 80
Leu Phe Cys Leu Arg Cys Thr Arg Cys Asp Ser Gly Glu Val Glu Leu
85 90 95
Ser Pro Cys Thr Thr Thr Arg Asn Thr Val Cys Gln Cys Glu Glu Gly
100 105 110
Thr Phe Arg Glu Glu Asp Ser Pro Glu Met Cys Arg Lys Cys Arg Thr
115 120 125
Gly Cys Pro Arg Gly Met Val Lys Val Gly Asp Cys Thr Pro Trp Ser
130 135 140
Asp Ile Glu Cys Val His Lys Glu Glu Pro Lys Ser Cys Asp Lys Thr
145 150 155 160
His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser
165 170 175
Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg
180 185 190
Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro
195 200 205
Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala
210 215 220
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val
225 230 235 240
Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr
245 250 255
Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr
260 265 270
Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu
275 280 285
Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys
290 295 300
Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser
305 310 315 320
Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp
325 330 335
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser
340 345 350
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala
355 360 365
Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys
370 375 380
<210> 6
<211> 373
<212> PRT
<213> Artificial sequence
<400> 6
Met Gly Val Leu Leu Thr Gln Arg Thr Leu Leu Ser Leu Val Leu Ala
1 5 10 15
Leu Leu Phe Pro Ser Met Ala Ser Met Ala Ala Pro Gln Gln Lys Arg
20 25 30
Ser Ser Pro Ser Glu Gly Leu Cys Pro Pro Gly His His Ile Ser Glu
35 40 45
Asp Gly Arg Asp Cys Ile Ser Cys Lys Tyr Gly Gln Asp Tyr Ser Thr
50 55 60
His Trp Asn Asp Leu Leu Phe Cys Leu Arg Cys Thr Arg Cys Asp Ser
65 70 75 80
Gly Glu Val Glu Leu Ser Pro Cys Thr Thr Thr Arg Asn Thr Val Cys
85 90 95
Gln Cys Glu Glu Gly Thr Phe Arg Glu Glu Asp Ser Pro Glu Met Cys
100 105 110
Arg Lys Cys Arg Thr Gly Cys Pro Arg Gly Met Val Lys Val Gly Asp
115 120 125
Cys Thr Pro Trp Ser Asp Ile Glu Cys Val His Lys Glu Glu Pro Lys
130 135 140
Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu
145 150 155 160
Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr
165 170 175
Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
180 185 190
Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val
195 200 205
Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser
210 215 220
Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu
225 230 235 240
Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala
245 250 255
Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
260 265 270
Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln
275 280 285
Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala
290 295 300
Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
305 310 315 320
Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu
325 330 335
Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser
340 345 350
Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser
355 360 365
Leu Ser Pro Gly Lys
370
Claims (10)
1. The application of the human sDR5-Fc recombinant fusion protein in preparing the medicine for preventing and treating acute kidney injury, wherein the nucleotide sequence for coding the sDR5-Fc recombinant fusion protein has the following steps: a) SEQ ID NO: 1 in the sequence listing; or b) a sequence that is identical to SEQ ID NO: 1; or c) a sequence which encodes a protein of the same sequence as the nucleotide sequence of a or b but which differs from the nucleotide sequence of a or b due to the degeneracy of the genetic code;
or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2 or the amino acid sequence is shown as SEQ ID NO: 2, and one or more amino acids are substituted, but the biological activity of the sDR5-Fc recombinant fusion protein is not changed;
or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. or SEQ ID NO: and 6.
2. The use of claim 1, wherein the nucleotide sequence encoding the sDR5-Fc recombinant fusion protein is as set forth in SEQ ID NO: 1 in the sequence listing; the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2, respectively.
3. The use of claim 1, wherein the human sDR5-Fc recombinant fusion protein is used for preparing a medicament for preventing and treating acute renal injury induced by ischemia-reperfusion.
4. The use according to claim 1, wherein the human sDR5-Fc recombinant fusion protein is used for the preparation of a medicament for the prevention and treatment of surgery-induced acute kidney injury.
5. The use according to claim 1, wherein the human sDR5-Fc recombinant fusion protein is used for preparing a medicament for preventing and treating rhabdomyolysis-induced acute kidney injury.
6. The use according to claim 1, wherein the human sDR5-Fc recombinant fusion protein is used for preparing a medicament for preventing and treating contrast-induced acute kidney injury.
7. The use according to claim 1, wherein the human sDR5-Fc recombinant fusion protein is used for preparing a medicament for preventing and treating drug-induced acute kidney injury.
8. The use according to claim 1, wherein the human sDR5-Fc recombinant fusion protein is used for preparing a medicament for preventing and treating infection-induced acute kidney injury.
9. The pharmaceutical composition for preventing and treating acute kidney injury is characterized in that the active ingredients of the pharmaceutical composition comprise an sDR5-Fc recombinant fusion protein, wherein the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2 or the amino acid sequence is shown as SEQ ID NO: 2, and one or more amino acids are substituted, but the biological activity of the sDR5-Fc recombinant fusion protein is not changed; or the amino acid sequence is shown as SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 5. or SEQ ID NO: and 6.
