WO2013040517A2 - IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING CotH - Google Patents

IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING CotH Download PDF

Info

Publication number
WO2013040517A2
WO2013040517A2 PCT/US2012/055659 US2012055659W WO2013040517A2 WO 2013040517 A2 WO2013040517 A2 WO 2013040517A2 US 2012055659 W US2012055659 W US 2012055659W WO 2013040517 A2 WO2013040517 A2 WO 2013040517A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
polypeptide
seq
coth
mucorales
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/055659
Other languages
English (en)
French (fr)
Other versions
WO2013040517A3 (en
Inventor
Ashraf S. Ibrahim
Mingfu Liu
Teklegiorgis GHEBREMARIAM
Yue Fu
John E. Edwards
Scott Filler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Lundquist Institute for Biomedical Innovation at Harbor UCLA Medical Center
Original Assignee
Los Angeles Biomedical Research Institute at Harbor-Ucla Medical Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Los Angeles Biomedical Research Institute at Harbor-Ucla Medical Center filed Critical Los Angeles Biomedical Research Institute at Harbor-Ucla Medical Center
Priority to CN201280056226.2A priority Critical patent/CN103998057A/zh
Priority to AU2012308240A priority patent/AU2012308240A1/en
Priority to EP12831998.5A priority patent/EP2755681B1/en
Priority to JP2014530916A priority patent/JP2014528715A/ja
Priority to CA2848765A priority patent/CA2848765A1/en
Publication of WO2013040517A2 publication Critical patent/WO2013040517A2/en
Publication of WO2013040517A3 publication Critical patent/WO2013040517A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/14Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from fungi, algea or lichens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10Antimycotics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56961Plant cells or fungi
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/37Assays involving biological materials from specific organisms or of a specific nature from fungi
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00Immunoassays for the detection of microorganisms
    • G01N2469/10Detection of antigens from microorganism in sample from host

Definitions

  • the present invention relates generally to compositions and methods for detecting, treating and preventing infectious diseases in a patient, and more specifically to compositions and methods that target specific proteins or nucleic acids unique to fungi that cause mucormycosis.
  • Mucormycosis p. 524-559, Medical Mycology, Lea & Febiger, Philadelphia (1992), and Ribes et al. Zygomycetes in Human Disease, Clin Microbiol Rev 13:236-301 (2000)).
  • Rhizopus oryzae Rhizopus arrhizus
  • Increasing cases of mucormycosis have been also reported due to infection with Cunninghamella spp. in the Cunninghamellaceae family (Cohen- Abbo et al., Clinical Infectious Diseases 17: 173-77 (1993); Kontoyianis et al., Clinical Infectious Diseases 18:925-28 (1994); Kwon-Chung et al., American Journal of Clinical Pathology 64:544-48 (1975), and Ventura et al, Cancer 58:1534-36 (1986)).
  • the major risk factors for mucormycosis include uncontrolled diabetes mellitus in ketoacidosis known as diabetes ketoacidosis (DKA), other forms of metabolic acidosis, treatment with corticosteroids, organ or bone marrow transplantation, neutropenia, trauma and burns, malignant hematological disorders, and deferoxamine chelation-therapy in subjects receiving hemodialysis.
  • DKA diabetes ketoacidosis
  • other forms of metabolic acidosis treatment with corticosteroids, organ or bone marrow transplantation, neutropenia, trauma and burns, malignant hematological disorders, and deferoxamine chelation-therapy in subjects receiving hemodialysis.
  • mucormycosis in transplant subjects over a similar time-span (Kontoyiannis et al, Clin. Infect. Dis. 30(6):851-6 (2000)).
  • the rise in incidence of mucormycosis is anticipated to continue unabated for the foreseeable future.
  • polypeptides and encoding nucleic acids can be advantageously used to diagnose, treat or prevent fungal conditions, in particular mucormycosis. Furthermore, the Mucorales CotH polypeptides and encoding nucleic acids are useful to generate or screen for agents that can alter Mucorales CotH activity or expression, which can further be used to treat or prevent fungal conditions.
  • the invention also provides vectors containing Mucorales CotH nucleic acids, host cells containing such vectors, Mucorales CotH anti-sense nucleic acids and related compositions.
  • the invention additionally provides Mucorales CotH
  • kits containing Mucorales CotH nucleic acids or Mucorales CotH specific antibodies can be used to diagnose fungal infection cause by Mucorales organisms.
  • pharmaceutical and vaccine compositions are also provided.
  • Figure 1 shows a FAR- western blot of four open reading frames (ORF) predicted to be cell surface proteins.
  • Figure 2 shows GRP78 binds to germlings but not to spores of R. oryzae.
  • Figure 3 shows expression of the four glycosylphosphatidylinisotol (GPI) anchored predicted to act as ligands to GRP78.
  • GPI glycosylphosphatidylinisotol
  • FIG 4 panels A and B, show expression of CotH genes in R. oryzae germlings incubated with endothelial cells.
  • Figure 5 shows homology of the 4 putative GPI-anchored proteins to each other and the number of predicted N-and O-glycosylation sites in CotH3.
  • FIG. 6 panel A demonstrates the ability of R. oryzae to adhere to human umbilical endothelial cells but not plastic. Further, Saccharomyces cerevisiae doesn't adhere to endothelial cells. Panel B, showing R. oryzae CotH2 and CotH3 enabling S. cerevisiae to bind endothelial cells expressing GRP78.
  • FIG. 7 shows CotH3 is conserved among various Mucorales including
  • FIG 8 panels A and B, show S. cerevisiae expressing CotH2 or CotH3 adhere to and invades endothelial cells or CHO cells overexpressing GRP78 but not CHO parent cells.
  • Figure 9 shows the amino acid sequence (SEQ ID NO. 1) and the nucleic acid coding sequence (SEQ ID NO. 2) of CotHl from R. oryzae.
  • Figure 10 shows the amino acid sequence (SEQ ID NO. 3) and the nucleic acid coding sequence (SEQ ID NO. 4) of CotH2 from R. oryzae.
  • Figure 11 shows the amino acid sequence (SEQ ID NO. 5) and the nucleic acid coding sequence (SEQ ID NO. 6) of CotFB from R. oryzae.
  • Figure 12 shows the amino acid sequence (SEQ ID NO. 7) and the nucleic acid coding sequence (SEQ ID NO. 8) of R03G 16295 from R. oryzae.
  • Figure 13 shows detection of CotFB in sheep's blood spiked with R. oryzae by PCR using oligonucleotide primers having the nucleic acid sequence of SEQ ID NO: 33 and SEQ ID NO: 34.
  • Figure 14 shows detection of CotFB in sheep's blood spiked with Mucor sp. or Lichtheimia corymbifera by PCR using oligonucleotide primers having the nucleic acid sequence of SEQ ID NO: 33 and SEQ ID NO: 34.
  • Figure 15 shows detection of CotH3 in sheep's blood spiked with
  • Cunninghamella bertholetiae or R. microsporus by PCR using oligonucleotide primers having the nucleic acid sequence of SEQ ID NO: 33 and SEQ ID NO: 34.
  • Figure 16 shows no detection of CotFB in sheep's blood spiked with
  • Aspergillus fumigates or Candida albicans by PCR using oligonucleotide primers having the nucleic acid sequence of SEQ ID NO: 33 and SEQ ID NO: 34.
  • Figure 17 shows the highest homology of any of the CotH predicted proteins
  • CotFB [R03G 11882] SEQ ID NO: 5 with an amino acid sequence of a protein from Stigmatella aurantiaca (ZP_01460584) (SEQ ID NO: 65).
  • Figure 18 shows an amino acid sequence alignment between the
  • R03G_ 16295 protein from R. oryzae (SEQ ID NO: 66) and Talaromyces stipitatus ATCC
  • EED23986 protein (SEQ ID NO: 67).
  • Figure 19 shows an amino acid sequence alignment between the
  • R03G_ 16295 protein from R. oryzae (SEQ ID NO: 66) and Penicillium marneffei ATCC 18224 (XP_002144175) protein (SEQ ID NO: 68).
  • Figure 20 shows an amino acid sequence alignment between the
  • Figure 21 shows an amino acid sequence alignment between the
  • Figure 22 shows an amino acid sequence alignment between the
  • R03GJ6295 protein from R. oryzae (SEQ ID NO: 66) and Ustilago maydis (XP_760027) protein (SEQ ID NO: 71).
  • Figure 23 shows an amino acid sequence alignment between the
  • R03G_ 16295 protein from R. oryzae (SEQ ID NO: 66) and Coccidioides immitis
  • Figure 24 shows an amino acid sequence alignment between the
  • R03G 16295 protein from R. oryzae (SEQ ID NO: 66) and Neurospora crassa (XP_956792) protein (SEQ ID NO: 73).
  • Figure 25 shows an amino acid sequence alignment between the
  • R03G_ 16295 protein from R. oryzae (SEQ ID NO: 66) and Cryptococcus neoformans (XP_775558) protein (SEQ ID NO: 74).
  • Figure 26 shows an amino acid sequence alignment between the
  • R03G_ 16295 protein from R. oryzae (SEQ ID NO: 66) and Streptomyces lividans
  • Figure 27 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-
  • Figure 28 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99- 880 (exon only from Data base) (SEQ ID NO: 10).
  • Figure 29 shows an amino acid sequence of CotH3 from Rhizopus oryzae 99-
  • Figure 30 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-
  • Figure 31 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-
  • Figure 32 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-
  • Figure 33 shows the predicted amino acid sequence of CotH3 from R. oryzae
  • Figure 34 shows the predicted amino acid sequence of CotH3 from R. oryzae
  • Figure 35 shows a nucleic acid sequence of CotH3 sequence from Mucor sp. 99-932(exons only from sequenced data) (SEQ ID NO: 17).
  • Figure 36 shows the predicted amino acid sequence of CotFB from
  • Figure 37 shows a nucleic acid sequence of CotFB from Mucor 99-932
  • Figure 38 shows the predicted amino acid sequence of CotFB from
  • Mucor 99-932(including introns) (SEQ ID NO: 20).
  • Figure 39 shows a nucleic acid sequence of CotFB from Lichtheimia corymbifera (exons only from sequenced data) (SEQ ID NO: 21).
  • Figure 40 shows the predicted amino acid sequence of CotFB from
  • Figure 41 shows a nucleic acid sequence of CotFB from Lichtheimia corymbifera (including introns) (SEQ ID NO: 23).
  • Figure 42 shows the predicted amino acid sequence of CotFB from
  • Figure 43 shows a nucleic acid sequence of CotFB sequence from
  • Figure 44 shows the predicted amino acid sequence of CotFB from Cunninghamella bertholetiae (exons only from sequenced data) (SEQ ID NO: 26).
  • Figure 45 shows a nucleic acid sequence of CotFB from Cunninghamella bertholetiae (including introns) (SEQ ID NO: 27).
  • Figure 46 shows the predicted amino acid sequence of CotFB from
  • Cunninghamella bertholetiae (including introns from sequenced data) (SEQ ID NO: 28).
  • Figure 47 shows a nucleic acid sequence of CotFB from R. microsporus
  • Figure 48 shows the predicted amino acid sequence of CotFB from R. microsporus (exons only from sequenced data) (SEQ ID NO: 30).
  • Figure 49 shows a nucleic acid sequence of CotFB from R. microsporus (including introns, has only one intron) (SEQ ID NO: 31).
  • Figure 50 shows the predicted amino acid sequence of CotFB from R. microsporus (including introns) (SEQ ID NO: 32).
  • Figure 51 panels A and B, show a FAR western blot of R. oryzae surface proteins that bound to GRP78 (Panel A) and a dendrogram showing the close identity between CotH2 and CotH3 predicated proteins and the divergence of the CotH proteins from the fourth identified ORF widely present in fungi without an identified function (i.e. R03G 16295) (Panel B).
  • Figure 52 panels A-C, show expression of CotH genes and R03G 16295 in response to germination and to host cell interaction. All CotH genes were expressed in resting spores but only CotH3 was expressed in germlings of R. oryzae grown in YPD at 37°C (Panel A). Exposure of R. oryzae germlings to endothelial cells induced expression of only CotH2 and CotH3 genes as determined by RT-PCR (Panel B). Quantification of gene expression of CotH genes in R.
  • Figure 53 shows antibodies raised against peptide
  • GAGKKHNNAKQSWNW (SEQ ID NO: 39) recognized CotH2 and CotFB but not CotHl proteins heterologous ly expressed by S. cerevisiae.
  • Peptide was coupled with KLH and used to raise rabbit antibodies commercially.
  • S. cerevisiae heterologously expressing CotH proteins were stained with the antibodies then counter stained with FITC labeled anti-rabbit goat antibody prior to visualizing the cells with confocal microscopy.
  • Figure 54 panels A-C, show endothelial cell surface GRP78 binds to S. cerevisiae cells heterologously expressing CotH2 or CotH 3 but not CotHl and S.
  • cerevisiae expressing CotH2 or CotH3 adhered and invaded endothelial cells or CHO cells overexpressing GRP78 but not S. cerevisiae expressing CotHl or empty plasmid.
  • Endothelial cell surface proteins were labeled with NHS-biotin and then extracted with n- octyl-P-d-glucopyranoside in PBS containing Ca 2+ and Mg 2+ and protease inhibitors.
  • the labeled proteins 250 ⁇ g were incubated with yeast cells (2xl0 8 ), then the unbound proteins were removed by extensive rinsing with PBS containing Ca 2+ and Mg 2+ .
  • the membrane proteins that remained bound to the organisms were eluted with 6 M urea, separated on 10% SDS-PAGE, and identified by immunoblotting with anti-GRP78 Ab (Panel A).
  • Adherence and endocytosis were carried out using endothelial cells (Panel B), or CHO parent cells or those overexpressing GRP78 (Panel C) split on 12-mm glass coverslips. * O.001 vs. S.
  • Figure 55 panels A and B, show anti-CotH3 Abs (raised against peptide
  • GAGKKHNNAKQSWNW (SEQ ID NO: 39) block endothelial cell endocytosis of and damage by R. oryzae. Adherence and endocytosis (determined by differential
  • FIG. 56 panels A-C, show RNA-i construct targeting CotH2 and CotH3 inhibits the expression of both genes, reduces CotH2 and CotH3 protein synthesis on the cell surface and has no effect on the growth or the pattern of germination of R. oryzae.
  • R. oryzae was transformed with an RNA-i construct (pRNAi) targeting CotH2 and CotH3 expression or with empty plasmid.
  • pRNAi RNA-i construct
  • Two transformants were shown to have > 80% reduction in the expression of CotH2 and CotH3 relative to cells transformed with the empty plasmid as determined by qRT-PCR (Panel A).
  • Flow cytometry testing using anti- CotH antibodies demonstrated reduction in cell surface expression of CotH proteins on R.
  • Figure 57, panels A-C show inhibition of CotH2 and CotH3 expression compromise the ability of R. oryzae to invade and damage endothelial cells and CHO cells overexpressing GRP78.
  • Adherence and endocytosis (determined by differential fluorescence) assays were carried out using endothelial cells split on 12-mm glass coverslips, while damage was carried out using the 96-well plate 51 Cr-release method.
  • R. oryzae germlings transformed with the RNA-i construct caused less invasion (Panel A) and damage (Panel B) to endothelial cells when compared to cells transformed with empty plasmid.
  • Transformants with RNA-i targeting CotH2 and CotH3 caused equivalent damage to CHO cells overexpressing GRP78 when compared to CHO parent cells.
  • R. oryzae germlings transformed with the empty plasmid or wild type R. oryzae caused significantly more damage to CHO cell overexpressing GRP78 vs. CHO parent cells (Panel C).
  • FIG. 58 panels A-C, show inhibition of CotH2 and CotH3 expression attenuates virulence of R. oryzae in diabetic ketoacidotic mice.
  • mice intratracheally with wild type (1.7 x 10 3 ), empty plasmid (3.0 x 10 3 ) or RNA-i (3.1 x 10 3 ) cells. Mice were sacrificed on day +2 relative to infection and their organs processed for tissue fungal burden using SYBR green assay. Data are expressed as median ⁇
  • Figure 59 shows histopathological examination of lungs harvested from diabetic ketoacidotic mice infected with wild type or R. oryzae transformed with empty plasmid or RNA-i. Periodic acid Schieff (PAS) stained sections demonstrating extensive hyphal elements (arrows) from organs collected from mice infected with wild type or R. oryzae transformed with empty plasmid but not R. oryzae transformed with RNA-i construct.
  • Figure 60 shows passive immunization with antiCotH antibodies raise against peptide GAGKKHNNAKQSWNW (SEQ ID NO: 39) (A) or peptide
  • MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) (B) protect mice from R. oryzae infection.
  • Diabetic ketoacidotic mice were given 1 mg of antiCotH IgG or pre-vaccination serum (control) 2 hr prior to infecting intratracheally with 2.4 x 10 3 spores of R. oryzae 99-880 (wild type).
  • a second dose of the polyclonal antibody or the pre- vaccination serum was given on day +3 relative to infection. * ⁇ 0.03 vs. mice receiving pre-vaccination serum.
  • Figure 61 shows the specificities of the CotFB molecular beacon detection of different fungal species.
  • the amplification plot was generated in StepOnePlus Real-Time PCR machine (Applied Biosystems).
  • the x axis is the time from the initiation of amplification; the y axis is the increase in fluorescence (ARn); threshold fluorescence is shown as the bold horizontal line (It is equal to the average plus 2 times SD for the water negative control samples).
  • Signals can be amplified from water samples (0.5 ml) spiked with 10 5 spores of R. oryzae but not Candida albicans ox Aspergillus fumigatus.
  • Figure 62 shows the sensitivity of the CotFB molecular beacon detection of water samples (0.5 ml) spiked with different inocula of R. oryzae 99-880.
  • the amplification plot was generated in StepOnePlus Real-Time PCR machine (Applied Biosystems).
  • the x axis is the time from the initiation of amplification; the y axis is the increase in fluorescence (ARn); threshold fluorescence is shown as the bold horizontal line (It is equal to the average plus 2 times SD for the water negative control samples).
  • Figure 63 shows the sensitivity and specificity of the CotFB molecular beacon probe in detection of Rhizopus oryzae spores in blood.
  • the amplification plot was generated in StepOnePlus Real-Time PCR machine (Applied Biosystems).
  • the x axis is the time from the initiation of amplification; the y axis is the increase in fluorescence (ARn); threshold fluorescence is shown as the bold horizontal line (It is equal to the average plus 2 times SD for the water negative control samples).
  • Blood is inoculated control.
  • C C. albicans each used to spike 350 ⁇ of blood at 10 5 cells.
  • Figure 64 shows the specificity of the CotFB molecular beacon probe in detection of Rhizopus.
  • the amplification plot was generated in a StepOnePlus Real-Time PCR machine (Applied Biosystems).
  • the x axis is the time from the initiation of amplification; the y axis is the increase in fluorescence (ARn); threshold fluorescence is shown as the bold horizontal line (It is equal to the average plus 2 times SD for the water negative control samples).
  • Blood uninoculated blood sample; 99-892: R. oryzae 99-892; ATCC62417: R. microspores ATCC62417; R1000: R. oryzae 99-880. All strains were used to spike blood (350 ⁇ ) with 10 3 spores. DETAILED DESCRIPTION OF THE INVENTION
  • compositions and methods disclosed herein are based, at least in part, on the identification and characterization of cell surface proteins that are uniquely expressed by fungi of the Mucorales order and can facilitate binding of endothelial cells during fungal infections.
  • Mucormycosis which is mainly caused by Rhizopus oryzae, is characterized by angioinvasion and vascular thrombosis. Interactions between Mucorales and endothelial cells is an important factor in establishing a fungal condition.
  • the recently identified Glucose Regulated Protein 78 (GRP78) a novel host receptor that mediates invasion and subsequent damage of human umbilical vein endothelial cells by R. oryzae germlings, provides a likely target ligand for R. oryzae and other Mucorales species to bind during invasion (Liu et al, J. Clin. Invest. 120: 1914-24 (2010)).
  • nucleic acids encoding Mucorales CotH polypeptides and other polypeptides disclosed herein, or functional polypeptide fragments thereof.
  • Mucorales CotH refers to sub-family members of the CotH family of proteins, wherein the Mucorales CotH proteins include cell surface proteins expressed by fungi in the Mucorales order that are involved in the process of adherence and invasion of host cells, such as endothelial cell. Because Mucorales CotH proteins are unique to Mucorales, the presence or absence of Mucorales CotH nucleic acid or polypeptide or changes in Mucorales CotH nucleic acid or polypeptide expression can serve as a marker for infection by a Mucorales species, for example, mucormycosis. Thus, the invention includes Mucorales CotH nucleic acids and/or polypeptides that can be used for screening for a fungal condition and/or for developing drug candidates for the treatment of a fungal condition.
  • CotH3 or CotH2 were expressed in S. cerevisae, the S. cerevisae cells adhere to and invade endothelial cells or CHO cells overexpressing GRP78. Therefore, one function of Mucorales CotH is a pro-adherance and/or pro-invasion function.
  • a functional Murcorales CotH polypeptide or fragment thereof can also include in vivo or in vitro binding to a GRP78 protein, variant or fragment thereof.
  • nucleic acid molecules described herein are useful for producing invention proteins, when such nucleic acids are incorporated into a variety of protein expression systems known to those of skill in the art.
  • nucleic acid molecules or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of an invention Mucorales CotH gene or mR A transcript in a given sample.
  • the nucleic acid molecules described herein, and fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding invention proteins described herein.
  • nucleic acid also referred to as polynucleotides, encompasses ribonucleic acid (R A) or deoxyribonucleic acid (DNA), probes, oligonucleotides, and primers and can be single stranded or double stranded.
  • DNA can be either complementary DNA (cDNA) or genomic DNA, and can represent the sense strand, the anti-sense strand or both. Examples of nucleic acids are RNA, cDNA, or isolated genomic DNA encoding an Mucorales CotH polypeptide.
  • nucleic acids include, but are not limited to, nucleic acids comprising substantially the same nucleotide sequence as set forth in 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
  • a genomic sequence of the invention includes regulatory regions such as promoters, enhancers, and introns that are outside of the exons encoding a Mucorales CotH but does not include proximal genes that do not encode Mucorales CotH .
  • substantially the same nucleotide sequence refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent hybridization conditions.
  • DNA having substantially the same nucleotide sequence as the reference nucleotide sequence encodes substantially the same amino acid sequence as that set forth in any of SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
  • DNA having substantially the same nucleotide sequence as the reference nucleotide sequence has at least 65% identity with respect to the reference nucleotide sequence.
  • DNA having substantially the same nucleotide sequence can have at least 65% identity, at least 70% identity, at least 75% identity, at least 80%> identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, or at least 99% identity to the reference nucleotide sequence.
  • a "modification" of a nucleic acid can also include one or several nucleotide additions, deletions, or substitutions with respect to a reference sequence.
  • a modification of a nucleic acid can include substitutions that do not change the encoded amino acid sequence due to the degeneracy of the genetic code. Such modifications can correspond to variations that are made deliberately, or which occur as mutations during nucleic acid replication.
  • Exemplary modifications of the recited Mucorales CotH sequences include sequences that correspond to homologs of other species, including species of the Mucorales order such as A. corymbifera, A. elegans, A. rouxii, B. circina, B. multispora, C. brefeldii, C. angarensis, C. recurvatus, D.fulva, E. anomalus, H. elegans, H.
  • Mucorales CotH sequences of Mucorales species can be determined by methods known in the art, such as by PCR or by screening genomic, cDNA or expression libraries.
  • Mucorales CotH can correspond to splice variant forms of the Mucorales CotH nucleotide sequence.
  • a modification of a nucleotide sequence can include one or more non-native nucleotides, having, for example, modifications to the base, the sugar, or the phosphate portion, or having a modified phosphodiester linkage. Such modifications can be advantageous in increasing the stability of the nucleic acid molecule.
  • the invention also encompasses nucleic acids which differ from the nucleic acids shown in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31, but which have the same phenotype. Phenotypically similar nucleic acids are also referred to as functionally equivalent nucleic acids.
  • the phrase functionally equivalent nucleic acids encompasses nucleic acids characterized by slight and non- consequential sequence variations that will function in substantially the same manner to produce the same protein product(s) as the nucleic acids disclosed herein.
  • functionally equivalent nucleic acids encode polypeptides that are the same as those encoded by the nucleic acids disclosed herein or that have conservative amino acid variations. For example, conservative variations include substitution of a non-polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue. These variations include those recognized by skilled artisans as those that do not substantially alter the tertiary structure of the protein.
  • polypeptides that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions.
  • degenerate refers to codons that differ in at least one nucleotide from a reference nucleic acid, but encode the same amino acids as the reference nucleic acid.
  • Nucleic acids encoding the invention Mucorales CotH polypeptides can be comprised of nucleotides that encode substantially the same amino acid sequence as set forth in SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32.
  • the invention provides an isolated nucleic acid encoding a polypeptide as disclosed herein including a Mucorales CotH polypeptide, an immunogenic fragment thereof, or a functional fragment thereof.
  • the invention also provides an isolated nucleic acid encoding a Mucorales CotH polypeptide, an
  • nucleic acid selected from: (a) nucleic acid encoding an amino acid sequence set forth in SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or (b) nucleic acid that hybridizes to the nucleic acid of (a) under low, moderately or highly stringent conditions, wherein said nucleic acid contiguously encodes biologically active Mucorales CotH polypeptide, or (c) nucleic acid degenerate with respect to either (a) or (b) above, wherein said nucleic acid encodes biologically active Mucorales CotH polypeptide.
  • the nucleic acid of the invention hybridizes under highly stringent conditions.
  • Hybridization refers to the binding of complementary strands of nucleic acid, for example, sense :antisense strands or probe :target-nucleic acid to each other through hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA. Stringency levels used to hybridize a given probe with target-DNA can be readily varied by those of skill in the art.
  • stringent hybridization is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T m ) of the hybrids. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions.
  • Moderately stringent hybridization refers to conditions that permit target-nucleic acid to bind a complementary nucleic acid.
  • the hybridized nucleic acids will generally have at least about 60% identity, at least about 75% identity, or at least about 85% identity; or at least about 90% identity.
  • Moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42EC, followed by washing in 0.2X SSPE, 0.2% SDS, at 42EC.
  • high stringent hybridization refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65EC, for example, if a hybrid is not stable in 0.018M NaCl at 65EC, it will not be stable under high stringency conditions, as contemplated herein.
  • High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42EC, followed by washing in 0.1X SSPE, and 0.1% SDS at 65EC.
  • low stringency hybridization refers to conditions equivalent to hybridization in 10% formamide, 5X Denhart's solution, 6X SSPE, 0.2% SDS at 22EC, followed by washing in IX SSPE, 0.2% SDS, at 37EC.
  • Denhart's solution contains 1% Ficoll, 1%) polyvinylpyrolidone, and 1% bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • 20X SSPE sodium chloride, sodium phosphate, ethylene diamide tetraacetic acid (EDTA)
  • EDTA ethylene diamide tetraacetic acid
  • Other suitable moderate stringency and high stringency hybridization buffers and conditions are well known to those of skill in the art and are described, for example, in Sambrook et al.,
  • Nucleic acids encoding polypeptides hybridize under moderately stringent or high stringency conditions to substantially the entire sequence, or substantial portions, for example, typically at least 15-30 nucleotides of the nucleic acid sequence set forth in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
  • the invention also provides a modification of a Mucorales CotH nucleotide sequence that hybridizes to a Mucorales CotH nucleic acid molecule, for example, a nucleic acid molecule set forth in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31, under moderately stringent conditions. Modifications of
  • Mucorales CotH nucleotide sequences where the modification has at least 65% identity to a Mucorales CotH nucleotide sequence, are also provided.
  • the invention also provides modification of a Mucorales CotH nucleotide sequence having at least 65% identity, at least 70%) identity, at least 75% identity, at least 80%> identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, or at least 99% identity.
  • the invention also provides modification of Mucorales CotH nucleotide sequences, wherein the amino acid sequence encoded by the modified nucleic acid has 65 % identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, or at least 99% identity to the amino acid sequence set forth in SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32.
  • Homology refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated” or “non-homologous” sequence shares less than 40%) identity, or alternatively less than 25% identity, with one of the sequences of the present invention.
  • a polynucleotide or polynucleotide region has a certain percentage (for example, 60%, 65%, 70%, 75%, 80%, 85%), 90%), 95%), 98%) or 99%) of "sequence identity" to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences.
  • This alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Ausubel et al, supra. Preferably, default parameters are used for alignment.
  • One alignment program is BLAST, using default parameters.
  • Bioly equivalent polynucleotides are those having the specified percent homology and encoding a polypeptide having the same or similar biological activity.
  • One means of isolating a nucleic acid encoding a Mucorales CotH polypeptide is to probe a cDNA library or genomic library with a natural or artificially designed nucleic acid probe using methods well known in the art. Nucleic acid probes derived from the Mucorales CotH gene are particularly useful for this purpose. DNA and cDNA molecules that encode Mucorales CotH polypeptides can be used to obtain complementary genomic DNA, cDNA or RNA from any number of Mucorales species sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods well known in the art (see, for example, Sambrook et al., supra, 1989; Ausubel et al, supra, 1999).
  • the invention additionally provides a Mucorales CotH oligonucleotide comprising between 15 and 300 contiguous nucleotides of SEQ ID NOS: 2, 4, 6, 9, 10, 12- 14, 17, 19, 21, 23, 25, 27, 29 or 31, or the anti-sense strand thereof.
  • oligonucleotide refers to a nucleic acid molecule that includes at least 15 contiguous nucleotides from a reference nucleotide sequence, and can include at least 16, 17, 18, 19, 20 or at least 25 contiguous nucleotides, and often includes at least 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, up to 350 contiguous nucleotides from the reference nucleotide sequence.
  • the reference nucleotide sequence can be the sense strand or the anti-sense strand.
  • CotH oligonucleotides can comprise the nucleic acid sequence of
  • AAACGTACCTGCTGACCGAATC SEQ ID NO: 37
  • oligonucleotide disclosed herein any oligonucleotide disclosed herein.
  • the Mucorales CotH oligonucleotides of the invention that contain at least 15 contiguous nucleotides of a reference Mucorales CotH nucleotide sequence are able to hybridize to Mucorales CotH under moderately stringent hybridization conditions and thus can be advantageously used, for example, as probes to detect Mucorales CotH DNA or RNA in a sample, and to detect splice variants thereof; as sequencing or PCR primers; as antisense reagents to block transcription of Mucorales CotH RNA in cells; or in other applications known to those skilled in the art in which hybridization to a
  • the isolated Mucorales CotH nucleic acid molecules of the invention can be used in a variety of diagnostic and therapeutic applications.
  • the isolated Mucorales CotH nucleic acid molecules of the invention can be used as probes, as described above; as templates for the recombinant expression of Mucorales CotH polypeptides; or in screening assays to identify cellular molecules that bind Mucorales CotH.
  • Another useful method for producing a Mucorales CotH nucleic acid molecule of the invention involves amplification of the nucleic acid molecule using PCR and Mucorales CotH oligonucleotides and, optionally, purification of the resulting product by gel electrophoresis.
  • Either PCR or RT-PCR can be used to produce a Mucorales CotH nucleic acid molecule having any desired nucleotide boundaries. Desired modifications to the nucleic acid sequence can also be introduced by choosing an appropriate
  • oligonucleotide primer with one or more additions, deletions or substitutions.
  • Such nucleic acid molecules can be amplified exponentially starting from as little as a single gene or mRNA copy, from any cell, tissue or species of interest.
  • the invention thus provides methods for detecting Mucorales CotH nucleic acid in a sample.
  • the methods of detecting Mucorales CotH nucleic acid in a sample can be either qualitative or quantitative, as desired.
  • the presence, abundance, integrity or structure of a Mucorales CotH can be determined, as desired, depending on the assay format and the probe used for hybridization or primer pair chosen for application.
  • Useful assays for detecting Mucorales CotH nucleic acid based on specific hybridization with an isolated Mucorales CotH nucleic acid molecule are well known in the art and include, for example, in situ hybridization, which can be used to detect altered chromosomal location of the nucleic acid molecule, altered gene copy number, and RNA abundance, depending on the assay format used.
  • Other hybridization assays include, for example, Northern blots and RNase protection assays, which can be used to determine the abundance and integrity of different RNA splice variants, and Southern blots, which can be used to determine the copy number and integrity of DNA.
  • a Mucorales CotH hybridization probe can be labeled with any suitable detectable moiety, such as a radioisotope, fluorochrome, chemiluminescent marker, biotin, or other detectable moiety known in the art that is detectable by analytical methods.
  • detectable moiety such as a radioisotope, fluorochrome, chemiluminescent marker, biotin, or other detectable moiety known in the art that is detectable by analytical methods.
  • Useful assays for detecting a Mucorales CotH nucleic acid in a sample based on amplifying a Mucorales CotH nucleic acid with two or more Mucorales CotH oligonucleotides are also well known in the art, and include, for example, qualitative or quantitative polymerase chain reaction (PCR); reverse-transcription PCR (RT-PCR); single strand conformational polymorphism (SSCP) analysis, which can readily identify a single point mutation in DNA based on differences in the secondary structure of single-strand DNA that produce an altered electrophoretic mobility upon non-denaturing gel
  • PCR polymerase chain reaction
  • RT-PCR reverse-transcription PCR
  • SSCP single strand conformational polymorphism
  • the amplified Mucorales CotH nucleic acid can be sequenced to detect mutations and mutational hot-spots, and specific assays for large-scale screening of samples to identify such mutations can be developed.
  • the invention further provides an isolated Mucorales CotH polypeptides, immunogenic fragment thereof, or a functional fragment thereof, encoded by a Mucorales CotH nucleic acid of the invention.
  • the invention provides a polypeptide comprising the same or substantially the same amino acid sequence as set forth in SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32.
  • a Mucorales CotH polypeptide encoded by a nucleotide sequence comprising the same or substantially the same nucleotide sequence as set forth in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
  • substantially the same amino acid sequence refers to amino acid sequences having at least about 65% identity with respect to the reference amino acid sequence, and retaining comparable functional and biological activity characteristic of the protein defined by the reference amino acid sequence.
  • proteins having substantially the same amino acid sequence will have at least 65% identity, at least 70%> identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, or at least 99% identity.
  • Mucorales CotH are functional fragments or polypeptide analogs thereof.
  • the term "functional fragment” refers to a peptide fragment that is a portion of a full length Mucorales CotH protein, provided that the portion has a biological activity, as defined herein, that is characteristic of the
  • the functional fragments of the invention can bind to the GRP78 protein or more specifically the functional fragments of the invention can bind to the GRP78 protein expressed by epithelial cells.
  • the invention also provides functional fragments of invention Mucorales CotH proteins, which can be identified using the binding and routine methods, such as bioassays described herein.
  • polypeptide when used in reference to
  • Mucorales CotH is intended to refer to a peptide or polypeptide of two or more amino acids.
  • polypeptide analog includes any polypeptide having an amino acid residue sequence substantially the same as a sequence specifically described herein in which one or more residues have been conservatively substituted with a functionally similar residue and which displays the ability to functionally mimic a Mucorales CotH as described herein.
  • a "modification" of a Mucorales CotH polypeptide also encompasses conservative substitutions of a Mucorales CotH polypeptide amino acid sequence.
  • amino acids that belong within the following groups: (1) non-polar amino acids (Gly, Ala, Val, Leu, and He); (2) polar neutral amino acids (Cys, Met, Ser, Thr, Asn, and Gin); (3) polar acidic amino acids (Asp and Glu); (4) polar basic amino acids (Lys, Arg and His); and (5) aromatic amino acids (Phe, Trp, Tyr, and His).
  • non-polar amino acids Gly, Ala, Val, Leu, and He
  • Cys polar neutral amino acids
  • Asp and Glu polar acidic amino acids
  • polar basic amino acids Lithys, Arg and His
  • aromatic amino acids Phe, Trp, Tyr, and His
  • the amino acid length of functional fragments or polypeptide analogs of the present invention can range from about 5 amino acids up to the full-length protein sequence of an invention Mucorales CotH.
  • the amino acid lengths include, for example, at least about 10 amino acids, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250 or more amino acids in length up to the full-length Mucorales CotH protein sequence.
  • the functional fragments can be contiguous amino acid sequences of a Mucorales CotH polypeptide, including contiguous amino acid sequences of SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32.
  • the invention provides an immunogenic fragment of the Mucorales CotH polypeptides disclosed herein.
  • the immunogenic fragments of the invention can include immunogenic epitopes, which can be identified using experimental methods well known in the art. Additionally, computational modeling can also be used to identify immunogenic epitopes. See, for example, Tong et al. ⁇ Brief Bioinform. 8(2):96- 108 (2006)) and Ponomarenko et al. (2008) "B-cell epitope prediction," in Structural Bioinformatics, Bourne PE and Gu J (eds) Wiley-Liss; 2 edition, pgs. 849-879.
  • an immunogenic fragment of the Mucorales CotH polypeptides disclosed herein can include the amino acid sequence GAGKKHNNAKQSWNW (SEQ ID NO: 39) or MGQTNDGAYRDPTDNNK (SEQ ID NO: 40).
  • the protein can be truncated or fragmented without losing the essential qualities as an immunogenic vaccine.
  • a protein can be truncated to yield an N-terminal fragment by truncation from the C-terminal end with preservation of the functional properties of the molecule as an immunogenic.
  • C-terminal fragments can be generated by truncation from the N-terminal end with preservation of the functional properties of the molecule as an immunogenic.
  • Other modifications in accordance with the teachings and guidance provided herein can be made pursuant to this invention to create other polypeptide functional fragments, immunogenic fragments, variants, analogs or derivatives thereof, to achieve the therapeutically useful properties described herein with the native proteins.
  • the term "immunogenic fragment” as it is used herein refers to a portion of a protein that is recognized by a T-cell and/or B-cell antigen receptor.
  • the immunogenic portion generally includes at least 5 amino acid residues, or alternatively at least 6, or alternatively at least 7, or alternatively at least 8, or alternatively at least 9, or alternatively at least 10, or alternatively at least 11, or alternatively at least 12, or alternatively at least 13, or alternatively at least 14, or alternatively at least 15, or alternatively at least 16, or alternatively at least 17, or alternatively at least 18, or alternatively at least 18, or alternatively at least 19, or alternatively at least 20, or alternatively at least 25, or alternatively at least 30, or alternatively at least 50, or alternatively at least 100 amino acid residues of a CotH polypeptide disclosed herein.
  • the immunogenic portion can include at most 5 amino acid residues, or alternatively at most 6, or alternatively at most 7, or alternatively at most 8, or
  • immunogenic portions can contain a small N-and/or C-terminal fragment (e.g., 5-30 amino acids, preferably 10-25 amino acids).
  • a modification of a polypeptide can also include derivatives, analogues and functional mimetics thereof, provided that such polypeptide displays the Mucorales CotH biological activity.
  • derivatives can include chemical modifications of the polypeptide such as alkylation, acylation, carbamylation, iodination, or any modification that derivatizes the polypeptide.
  • derivatized molecules include, for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups,
  • t-butyloxycarbonyl groups chloroacetyl groups or formyl groups.
  • Free carboxyl groups can be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides.
  • Free hydroxyl groups can be derivatized to form O-acyl or O-alkyl derivatives.
  • the imidazole nitrogen of histidine can be derivatized to form
  • N-im-benzylhistidine also included as derivatives or analogues are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids, for example, 4-hydroxyproline, 5 -hydroxy lysine, 3-methylhistidine, homoserine, ornithine or carboxyglutamate, and can include amino acids that are not linked by peptide bonds.
  • Polypeptides of the present invention also include any polypeptide having one or more additions and/or deletions of residues, relative to the sequence of a polypeptide whose sequence is shown herein, so long as Mucorales CotH activity is maintained.
  • the invention provides an isolated Mucorales CotH polypeptides, immunogenic fragment thereof, or functional fragment thereof.
  • the invention Mucorales CotH polypeptides can be isolated by a variety of methods well-known in the art, for example, recombinant expression systems, precipitation, gel filtration, ion-exchange, reverse-phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al., Guide to Protein Purification: Methods in Enzymology, Vol. 182, (Academic Press, (1990)). Alternatively, the isolated polypeptides of the present invention can be obtained using well-known recombinant methods (see, for example, Sambrook et al, supra, 1989; Ausubel et al, supra, 1999). The methods and conditions for biochemical purification of a polypeptide of the invention can be chosen by those skilled in the art, and purification monitored, for example, by an immunological assay or a functional assay.
  • An example of the means for preparing the invention polypeptide(s) is to express nucleic acids encoding Mucorales CotH in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell such as an oocyte, or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well-known purification methods, so described herein.
  • a suitable host cell such as a bacterial cell, a yeast cell, an amphibian cell such as an oocyte, or a mammalian cell
  • Recombinantly expressed polypeptides of the invention can also be expressed as fusion proteins with appropriate affinity tags, such as glutathione S transferase (GST) or poly His, and affinity purified.
  • GST glutathione S transferase
  • the invention polypeptide, biologically functional fragments, and functional equivalents thereof can also be produced by chemical synthesis.
  • synthetic polypeptides can be produced using Applied Biosystems, Inc. Model 43 OA or 431 A automatic peptide synthesizer (Foster City, CA) employing the chemistry provided by the manufacturer.
  • the present invention also provides compositions containing an acceptable carrier and any of an isolated, purified Mucorales CotH mature protein or functional polypeptide fragments thereof, alone or in combination with each other.
  • acceptable carrier encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil and water emulsion, and various types of wetting agents.
  • the invention thus provides a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a compound selected from the group consisting of a Mucorales CotH polypeptide, an immunogenic fragment thereof, or a functional fragment thereof as described herein, an antisense nucleic acid as described herein or an anti-Mucorales CotH antibody as described herein.
  • the invention additionally provides a method of treating or preventing mucormycosis in a subject in need thereof by
  • the invention additionally provides a method of treating or preventing mucormycosis in a subject in need thereof by administering an therapeutically effective amount of a vaccine composition as disclosed herein.
  • antisense-nucleic acids having a sequence capable of binding specifically with full-length or any portion of an mR A that encodes Mucorales CotH polypeptides so as to prevent translation of the mRNA.
  • the antisense-nucleic acid can have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding Mucorales CotH polypeptides.
  • binding specifically encompasses the ability of a nucleic acid sequence to recognize a
  • an antisense-nucleic acid is an antisense-nucleic acid comprising chemical analogs of nucleotides.
  • the present invention provides means to modulate levels of expression of
  • Mucorales CotH polypeptides by recombinantly expressing Mucorales CotH anti-sense nucleic acids or employing synthetic anti-sense nucleic acid compositions (hereinafter SANC) that inhibit translation of mRNA encoding these polypeptides.
  • SANC synthetic anti-sense nucleic acid compositions
  • Synthetic oligonucleotides, or other antisense-nucleic acid chemical structures designed to recognize and selectively bind to mRNA are constructed to be complementary to full-length or portions of an Mucorales CotH coding strand, including nucleotide sequences set forth in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
  • the SANC is designed to be stable in the blood stream for administration to a subject by injection, or in laboratory cell culture conditions.
  • the SANC is designed to be capable of passing through the cell membrane in order to enter the cytoplasm of the cell by virtue of physical and chemical properties of the SANC, which render it capable of passing through cell membranes, for example, by designing small, hydrophobic SANC chemical structures, or by virtue of specific transport systems in the cell which recognize and transport the SANC into the cell.
  • the SANC can be designed for administration only to certain selected cell populations by targeting the SANC to be recognized by specific cellular uptake mechanisms which bind and take up the SANC only within select cell populations.
  • the SANC is an antisense oligonucleotide.
  • the SANC may be designed to bind to a receptor found only in a certain cell type, as discussed above.
  • the SANC is also designed to recognize and selectively bind to target mRNA sequence, which can correspond to a sequence contained within the sequences shown in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
  • the SANC is designed to inactivate target mRNA sequence by either binding thereto and inducing degradation of the mRNA by, for example, RNase I digestion, or inhibiting translation of mRNA target sequence by interfering with the binding of translation-regulating factors or ribosomes, or inclusion of other chemical structures, such as ribozyme sequences or reactive chemical groups which either degrade or chemically modify the target mRNA.
  • SANCs have been shown to be capable of such properties when directed against mRNA targets (see Cohen et al, TIPS, 10:435 (1989) and Weintraub, Sci. American, January (1990), pp.40).
  • compositions comprising an amount of the antisense-nucleic acid of the invention, effective to reduce expression of Mucorales CotH polypeptides by entering a cell and binding specifically to mRNA encoding Mucorales CotH polypeptides so as to prevent translation and an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein.
  • Suitable hydrophobic carriers are described, for example, in U.S. Patent Nos. 5,334,761; 4,889,953; 4,897,355, and the like.
  • the acceptable hydrophobic carrier capable of passing through cell membranes may also comprise a structure which binds to a receptor specific for a selected cell type and is thereby taken up by cells of the selected cell type.
  • Antisense-nucleic acid compositions are useful to inhibit translation of mRNA encoding invention polypeptides.
  • Synthetic oligonucleotides, or other antisense chemical structures are designed to bind to mRNA encoding Mucorales CotH polypeptides and inhibit translation of mRNA and are useful as compositions to inhibit expression of Mucorales CotH associated genes in a tissue sample or in a subject.
  • the invention also provides a method for expression of a Mucorales
  • CotH polypeptide by culturing cells containing a Mucorales CotH nucleic acid under conditions suitable for expression of Mucorales CotH .
  • a method for the recombinant production of a Mucorales CotH of the invention by expressing the nucleic acid sequences encoding Mucorales CotH in suitable host cells.
  • vector refers to a recombinant DNA or RNA plasmid or virus containing discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof.
  • the invention also provides vectors containing the Mucorales CotH nucleic acids of the invention.
  • Suitable expression vectors are well-known in the art and include vectors capable of expressing nucleic acid operatively linked to a regulatory sequence or element such as a promoter region or enhancer region that is capable of regulating expression of such nucleic acid.
  • Appropriate expression vectors include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.
  • vector means the vehicle by which a nucleic acid can be introduced into a host cell.
  • the vector can be used for propagation or harboring a nucleic acid or for polypeptide expression of an encoded sequence.
  • vectors include, for example, plasmids, phages and viruses. Exemplary vectors can be found described in, for example, Sambrook et al., supra; Ausubel et al., supra.
  • Promoters or enhancers can be constitutive or regulated.
  • the regulatory sequences or regulatory elements are operatively linked to a nucleic acid of the invention such that the physical and functional relationship between the nucleic acid and the regulatory sequence allows transcription of the nucleic acid.
  • Suitable vectors for expression in prokaryotic or eukaryotic cells are well known to those skilled in the art (see, for example, Ausubel et al, supra, 1999).
  • Vectors useful for expression in eukaryotic cells can include, for example, regulatory elements including the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like.
  • CMV cytomegalovirus
  • MMTV mouse mammary tumor virus
  • MMLV Moloney murine leukemia virus
  • the vectors of the invention are useful for subcloning and amplifying a Mucorales CotH nucleic acid molecule and for
  • a vector of the invention can include, for example, viral vectors such as a bacteriophage, a baculovirus or a retrovirus; cosmids or plasmids; and, particularly for cloning large nucleic acid molecules, bacterial artificial chromosome vectors (BACs) and yeast artificial chromosome vectors (YACs).
  • viral vectors such as a bacteriophage, a baculovirus or a retrovirus
  • cosmids or plasmids and, particularly for cloning large nucleic acid molecules, bacterial artificial chromosome vectors (BACs) and yeast artificial chromosome vectors (YACs).
  • BACs bacterial artificial chromosome vectors
  • YACs yeast artificial chromosome vectors
  • the invention additionally provides recombinant cells containing
  • Mucorales CotH nucleic acids of the invention are generated by introducing into a host cell a vector containing a Mucorales CotH nucleic acid molecule.
  • the recombinant cells are transducted, transfected or otherwise genetically modified.
  • Exemplary host cells that can be used to express recombinant Mucorales CotH molecules include mammalian primary cells; established mammalian cell lines, such as COS, CHO, HeLa, NIH3T3, HEK 293 and PC12 cells; amphibian cells, such as Xenopus embryos and oocytes; and other vertebrate cells.
  • Exemplary host cells also include insect cells such as Drosophila, yeast cells such as Saccharomyces cerevisiae, Saccharomyces pombe, or Pichia pastoris, and prokaryotic cells such as Escherichia coli.
  • the invention provides a vaccine composition having an immunogenic amount of a Mucorales CotH polypeptide, an immunogenic fragment thereof or a variant of the polypeptide.
  • the vaccine composition also can include an adjuvant.
  • the formulation of the vaccine composition of the invention is effective in inducing protective immunity in a subject by stimulating both specific humoral
  • the vaccine composition of the invention is also used in the treatment or prophylaxis of fungal infections such as, for example, mucormycosis.
  • the vaccine of the present invention will contain an immunoprotective quantity of Mucorales CotH polypeptide antigens and is prepared by methods well known in the art. The preparation of vaccines is generally described in, for example, M. F.
  • Mucorales CotH polypeptide, and peptide fragments or variants thereof can include immunogenic epitopes, which can be identified using methods known in the art and described in, for example, Geysen et al. Proc. Natl. Acad. Sci. USA 81 : 3998 (1984)). Briefly, hundreds of overlapping short peptides, e.g., hexapeptides, can be synthesized covering the entire amino acid sequence of the target polypeptide (i.e., Mucorales CotH). The peptides while still attached to the solid support used for their synthesis are then tested for antigenicity by an ELISA method using a variety of antisera.
  • immunogenic epitopes which can be identified using methods known in the art and described in, for example, Geysen et al. Proc. Natl. Acad. Sci. USA 81 : 3998 (1984)). Briefly, hundreds of overlapping short peptides, e.g., hexa
  • CotH protein can be obtained by known techniques, Kohler and Milstein, Nature 256: 495-499 (1975), and can be humanized to reduce antigenicity, see, for example, U.S. Patent No. 5,693,762, or produced in transgenic mice leaving an unrearranged human immunoglobulin gene, see, for example, U.S. Patent No. 5,877,397.
  • the peptide can be further tested for specificity by amino acid substitution at every position and/or extension at both C and/or N terminal ends.
  • Such epitope bearing polypeptides typically contain at least six to fourteen amino acid residues, and can be produced, for example, by polypeptide synthesis using methods well known in the art or by fragmenting an Mucorales CotH polypeptide.
  • Mucorales CotH polypeptide can be truncated or fragmented without losing the essential qualities as an immunogenic vaccine.
  • Mucorales CotH polypeptide can be truncated to yield an N-terminal fragment by truncation from the C- terminal end with preservation of the functional properties of the molecule as an immunogen.
  • C-terminal fragments can be generated by truncation from the N- terminal end with preservation of the functional properties of the molecule as an immunogen.
  • Other modifications in accord with the teachings and guidance provided herein can be made pursuant to this invention to create other Mucorales CotH polypeptide functional fragments, immunogenic fragments, variants, analogs or derivatives thereof, to achieve the therapeutically useful properties described herein with the native protein.
  • the vaccine compositions of the invention further contain conventional pharmaceutical carriers. Suitable carriers are well known to those of skill in the art.
  • compositions can be prepared in liquid unit dose forms.
  • Other optional components e.g., pharmaceutical grade stabilizers, buffers, preservatives, excipients and the like can be readily selected by one of skill in the art.
  • the compositions can be lyophilized and reconstituted prior to use.
  • the vaccine compositions can be prepared in any manner appropriate for the chosen mode of administration, e.g., intranasal administration, oral administration, etc.
  • the preparation of a pharmaceutically acceptable vaccine having due regard to pH, isotonicity, stability and the like, is within the skill of the art.
  • the immunogenicity of the vaccine compositions of the invention can further be enhanced if the vaccine further comprises an adjuvant substance.
  • the vaccine further comprises an adjuvant substance.
  • Various methods of achieving adjuvant effect for the vaccine are known. General principles and methods are detailed in "The Theory and Practical Application of Adjuvants", 1995,
  • Preferred adjuvants facilitate uptake of the vaccine molecules by antigen presenting cells (APCs), such as dendritic cells, and activate these cells.
  • APCs antigen presenting cells
  • Non-limiting examples are selected from the group consisting of an immune targeting adjuvant; an immune modulating adjuvant such as a toxin, a cytokine, and a mycobacterial derivative; an oil formulation; a polymer; a micelle forming adjuvant; a saponin; an immune targeting adjuvant; an immune modulating adjuvant such as a toxin, a cytokine, and a mycobacterial derivative; an oil formulation; a polymer; a micelle forming adjuvant; a saponin; an immune targeting adjuvant; an immune modulating adjuvant such as a toxin, a cytokine, and a mycobacterial derivative; an oil formulation; a polymer; a micelle forming adjuvant; a saponin; an
  • ISCOM® matrix immunostimulating complex matrix
  • DDA immunostimulating complex matrix
  • Liposome formulations are also known to confer adjuvant effects, and therefore liposome adjuvants are included according to the invention.
  • the vaccine compositions of the present invention can be used to treat, immunotherapeutically, subjects suffering from a variety of fungal infections.
  • vaccines that contain one or more of Mucorales CotH polynucleotides, polypeptides and/or antibody compositions described herein in combination with adjuvants, and that act for the purposes of prophylactic or therapeutic use, are also within the scope of the invention.
  • vaccines of the present invention will induce the body's own immune system to seek out and inhibit Mucorales CotH molecules.
  • vaccine refers to a composition that can be administered to an individual to protect the individual against an infectious disease.
  • Vaccines protect against diseases by inducing or increasing an immune response in an animal against the infectious disease.
  • An exemplary infectious disease amenable to treatment with the vaccines of the invention is mucormycosis.
  • the vaccine-mediated protection can be humoral and/or cell mediated immunity induced in host when a subject is challenged with, for example, Mucorales CotH or an immunogenic portion or fragment thereof.
  • adjuvant is intended to mean a composition with the ability to enhance an immune response to an antigen generally by being delivered with the antigen at or near the site of the antigen.
  • ability to increase an immune response is manifested by an increase in immune mediated protection.
  • Enhancement of humoral immunity can be determined by, for example, an increase in the titer of antibody raised to the antigen.
  • Enhancement of cellular immunity can be measured by, for example, a positive skin test, cytotoxic T-cell assay, ELISPOT assay for IFN-gamma or IL-2.
  • Adjuvants are well known in the art. Exemplary adjuvants include, for example, Freud's complete adjuvant, Freud's incomplete adjuvant, aluminum adjuvants, MF59 and QS21.
  • treating or "treatment,” as it is used herein is intended to mean an amelioration of a clinical symptom indicative of a fungal condition.
  • Amelioration of a clinical symptom includes, for example, a decrease or reduction in at least one symptom of a fungal condition in a treated individual compared to pretreatment levels or compared to an individual with a fungal condition.
  • the term "treating” also is intended to include the reduction in severity of a pathological condition, a chronic complication or an opportunistic fungal infection which is associated with a fungal condition. Such pathological conditions, chronic complications or opportunistic infections are exemplified below with reference to mucormycosis.
  • Mucormycosis and other such pathological conditions, chronic complications and opportunistic infections also can be found described in, for example, Merck Manual, Sixteenth Edition, 1992, and Spellberg et al, Clin. Microbio. Rev. 18:556-69 (2005).
  • the term "preventing” or "prevention,” as it is used herein is intended to mean a forestalling of a clinical symptom indicative of a fungal condition. Such forestalling includes, for example, the maintenance of normal physiological indicators in an individual at risk of infection by a fungus or fungi prior to the development of overt symptoms of the condition or prior to diagnosis of the condition. Therefore, the term “preventing” includes the prophylactic treatment of individuals to guard them from the occurrence of a fungal condition. Preventing a fungal condition in an individual also is intended to include inhibiting or arresting the development of the fungal condition.
  • Inhibiting or arresting the development of the condition includes, for example, inhibiting or arresting the occurrence of abnormal physiological indicators or clinical symptoms such as those described above and/or well known in the art. Therefore, effective prevention of a fungal condition would include maintenance of normal body temperature, weight, psychological state as well as lack of lesions or other pathological manifestations in an individual predisposed to a fungal condition.
  • Individuals predisposed to a fungal condition include an individual who is immunocompromised, for example, but not limited to, an individual with AIDS, azotemia, diabetes mellitus, diabetic ketoacidosis, neutropenia, bronchiectasis, emphysema, TB, lymphoma, leukemia, or burns, or an individual undergoing chemotherapy, bone marrow-, stem cell- and/or solid organ transplantation or an individual with a history of susceptibility to a fungal condition.
  • Inhibiting or arresting the development of the condition also includes, for example, inhibiting or arresting the progression of one or more pathological conditions, chronic complications or susceptibility to an opportunistic infection associated with a fungal condition.
  • a "subject,” “individual” or “patient” is used interchangeably herein, and refers to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, rats, rabbits, simians, bovines, ovines, porcines, canines, felines, farm animals, sport animals, pets, equines, and primates, particularly humans.
  • fungal condition refers to fungal diseases, infection, or colonization including superficial mycoses (i.e., fungal diseases of skin, hair, nail and mucous membranes; for example, ringworm or yeast infection), subcutaneous mycoses (i.e., fungal diseases of subcutaneous tissues, fascia and bone; for example, mycetoma, chromomycosis, or sporotichosis), and systemic mycoses (i.e., deep-seated fungal infections generally resulting from the inhalation of air-borne spores produced by causal moulds; for example, zygomycosis, aspergillosis, cryptococcosis, candidiasis, histoplasmosis, coccidiomycosis, paracoccidiomycosis, fusariosis (hyalohyphomycoses), blastomycosis, penicilliosis or sporotrichosis.
  • superficial mycoses i.e., fungal diseases of skin, hair
  • zygomycosis is intended to mean a fungal condition caused by fungi of the class Zygomycetes, comprised of the orders Mucorales and Entomophthorales.
  • the Entomophthorales are causes of subcutaneous and mucocutaneous infections known as entomophthoromycosis, which largely afflict immunocompetent hosts in developing countries.
  • Zygomycosis is also referred to as mucormycosis and the two terms are used interchangeably to refer to similar types of fungal infections.
  • Mucormycosis is intended to mean a fungal condition caused by fungi of the order Mucorales.
  • Mucormycosis is a life -threatening fungal infection almost uniformly affecting immunocompromised hosts in either developing or industrialized countries.
  • Fungi belonging to the order Mucorales are distributed into at least six families, all of which can cause cutaneous and deep infections.
  • Species belonging to the family Mucoraceae are isolated more frequently from patients with mucormycosis than any other family.
  • Rhizopus oryzae ⁇ Rhizopus arrhizus is a common cause of infection.
  • Mucoraceae family that cause a similar spectrum of infections include, for example, Rhizopus microsporus var. rhizopodiformis, Absidia corymbifera, Apophysomyces elegans, Mucor species, Rhizomucor pusillus and Cunninghamella spp
  • Mucormycosis is well known in the art and includes, for example, rinocerebral mucormycosis, pulmonary mucormycosis, gastrointestinal mucormycosis, disseminated mucormycosis, bone mucormycosis, mediastinum
  • mucormycosis trachea mucormycosis, kidney mucormycosis, peritoneum mucormycosis, superior vena cava mucormycosis or external otitis mucormycosis.
  • Fungi belonging to the order Mucorales are currently distributed into the families of Choanephoraceae; Cunninghamellaceae; Mucoraceae; Mycotyphaceae;
  • Umbelopsidaceae Each of these fungi families consists of one or more genera. For example, fungi belonging to the order Mucorales, family Mucoraceae, are further classified into the genera of Absidia (e.g., A. corymbifera); Actinomucor (e.g., A. elegans); Amylomyces (e.g., A. rouxii); Apophysomyces; Backusella (e.g., B. circina);
  • Absidia e.g., A. corymbifera
  • Actinomucor e.g., A. elegans
  • Amylomyces e.g., A. rouxii
  • Apophysomyces e.g., B. circina
  • Backusella e.g., B. circina
  • Benjaminiella e.g., B. multispora
  • Chaetocladium e.g., C. brefeldii
  • Circinella e.g., C. angarensis
  • Cokeromyces e.g., C. recurvatus
  • Dicranophora e.g., D.fulva
  • Ellisomyces e.g., E. anomalus; Helicostylum (e.g., H. elegans); Hyphomucor (e.g., H. assamensis); Kirkomyces (e.g., K. cordensis); Mucor (e.g., M. amphibiorum); Parasitella (e.g., P. parasitica); Philophora (e.g., P. agaricina); Pilaira (e.g., P. anomala); Pirella
  • Rhizomucor e.g., R. endophyticus
  • Rhizopodopsis e.g., R. javensis
  • Rhizopus e.g., S. umbellata
  • Syzygites e.g., S. megalocarpus
  • Thamnidium e.g., T. elegans
  • Thermomucor e.g., T. indicae-seudaticae
  • Zygorhynchus e.g., Z. calif orniensis
  • the genus Rhizopus for example, consists of R. azygosporus; R. caespitosus; R. homothallicus; R. oryzae; R. microsporus, R. microsporus var. rhizopodiformis and R. schipperae species.
  • immunogenic amount refers an effective amount of a particular epitope of a polypeptide of the invention or a fragment or variant thereof that can induce the host immune response against the polypeptide or the infectious agent expressing the polypeptide. This amount is generally in the range of 20 ⁇ g to 10 mg of antigen per dose of vaccine and depends on the subject to be treated, capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. The precise amount of immunogen required can be calculated by various methods such as, for example, antibody titration.
  • effective amount refers to an amount of a compound or compositions that is sufficient to provide a desired result.
  • an effective amount refers to an amount of a compound or composition (e.g., an antigen) that is sufficient to produce or elicit a protective immune response.
  • An effective amount with respect to an immunological composition is an amount that is sufficient to elicit an immune response, whether or not the response is protective.
  • the "therapeutically effective amount” will vary depending on the polypeptide, polynucleotide, antibody, antibody fragment or compositions, the disease and its severity and the age, weight, etc., of the patient to be treated all of which is within the skill of the attending clinician. It is contemplated that a therapeutically effective amount of one or more of a polynucleotide, polypeptide, antibody, antibody fragment or composition described herein will alter a fungal pathogen penetration through and damage of endothelial cells in the patient as compared to the absence of treatment. As such, fungal pathogenesis is decreased. A therapeutically effective amount is distinguishable from an amount having a biological effect (a "biologically effective amount").
  • a polypeptide, polynucleotide, antibody, antibody fragment or compositions of the present invention may have one or more biological effects in vitro or even in vivo, such as reducing function of a Mucorales CotH polypetide.
  • a biological effect may not result in any clinically measurable therapeutically effect as described herein as determined by methods within the skill of the attending clinician.
  • nucleic acids encoding the invention Mucorales
  • CotH polypeptides can be delivered into mammalian cells, either in vivo or in vitro using suitable vectors well-known in the art.
  • suitable vectors for delivering a Mucorales CotH polypeptide, an immunogenic fragment thereof, or a functional fragment thereof to a mammalian cell include viral vectors such as retroviral vectors, adenovirus, adeno- associated virus, lentivirus, herpesvirus, as well as non-viral vectors such as plasmid vectors.
  • viral vectors such as retroviral vectors, adenovirus, adeno- associated virus, lentivirus, herpesvirus, as well as non-viral vectors such as plasmid vectors.
  • Such vectors are useful for providing therapeutic or immunogenic amounts of a Mucorales CotH polypeptide (see, for example, U.S. Patent No. 5,399,346, issued March 21, 1995).
  • CotH polypeptides or nucleic acids therapeutically can be particularly useful when targeted to a muscel cell, bone marrow cell or B-cell, thereby presenting the encoded mucorales CotH polypeptide for development of an immune response. Such presentation is commonly known in the art as a DNA vaccination.
  • Viral based systems provide the advantage of being able to introduce relatively high levels of the heterologous nucleic acid into a variety of cells.
  • Suitable viral vectors for introducing invention nucleic acid encoding an Mucorales CotH protein into mammalian cells are well known in the art. These viral vectors include, for example, Herpes simplex virus vectors (Geller et al, Science, 241 : 1667-1669 (1988)); vaccinia virus vectors (Piccini et al, Meth. Enzymology, 153:545-563 (1987)); cytomegalovirus vectors (Mocarski et al, in Viral Vectors, Y. Gluzman and S.H.
  • Vectors useful for therapeutic administration of a Mucorales CotH polypeptide of nucleic acid can contain a regulatory element that provides tissue specific or inducible expression of an operatively linked nucleic acid.
  • tissue-specific promotor or enhancer that allows exparssion of a Mucorales CotH polypeptide or nucleic acid in a desired tissue or cell.
  • Any of a variety of inducible promoters or enhancers can also be included in the vector for regulatable expression of a Mucorales CotH polypeptide or nucleic acid.
  • inducible systems include, for example, tetracycline inducible system (Gossen & Bizard, Proc. Natl. Acad. Sci.
  • An inducible system particularly useful for therapeutic administration utilizes an inducible promotor that can be regulated to deliver a level of therapeutic product in response to a given level of drug administered to an individual and to have little or no expression of the therapeutic product in the absence of the drug.
  • One such system utilizes a Gal4 fusion that is inducible by an antiprogestin such as mifepristone in a modified adenovirus vector (Burien et al, Proc. Natl. Acad. Sci. USA, 96:355-360 (1999).
  • Another such inducible system utilizes the drug rapamycin to induce reconstitution of a transcriptional activator containing rapamycin binding domains of FKBP12 and FRAP in an adeno-associated virus vector (Ye et al, Science, 283:88-91 (1999)). It is understood that any combination of an inducible system can be combined in any suitable vector, including those disclosed herein. Such a regulatable inducible system is advantageous because the level of expression of the therapeutic product can be controlled by the amount of drug administered to the individual or, if desired, expression of the therapeutic product can be terminated by stopping administration of the drug.
  • the invention additionally provides an isolated anti-Mucorales CotH antibody having specific reactivity with a Mucorales CotH polypeptide, an immunogenic fragment thereof, or functional fragment thereof.
  • an anti-Mucorales CotH antibody of the invention can have specific reactivity to a polypeptide having the amino acid sequence GAGKKHNNAKQSWNW (SEQ ID NO: 39) or
  • the anti-Mucorales CotH antibody can be a monoclonal antibody or a polyclonal antibody.
  • the invention further provides cell lines producing monoclongal antibodies having specific reactivity with a Mucorales CotH polypeptide, an immunogenic fragment thereof, or functional fragment thereof.
  • the invention thus provides antibodies that specifically bind a Mucorales
  • CotH polypeptide As used herein, the term “antibody” is used in its broadest sense to include polyclonal and monoclonal antibodies, as well as antigen binding fragments of such antibodies. With regard to an anti-Mucorales CotH antibody of the invention, the term “antigen” means a native or synthesized Mucorales CotH polypeptide or fragment thereof. An anti-Mucorales CotH antibody, or antigen binding fragment of such an antibody, is characterized by having specific binding activity for a Mucorales CotH polypeptide or a peptide portion thereof of at least about 1 x 10 5 M "1 .
  • Fab, F(ab') 2 , Fd and Fv fragments of an anti-Mucorales CotH antibody which retain specific binding activity for a Mucorales CotH polypeptide, are included within the definition of an antibody.
  • Specific binding activity of a Mucorales CotH polypeptide can be readily determined by one skilled in the art, for example, by comparing the binding activity of an anti-Mucorales CotH antibody to a Mucorales CotH polypeptide versus a control polypeptide that is not a Mucorales CotH polypeptide.
  • Methods of preparing polyclonal or monoclonal antibodies are well known to those skilled in the art (see, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1988)).
  • antibodies of the invention can be naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, single chain antibodies, chimeric, bifunctional and humanized antibodies, as well as antigen- binding fragments thereof.
  • non-naturally occurring antibodies can be constructed using solid phase peptide synthesis, can be produced recombinantly or can be obtained, for example, by screening combinatorial libraries consisting of variable heavy chains and variable light chains as described by Huse et al. (Huse et al, Science 246: 1275-1281 (1989)).
  • Anti-Mucorales CotH antibodies can be raised using a Mucorales CotH immunogen such as an isolated Mucorales CotH polypeptide having the amino acid sequence of SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or an immunogenic fragment thereof, which can be prepared from natural sources or produced recombinantly, or a peptide portion of the Mucorales CotH polypeptide.
  • a Mucorales CotH polypeptide having the amino acid sequence of SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or an immunogenic fragment thereof, which can be prepared from natural sources or produced recombinantly, or a peptide portion of the Mucorales CotH polypeptide.
  • Such peptide portions of a Mucorales CotH polypeptide are functional antigenic fragments if the antigenic peptides can be used to generate a Mucorales CotH -specific antibody.
  • a non- immunogenic or weakly immunogenic Mucorales CotH polypeptide or portion thereof can be made immunogenic by coupling the hapten to a carrier molecule such as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH).
  • BSA bovine serum albumin
  • KLH keyhole limpet hemocyanin
  • an immunogenic fragment of the CotH polypeptides disclosed herein can be conjugated to a carrier molecule, such as, but not limited to KLH or BSA.
  • carrier molecules such as, but not limited to KLH or BSA.
  • carrier molecules and methods for coupling a hapten to a carrier molecule are well known in the art (see, for example, Harlow and Lane, supra, 1988).
  • CotH polypeptide fragment can also be generated by expressing the peptide portion as a fusion protein, for example, to glutathione S transferase (GST), polyHis or the like. Methods for expressing peptide fusions are well known to those skilled in the art (Ausubel et al, supra).
  • the invention further provides a method for detecting the presence of a
  • Mucorales organism in a sample by contacting a sample with a Mucorales CotH-specific antibody, and detecting the presence of specific binding of the antibody to the sample, thereby detecting the presence of a Mucorales CotH polypeptide in the sample.
  • Mucorales CotH specific antibodies can be used in diagnostic methods and systems to detect the level of Mucorales CotH present in a sample.
  • sample is intended to mean any biological fluid, cell, tissue, organ or portion thereof, that includes or potentially includes Mucorales CotH nucleic acids or polypeptides.
  • the term includes samples present in an individual as well as samples obtained or derived from the individual.
  • a sample can be a histologic section of a specimen obtained by biopsy, or cells that are placed in or adapted to tissue culture.
  • a sample further can be a subcellular fraction or extract, or a crude or substantially pure nucleic acid or protein preparation.
  • Mucorales CotH -specific antibodies can also be used for the
  • kits for detecting the presence of an invention Mucorales CotH protein in a cell comprising contacting the cell with an antibody that specifically binds to Mucorales CotH polypeptides under conditions permitting binding of the antibody to the Mucorales CotH polypeptides, detecting the presence of the antibody bound to the Mucorales CotH polypeptide, and thereby detecting the presence of invention polypeptides in a cell.
  • the antibodies can be used for in vitro diagnostic or in vivo imaging methods.
  • Mucorales CotH polypeptides in a sample include immunoassays that employ a detectable antibody.
  • immunoassays include, for example, immunohistochemistry,
  • An antibody can be made detectable by various means well known in the art.
  • a detectable marker can be directly attached to the antibody or indirectly attached using, for example, a secondary agent that recognizes the Mucorales CotH specific antibody.
  • Useful markers include, for example, radionucleotides, enzymes, binding proteins such as biotin, fluorogens, chromogens and chemiluminescent labels.
  • label and indicating means in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal. Any label or indicating means can be linked to invention nucleic acid probes, expressed proteins, polypeptide fragments, or antibody molecules. These atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well-known in clinical diagnostic chemistry.
  • the labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturation to form a fluorochrome (dye) that is a useful immunofluorescent tracer.
  • a fluorochrome a fluorochrome that is a useful immunofluorescent tracer.
  • a description of immunofluorescent analytic techniques is found in DeLuca, "Immunofluorescence Analysis", in Antibody As a Tool, Marchalonis et al, eds., John Wiley & Sons, Ltd., pp. 189-231 (1982), which is incorporated herein by reference.
  • the indicating group is an enzyme, such as horseradish peroxidase (HRP), glucose oxidase, and the like.
  • HRP horseradish peroxidase
  • radioactive elements are employed labeling agents.
  • the linking of a label to a substrate, i.e., labeling of nucleic acid probes, antibodies, polypeptides, and proteins, is well known in the art.
  • an invention antibody can be labeled by metabolic incorporation of radiolabeled amino acids provided in the culture medium. See, for example, Galfre et al., Meth. Enzymol., 73:3-46 (1981). Conventional means of protein conjugation or coupling by activated functional groups are particularly applicable.
  • invention nucleic acids, oligonucleotides, including antisense, vectors containing invention nucleic acids, transformed host cells, polypeptides and combinations thereof, as well as antibodies of the present invention can be used to screen compounds to determine whether a compound functions as a potential agonist or antagonist of invention polypeptides. These screening assays provide information regarding the function and activity of invention polypeptides, which can lead to the identification and design of compounds that are capable of specific interaction with one or more types of polypeptides, peptides or proteins .
  • the invention provides methods for identifying compounds which bind to Mucorales CotH polypeptides.
  • the invention proteins can be employed in a competitive binding assay. Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of binding to Mucorales CotH polypeptides. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention Mucorales CotH polypeptides.
  • Various binding assays to identify cellular proteins that interact with protein binding domains are known in the art and include, for example, yeast two-hybrid screening assays (see, for example, U.S. Patent Nos. 5,283,173, 5,468,614 and 5,667,973; Ausubel et al, supra, 1999; Luban et al, Curr. Opin. Biotechnol 6:59-64 (1995)) and affinity column chromatography methods using cellular extracts.
  • yeast two-hybrid screening assays see, for example, U.S. Patent Nos. 5,283,173, 5,468,614 and 5,667,973; Ausubel et al, supra, 1999; Luban et al, Curr. Opin. Biotechnol 6:59-64 (1995)
  • affinity column chromatography methods using cellular extracts.
  • a bioassay for identifying compounds which modulate the activity of invention Mucorales CotH polypeptides According to this method, invention polypeptides are contacted with an "unknown" or test substance, for example, in the presence of a reporter gene construct responsive to a Mucorales CotH signaling pathway, the activity of the polypeptide is monitored subsequent to the contact with the "unknown" or test substance, and those substances which cause the reporter gene construct to be expressed are identified as functional ligands for Mucorales CotH polypeptides.
  • reporter gene assays and systems are well known to those skilled in the art (Ausubel et al, supra, 1999).
  • a reporter gene constrict can be generated using the promoter region of
  • transformed host cells that recombinantly express invention polypeptides can be contacted with a test compound, and the modulating effect(s) thereof can then be evaluated by comparing the Mucorales CotH-mediated response, for example, via reporter gene expression in the presence and absence of test compound, or by comparing the response of test cells or control cells, to the presence of the compound.
  • a compound or a signal that modulates the activity of invention polypeptides refers to a compound or a signal that alters the activity of
  • Mucorales CotH polypeptides so that the activity of the invention polypeptide is different in the presence of the compound or signal than in the absence of the compound or signal.
  • compounds or signals include agonists and antagonists.
  • An agonist encompasses a compound or a signal that activates Mucorales CotH protein expression or biological activity.
  • an antagonist includes a compound or signal that interferes with Mucorales CotH expression or biological activity.
  • the effect of an antagonist is observed as a blocking of agonist-induced protein activation.
  • Antagonists include competitive and non-competitive antagonists.
  • Assays to identify compounds that modulate Mucorales CotH polypeptide expression can involve detecting a change in Mucorales CotH polypeptide abundance in response to contacting the cell with a compound that modulates Mucorales CotH activity.
  • Assays for detecting changes in polypeptide expression include, for example,
  • immunoassays with Mucorales CotH -specific Mucorales CotH antibodies such as immunoblotting, immunofluorescence, immunohistochemistry and immunoprecipitation assays, as described above.
  • control is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control" cell or culture is not exposed to the compound.
  • Another type of "control” cell or culture can be a cell or culture that is identical to the test cells, with the exception that the
  • control cells or culture do not express a Mucorales CotH polypeptide. Accordingly, the response of the transfected cell to a compound is compared to the response, or lack thereof, of the "control" cell or culture to the same compound under the same reaction conditions.
  • the invention further provides a method for modulating an activity mediated by a Mucorales CotH polypeptide by contacting the Mucorales CotH
  • the polypeptide with an effective, modulating amount of an agent that modulates Mucorales CotH activity.
  • the Mucorales CotH activity can be, for example, binding to GRP78.
  • the invention additionally provides a method of modulating the level of adhesion to a cell.
  • the invention provides a method of detecting a
  • Mucorales CotH nucleic acid molecule in a sample can include the steps of contacting a sample with two or more oligonucleotides disclosed herein, amplifying a nucleic acid molecule, and detecting the amplification. It is understood that methods for amplifying a nucleic acid are well known to one of skill in the art, which can be readily selected and applied to the methods of the invention. For example, in some aspects, the amplification is performed using polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • At least one of the two or more oligonucleotides used in the method of the invention includes an oligonucleotide having the nucleic acid sequence of ATGAAATTATCTATTATATCCGCTGCC (SEQ ID NO: 33),
  • AAACGTACCTGCTGACCGAATC SEQ ID NO: 37 or any oligonucleotide disclosed herein.
  • the invention further provides a method of diagnosing mucormycosis infection in a subject by detecting the presence of a Mucorales organism in a sample from the patient.
  • the method can include the steps of (a) providing a test sample from the subject; (b) contacting the sample with an agent that can binds a nucleic acid or a polypeptide of the invention under suitable conditions, wherein the conditions allow specific binding of the agent to the nucleic acid or polypeptide; and (c) comparing the amount of the specific binding in the test sample with the amount of specific binding in a control sample, wherein an increased or decreased amount of the specific binding in the test sample as compared to the control sample is diagnostic of mucormycosis infection.
  • the agent is selected from the group consisting of an anti- Mucorales CotH antibody or a CotH oligonucleotide as described herein.
  • diagnostic systems preferably in kit form, comprising at least one invention nucleic acid or antibody in a suitable packaging material.
  • the diagnostic kits containing nucleic acids are derived from the Mucorales CotH -encoding nucleic acids described herein.
  • the diagnostic nucleic acids are derived from any of SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31 and can be oligonucleotides of the invention.
  • at least one oligonucleotide comprises a nucleic acid seqeunce selected from
  • AAACGTACCTGCTGACCGAATC SEQ ID NO: 37
  • Invention diagnostic systems are useful for assaying for the presence or absence of nucleic acid encoding Mucorales CotH in either genomic DNA or mRNA.
  • a suitable diagnostic system includes at least one invention nucleic acid or antibody, as a separately packaged chemical reagent(s) in an amount sufficient for at least one assay.
  • the kit will generally contain two or more nucleic acids.
  • the kit will contain at least two oligonucleotides that can serve as primers for PCR.
  • Those of skill in the art can readily incorporate invention nucleic probes and/or primers or invention antibodies into kit form in combination with appropriate buffers and solutions for the practice of the invention methods as described herein.
  • Mucorales CotH antibody can contain a reaction cocktail that provides the proper conditions for performing an assay, for example, an ELISA or other immunoassay, for determining the level of expression of a Mucorales CotH polypeptide in a sample, and can contain control samples that contain known amounts of a Mucorales CotH polypeptide and, if desired, a second antibody specific for the anti-Mucorales CotH antibody.
  • an assay for example, an ELISA or other immunoassay, for determining the level of expression of a Mucorales CotH polypeptide in a sample
  • control samples that contain known amounts of a Mucorales CotH polypeptide and, if desired, a second antibody specific for the anti-Mucorales CotH antibody.
  • kits of the invention for example, Mucorales CotH nucleic acids or antibodies
  • packaging material preferably to provide a sterile, contaminant-free environment.
  • the packaging material contains instructions indicating how the materials within the kit can be employed both to detect the presence or absence of a particular Mucorales CotH sequence or Mucorales CotH polypeptide or to diagnose the presence of, or a predisposition for a condition associated with mucormycosis.
  • the instructions for use typically include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions, and the like.
  • the eluted peptides were loaded onto a CVC Microtech (Fontana, CA ) 35 mm length, 100 ⁇ ID C18 pre-Trap column and washed for 10 min with 100% Buffer A (2% acetonitrile containing 0.1% formic acid) at a flow rate of 5 ⁇ /min.
  • the peptides were separated on a 15 cm New Objective ProteoPep IntegraFrit column (Woburn, MA) using a flow rate of 300 nl/min.
  • the following elution gradient was used: 0-15 min 0-30%> Buffer B (98%> acetonitrile containing 0.1% formic acid), 15-20min 30-80% Buffer B and 20-22 min 80% Buffer B.
  • the column was then re-equilibrated for 13 min with Buffer A.
  • the eluting analytes were sprayed in positive mode into the LTQ-Orbitrap MS using electrospray ionization voltage of 2300 V, capillary voltage of 45 V, tube lens of 130 V, and capillary temperature of 200°C.
  • Information dependent acquisition was performed where the 6 most intense ions were selected in the m/z range of 300-1600 using a 60 K resolution FTMS scan and subjecting them to MS-MS using broadband collision induced disassociation of normalized collision energy of 35 and LTQ detection. Peaks were excluded from further MS-MS for a period of 60 sec.
  • a fourth ORF (R03G 16295) is widely present in other pathogenic fungi, but none of these ORFs appear to encode a protein that has an identified function. As sequence comparison between the identified CotH polypeptides and other bacterial CotH proteins shows very little sequence identity ( Figure 17 and Table 1).
  • CotH3 and to a lesser extent CotH2 were expressed in R. oryzae germlings interacting with human umbilical vein endothelial cells (Figure 4).
  • CotHl was expressed by R. oryzae spores but not germlings interacting with endothelial cells ( Figure 3).
  • FAR- Western analysis identified the 4th ORF (R03G 16295), this gene was not expressed by R. oryzae germlings interacting with endothelial cells.
  • S. cerevisiae expressing CotH3, and to a lesser extent CotH2, specifically bound endothelial cell GRP78 Figure 6). Heterologous expression of CotH3 in the non-adherent S.
  • CotH3 and CotH2 are Unique Mucorales Invasins that Bind to Endothelial Cell GRP78.
  • Lichtheimia corymbifera is also a clinical isolate obtained from the DEFEAT Mucor clinical study (Spellberg et al. (2102), J Antimicorbiol Chemother 67(3):715-22)
  • Mucorales were grown on potato dextrose agar (PDA, BD Diagnostic) plates for 3-5 days at 37°C, while A. fumigatus and C. albicans were grown on Sabouraud dextrose agar (SDA) plates for 2 weeks and 48 h at 37°C, respectively.
  • the sporangiospores were collected in endotoxin free Dulbecco's phosphate buffered saline (PBS) containing 0.01% Tween 80, washed with PBS, and counted with a hemocytometer to prepare the final inocula.
  • PBS endotoxin free Dulbecco's phosphate buffered saline
  • spores were collected in PBS after growing the organisms in YPD medium [1% yeast extract (Difco Laboratories), 2% bacto-peptone (Difco) and 2% glucose (Sigma)] at 30°C for overnight.
  • YPD medium 1% yeast extract (Difco Laboratories), 2% bacto-peptone (Difco) and 2% glucose (Sigma)] at 30°C for overnight.
  • spores were incubated in liquid YPD medium at 37°C with shaking for 1-3 h based on the assay under study.
  • Germlings were washed twice with RPMI 1640 without glutamine (Irvine Scientific) for all assays used except for isolating the endothelial cell receptor experiments in which the germlings were washed twice with PBS (plus Ca 2+ and Mg 2+ ).
  • the generated yeast expression vectors were independently transformed into yeast strain LL-20 by the polyethylene glycol-LiOAc method, and transformants were screened on the solid synthetic dextrose minimal medium lacking leucine. S. cerevisiae transformed with the empty plasmid served as control.
  • MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) were coupled with KLH and used to commercially vaccinate rabbits (ProMab Biotechnologies Inc., Richmond, CA). Purified IgG from the vaccinated rabbits were used to detect cell surface localization of CotH proteins on S. cerevisiae and on R. oryzae interacting with endothelial cells (Liu et al, J. Clin. Invest., 120: 1914-1924 (2010)).
  • spores were germinated in YPD for 3 hours at 37°C. Germlings were stained with the anti-CotH IgG at 1 :50, followed by FITC-labeled goat anti-rabbit IgG at 1 : 100.
  • Fluorescence data were collected with logarithmic amplifiers. The mean fluorescence intensities of 10 4 events were calculated using the CELLQUEST software.
  • Endothelial cells and Chinese Hamster Ovary (CHO) cells
  • Endothelial cells were collected from umbilical vein endothelial cells by the method of Jaffe et al. (Jaffe et al, J. Clin. Invest. 52:2745-2756 (1973)). The cells were harvested by using collagenase and were grown in M-199 (Gibco BRL) enriched with 10% fetal bovine serum, 10%> defined bovine calf serum, L-glutamine, penicillin, and streptomycin (all from Gemini Bio-Products, CA). Second-passage cells were grown to confluency in 96- well tissue culture plates (Costar, Van Nuys, CA) on fibronectin (BD Biosciences). All incubations were in 5%> C0 2 at 37°C.
  • CHO cell line C.l which was derived from parental DHFR-deficient CHO cells engineered to overexpress GRP78s were kind gifts of Dr. Randall Kaufman (Morris et al, J. Biol. Chem., 272:4327-4334 (1997); Reddy et al, J. Biol. Chem., 278:20915-20924 (2003)).
  • Endothelial cell membrane proteins were extracted according to the method of Isberg and Leong (Isberg and Leong, Cell 60:861-871 (1990)). Briefly, confluent endothelial cells in 100-mm diameter tissue culture dishes were rinsed twice with warm DPBS containing Ca 2+ and Mg 2+ (PBS-CM) and then incubated with Ez-Link Sulfo-NHS-LS Biotin (0.5 mg/ml, Pierce) in PBS-CM for 12 min at 37°C in 5% C0 2 . The cells were then rinsed extensively with cold PBS-CM and scraped from the tissue culture dishes.
  • PBS-CM DPBS containing Ca 2+ and Mg 2+
  • Ez-Link Sulfo-NHS-LS Biotin 0.5 mg/ml, Pierce
  • the endothelial cells were collected by centrifugation at 500 x g for 5 min at 4°C and then lysed by incubation for 20 min on ice in PBS-CM containing 5.8% n-octyl-B-D-glucopyranoside (w/v) (Cal BioChem) and protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 ⁇ g/ml pepstatin A, 1 ⁇ g/ml leupeptin, and 1 ⁇ g/ml aprotinin) (Sigma).
  • the cell debris was removed by centrifugation at 5000 x g for 5 min at 4°C.
  • the supernatant was collected and centrifuged at 100,000 x g for 1 h at 4°C.
  • the concentration of the endothelial cell proteins in the resulting supernatant was determined using Bradford method (Bio-Rad).
  • RNA interference (RNAi) technology (Ibrahim et al.,
  • the generated plasmid was transformed into R. oryzae pyrF mutant using the 53 biolistic delivery system (Skory, Mol. Genet. Genomics 268: 397-406 (2002)) (BioRad) and transformants were selected on minimal medium lacking uracil.
  • S. cerevisiae cells (8 x 10 8 ) expressing CotHl, CotH2, CotH3, or empty plasmid were incubated for 1 h on ice with 250 ⁇ g of biotin-labeled endothelial cell surface proteins in PBS-CM plus 1.5% n-octyl-B-D-glucopyranoside and protease inhibitors. The unbound endothelial cell proteins were washed away by three rinses with this buffer.
  • endothelial cell proteins that remained bound to the fungal cells were eluted twice with 6M urea (Fluka) and the supernatant was combined and concentrated to appropriate volume with a Microcon centrifugal filter (10,000 MWCO, Millipore). The proteins were then separated on 10% SDS-PAGE, and transferred to PVDF-plus membranes (GE Water& Process
  • the membrane was then treated with Western Blocking Reagent (Roche) and probed with a rabbit anti-GRP78 antibody (Abeam) followed with secondary antibodies of HRP-conjugated goat anti-rabbit IgG (Pierce), respectively. After incubation with
  • the cells were fixed in 3% paraformaldehyde and the cells were stained with 1% Uvitex (a kind gift from Jay Isharani, Ciba-Geigy, Greensboro, N.C.) for 1 hr, which specifically binds to the chitin of fungal cell wall.
  • Uvitex a kind gift from Jay Isharani, Ciba-Geigy, Greensboro, N.C.
  • the coverslips were mounted on a glass slide with a drop of ProLong Gold antifade reagent (Molecular Probes) and sealed with nail polish.
  • the total number of cell associated organisms (i.e. germlings adhering to monolayer) 54 was determined by phase-contrast microscopy. The same field was examined by
  • epifluorescence microscopy and the number of uninternalized germlings (which were brightly fluorescent) was determined.
  • the number of endocytosed organisms was calculated by subtracting the number of fluorescent organisms from the total number of visible organisms. At least 400 organisms were counted in 20-40 different fields on each slide. Two slides per arm were used for each experiment and the experiment was performed in triplicate on different days.
  • R. oryzae-induced endothelial or CHO cell damage was quantified by using a chromium ( 51 Cr) release assay (Ibrahim et al, J. Infect. Dis., 198: 1083-1090 (2008)). Briefly, endothelial cells or CHO cells grown in 96-well tissue culture plates containing detachable wells were incubated with 1 per well of Na 2 51 Cr0 4 (ICN, Irvine, CA) in M-199 medium (for endothelial cells) or Alpha minimum Eagle's medium (for CHO cells) for 16 h.
  • Na 2 51 Cr0 4 ICN, Irvine, CA
  • M-199 medium for endothelial cells
  • Alpha minimum Eagle's medium for CHO cells
  • the percentage of specific endothelial cell release of 51 Cr was calculated by the following formula: [(experimental release x 2)-(spontaneous release x 2)]/[total incorporation -(spontaneous release x 2)].
  • Each experimental condition was tested at least in triplicate and the experiment repeated at least once.
  • the assays were carried out as described above except for incubating endothelial cells with 50 g of anti-CotH antibodies (purified IgG) or with serum obtained from the same 55 rabbit prior to vaccination with CotH3 peptide predicted to be antigenic for 1 h prior to adding R. oryzae germlings.
  • mice >20g (Taconic Farms) were rendered
  • the lungs from three mice that were sacrificed immediately following inoculation were homogenized in PBS and quantitatively cultured on PDA plates containing 0.1% triton and colonies were counted following a 24 h incubation period at 37°C.
  • the primary efficacy endpoint was time to moribundity.
  • fungal burden in the lungs and brains was determined on day +2 post infection by qPCR assay as previously described (Ibrahim et al, Antimicrob. Agents Chemother., 49:721-727 (2005)). Values were expressed as logio spore equivalent/g of tissue.
  • Histopathological examination was carried out on sections of the harvested organs after fixing in 10% zinc formalin.
  • the fixed organs were embedded in paraffin, and 5 mm sections were stained with hematoxylin and eosin (H&E) or Periodic acid-Schiff stains to detect R. oryzae hyphae (Ibrahim et al., J. Clin. Invest.,
  • lungs and brains collected from mice 48 h post infection intratracheally with wild-type R. oryzae, or transformants with empty plasmid or with RNA-i construct were flash frozen in liquid nitrogen and process for RNA extraction using a Tri Reagent solution (Ambion). Reverse transcription was performed with RETROscript (Ambion) using primers listed in Table 3. For quantitative RT-PCR, SYBR green assays were performed .Constitutively expressed A CTI was used as a control for all reactions. Calculations and statistical analyses were performed using ABI PRISM 7000 Sequence Detection System User Bulletin 2 (Applied Biosystems). Passive immunization
  • MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) by intraperitoneal injection 2 hours prior to infecting the mice intratracheally as outlined above.
  • Control mice were infected similarly but received a similar dose from the same rabbit prior to vaccinating with the CotEO peptide.
  • Three days post infection a repeated dose of the antibody or the control serum (prior to vaccination) was introduced.
  • the primary efficacy endpoint was time to moribundity.
  • RO3G 05018, RO3G 08029, and R03G 11882) had limited homology of 17% at the amino acid level to CotH family of proteins implicated in spore coat formation from several bacteria (Giorno et al., J. Bacteriol., 189:691-705 (2007); Naclerio et al, J. Bacteriol, 178:6407 (1996)). These were named CotHl (RO3G 05018), CotH2 (RO3G 08029) and CotFB (R03G 11882).
  • the fourth ORF R03G 16295 is widely present in many fungi and some bacteria without an identified function.
  • CotH2 and CotFB are closely related to each other with 77% identity at the amino acid level, while CotHl is more distantly related ( Figure 5 lb).
  • the fourth ORF had an overall identity of 10% to the three CotH proteins at the amino acid level.
  • R. oryzae (delemar) 99-880 genome data base two more related ORFs were found (66%> homology at the amino acid level) and were predicted to encode GPI-anchored proteins.
  • These two ORFS (RO3G 09276; and RO3G 01139) had distant homology to CotHl, CotH2, CotH3 proteins (20-24% at the amino acid level).
  • These ORFs were named CotH4 and CotH5, respectively.
  • CotH2 and CotH3 are Expressed During Interaction of R. oryzae with Endothelial Cells.
  • CotH2 and CotFB were heterologously expressed in the none-adherent none invading S. cerevisiae.
  • the transformed yeast cells were tested for their ability to specifically bind endothelial cell GRP78.
  • Antibodies raised against two CotFB peptides predicted to be antigenic and surface expressed (GAGKKHNNAKQSWNW (SEQ ID NO: 39), and
  • MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) recognized S. cerevisiae expressing CotFB, and to a lesser extent CotH2, but not cells expressing CotHl ( Figure 53).
  • S. cerevisiae cells expressing CotFB primarily bound GRP78 from endothelial cell membrane protein extracts.
  • CotH2 expressing yeast cells also bound GRP78 from the same extract but S. cerevisiae expressing CotHl ( Figure 54A). These results indicated that CotH3, and to lesser extent CotH2, interact with endothelial cell GRP78 during invasion of R. oryzae of the endothelium. To confirm this hypothesis, the ability of the transformed yeast cells to adhere to and invade endothelial cells in vitro was examined.
  • S. cerevisiae expressing CotHl had no enhancement in adherence to or endocytosis (invasion) of endothelial cells.
  • yeast cells expressing CotH2 or CotH3 had multiple fold increase in adherence to and invasion of endothelial cells compared to S. cerevisiae expressing CotHl or those transformed with empty plasmid ( Figure 54B).
  • cells expressing CotH3 had significantly higher ability to adhere to and invade endothelial cells compared to yeast cells expressing CotH2.
  • the ability of S. cerevisiae expressing CotHl, CotH2, CotH3 or empty plasmid to adhere to and invade parent CHO cells were compared to CHO cells overexpressing GRP78 59
  • CotH3 Protein is a R. oryzae Invasin.
  • CotH2 expression was investigated to determine their impact on adherence, endocytosis, and endothelial cell damage.
  • RNA-i method Ibrahim et al., Mol. Microbiol, 77:587-604 (2010)
  • a -400 bp fragment was used to suppress both genes in one construct.
  • CotH2 and CotFB expression in two clones of R. oryzae pyrf mutant (Skory and (2004), Curr. Genet. 52:23-33 (2007)) transformed with the RNA-i construct harboring PyrF as a selection marker (i.e. Trans 2 and Trans 6) were almost entirely abrogated compared to R. oryzae pyrf mutant transformed with empty plasmid ( Figure 56A).
  • CotH2 and CotH3 are Required for Full Virulence of R. oryzae in vivo.
  • mice 61 infected with the RNA-i transformant had significantly less fungal burden in the lungs and brains (primary and secondary target organs) when compared to the same organs recovered from mice infected with wild type cells or those infected with the empty plasmid transformant ( Figure 58B).
  • mice organs infected with the three different strains were examined. Lungs harvested from mice infected with R. oryzae transformed with RNA-i construct had normal histology compared with lungs taken from mice infected with the wild type or R. oryzae transformed with the empty plasmid, which had an abundance of fungal abscesses characterized by phagocyte infiltration and substantial edema ( Figure 59).
  • Anti-CotH3p antibodies protect diabetic ketoacidotic mice from R. oryzae infection.
  • mice receiving the anti-CotH2 and anti-CotH3 rabbit IgG had a significantly enhanced survival time compared to mice receiving pre-vaccination serum from the same rabbit. Survival at day 21 post infection was 44% for the mice receiving antibodies raised against peptide GAGKKHNNAKQSWNW (SEQ ID NO: 39) vs. 0% survival for the mice receiving the control pre-vaccination IgG ( Figure 60A).
  • NASBA Nucleic Acid Sequence-Based Amplification
  • CotFB forward primer 5'- GATGACAATTATATTCCCAGC-3 ' (SEQ ID NO: 35)
  • CotFB reverse primer 5'- GAGTAGACGTAATTAGATCCAA-3 ' (SEQ ID NO: 36), Molecular beacon probe: 5 '-CGCGATCAAACGTACCTGCTGACCGAATCGATCGCG-3 ' (SEQ ID NO: 38)
  • RNAs from Aspergillus fumigatus, Candida albicans, and Rhizopus oryzae were isolated using an RNeasy ® Plant Mini Kit (Qiagen) according to manufacturer's instructions. Total RNA isolated from four different R. oryzae spores (10, 100, 1000, 10000 spores, respectively) were added to the NASBA reactions.
  • RNAs isolated from C. albicans and A. fumigatus were used as controls. 300 ng total RNA was added to each reaction.
  • NASBA reactions were performed with NucliSENS EasyQ Basic kit 63 v2 (bioMerieux bv, Boxtel, NL) according to manufacturer's instructions.
  • the NASBA reaction volume was 20 ⁇ (per reaction) in MicroAmp ® 96-Well Reaction Plate (Applied Biosystems) and contained 5.4 ⁇ of sterile water, 0.4 ⁇ of each primer, 0.2 ⁇ probe, 4 ⁇ of 5 x NASBA buffer.
  • 5 ⁇ of purified RNA (300 ng) or water (when preparing no template controls) was added to the premix. Reaction mixtures were
  • the CotH3 molecular beacon primers/probe showed differential detection of fungal species, i.e.
  • the CotH3 molecular beacon primers/probe showed highly sensitive detection of R. oryzae.
  • Fungal spores were germinated in YPD broth for 3 hours at 37°C shaker.
  • ⁇ of samples containing 10 to 10 5 of germlings were aliquoted into 250 ⁇ of sheep blood.
  • Total RNA was isolated from the spiked blood samples with RNeasy Plant Mini Kit (Qiagen) and eluted in 30 ⁇ elution buffer. Five microliter of the total RNA was added to each NASBA reaction. Applification products were detected in all samples, include samples inoculated with only 10 germlings ( Figure 62).
  • the CotH3 molecular beacon primers showed not only highly sensitive detection of R. oryzae, but also a robust specificity.
  • Fresh R. oryzae, A. fumigatus and C. albicans spores were collected, counted and aliquoted into 10 ⁇ of YPD broth each. 350 ⁇ of sheep blood was added into each tube and incubated for 24 hours at 37°C shaker.
  • Total RNA was isolated with RNeasy Plant Mini Kit (Qiagen) and eluted in 30 ⁇ in elution buffer. Five microliter of the RNA was added to each NASBA reaction. No amplification products were detected in samples inoculated with 10 6 spores of A. fumigatus or C. albicans, whereas each sample inoculated with 10 to 10 4 spores of R. oryzae were detectable (Figure 63).
  • Rhizopus species Fresh R. oryzae (99-880 and 99-892 isolates) and ?. microsporias spores (1000 spores each) were aliquoted into 10 ⁇ of YPD broth. 350 ⁇ of sheep blood was added into each tube and incubated for 24 hours at 37°C shaker. Total R A was isolated with R easy Plant Mini Kit (Qiagen) and eluted in 30 ⁇ in elution buffer. Five microliter of the RNA was added to each NASBA reaction. Not only were samples containing R. oryzae 99- 892 spores detectable, but samples containing R. oryzae 99-880 (R1000) and R.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Botany (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Communicable Diseases (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2012/055659 2011-09-15 2012-09-14 IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING CotH Ceased WO2013040517A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CN201280056226.2A CN103998057A (zh) 2011-09-15 2012-09-14 利用CotH的毛霉菌病的免疫疗法和诊断
AU2012308240A AU2012308240A1 (en) 2011-09-15 2012-09-14 Immunotherapy and diagnosis of mucormycosis using CotH
EP12831998.5A EP2755681B1 (en) 2011-09-15 2012-09-14 IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING CotH
JP2014530916A JP2014528715A (ja) 2011-09-15 2012-09-14 CotHを用いたムコール菌症の免疫療法および診断法
CA2848765A CA2848765A1 (en) 2011-09-15 2012-09-14 Immunotherapy and diagnosis of mucormycosis using coth

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161535257P 2011-09-15 2011-09-15
US61/535,257 2011-09-15

Publications (2)

Publication Number Publication Date
WO2013040517A2 true WO2013040517A2 (en) 2013-03-21
WO2013040517A3 WO2013040517A3 (en) 2013-07-18

Family

ID=47884011

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/055659 Ceased WO2013040517A2 (en) 2011-09-15 2012-09-14 IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING CotH

Country Status (7)

Country Link
US (3) US9279002B2 (https=)
EP (1) EP2755681B1 (https=)
JP (1) JP2014528715A (https=)
CN (1) CN103998057A (https=)
AU (1) AU2012308240A1 (https=)
CA (1) CA2848765A1 (https=)
WO (1) WO2013040517A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4334344A4 (en) * 2021-05-06 2025-07-02 Lundquist Inst For Biomedical Innovation At Harbor Ucla Medical Center COTH3 BINDING AGENTS AND THEIR USES

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10465233B2 (en) * 2016-03-25 2019-11-05 The Government Of The United States Of America, As Represented By The Secretary Of The Navy Time-resolved nucleic acid hybridization beacons
US10960002B2 (en) 2016-05-13 2021-03-30 The Brigham And Women's Hospital, Inc. Volatile metabolite profiles for the diagnosis and treatment of Mucorales fungi
US10877037B2 (en) 2016-11-21 2020-12-29 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Fungal toxins and methods related to the same
CN114324896A (zh) * 2021-12-31 2022-04-12 菲鹏生物股份有限公司 特异性结合mucoricin蛋白的试剂的用途和毛霉菌检测试剂盒
CN114568490B (zh) * 2022-04-01 2023-12-19 眉山职业技术学院(眉山技师学院) 雷帕霉素在抑制柑橘青霉菌生长中的应用

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4405712A (en) 1981-07-01 1983-09-20 The United States Of America As Represented By The Department Of Health And Human Services LTR-Vectors
US4493795A (en) 1983-10-17 1985-01-15 Syntex (U.S.A.) Inc. Synthetic peptide sequences useful in biological and pharmaceutical applications and methods of manufacture
US4650764A (en) 1983-04-12 1987-03-17 Wisconsin Alumni Research Foundation Helper cell
WO1989005345A1 (en) 1987-12-11 1989-06-15 Whitehead Institute For Biomedical Research Genetic modification of endothelial cells
US4889953A (en) 1986-07-22 1989-12-26 Takeda Chemical Industries, Ltd. Glycerol derivatives, their production and use
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
WO1990006997A1 (en) 1988-12-13 1990-06-28 United States Government As Represented By The Secretary Of The Department Of Health And Human Services Genetically engineered endothelial cells and use thereof
WO1992005266A2 (en) 1990-09-21 1992-04-02 Viagene, Inc. Packaging cells
WO1992007573A1 (en) 1990-10-31 1992-05-14 Somatix Therapy Corporation Genetic modification of endothelial cells
WO1992014829A1 (en) 1991-02-19 1992-09-03 The Regents Of The University Of California Viral particles having altered host range
US5252479A (en) 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
US5283173A (en) 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5334761A (en) 1992-08-28 1994-08-02 Life Technologies, Inc. Cationic lipids
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
US5693762A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Humanized immunoglobulins
US5877397A (en) 1990-08-29 1999-03-02 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003018051A1 (en) * 2001-08-27 2003-03-06 Vic Jira Anti-fungal composition
GB0205378D0 (en) * 2002-03-07 2002-04-24 Royal Holloway University Of L Bacterial spores
WO2008017483A2 (en) 2006-08-09 2008-02-14 Dsm Ip Assets B.V. Spore surface displays of bioactive molecules
BRPI0906060A2 (pt) * 2008-02-28 2015-12-01 3M Innovative Properties Co anticorpos isolados, métodos de preparo de um anticorpo anti-clostridium difficile, composição e método para a detecção da presença de um esporo de clostridium difficile em uma amostra
NZ614255A (en) 2009-03-19 2015-03-27 Los Angeles Biomed Res Inst Vaccine compositions and methods for treatment of mucormycosis and other fungal diseases
US20110059111A1 (en) * 2009-09-01 2011-03-10 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Mammalian receptors as targets for antibody and active vaccination therapy against mold infections

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4405712A (en) 1981-07-01 1983-09-20 The United States Of America As Represented By The Department Of Health And Human Services LTR-Vectors
US4650764A (en) 1983-04-12 1987-03-17 Wisconsin Alumni Research Foundation Helper cell
US4493795A (en) 1983-10-17 1985-01-15 Syntex (U.S.A.) Inc. Synthetic peptide sequences useful in biological and pharmaceutical applications and methods of manufacture
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4889953A (en) 1986-07-22 1989-12-26 Takeda Chemical Industries, Ltd. Glycerol derivatives, their production and use
WO1989005345A1 (en) 1987-12-11 1989-06-15 Whitehead Institute For Biomedical Research Genetic modification of endothelial cells
WO1990006997A1 (en) 1988-12-13 1990-06-28 United States Government As Represented By The Secretary Of The Department Of Health And Human Services Genetically engineered endothelial cells and use thereof
US5693762A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Humanized immunoglobulins
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
US5468614A (en) 1990-01-24 1995-11-21 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5283173A (en) 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5667973A (en) 1990-01-24 1997-09-16 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5877397A (en) 1990-08-29 1999-03-02 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
WO1992005266A2 (en) 1990-09-21 1992-04-02 Viagene, Inc. Packaging cells
WO1992007573A1 (en) 1990-10-31 1992-05-14 Somatix Therapy Corporation Genetic modification of endothelial cells
WO1992014829A1 (en) 1991-02-19 1992-09-03 The Regents Of The University Of California Viral particles having altered host range
US5252479A (en) 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
US5334761A (en) 1992-08-28 1994-08-02 Life Technologies, Inc. Cationic lipids

Non-Patent Citations (99)

* Cited by examiner, † Cited by third party
Title
"Clinical Mycology", 2003, OXFORD UNIVERSITY PRESS
"Medical Mycology", 1992, LEA & FEBIGER
"Merck Manual", 1992
"The Theory and Practical Application of Adjuvants", 1995, JOHN WILEY & SONS LTD
"Vaccine Ajuvants: Preparation Methods and Research Protocols (Methods in Molecular Medicine", 2000, HUMANA PRESS
"Vaccine Design (the subunit and adjuvant approach", 1995, PLENUM PRESS
"Vaccine Protocols (Methods in Molecular Medicine", 2003, HUMANA PRESS
"Vaccines: New Generationn Immunological Adjuvants", 1995, PLENUM PRESS
AURAMEAS ET AL., SCAND. J. IMMUNOL., vol. 8, no. 7, 1978, pages 7 - 23
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1999, JOHN WILEY AND SONS
BEARER ET AL., JOURNAL OF CLINICAL MICROBIOLOGY, vol. 32, 1994, pages 1823 - 24
BERKNER, BIOTECHNIQUES, vol. 6, 1988, pages 616 - 626
BLAESE ET AL., SCIENCE, vol. 270, 1995, pages 475 - 479
BORRABECK: "Antibody Engineering", 1995, OXFORD UNIVERSITY PRESS
BURIEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 355 - 360
COHEN ET AL., TIPS, vol. 10, 1989, pages 435
COHEN-ABBO ET AL., CLINICAL INFECTIOUS DISEASES, vol. 17, 1993, pages 173 - 77
COTTEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 6094 - 6098
DANOS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 6460 - 6464
DELUCA ET AL.: "Antibody As a Tool", 1982, JOHN WILEY & SONS, LTD., article "Immunofluorescence Analysis", pages: 189 - 231
DEUTSCHER ET AL.: "Guide to Protein Purification: Methods in Enzvmology", vol. 182, 1990, ACADEMIC PRESS
DONAHUE ET AL., NATURE MED., vol. 4, 1998, pages 181 - 186
GALFRE ET AL., METH. ENZYMOL., vol. 73, 1981, pages 3 - 46
GELLER ET AL., SCIENCE, vol. 241, 1988, pages 1667 - 1669
GEYSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 3998
GIORNO ET AL., J. BACTERIOL., vol. 189, 2007, pages 691 - 705
GLEISSNER ET AL., LEUK. LYMPHOMA, vol. 45, no. 7, 2004, pages 1351 - 60
GOLDMAN ET AL., HUMAN GENE THERAPY, vol. 10, 1997, pages 2261 - 2268
GOSSEN ET AL., SCIENCE, vol. 268, 1995, pages 1766 - 1769
GOSSEN; BIZARD, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 5547 - 5551
GRAHAM ET AL., METH. MOL. BIOL., vol. 7, 1991, pages 109 - 127
GREELISH ET AL., NATURE MED., vol. 5, 1999, pages 439 - 443
HARLOW; LANE: "Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS
HARLOW; LANE: "Using Antibodies: A Laboratory Manual", 1999, COLD SPRING HARBOR PRESS
HERZOG ET AL., NATURE MED., vol. 5, 1999, pages 56 - 63
HILYARD ET AL.: "Protein Engineering: A practical approach", 1992, IRL PRESS
HUSE ET AL., SCIENCE, vol. 246, 1989, pages 1275 - 1281
IBRAHIM ET AL., ANTIMICROB. AGENTS CHEMOTHER., vol. 47, 2003, pages 3343 - 3344
IBRAHIM ET AL., ANTIMICROB. AGENTS CHEMOTHER., vol. 49, 2005, pages 721 - 727
IBRAHIM ET AL., INFECT. IMMUN., vol. 63, 1995, pages 4368 - 4374
IBRAHIM ET AL., INFECT. IMMUN., vol. 73, 2005, pages 778 - 783
IBRAHIM ET AL., J INFECT. DIS., vol. 198, 2008, pages 1083 - 1090
IBRAHIM ET AL., J. CLIN. INVEST., vol. 117, 2007, pages 2649 - 2657
IBRAHIM ET AL., MOL. MICROBIOL., vol. 77, 2010, pages 587 - 604
IBRAHIM ET AL., ZYGOMYCOSIS, pages 241 - 251
ISBERG; LEONG, CELL, vol. 60, 1990, pages 861 - 871
JAFFE ET AL., J. CLIN. INVEST., vol. 52, 1973, pages 2745 - 2756
KAFRI ET AL., NATURE GENETICS, vol. 17, 1997, pages 314 - 317
KAMALAM; THAMBIAH, SABOURAUDIA, vol. 18, 1980, pages 19 - 20
KEMNA ET AL., JOURNAL OF CLINICAL MICROBIOLOGY, vol. 32, 1994, pages 843 - 45
KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495 - 499
KONTOYIANIS ET AL., CLINICAL INFECTIOUS DISEASES, vol. 18, 1994, pages 925 - 28
KONTOYIANNIS ET AL., CLIN. INFECT. DIS., vol. 30, no. 6, 2000, pages 851 - 6
KWON-CHUNG ET AL., AMERICAN JOURNAL OF CLINICAL PATHOLOGY, vol. 64, 1975, pages 544 - 48
KWON-CHUNG, K. J.; J. E. BENNETT, MUCORMYCOSIS, pages 524 - 559
LEE ET AL., NATURE, vol. 294, 1981, pages 228 - 232
LI ET AL., HUMAN GENE THERAPY, vol. 4, 1993, pages 403 - 409
LIU ET AL., J. CLIN. INVEST., vol. 120, 2010, pages 1914 - 1924
LIU ET AL., J. CLIN. INVEST., vol. 120, 2010, pages 1914 - 24
LUBAN ET AL., CURR. OPIN. BIOTECHNOL., vol. 6, 1995, pages 59 - 64
LYE ET AL., PATHOLOGY, vol. 28, 1996, pages 364 - 65
MARR ET AL., CLIN. INFECT. DIS., vol. 34, no. 7, 2002, pages 909 - 17
MERTENS ET AL., ARCHIVES OF MICROBIOLOGY, vol. 186, 2006, pages 41 - 50
MICHIELSE ET AL., MOL. GENET. GENOMICS, vol. 271, 2004, pages 499 - 510
MOCARSKI ET AL.: "Viral Vectors", 1988, COLD SPRING HARBOR LABORATORY, pages: 78 - 84
MORRIS ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 4327 - 4334
NACLERIO ET AL., J. BACTERIOL., vol. 178, 1996, pages 6407
NAKAYASHIKI ET AL., FUNGAL GENET. BIOL., vol. 42, 2005, pages 275 - 283
NO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 3346 - 3351
ONODERA ET AL., J. VIROL., vol. 72, 1998, pages 1769 - 1774
PICCINI ET AL., METH. ENZYMOLOGY, vol. 153, 1987, pages 545 - 563
PITARCH ET AL., ELECTROPHORESIS, vol. 20, 1999, pages 1001 - 1010
PITARCH ET AL., MOL. CELL. PROTEOMICS, vol. 5, 2006, pages 79 - 96
PONOMARENKO ET AL.: "Structural Bioinformatics", 2008, WILEY-LISS, article "B-cell epitope prediction", pages: 849 - 879
REDDY ET AL., J. BIOL. CHEM., vol. 278, 2003, pages 20915 - 20924
RIBES ET AL.: "Zygomycetes in Human Disease", CLIN MICROBIOL REV, vol. 13, 2000, pages 236 - 301
RODWELL ET AL., BIOTECH., vol. 3, 1984, pages 889 - 894
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORIES
See also references of EP2755681A4
SHACKLEFORD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 9655 - 9659
SHEVCHENKO ET AL., ANAL. CHEM., vol. 68, no. 5, 1996, pages 850 - 8
SHEVCHENKO ET AL., PROC NATL ACAD SCI U S A, vol. 93, 1996, pages 14440 - 14445
SKORY, CURR. MICROBIOL., vol. 47, 2003, pages 59 - 64
SKORY, MOL. GENET. GENOMICS, vol. 268, 2002, pages 397 - 406
SKORY; IBRAHIM, CURR. GENET., vol. 52, 2007, pages 23 - 33
SNYDER ET AL., NATURE MED., vol. 5, 1999, pages 64 - 70
SPELLBERG ET AL., CLIN. MICROBIO. REV., vol. 18, 2005, pages 556 - 69
SPELLBERG ET AL., CLIN. MICROBIOL. REV., vol. 18, 2005, pages 556 - 69
TONG ET AL., BRIEF BIOINFORM., vol. 8, no. 2, 2006, pages 96 - 108
VENTURA ET AL., CANCER, vol. 58, 1986, pages 1534 - 36
WANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 3906 - 3910
WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546
WEINTRAUB, SCI. AMERICAN, January 1990 (1990-01-01), pages 40
WESLEY ET AL., PLANT J., vol. 27, 2001, pages 581 - 590
WINTER; HARRIS, IMMUNOL. TODAY, vol. 14, 1993, pages 243 - 246
WU ET AL., NAT. PROTOC., vol. 2, 2007, pages 3278 - 3284
YAO ET AL., NATURE, vol. 366, 1993, pages 476 - 479
YE ET AL., SCIENCE, vol. 283, 1999, pages 88 - 91
ZABNER ET AL., NATURE GENETICS, vol. 6, 1994, pages 75 - 83

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4334344A4 (en) * 2021-05-06 2025-07-02 Lundquist Inst For Biomedical Innovation At Harbor Ucla Medical Center COTH3 BINDING AGENTS AND THEIR USES

Also Published As

Publication number Publication date
EP2755681B1 (en) 2018-06-27
US9279002B2 (en) 2016-03-08
US20130108642A1 (en) 2013-05-02
AU2012308240A1 (en) 2013-05-02
CN103998057A (zh) 2014-08-20
CA2848765A1 (en) 2013-03-21
WO2013040517A3 (en) 2013-07-18
EP2755681A4 (en) 2015-05-13
JP2014528715A (ja) 2014-10-30
US20190194301A1 (en) 2019-06-27
US20160159887A1 (en) 2016-06-09
EP2755681A2 (en) 2014-07-23

Similar Documents

Publication Publication Date Title
US20190194301A1 (en) Immunotherapy and diagnosis of mucormycosis using coth
Gebremariam et al. CotH3 mediates fungal invasion of host cells during mucormycosis
CA2372821C (en) Antimicrobial theta defensins and methods of using same
CN102574895B (zh) 作为针对念珠菌的主动和被动免疫接种的靶标的hyr1
WO2004108765A2 (en) Extracellular aspergillus polypeptides
US20120014995A1 (en) Pharmaceutical compositions and methods to vaccinate against disseminated candidiasis and other infectious agents
US20160130330A1 (en) Mammalian receptors as targets for antibody and active vaccination therapy against mold infections
US20100330070A1 (en) Methods Of Making An Antibody And Compositions Thereof
US20020034751A1 (en) Aspergillus fumigatus antigenic protein 1
WO2003018629A1 (en) Cage antigen
CN1948335B (zh) 白念珠菌菌丝调控因子基因及其用途
JP2008540453A (ja) 播種性カンジダ症および他の感染性因子に対してワクチン接種するための薬学的組成物および方法
US6020164A (en) Human RNA binding proteins
US6638734B1 (en) Nucleic acid encoding proteins involved in protein degradation, products and methods related thereto
US20030092083A1 (en) Cage antigen
KR101683002B1 (ko) 국균증 또는 아스퍼질루스증 치료를 위한 유전자 sppA 및 단백질 SppA의 용도
JPWO2013024517A1 (ja) アスペルギルスフミガーツス感染症の検査、予防及び治療のための方法並びに組成物
CN100480379C (zh) 白念珠菌ctd蛋白激酶基因及其用途
EP1185652A2 (en) Nucleic acid encoding proteins involved in protein degradation, products and methods related thereto
CN101712935A (zh) 白念珠菌毒力相关基因CaMSS11及其用途
CN100497380C (zh) 白念珠菌白/灰转变调控因子基因及其用途
CN106699892B (zh) 肺鳞癌中dnah5融合基因及其用途
CN1951966A (zh) 锌指蛋白hzf1抗体
Kumar Generation of monoclonal antibodies against covalently linked cell wall proteins of Candida albicans
JP2002502609A (ja) 真菌タンパク質の発現に重要な新規真菌タンパク質

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2012308240

Country of ref document: AU

Date of ref document: 20120914

Kind code of ref document: A

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12831998

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2848765

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2014530916

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012831998

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12831998

Country of ref document: EP

Kind code of ref document: A2