10. The pharmaceutical composition of claim 9, wherein the pharmaceutical composition is in the form of an injection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910750670.8A CN112386686A (en) | 2019-08-14 | 2019-08-14 | Application of human sDR5-Fc recombinant fusion protein in preparation of acute kidney injury prevention and treatment drugs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910750670.8A CN112386686A (en) | 2019-08-14 | 2019-08-14 | Application of human sDR5-Fc recombinant fusion protein in preparation of acute kidney injury prevention and treatment drugs |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112386686A true CN112386686A (en) | 2021-02-23 |
Family
ID=74601475
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910750670.8A Pending CN112386686A (en) | 2019-08-14 | 2019-08-14 | Application of human sDR5-Fc recombinant fusion protein in preparation of acute kidney injury prevention and treatment drugs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112386686A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114200141A (en) * | 2021-11-03 | 2022-03-18 | 浙江大学 | Application of GDF15, uPAR and IL1RL1 in preparation of auxiliary diagnostic reagent or kit for acute kidney injury |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013053080A1 (en) * | 2011-10-12 | 2013-04-18 | 中国人民解放军军事医学科学院生物工程研究所 | Anti-tumour fusion protein and coding gene and use thereof |
| CN105688189A (en) * | 2016-01-21 | 2016-06-22 | 河南大学 | Application of human sDR5-Fc (soluble DR5-Fc) antibody fusion protein used as renal injury treatment medicament |
| CN107022557A (en) * | 2016-01-29 | 2017-08-08 | 深圳市中科艾深医药有限公司 | New death receptor 5 antibody fusion protein and its application |
| CN109954136A (en) * | 2017-12-14 | 2019-07-02 | 深圳市中科艾深医药有限公司 | Application of the people sDR5-Fc recombination fusion protein as Treatment of Cerebral Stroke drug |
-
2019
- 2019-08-14 CN CN201910750670.8A patent/CN112386686A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013053080A1 (en) * | 2011-10-12 | 2013-04-18 | 中国人民解放军军事医学科学院生物工程研究所 | Anti-tumour fusion protein and coding gene and use thereof |
| CN105688189A (en) * | 2016-01-21 | 2016-06-22 | 河南大学 | Application of human sDR5-Fc (soluble DR5-Fc) antibody fusion protein used as renal injury treatment medicament |
| CN107022557A (en) * | 2016-01-29 | 2017-08-08 | 深圳市中科艾深医药有限公司 | New death receptor 5 antibody fusion protein and its application |
| CN109954136A (en) * | 2017-12-14 | 2019-07-02 | 深圳市中科艾深医药有限公司 | Application of the people sDR5-Fc recombination fusion protein as Treatment of Cerebral Stroke drug |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114200141A (en) * | 2021-11-03 | 2022-03-18 | 浙江大学 | Application of GDF15, uPAR and IL1RL1 in preparation of auxiliary diagnostic reagent or kit for acute kidney injury |
| CN114200141B (en) * | 2021-11-03 | 2024-04-30 | 浙江大学 | Application of GDF15, uPAR and IL1RL1 in preparation of auxiliary diagnostic reagent or kit for acute kidney injury |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kato et al. | Renin-angiotensin blockade lowers MCP-1 expression in diabetic rats | |
| US20200164035A1 (en) | Methods of using variants of fgf19 polypeptides for the treatment of cancer | |
| Vlassara et al. | Advanced glycation end products induce glomerular sclerosis and albuminuria in normal rats. | |
| DE60219611T2 (en) | MODIFIED ANNEXIN PROTEINS AND PREVENTION AND TREATMENT OF THROMBOSE | |
| JP2015506373A (en) | Growth differentiation factor 15 (GDF-15) polypeptide | |
| JPS62502661A (en) | Transformed yeast and method for producing hirudin | |
| KR102060207B1 (en) | Blockade of inflammatory proteases with theta-defensins | |
| Xu et al. | Long-acting hypoglycemic effects of PEGylated FGF21 and insulin glargine in mice with type 1 diabetes | |
| CN107320719A (en) | HGH XTEN fusion proteins and its purposes in treatment growth hormone deficiency | |
| EP2341138B1 (en) | FUSION PROTEIN COMPOSED OF MATRIX METALLOPROTEINASE-2 INHIBITOR PEPTIDE DERIVED FROM AMYLOID-beta PRECURSOR PROTEIN AND TISSUE INHIBITOR OF METALLOPROTEINASE-2 | |
| CN110878127B (en) | Long-acting recombinant GLP1-Fc-CD47 protein and preparation and application thereof | |
| CA2224859A1 (en) | Ligand inhibitors of insulin-like growth factor binding proteins and methods of use therefor | |
| CN112386686A (en) | Application of human sDR5-Fc recombinant fusion protein in preparation of acute kidney injury prevention and treatment drugs | |
| KR20240013820A (en) | Prophylactic and/or therapeutic drug for diabetic nephropathy | |
| Zhao et al. | USP25 inhibits renal fibrosis by regulating TGFβ-SMAD signaling pathway in Ang II-induced hypertensive mice | |
| CN112439052A (en) | Application of human sDR5-Fc recombinant fusion protein in preparation of medicine for preventing and treating liver ischemia-reperfusion injury | |
| Varga et al. | The clinical and biochemical spectrum of hereditary amyloidosis | |
| Zhang et al. | Effects of cerebral glucose levels in infarct areas on stroke injury mediated by blood glucose changes | |
| CN112294945A (en) | Application of human sDR5-Fc recombinant fusion protein in preparation of drugs for preventing and treating myocardial infarction and ischemia-reperfusion injury | |
| EP4249594A1 (en) | Adamts13 variant having increased escaping rate or activity against autoantibody | |
| CN112587654A (en) | Application of mesencephalon astrocyte-derived neurotrophic factor in treatment of ulcerative colitis | |
| JP2023518083A (en) | Use of Mitochondrial Extract for Treating and/or Preventing Diseases Related to Renal Injury | |
| KR20140054369A (en) | Compositions and methods modulating mg29 for the treatment of diabetes | |
| EP1284291A1 (en) | Human pgc-1 promoter | |
| CN110339343B (en) | Application of nuclear receptor Rev-erb alpha in preparation of anti-sepsis cardiomyopathy medicines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |