WO2013012446A1 - Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene - Google Patents

Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene Download PDF

Info

Publication number
WO2013012446A1
WO2013012446A1 PCT/US2012/023658 US2012023658W WO2013012446A1 WO 2013012446 A1 WO2013012446 A1 WO 2013012446A1 US 2012023658 W US2012023658 W US 2012023658W WO 2013012446 A1 WO2013012446 A1 WO 2013012446A1
Authority
WO
WIPO (PCT)
Prior art keywords
felv
polypeptide
sequence
composition
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/023658
Other languages
English (en)
French (fr)
Inventor
Hervé Poulet
Thierry Heidmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut Gustave Roussy (IGR)
Universite Paris Sud
Merial Ltd
Merial LLC
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut Gustave Roussy (IGR)
Universite Paris Sud
Merial Ltd
Merial LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA2842055A priority Critical patent/CA2842055C/en
Priority to CN201280041551.1A priority patent/CN103957932B/zh
Priority to PL12705199T priority patent/PL2734230T3/pl
Priority to NZ620566A priority patent/NZ620566B2/en
Priority to HRP20190271TT priority patent/HRP20190271T1/hr
Priority to JP2014521612A priority patent/JP6084970B2/ja
Priority to SI201231522T priority patent/SI2734230T1/sl
Priority to LTEP12705199.3T priority patent/LT2734230T/lt
Priority to RS20190039A priority patent/RS58289B1/sr
Priority to SM20190129T priority patent/SMT201900129T1/it
Priority to MX2014000625A priority patent/MX351642B/es
Priority to EP12705199.3A priority patent/EP2734230B1/en
Priority to DK12705199.3T priority patent/DK2734230T3/en
Application filed by Centre National de la Recherche Scientifique CNRS, Institut Gustave Roussy (IGR), Universite Paris Sud, Merial Ltd, Merial LLC filed Critical Centre National de la Recherche Scientifique CNRS
Priority to BR112014001287-3A priority patent/BR112014001287B1/pt
Priority to AU2012284558A priority patent/AU2012284558B2/en
Priority to ES12705199T priority patent/ES2720150T3/es
Priority to RU2014106295/15A priority patent/RU2591817C2/ru
Priority to IN547CHN2014 priority patent/IN2014CN00547A/en
Publication of WO2013012446A1 publication Critical patent/WO2013012446A1/en
Priority to IL230460A priority patent/IL230460B/en
Priority to ZA2014/00349A priority patent/ZA201400349B/en
Anticipated expiration legal-status Critical
Priority to AU2017204298A priority patent/AU2017204298A1/en
Priority to CY20191100209T priority patent/CY1125328T1/el
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/04Nitro compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/162Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/21Retroviridae, e.g. equine infectious anemia virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/275Poxviridae, e.g. avipoxvirus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08RNA viruses
    • C07K14/15Retroviridae, e.g. bovine leukaemia virus, feline leukaemia virus human T-cell leukaemia-lymphoma virus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/70Multivalent vaccine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24041Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24041Use of virus, viral particle or viral elements as a vector
    • C12N2710/24044Chimeric viral vector comprising heterologous viral elements for production of another viral vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/22Vectors comprising a coding region that has been codon optimised for expression in a respective host

Definitions

  • the present invention relates to compositions or vaccines for combating feline leukemia virus infections in animals.
  • the present invention provides vectors that contain and express in vivo or in vitro optimized feline leukemia virus envelope antigens that elicit an immune response in animals against feline leukemia virus, including compositions comprising said vectors, methods of vaccination against feline leukemia virus, and kits for use with such methods and compositions.
  • Feline Leukemia Virus is a common cause of infection of domestic cats throughout the world and a cause of significant morbidity and mortality.
  • the prevalence of antigenaemia may vary from 1 to 5 percent in healthy cats to 15 to 30 percent in sick cats (Hosie M.J. et al, Veterinary Records, 1989, 128, 293-297; Braley J., Feline Practice, 1994, 22, 25-29; Malik R. et al., Australian Veterinary Journal, 1997, 75, 323-327; Arjona A. et al., Journal of Clinical Microbiology, 2000, 38, 3448-3449).
  • the virus may establish a life-long infection characterized by a persistent viraemia and a fatal outcome.
  • FeLV -related diseases occur persistently in infected animals, and they are always serious and most likely fatal. Among the most frequently diagnosed conditions are lymphomas, myeloid leukaemias, immunodeficiency and non-regenerative anaemia. The infection can be controlled by the identification and isolation of persistently viraemic cats, which are the source of the infection. Vaccines have also helped to prevent the virus spreading. Several FeLV vaccines are available. Most of them contain either inactivated virus or recombinant subunits. Their efficacy is controversial (Sparkes A.H., Journal of Small Animal Practice, 1997, 38, 187-194). Vaccine breakdowns have been observed.
  • the FeLV genome codes for three genes: a GAG gene coding for the major structural components of the virus, an ENV gene which codes for the envelope glycoprotein, and a POL gene cndoing the polymerase protein (Thomsen D.R., et al, Journal of General Virology, 73, 1819-1824, 1992).
  • the FeLV envelope (ENV) gene encodes a gp85 precursor protein which is proteolytically processed by cellular enzymes(s) to yield the major envelope glycoprotein gp70 and the associated transmembrane protein pl5E (DeNoronha, F., et al., 1978, Virology 85:617- 621; Nunberg, J.H., et al, 1983, PNAS 81 :3675-3679).
  • the transmembrane protein pl5E contains a sequence conserved among gammaretroviruses with immunosuppressive properties (Mathes, L.E. et al., 1978, Nature).
  • FeLV envelope glycoprotein is one of the major immunogens and is the target of FeLV-specific cytotoxic T cell responses as well as neutralizing antibodies (Flynn, J.N., et al, 2002, J. Virol).
  • US patent application US 2008/0008683 discussed a polypeptide that is capable of modulating the immunosuppressive properties of a viral protein against the host in which it is expressed.
  • the FeLV GAG gene encodes a precursor polyprotein which is cleaved by the protease (FeLV PRO gene) to generate the capsid proteins.
  • the capsid proteins are also a major immunogen inducing FeLV-specific cytotoxic T cell responses as well as neutralizing antibodies (Flynn, J.N., et al., 2002, J.
  • the POL gene encodes three proteins: protease (PRO), reverse transcriptase and integrase. Autoprocessing by the protease portion of the gene gives rise to all three proteins of the POL region (Thomsen D.R., et al., 1992).
  • An object of this invention can be any one or all of providing recombinant vectors or viruses as well as methods for making such viruses, and providing compositions and/or vaccines as well as methods for treatment and prophylaxis of infection by FeLV.
  • the invention provides a recombinant vector, such as a recombinant virus, e.g., a recombinant poxvirus, that contains and expresses at least one exogenous nucleic acid molecule and, the at least one exogenous nucleic acid molecule may comprise a nucleic acid molecule encoding an immunogen or epitope of interest from FeLV proteins, such as FeLV ENV and/or FeLV GAG/PRO.
  • a recombinant vector such as a recombinant virus, e.g., a recombinant poxvirus
  • the present invention provides a recombinant vector, such as a recombinant virus, e.g., a recombinant poxvirus, that contains and expresses at least one exogenous nucleic acid molecule and, the at least one exogenous nucleic acid molecule may comprise FeLV polypeptides and/or variants or fragments thereof.
  • a recombinant vector such as a recombinant virus, e.g., a recombinant poxvirus, that contains and expresses at least one exogenous nucleic acid molecule and, the at least one exogenous nucleic acid molecule may comprise FeLV polypeptides and/or variants or fragments thereof.
  • the invention further provides compositions or vaccine comprising such an expression vector or the expression product(s) of such an expression vector.
  • the invention further provides methods for inducing an immunological (or immunogenic) or protective response against FeLV, as well as methods for preventing FeLV or disease state(s) caused by FeLV, comprising administering the expression vector or an expression product of the expression vector, or a composition comprising the expression vector, or a composition comprising an expression product of the expression vector.
  • the invention also relates to expression products from the virus as well as antibodies generated from the expression products or the expression thereof in vivo and uses for such products and antibodies, e.g., in diagnostic applications.
  • Figure 1 provides a table identifying the SEQ ID NO assigned to the polynucleotide and protein sequence.
  • Figure 2 depicts a plasmid map of pH6C5env (208.2).
  • Figure 3 provides the sequences for plasmid pCXL208.2 (pH6C5env) fragment containing FeLV ENV DNA and left and right arms (SEQ ID NO: 36) and FeLV ENV protein (SEQ ID NO:7) from plasmid pHCMV-ENV FeLV.
  • Figure 4 provides the restriction map for plasmid pPB713.
  • Figure 5 provides the sequence alignments of the FeLV ENV DNA and proteins.
  • Figure 6 provides the plasmid pPB712 restriction map.
  • Figure 7 shows the DNA sequence alignment between wild-type GAG/PRO DNA (SEQ ID NO: 11) and codon-optimized GAG/PRO DNA (SEQ ID NO: 10).
  • Figure 8 provides the cloning scheme.
  • Figure 9 provides the restriction map of plasmid pJYl 874.1.
  • Figure 10 provides the FeLV GAG-PRO protein sequence.
  • Figure 11 shows the nucleotide sequence of the pJYl 874.1 DNA fragment containing the arms and insert (SEQ ID NO:38).
  • Figure 12 provides the cloning scheme for making vCP2294 plasmid.
  • Figure 13 shows the vCP2294 plasmid C3 region map with primer locations.
  • Figure 14 depicts the vCP2294 plasmid sequence (annotated).
  • Figure 15 provides the cloning scheme for making vCP2296 plasmid.
  • Figure 16 shows the vCP2296 plasmid C5 region map with primer locations.
  • Figure 17 provides the cloning scheme for making vCP2295 plasmid.
  • Figure 18 depicts the vCP2295 plasmid sequence.
  • Figure 19 is a graph showing the evolution of the mean proviremia per group after challenge.
  • Figure 20 is a graph showing the evolution of the mean proviremia per group and p27 status after challenge.
  • Figure 21 is a graph showing the proviremia in marrow correlating to p27 status.
  • Figure 22 shows the FeLV specific- IFNy response on D35.
  • Figure 23 shows the FeLV specific (ENV peptide pool No. 1) IFNy response on D35.
  • Figure 24 shows the FeLV specific (ENV peptide pools) IL-10 response on D35.
  • Figure 25 shows the FeLV specific (GAG/PRO peptide pools) - IL-20 response on D35.
  • Figures 26a-b show the FeLV specific (ENV stimulation) - IFNy/IL-lO ratio on D35.
  • Figure 27 shows the FeLV specific (GAG/PRO stimulation) - IFNy response on D126.
  • Figure 28a shows the FeLV specific (ENV stimulation) - IL-10 response on D126.
  • Figure 28b shows the FeLV specific (GAG/PRO stimulation) - IL-10 response on D126.
  • Figure 29 shows the FeLV specific IFNy/IL- 10 ratio FeLV ENV and GAG/PRO peptide pools on D35.
  • FeLV ENV polypeptide or DNA refers to any native or
  • the optimized/mutated FeLV ENV DNA may be codon-optimized FeLV DNA
  • the FeLV ENV DNA may be optimized to produce a single amino acid mutation in the FeLV polypeptide.
  • the optimized/mutated FeLV ENV polypeptide may comprise a single amino acid mutation, or a double amino acid mutation, or a multiple amino acid mutation.
  • animal is used herein to include all mammals, birds and fish.
  • the animal as used herein may be selected from the group consisting of equine (e.g., horse), canine (e.g., dogs, wolves, foxes, coyotes, jackals), feline (e.g., lions, tigers, domestic cats, wild cats, other big cats, and other felines including cheetahs and lynx), bovine (e.g., cattle), porcine (e.g., pig), ovine (e.g., sheep, goats, lamas, bisons), avian (e.g., chicken, duck, goose, turkey, quail, pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary), primate (e.g., prosimian, tarsier, monkey, gibbon, ape), humans, and fish.
  • equine e.g.,
  • polypeptide and “protein” are used interchangeably herein to refer to a polymer of consecutive amino acid residues.
  • nucleic acid refers to R A or DNA and derivatives thereof, such as those containing modified backbones. It should be appreciated that the invention provides polynucleotides comprising sequences complementary to those described herein. Polynucleotides according to the invention can be prepared in different ways (e.g. by chemical synthesis, by gene cloning etc.) and can take various forms (e.g. linear or branched, single or double stranded, or a hybrid thereof, primers, probes etc.).
  • genes or polynucleotides include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs , such as an open reading frame (OPvF), starting from the start codon (methionine codon) and ending with a termination signal (stop codon).
  • genes and polynucleotides can also include regions that regulate their expression, such as transcription initiation, translation and transcription termination.
  • promoters and ribosome binding regions in general these regulatory elements lie approximately between 60 and 250 nucleotides upstream of the start codon of the coding sequence or gene; Doree S M ei al.; Pandher K et al.; Chung J Y et al), transcription terminators (in general the terminator is located within approximately 50 nucleotides downstream of the stop codon of the coding sequence or gene; Ward C K et al.).
  • Gene or polynucleotide also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.
  • immunogenic polypeptide or “immunogenic fragment” as used herein refers to a polypeptide or a fragment of a polypeptide which comprises an allele-specific motif, an epitope or other sequence such that the polypeptide or the fragment will bind an MHC molecule and induce a cytotoxic T lymphocyte ("CTL") response, and/or a B cell response (for example, antibody production), and/or T-helper lymphocyte response, and/or a delayed type hypersensitivity (DTH) response against the antigen from which the immunogenic polypeptide or the immunogenic fragment is derived.
  • CTL cytotoxic T lymphocyte
  • B cell response for example, antibody production
  • T-helper lymphocyte response for example, T-helper lymphocyte response
  • DTH delayed type hypersensitivity
  • a DTH response is an immune reaction in which T cell-dependent macrophage activation and inflammation cause tissue injury.
  • a DTH reaction to the subcutaneous injection of antigen is often used as an assay for cell-mediated immunity.
  • an epitope is an antigenic determinant that is immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral (B cells) and/or cellular type (T cells). These are particular chemical groups or peptide sequences on a molecule that are antigenic.
  • An antibody specifically binds a particular antigenic epitope on a polypeptide.
  • Specific, non-limiting examples of an epitope include a tetra- to penta- peptide sequence in a polypeptide, a tri- to penta-glycoside sequence in a polysaccharide. In the animal most antigens will present several or even many antigenic determinants simultaneously.
  • Such a polypeptide may also be qualified as an immunogenic polypeptide and the epitope may be identified as described further.
  • an "isolated" biological component refers to a component that has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, for instance, other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles.
  • Nucleic acids and proteins that have been "isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant technology as well as chemical synthesis.
  • a purified polypeptide preparation is one in which the polypeptide is more enriched than the polypeptide is in its natural environment.
  • a polypeptide preparation is substantially purified such that the polypeptide represents several embodiments at least 60%, at least 70%>, at least 80%>, at least 90%>, at least 95%, or at least 98%>, of the total polypeptide content of the preparation.
  • the polypeptides disclosed herein can be purified by any of the means known in the art.
  • a recombinant polynucleotide is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques.
  • a recombinant polynucleotide encodes a fusion protein.
  • the present invention provides optimized or mutated polypeptides from FeLV. In another aspect, the present invention provides optimized or mutated FeLV ENV polypeptides. In yet another aspect, the present invention provides an optimized FeLV ENV protein wherein a mutation occurs at, but not limited to, the amino acid position 527 of SEQ ID NOs: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, 34, or 43 or amino acid position 533 of SEQ ID NO:7.
  • the mutation is a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E) at amino acid position 527 of SEQ ID NOs: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or amino acid position 533 of SEQ ID NO:7.
  • the described mutation encompasses the mutation at the corresponding amino acid position in other FeLV ENV polypeptides which are not listed in the present application, wherein the corresponding amino acid position is equivalent to the amino acid position 527 of SEQ ID NOs: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or amino acid position 533 of SEQ ID NO:7.
  • the protein sequence alignment of some of the FeLV ENV polypeptides is exemplified in Figure Id.
  • the optimized or mutated FeLV ENV polypeptide comprises an amino acid mutation at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV proteins.
  • the optimized or mutated FeLV ENV polypeptide comprises the amino acid substitution of R, D or M for E at amino acid position 527 of SEQ ID NO:6 or at the
  • the optimized or mutated FeLV ENV polypeptide comprises the amino acid substitution of R for E at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV polypeptide.
  • the mutated FELV ENV polypeptide has the sequence as set forth in SEQ ID NO:2, 4, 7, or 43 .
  • homologs of polypeptides from FeLV are intended to be within the scope of the present invention.
  • the term “homologs” includes orthologs, analogs and paralogs.
  • the tern “anologs” refers to two polynucleotides or polypeptides that have the same or similar function, but that have evolved separately in unrelated organisms.
  • the term “orthologs” refers to two polynucleotides or polypeptides from different species, but that have evolved from a common ancestral gene by speciation. Normally, orthologs encode polypeptides having the same or similar functions.
  • paralogs refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. Analogs, orthologs, and paralogs of a wild-type FeLV polypeptide can differ from the wild-type FeLV polypeptide by post-translational modifications, by amino acid sequence differences, or by both. In particular, homologs of the invention will generally exhibit at least 80-85%, 85-90%, 90-95%, or 95%, 96%, 97%, 98% , 99% sequence identity, with all or part of the wild-type FeLV polypeptide or polynucleotide sequences, and will exhibit a similar function.
  • the present invention provides an optimized or mutated FeLV ENV polypeptide having at least 70%>, at least 75%, at least 80%>, at least 85%, at least 90%, at least 95%), 96%o, 97%), 98%) or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, or 34.
  • the present invention provides fragments and variants of the optimized or mutated FeLV ENV polypeptides identified above, which may readily be prepared by one of skill in the art using well-known molecular biology techniques.
  • Variants are homologous polypeptides having an amino acid sequence at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence as set forth in SEQ ID NO: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, or 34.
  • Variants include allelic variants.
  • allelic variant refers to a polynucleotide or a polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exist within a natural population (e.g., a virus species or variety). Such natural allelic variations can typically result in 1- 5% variance in a polynucleotide or a polypeptide.
  • Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different species, which can be readily carried out by using hybridization probes to identify the same gene genetic locus in those species. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity of gene if interest, are intended to be within the scope of the invention.
  • the term “derivative” or “variant” refers to a polypeptide, or a nucleic acid encoding a polypeptide, that has one or more conservative amino acid variations or other minor modifications such that (1) the corresponding polypeptide has substantially equivalent function when compared to the wild type polypeptide or (2) an antibody raised against the polypeptide is immunoreactive with the wild-type polypeptide.
  • variants or derivatives include polypeptides having minor modifications of the optimized or mutated FeLV ENV polypeptide primary amino acid sequences that may result in peptides which have substantially equivalent activity as compared to the unmodified counterpart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous.
  • variant further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein.
  • modifications may be any amino acid change at amino acid positions other than position 527 of SEQ ID NOs: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or amino acid position 533 of SEQ ID NO:7.
  • substitution variation denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue.
  • particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids.
  • amino acids are generally divided into four families: (1) acidic—aspartate and glutamate; (2) basic— lysine, arginine, histidine; (3) non-polar— alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar— glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids.
  • conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity.
  • Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein.
  • the term "conservative variation" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.
  • An immunogenic fragment of an FeLV ENV polypeptide includes at least 8, 10, 15, or 20 consecutive amino acids, at least 21 amino acids, at least 23 amino acids, at least 25 amino acids, or at least 30 amino acids of an FeLV ENV polypeptide having a sequence as set forth in SEQ ID NO: 2, 4, 6, 7, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or variants thereof
  • a fragment of an FeLV ENV polypeptide includes a specific antigenic epitope found on a full-length FeLV ENV polypeptide.
  • Procedures to determine fragments of polypeptide and epitope such as, generating overlapping peptide libraries (Hemmer B. et al.), Pepscan (Geysen H. M. et al, 1984; Geysen H. M. et al, 1985; Van der Zee R. et al; Geysen H. M.) and algorithms (De Groot A. et al; Hoop T. et al; Parker K. et al), can be used in the practice of the invention, without undue
  • antibodies specifically bind a particular antigenic epitope.
  • epitopes include a tetra- to penta- peptide sequence in a polypeptide, a tri- to penta glycoside sequence in a polysaccharide.
  • the epitope is a protein fragment of a larger molecule it will have substantially the same immunological activity as the total protein.
  • the present invention provides a polynucleotide encoding an FeLV ENV polypeptide. In another aspect, the present invention provides an FeLV ENV
  • the FeLV ENV polynucleotide encodes an optimized or mutated FeLV ENV polypeptide wherein the mutation is a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E) at the amino acid position 527 of SEQ ID NOs: 2, 4, 6, 7, 28, 29, 30, 31, 32, 33, 34, or 43, or amino acid position 533 of SEQ ID NO:7.
  • the FeLV ENV polynucleotide encodes an optimized or mutated FeLV ENV polypeptide having an amino acid mutation at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV proteins. In another aspect, the FeLV ENV polynucleotide encodes an optimized or mutated
  • FeLV ENV polypeptide having the amino acid change of E to R, D or M at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV polypeptide.
  • the FeLV ENV polynucleotide encodes an optimized or mutated FeLV ENV polypeptide having the amino acid change of E to R at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV polypeptide.
  • the FeLV ENV polynucleotide encodes an FeLV ENV polypeptide having the sequence as set forth in SEQ ID NO:2, 4, 7, or 43.
  • the FeLV ENV polynucleotide encodes an FeLV ENV polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 2, 4, 6, 7, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or a conservative variant, an allelic variant, a homo log or an immunogenic fragment comprising at least eight or at east ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides.
  • the present invention provides an FeLV GAG-PRO polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%), 98%) or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 12.
  • the present invention provides an FeLV ENV polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 1, 3, or 5, or a variant thereof.
  • the present invention provides an FeLV ENV polynucleotide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 95%, 96%, 97%, 98% or 99%) sequence identity to a polynucleotide having a sequence as set forth in SEQ ID NO: 1, 3, or 5, or a variant thereof.
  • the present invention provides an FeLV GAG-PRO
  • polynucleotide having at least 70%>, at least 75%, at least 80%>, at least 85%, at least 90%, at least 95%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polynucleotide having a sequence as set forth in SEQ ID NO: 10, or 11, or a variant thereof.
  • polynucleotides may include DNA, cDNA, and RNA sequences that encode FeLV ENV or GAG-PRO polypeptides. It is understood that all polynucleotides encoding FeLV ENV or GAG-PRO polypeptides are also included herein, as long as they encode a polypeptide with the recognized activity, such as the binding to an antibody that recognizes the polypeptide, the induction of an immune response to the polypeptide, or an effect on survival of Leukemia disease when administered to a subject exposed to the parasite or who undergoes a decrease in a sign or a symptom of FeLV infection.
  • the polynucleotides of the disclosure include sequences that are degenerate as a result of the genetic code, e.g., optimized codon usage for a specific host.
  • optimized refers to a polynucleotide that is genetically engineered to increase its expression in a given species.
  • the DNA sequence of the FeLV ENV or GAG-PRO gene can be modified to 1) comprise codons preferred by highly expressed genes in a particular species; 2) comprise an A+T or G+C content in nucleotide base composition to that substantially found in said species; 3) form an initiation sequence of said species; or 4) eliminate sequences that cause destabilization, inappropriate polyadenylation, degradation and termination of RNA, or that form secondary structure hairpins or RNA splice sites.
  • Increased expression of FeLV protein in said species can be achieved by utilizing the distribution frequency of codon usage in eukaryotes and prokaryotes, or in a particular species.
  • the term "frequency of preferred codon usage" refers to the preference exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. There are 20 natural amino acids, most of which are specified by more than one codon.
  • nucleotide sequences are included in the disclosure as long as the amino acid sequence of the FeLV polypeptide encoded by the nucleotide sequence is
  • sequence identity between two amino acid sequences may be established by the NCBI (National Center for Biotechnology Information) pairwise blast and the blosum62 matrix, using the standard parameters (see, e.g., the BLAST or BLASTX algorithm available on the "National Center for Biotechnology Information” (NCBI, Bethesda, Md., USA) server, as well as in Altschul et al. ; and thus, this document speaks of using the algorithm or the BLAST or BLASTX and BLOSUM62 matrix by the term "blasts").
  • Sequence identity between two nucleotide sequences also may be determined using the "Align” program of Myers and Miller, ("Optimal Alignments in Linear Space", CABIOS 4, 11-17, 1988) and available at NCBI, as well as the same or other programs available via the Internet at sites thereon such as the NCBI site.
  • identity for instance, with respect to a nucleotide or amino acid sequence, may indicate a quantitative measure of homology between two sequences. The percent sequence homology may be calculated as:
  • identity with respect to sequences can refer to the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman), for instance, using a window size of 20 nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and computer-assisted analysis and interpretation of the sequence data including alignment can be conveniently performed using commercially available programs (e.g., IntelligeneticsTM Suite, Intelligenetics Inc. CA).
  • IntelligeneticsTM Suite Intelligenetics Inc. CA
  • RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence.
  • RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.
  • sequence identity or sequence similarity of two amino acid sequences, or the sequence identity between two nucleotide sequences can be determined using Vector NTI software package (Invitrogen, 1600 Faraday Ave., Carlsbad, CA).
  • the FeLV ENV or GAG-PRO polynucleotides may include a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (for example, a cDNA) independent of other sequences.
  • Recombinant vectors disclosed herein may include a polynucleotide encoding a polypeptide, a variant thereof or a fragment thereof.
  • Recombinant vectors may include plasmids and viral vectors and may be used for in vitro or in vivo expression.
  • Recombinant vectors may include further a signal peptide.
  • Signal peptides are short peptide chain (3-60 amino acids long) that direct the post-translational transport of a protein (which are synthesized in the cytosol) to certain organelles such as the nucleus, mitochondrial matrix, endoplasmic reticulum, chloroplast, apoplast and peroxisome.
  • the naturally occurring FeLV ENV proteins may be translated as precursors, having an N-terminal signal peptide sequence and a "mature" protein domain.
  • the signal peptide may be cleaved off rapidly upon translation.
  • the signal sequence may be the natural sequence from the FeLV ENV protein or a peptide signal from a secreted protein e.g. the signal peptide from the tissue plasminogen activator protein (tPA), in particular the human tPA (S. Friezner Degen et al; R. Rickles et al; D. Berg, et al), or the signal peptide from the Insulin-like growth factor 1 (IGF1), in particular the equine IGF1 (K.
  • tPA tissue plasminogen activator protein
  • IGF1 Insulin-like growth factor 1
  • the signal peptide from IGF1 may be natural or optimized which may be achieved by removing cryptic splice sites and/or by adapting the codon usage.
  • the unprocessed polypeptide may be cleaved at a cleavage site to lead to the mature polypeptide.
  • the cleavage site may be predicted using the method of Von Heijne (1986).
  • a plasmid may include a DNA transcription unit, for instance a nucleic acid sequence that permits it to replicate in a host cell, such as an origin of replication (prokaryotic or eukaryotic).
  • a plasmid may also include one or more selectable marker genes and other genetic elements known in the art. Circular and linear forms of plasmids are encompassed in the present disclosure.
  • the present invention relates to an in vivo expression vector comprising a polynucleotide sequence, which contains and expresses in vivo in a host the optimized or mutated FeLV ENV polypeptides and/or variants or fragments thereof.
  • the expression vector may further comprise a polynucleotide encoding an FeLV GAG-PRO polypeptide and/or variants or fragments thereof.
  • the in vivo expression vector may include any transcription unit containing a polynucleotide or a gene of interest and those essential elements for its in vivo expression. These expression vectors may be plasmids or recombinant viral vectors.
  • the promoter may be of viral or cellular origin. In one embodiment, the promoter may be the cytomegalovirus (CMV) early promoter (CMV-IE promoter), the SV40 virus early or late promoter or the Rous Sarcoma virus LTR promoter, a promoter of a cytoskeleton gene, such as the desmin promoter (Kwissa M. et al.), or the actin promoter (Miyazaki J. et al.). When several genes are present in the same plasmid, they may be provided in the same transcription unit or in different units.
  • the term "plasmid” may include any DNA transcription unit comprising a polynucleotide according to the invention and the elements necessary for its in vivo expression in a cell or cells of the desired host or target; and, in this regard, it is noted that a supercoiled or non-supercoiled, circular plasmid, as well as a linear form, are intended to be within the scope of the invention.
  • the plasmids may also comprise other transcription-regulating elements such as, for example, stabilizing sequences of the intron type.
  • the plasmids may include the first intron of CMV-IE (WO 89/01036), the intron II of the rabbit beta-globin gene (van Ooyen et al), the signal sequence of the protein encoded by the tissue plasminogen activator (tPA; Montgomery et al), and/or a polyadenylation signal (polyA), in particular the polyA of the bovine growth hormone (bGH) gene (US 5,122,458) or the polyA of the rabbit beta-globin gene or of SV40 virus.
  • CMV-IE WO 89/01036
  • tPA tissue plasminogen activator
  • polyA polyadenylation signal
  • bGH bovine growth hormone
  • the present invention relates to a composition
  • a composition comprising: a) an in vivo expression vector, wherein the vector comprises a polynucleotide encoding one or more polypeptide selected from the group consisting of an FeLV ENV polypeptide, a variant or fragment of the FeLV ENV polypeptide, and a mixture thereof; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient.
  • the present invention relates to a composition
  • a composition comprising: a) an in vivo expression vector, wherein the vector comprises a polynucleotide encoding one or more polypeptide selected from the group consisting of an FeLV ENV polypeptide, an FeLV
  • GAG/PRO polypeptide a variant or fragment of the FeLV ENV polypeptide, and a mixture thereof; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient.
  • the present invention relates to a composition
  • a composition comprising: a) an in vivo expression vector, wherein the vector comprises a polynucleotide encoding an FeLV ENV polypeptide, an FeLV GAG/PRO polypeptide; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient.
  • the present invention relates to a composition
  • a composition comprising: a) an in vivo expression vector, wherein the vector comprises a polynucleotide encoding an optimized or mutated FeLV ENV having the amino acid substitution of R, D or M for E at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV polypeptide and a polynucleotide encoding an FeLV GAG/PRO polypeptide having at least 90% sequence identity to a polypeptide having the sequence as set forth in SEQ ID NO: 12; and b) a
  • the composition of the present invention comprises: a) an expression vector comprising a first polynucleotide encoding an FeLV ENV polypeptide having an amino acid sequence as set forth in SEQ ID NO:2 or 4 and a second polynucleotide encoding an FeLV GAG/PRO polypeptide having an amino acid sequence as set forth in SEQ ID NO: 12; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient.
  • composition comprises any vaccine or immunological composition, once it has been injected to a host, including canines, felines and humans, that induces an immune response in the host, and/or protects the host from leukemia, and/or which may prevent implantation of the parasite, and/or which may prevent disease progression in infected subjects, and/or which may limit the diffusion of runaway parasites to internal organs.
  • This may be accomplished upon vaccination according to the present invention through the induction of cytokine secretion, notably IFN-gamma secretion (as example of a method of measurement of IFN-gamma secretion, the Quantikine® immunoassay from R&D Systems Inc. (catalog number# CAIF00) could be used (Djoba Siawaya JF et al.)).
  • compositions or excipients of use are conventional.
  • parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • non-toxic solid vehicles or excipients can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
  • immunogenic compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • compositions or vaccines according to the instant invention may include vectors encoding any polynucleotide according to the present invention as described above.
  • each polynucleotide insert which may be any polynucleotide of the present invention aforementioned, may be inserted under the control of the same and/or different promoters.
  • the insertion can be done tail-to-tail, head-to- head, tail-to-head, or head-to-tail.
  • IRES elements Internal Ribosome Entry Site, see EP 0803573 can also be used to separate and to express multiple inserts operably linked to the same and/or different promoters.
  • the present invention relates to an expression vector comprising a polynucleotide aforementioned.
  • the expression vector may be an in vivo expression vector, or an in vitro expression vector.
  • the present invention encompasses in vivo expression vectors including any plasmid (EP-A2- 1001025; Chaudhuri P.) containing and expressing in vivo in a host the polynucleotide or gene of FeLV ENV polypeptide, variant thereof or fragment thereof and elements necessary for its in vivo expression.
  • the pVR1020 or pVR1012 plasmid can be utilized as a vector for the insertion of a polynucleotide sequence.
  • the pVR1020 plasmid is derived from pVR1012 and contains the human tPA signal sequence.
  • the pVR1020 is a plasmid backbone available from Vical, Inc., (San Diego, CA) which has been previously used, see, e.g., US Patent Nos. 6,451 ,769 and 7,078,507.
  • plasmid pVR2001 -TOPO or pVR2001 -TOP A
  • tPA tissue plasminogen activator signal peptide
  • Each plasmid may comprise or contain or consist essentially of, the polynucleotide according to the present invention, operably linked to a promoter or under the control of a promoter or dependent upon a promoter, wherein the promoter may be advantageously adjacent to the polynucleotide for which expression is desired.
  • a strong promoter that is functional in eukaryotic cells.
  • a useful promoter may be the immediate early cytomegalovirus promoter (CMV-IE) of human or murine origin, or it may optionally have another origin such as from rat or guinea pig.
  • the CMV-IE promoter may comprise the actual promoter part, which may or may not be associated with the enhancer part.
  • the CMV-IE promoter may advantageously be a human CMV-IE (Boshart M. et al.) or murine CMV-IE. In more general terms, the promoter may have either a viral or a cellular origin.
  • a strong viral promoter other than CMV-IE that may be usefully employed in the practice of the invention is the early/late promoter of the SV40 virus or the LTR promoter of the Rous sarcoma virus.
  • a strong cellular promoter that may be usefully employed in the practice of the invention is the promoter of a gene of the cytoskeleton, such as the desmin promoter (Kwissa M. et al.), or the actin promoter (Miyazaki J. et al.). Functional sub fragments of these promoters, i.e., portions of these promoters that maintain adequate promoter activity, are included within the present invention, e.g. truncated CMV-IE promoters according to WO
  • a promoter useful in the practice of the invention consequently may include derivatives and/or sub fragments of a full- length promoter that maintain adequate promoter activity and hence function as a promoter, and which may advantageously have promoter activity that is substantially similar to that of the actual or full-length promoter from which the derivative or sub fragment is derived, e.g., akin to the activity of the truncated CMV-IE promoters of US 6,156,567 in comparison to the activity of full-length CMV-IE promoters.
  • a CMV-IE promoter in the practice of the invention may comprise or consist essentially of or consist of the promoter portion of the full-length promoter and/or the enhancer portion of the full-length promoter, as well as derivatives and/or sub fragments thereof.
  • the plasmids comprise or consist essentially of other expression control elements. It is especially advantageous to incorporate stabilizing sequence(s), e.g., intron sequence(s), for example, the first intron of the hCMV-IE (WO 89/01036), the intron II of the rabbit ⁇ -globin gene (van Ooyen et al.).
  • stabilizing sequence(s) e.g., intron sequence(s), for example, the first intron of the hCMV-IE (WO 89/01036), the intron II of the rabbit ⁇ -globin gene (van Ooyen et al.).
  • poly A polyadenylation signal
  • the present invention encompasses in vivo expression vectors including any recombinant viral vector containing a polynucleotide or gene encoding one or more FeLV ENV and/or variants or fragments thereof, including any elements necessary for its in vivo expression.
  • Said recombinant viral vectors could be selected from, for example, the poxviruses, especially avipox viruses, such as fowlpox viruses or canarypox viruses.
  • the fowlpox virus is a TROVAC (see WO 96/40241).
  • the canarypox vector is an ALVAC.
  • the viral vector is an adenovirus, such as a human adenovirus (HAV) or a canine adenovirus (CAV).
  • HAV human adenovirus
  • CAV canine adenovirus
  • the viral vector is a human adenovirus, specifically a serotype 5 adenovirus, rendered incompetent for replication by a deletion in the El region of the viral genome, especially from about nucleotide 459 to about nucleotide 3510 by reference to the sequence of the hAd5 disclosed in Genbank under the accession number M73260 and in the referenced publication Chroboczek et al, 1992.
  • the deleted adenovirus is propagated in El- expressing 293 (Graham et al., 1977) or PER cells, especially PER.C6 (Falloux et al., 1998).
  • the human adenovirus can additionally or alternatively be deleted in the E3 region, especially from about nucleotide 28592 to about nucleotide 30470.
  • the deletion in the El region can be done in combination with a deletion in the E3 region (see, e.g. Shriver et al.; Graham et al.; Ilan et al.; U.S. Patent Nos. 6,133,028 and 6,692,956; Tripathy et al.; Tapnell; Danthinne et al.; Berkner; Berkner et al.; Chavier et al.).
  • the insertion sites can be the El and/or E3 loci (region) eventually after a partial or complete deletion of the El and/or E3 regions.
  • the expression vector is an adenovirus
  • the polynucleotide to be expressed is inserted under the control of a promoter functional in eukaryotic cells, such as a strong promoter,
  • CMV-IE promoter cytomegalovirus immediate-early gene promoter
  • the CMV-IE promoter is advantageously of murine or human origin.
  • the promoter of the elongation factor l can also be used.
  • a muscle specific promoter can also be used (Li et al.). Strong promoters are also discussed herein in relation to plasmid vectors.
  • a splicing sequence can be located downstream of the enhancer / promoter region.
  • the intron 1 isolated from the CMV-IE gene (Stenberg et al.), the intron isolated from the rabbit or human ⁇ -globin gene, especially the intron 2 from the ⁇ -globin gene, the intron isolated from the immunoglobulin gene, a splicing sequence from the SV40 early gene or the chimeric intron sequence isolated from the pCI vector from Promege Corp.
  • a poly(A) sequence and terminator sequence can be inserted downstream the polynucleotide to be expressed, e.g. a bovine growth hormone gene, especially from about nucleotide 2339 to about nucleotide 2550 of the sequence with GenBank accession No. BOVGHRH, a rabbit ⁇ -globin gene or a SV40 late gene polyadenylation signal.
  • the viral vector is a canine adenovirus, especially a CAV-2 (see, e.g. Fischer et al; U.S. Patent Nos. 5,529,780 and 5,688,920; WO 95/14102).
  • the insertion sites can be in the E3 region and /or in the region located between the E4 region and the right ITR region (see U.S. Patent Nos. 6,090,393 and 6,156,567).
  • the insert is under the control of a promoter, such as a cytomegalovirus immediate-early gene promoter (CMV-IE promoter) or a promoter already described for a human adenovirus vector.
  • CMV-IE promoter cytomegalovirus immediate-early gene promoter
  • a poly(A) sequence and terminator sequence can be inserted downstream the polynucleotide to be expressed, e.g. a bovine growth hormone gene or a rabbit ⁇ -globin gene polyadenylation signal.
  • the viral vector is a herpesvirus such as a feline herpesvirus (FHV).
  • FHV feline herpesvirus
  • the polynucleotide to be expressed is inserted under the control of a promoter functional in eukaryotic cells, advantageously a CMV-IE promoter (murine or human).
  • a poly(A) sequence and terminator sequence can be inserted downstream the polynucleotide to be expressed, e.g. bovine growth hormone or a rabbit ⁇ -globin gene polyadenylation signal.
  • a vaccinia virus or an attenuated vaccinia virus for instance, MVA, a modified Ankara strain obtained after more than 570 passages of the Ankara vaccine strain on chicken embryo fibroblasts; see Stickl & Hochstein- Mintzel; Sutter et al; available as ATCC VR-1508; or NY VAC, see US 5,494,807, and U.S. Patent No.
  • Attenuated canarypox viruses are described in US 5,756,103 (ALVAC) and WO 01/05934. Reference is also made to US5,766,599 which pertains to the attenuated fowlpox strain TROVAC. Reference is made to the canarypox available from the ATCC under access number VR-111. Numerous fowlpox virus vaccination strains are also available, e.g. the DIFTOSEC CT strain marketed by MERIAL and the NOBILIS VARIOLE vaccine marketed by INTER VET.
  • hemagglutinin (HA) gene or insertion site the region encoding the inclusion body of the A type (ATI); see also documents cited herein, especially those pertaining to vaccinia virus.
  • the insertion site or sites are ORF(s) C3, C5 and/or C6; see also documents cited herein, especially those pertaining to canarypox virus.
  • the insertion site or sites are ORFs F7 and/or F8; see also documents cited herein, especially those pertaining to fowlpox virus.
  • the insertion site or sites for MVA virus are advantageously as in various publications, including Carroll M. W.
  • the polynucleotide to be expressed is inserted under the control of a specific poxvirus promoter, e.g., the vaccinia promoter 7.5 kDa (Cochran et al.), the vaccinia promoter I3L (Riviere et al.), the vaccinia promoter HA (Shida), the cowpox promoter ATI (Funahashi et al.), the vaccinia promoter H6 (Taylor J. et al.; Guo P. et al. J.; Perkus M. et al.), inter alia.
  • a specific poxvirus promoter e.g., the vaccinia promoter 7.5 kDa (Cochran et al.), the vaccinia promoter I3L (Riviere et al.), the vaccinia promoter HA (Shida), the cowpox promoter ATI (Funahashi et al.),
  • Any of the polynucleotides disclosed here may be expressed in vitro by DNA transfer or expression vectors into a suitable host cell.
  • the host cell may be prokaryotic or eukaryotic.
  • the term "host cell” also includes any progeny of the subject host cell. Methods of stable transfer, meaning that the foreign polynucleotide is continuously maintained in the host cell, are known in the art.
  • Host cells may include bacteria (for example, Escherichia coli), yeast, insect cells, and vertebrate cells. Methods of expressing DNA sequences in eukaryotic cells are well known in the art.
  • Baculovirus vectors for example, Autographa California Nuclear Polyhedrosis Virus (AcNPV)
  • AcNPV Autographa California Nuclear Polyhedrosis Virus
  • polyhedrin promoters may be utilized with insect cells (for example, Spodoptera frugiperda cells, like Sf9 cells available at the ATCC under the Accession number CRL 1711, or Sf21 cells) (see for example, Smith et al.; Pennock et al;
  • E. coli may be used as a method for in vitro expression.
  • inducible promoters such as arabinose promoter, pL of bacteriophage lambda, plac, ptrp, ptac (ptrp-lac hybrid promoter), and the like may be used. Transformation of a host cell with recombinant DNA may be carried out by conventional techniques are well known to those skilled in the art. Where the host is prokaryotic, such as E.
  • competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaC12 method using procedures well known in the art. Alternatively, MgC12 or RbCl can be used. Transformation can also be performed by electroporation.
  • the host is a eukaryote
  • such methods of transduction of DNA as calcium phosphate coprecipitates conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in liposomes, or virus vectors may be used.
  • Eukaryotic cells may also be cotransformed with L.
  • a eukaryotic viral vector such as a herpes virus or adenovirus (for example, canine adenovirus 2)
  • a transfection agent can be utilized, such as dioleoyl-phosphatidyl-ethanolamme (DOPE).
  • DOPE dioleoyl-phosphatidyl-ethanolamme
  • Isolation and purification of recombinantly expressed polypeptide may be carried out by conventional means including preparative chromatography (for example, size exclusion, ion exchange, affinity), selective precipitation and ultra-filtration. Examples of state of the art techniques that can be used, but not limited to, may be found in "Protein Purification
  • polynucleotide according to the disclosure and of a host cell.
  • the vaccines containing recombinant viral vectors according to the invention may be freeze-dried, advantageously with a stabilizer. Freeze-drying can be done according to well- known standard freeze-drying procedures.
  • the pharmaceutically or veterinary acceptable stabilizers may be carbohydrates (e.g. sorbitol, mannitol, lactose, sucrose, glucose, dextran, trehalose), sodium glutamate (Tsvetkov T et al; Israeli E et al), proteins such as peptone, albumin, lactalbumin or casein, protein containing agents such as skimmed milk (Mills C K et al; Wolff E et al), and buffers (e.g. phosphate buffer, alkaline metal phosphate buffer).
  • An adjuvant may be used to make soluble the freeze-dried preparations.
  • Any vaccine composition according to the invention can also advantageously contain one or more adjuvant.
  • the plasmid-based vaccines may be formulated with cationic lipids, advantageously with DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-l-propanammonium ; WO96/34109), and advantageously in association with a neutral lipid, for example DOPE (dioleoyl-phosphatidyl-ethanolamine ; Behr J. P.), in order to form DMRIE-DOPE.
  • the mixture is made extemporaneously, and before its administration it is advantageous to wait about 10 min to about 60 min, for example, about 30 min, for the appropriate mixture.
  • the molar ratio of DMRIE/DOPE can be from 95/5 to 5/95 and is advantageously 1/1.
  • the weight ratio plasmid/DMRIE or DMRIE-DOPE adjuvant is, for example, from 50/1 to 1/10, from 10/1 to 1/5 or from 1/1 to 1/2.
  • a cytokine may be added to the composition, especially GM-CSF or cytokines inducing Thl (e.g. IL12). These cytokines can be added to the composition as a plasmid encoding the cytokine protein.
  • the cytokines are from canine origin, e.g. canine GM-CSF which gene sequence has been deposited at the GenBank database
  • the recombinant viral vector-based vaccine may be combined with fMLP (N-formyl- methionyl-leucyl-phenylalanine; US 6,017,537) and/or Carbomer adjuvant (Phameuropa Vol. 8, No. 2, June 1996).
  • fMLP N-formyl- methionyl-leucyl-phenylalanine
  • Carbomer adjuvant Phameuropa Vol. 8, No. 2, June 1996.
  • Persons skilled in the art can also refer to US 2,909,462, which describes such acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, advantageously not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms.
  • the radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups.
  • CARBOPOL® BF Goodrich, Ohio, USA
  • the products are cross-linked with an allyl sucrose or with allyl pentaerythritol.
  • CARBOPOL® 974P, 934P and 97 IP there may be advantageously mentioned.
  • copolymers of maleic anhydride and alkenyl derivative the copolymers EMA® (Monsanto) which are copolymers of maleic anhydride and ethylene, linear or cross- linked, for example cross-linked with divinyl ether, are advantageous.
  • EMA® Monsanto
  • polymers of acrylic or methacrylic acid and the copolymers EMA® are formed, for example, of basic units of the following formula in which:
  • Ri and R 2 which are identical or different, represent H or CH 3
  • a solution of adjuvant especially of carbomer (Pharmeuropa, vol. 8, No.2, June 1996), is prepared in distilled water, advantageously in the presence of sodium chloride, the solution obtained being at an acidic pH.
  • This stock solution is diluted by adding it to the desired quantity (for obtaining the desired final concentration), or a substantial part thereof, of water charged with NaCl, advantageously physiological saline (NaCl 9 g/1) all at once in several portions with concomitant or subsequent neutralization (pH 7.3 to 7.4),
  • This solution at physiological pH is used for mixing with the vaccine, which may be especially stored in freeze-dried, liquid or frozen form.
  • the polymer concentration in the final vaccine composition can be from 0.01% to 2% w/v, from 0.06 to 1% w/v, or from 0.1 to 0.6% w/v.
  • the sub-unit vaccine may be combined with adjuvants, like oil-in-water, water-in-oil- in-water emulsions based on mineral oil and/or vegetable oil and non ionic surfactants such as block copolymers, TWEEN®, SPAN®.
  • adjuvants like oil-in-water, water-in-oil- in-water emulsions based on mineral oil and/or vegetable oil and non ionic surfactants such as block copolymers, TWEEN®, SPAN®.
  • emulsions are notably those described in page 147 of "Vaccine Design - The Subunit and Adjuvant Approach", Pharmaceutical Biotechnology, 1995, or TS emulsions, notably the TS6 emulsion, and LF emulsions, notably LF2 emulsion (for both TS and LF emulsions, see WO 04/024027).
  • Suitable adjuvants are for example vitamin E, saponins, and CARBOPOL® (Noveon; see WO 99/51269; WO 99/44633), aluminium hydroxide or aluminium phosphate ("Vaccine Design, The subunit and adjuvant approach", Pharmaceutical Biotechnology, vol. 6, 1995), biological adjuvants (i.e. C4b, notably murine C4b (Ogata R T et al) or equine C4b, GM-CSF, notably equine GM-CSF (US
  • toxins i.e. cholera toxins CTA or CTB, Escherichia coli heat-labile toxins LTA or LTB (Olsen C W et al; Fingerut E et al; Zurbriggen R et al Peppoloni S et al), and CpG (i.e. CpG #2395 (see Jurk M et al), CpG #2142 (see SEQ. ID. NO: 890 in EP 1,221,955).
  • CpG i.e. CpG #2395 (see Jurk M et al)
  • CpG #2142 see SEQ. ID. NO: 890 in EP 1,221,955
  • composition or vaccine may also contain or comprise one or more FeLV antigens, for example, ENV, or ENV and GAG, or ENV and GAG and PRO gene.
  • the composition or vaccine may also be associated with at least one FeLV antigen, for example inactivated FeLV.
  • the FeLV strain may be an FeLV type A strain, or a combination of FeLV type A and type B, or a combination of FeLV type A and type C, or a combination of type A, type B and type C strains.
  • These strains of FeLV may be inactivated by chemical or physical methods.
  • the chemical methods are notably BPL, formaldehyde.
  • the physical methods may notably be sonication.
  • One method for inactivating FeLV for use in a vaccine is described in R. Cordeiro Giunchetti et ah, Vaccine, 2007.
  • the inactivated FeLV vaccine may be combined with adjuvants, like those described previously for sub-unit vaccines.
  • Another aspect of the present invention relates to methods of vaccinating a host against FeLV using the vaccine compositions disclosed herein.
  • the host may be any one or all of felines (for example, domesticated cats, kittens, big cats and wild cats).
  • the host is a feline.
  • the routes of administration may be, for example, intramuscular (IM) or intradermal (ID) or transdermal (TD) or subcutaneous (SC).
  • the means of administration may be, for example, a syringe with a needle, or needle free apparatus, or a syringe with a needle coupled to electrotransfer (ET) treatment, or needle free apparatus coupled to ET treatment.
  • IM intramuscular
  • ID intradermal
  • TD transdermal
  • SC subcutaneous
  • the means of administration may be, for example, a syringe with a needle, or needle free apparatus, or a syringe with a needle coupled to electrotransfer (ET) treatment, or needle free apparatus coupled to ET treatment.
  • ET electrotransfer
  • Another aspect of the invention relates to the use of a plasmid-based vaccine according to the present invention for administration to a host, wherein this administration is coupled to ET treatment.
  • the administration of a plasmid-based vaccine is advantageously intramuscular.
  • the means of administration is, for example, a syringe and a needle.
  • One or several injections may be administered successively. In the case of several injections, they may be carried out 2 to 6 weeks apart, for example, about 3 weeks apart. In one embodiment, a semiannual booster or an annual booster is further administered.
  • advantageous routes of administration may be ID or IM.
  • This administration may be through use of a syringe with a needle or with a needle free apparatus like Dermojet or Biojector (Bioject, Oregon, USA) or VetjetTM (Merial) or VitajetTM (Bioject Inc.), see US 2006/0034867.
  • the dosage may be from 50 ⁇ g to 500 ⁇ g per plasmid.
  • DMRIE-DOPE 100 ⁇ g per plasmid may be utilized.
  • GM-CSF or other cytokines are used, the plasmid encoding this protein may be present at a dosage of from about 200 ⁇ g to about 500 ⁇ g and may be 200 ⁇ g.
  • the volume of doses can be between 0.01 ml and 0.5 ml, for example, 0.25 ml.
  • Administration may be provided with multiple points of injection.
  • plasmid-based vaccines may be administered via the IM route coupled to electrotransfer (ET) treatment.
  • ET treatment may be performed using an apparatus for electrotransfer and the specifications of the manufacturer (i.e. Sphergen G250 generator
  • the apparatus for electrotransfer has a unipolar field.
  • the field intensity may be from about 50 to about 250 V/cm, from about 50 to about 200 V/cm, or from about 50 to about 175 V/cm.
  • the pulse duration may be from about 1 to about 50 msec, or from about 15 to about 25 msec.
  • the frequency may be from about 1 to about 50 Hz, or from about 5 to about 15 Hz.
  • the interpulse interval may be from about 1 to 1000 msec, or from about 1 to about 200 msec.
  • the number of pulses may be from 1 to 20, or from 5 to 10.
  • the intra tissular intensity may advantageously be up to about 2 A.
  • the distance between electrodes may be from about 0.2 to about 1 cm, or from about 0.2 to about 0.5 cm.
  • the routes of administration may advantageously be SC or IM or TD or ID.
  • This administration may be made by a syringe with a needle or with a needle free apparatus like Dermojet or Biojector (Bioject, Oregon, USA) or VetjetTM (Merial) or VitajetTM (Bioject Inc.).
  • the dosage may be from about 10 3 pfu to about 10 9 pfu per recombinant poxvirus vector.
  • the dosage may be, for example, from about 10 5 pfu to about 10 9 pfu, from about 10 6 pfu to about 10 8 pfu, or from about 10 6 pfu to about 10 7 pfu.
  • the volume of doses may be from about 0.01 ml to 0.2 ml, and is advantageously 0.1 ml.
  • Administration may comprise multiple points of injection.
  • the volume of the vaccine provided may be from 0.2 to 2 ml, in particular from about 0.5 to 1 ml.
  • the same dosages are utilized for any of the vectors of the present invention.
  • the route of administration may advantageously be via SC or IM or TD or ID.
  • This administration may be made by a syringe with a needle or with a needle free apparatus like Dermojet or Biojector (Bioject, Oregon, USA) or VetjetTM (Merial) or VitajetTM (Bioject Inc.).
  • the dosage may be from about 50 to about 500 ⁇ g, in particular from about 50 to about 150 ⁇ g, and more particularly from about 50 to about 100 ⁇ g.
  • the volume of the sub-unit vaccine provided is from 0.2 to 2 ml, in particular from about 0.5 to 1 ml.
  • the present invention relates to a vaccine strategy, which is based on a prime-boost administration regimen, where the primo-administration and the boost administration(s) utilize a composition comprising a pharmaceutically or veterinary acceptable excipient, diluent or vehicle and an in vivo expression vector comprising a polynucleotide sequence, that contains and expresses the FeLV polypeptide and/or variants or fragments thereof.
  • the present invention relates to the use of in vivo expression vectors in a prime -boost administration regimen, comprising a primo-administration of a vaccine comprising a
  • an in vivo expression vector containing a polynucleotide sequence for expressing, in vivo, FeLV polypeptides and/or variants or fragments thereof followed by a boost administration of a vaccine comprising a pharmaceutically or veterinary acceptable vehicle or excipient, an in vivo expression vector containing a polynucleotide sequence for expressing, in vivo, FeLV polypeptides and/or variants or fragments thereof as described above, to protect a host from FeLV and/or to prevent disease progression in infected hosts.
  • a prime-boost regimen comprises at least one primo-administration and at least one boost administration using at least one common polypeptide and/or variants or fragments thereof.
  • the vaccine used in primo-administration may be different in nature from those used as a later booster vaccine.
  • the primo-administration may comprise one or more administrations.
  • the boost administration may comprise one or more administrations.
  • the prime-boost administrations may be advantageously carried out 2 to 6 weeks apart, for example, about 3 weeks apart.
  • a semi-annual booster or an annual booster advantageously using the viral vector-based vaccine, is also envisaged.
  • the animals may be at least 6 to 8 weeks old at the time of the first administration.
  • the prime -boost administration regimen comprises at least one prime-administration of a plasmid-based vaccine according to the present invention and at least one boost-administration of a recombinant viral vector-based vaccine according to the present invention.
  • the prime-boost administration regimen comprises at least one prime-administration of a recombinant viral vector-based vaccine according to the present invention and at least one boost-administration of a sub-unit vaccine according to the present invention.
  • the prime-boost administration regimen comprises at least one prime-administration of a recombinant viral vector-based vaccine according to the present invention and at least one boost-administration of a plasmid-based vaccine according to the present invention.
  • the present invention relates to a method of vaccinating a subject susceptible to FeLV comprising a prime-boost administration regimen wherein said regiment comprises a prime-administration of a vaccine or composition comprising, in a pharmaceutically or veterinary acceptable vehicle, diluent or excipient, a plasmid containing a polynucleotide for expressing, in vivo, an FeLV polypeptide, a variant or fragment of the FeLV polypeptide, or a mixture thereof, followed by a boost administration of a vaccine comprising, in a
  • a recombinant viral vector comprising a polynucleotide for expressing, in vivo, the same FeLV polypeptide(s), variant thereof, fragment thereof, to protect the subject from FeLV and/or to prevent disease progression in infected subject.
  • the present invention relates to a method vaccinating a subject susceptible to FeLV comprising a prime-boost administration regimen wherein said regiment comprises a prime-administration of a vaccine or composition comprising, in a pharmaceutically or veterinary acceptable vehicle, diluent or excipient, a recombinant viral vector comprising a polynucleotide for expressing, in vivo, an FeLV polypeptide, a variant or fragment of the FeLV polypeptide, or a mixture thereof, followed by a boost administration of a vaccine comprising, in a pharmaceutically or veterinary acceptable vehicle or excipient, a plasmid containing a polynucleotide for expressing, in vivo, the FeLV polypeptide(s), variant thereof, fragment thereof, to protect the subject from FeLV and/or to prevent disease progression in infected subject.
  • a vaccine or composition comprising, in a pharmaceutically or veterinary acceptable vehicle, diluent or excipient, a recombinant
  • the present invention related to a method of vaccinating a subject susceptible to FeLV comprising a prime-boost administration regimen wherein said regiment comprises a prime-administration of a vaccine or composition comprising, in a pharmaceutically or veterinary acceptable vehicle, diluent or excipient, a recombinant viral vector comprising a polynucleotide for expressing, in vivo, a an FeLV polypeptide, a variant or fragment of the FeLV polypeptide, or a mixture thereof, followed by a boost administration of a vaccine comprising, in a pharmaceutically or veterinary acceptable vehicle or excipient, the same FeLV polypeptide(s), variant thereof, fragment thereof, to protect the subject from FeLV and/or to prevent disease progression in infected subject.
  • a vaccine or composition comprising, in a pharmaceutically or veterinary acceptable vehicle, diluent or excipient, a recombinant viral vector comprising a polynucleotide for expressing, in vivo,
  • kits for prime-boost vaccination may comprise at least two vials: a first vial containing a vaccine for the prime-vaccination according to the present invention, and a second vial containing a vaccine for the boost- vaccination according to the present invention.
  • the kit may advantageously contain additional first or second vials for additional prime-vaccinations or additional boost- vaccinations.
  • the kit may comprise two vials, one containing a plasmid-based vaccine for the prime-vaccination according to the present invention, the other vial containing a recombinant viral vector-based vaccine for the boost- vaccination according to the present invention.
  • the kit may comprise two vials, one containing a recombinant viral vector-based vaccine for the prime-vaccination according to the present invention, the other vial containing a sub-unit vaccine for the boost- vaccination according to the present invention.
  • the kit may comprise two vials, one containing a recombinant viral vector-based vaccine for the prime-vaccination according to the present invention, the other vial containing a plasmid-based vaccine for the boost- vaccination according to the present invention.
  • ALVAC(l) recombinant virus which contains FeLV ENV inserted at C5 locus and GAG/POL (+T5NT) inserted at C3 locus (Merial proprietary material) was used to amplify the FeLV ENV gene.
  • Primers 7862CXL and 7847CXL were used for the PCR amplification. 7862CXL: ACG CCG CTC GAG CGG GGA TCT CTT TAT TCT ATA CTT A (SEQ ID NO:25)
  • the amplified PCR fragment (2.1Kb) contains the FeLV ENV gene, H6 promoter immediately upstream of the ENV and a T5NT sequence followed by stop codon of the ENV.
  • the PCR fragment was then digested with XhoI/BamHI and ligated to XhoI/BamHI digested pH6C5ALVAC donor plasmid (Merial proprietary material) to generate pCXL208.2, which was sequence confirmed.
  • FeLV ENV is glycosylated and cleaved to produce glycoprotein gp70 ENV and pl5E ENV.
  • the protein sequence of mutated FeLV ENV gene of strain 82K is shown in Figure 5. The mutation is the substitution of Arg for Glu at position 527 of the FeLV ENV gene.
  • Plasmid pHCMV- ENV FeLV was received from Institut Gustave-Roussy
  • Plasmid phCMV-ENV FeLV was digested with RsrII/SacII to generate an Rsrll- SacII fragment (fragment B: 520 bp).
  • Plasmid pCXL208.2 was digested with RsrII/SacII to generate a RsrII-SacII fragment (fragment A: 6231 bp). Fragments A and B were ligated to generate plasmid pPB713 (6756 bp). The identity of pPB713 was confirmed by an Fspl digestion. The restriction map of pPB713 and the pPB713 sequences are shown in Figure 4. Construction of pH6C5env plasmid pPB712
  • Plasmid PhCMV-ENV FeLV was digested with RsrII/SacII to generate an Rsrll- SacII fragment (fragment A: 520 bp).
  • Plasmid pPB575 (Merial proprietary material) was digested with RsrII/SacII to generate an RsrII-SacII fragment (fragment B: 5971 bp).
  • Fragments A and B were ligated to generate plasmid pPB712 (6496 bp).
  • the identity of pPB712 was confirmed by an EcoRI digestion.
  • the sequence of the mutated region of FeLV present in pPB712 clone was controlled by DNA sequencing (Cogenics, France) with universal Ml 3 primer and reverse M13 primer. Two candidates were selected (n°l and n°2).
  • the sequences of the 2 clones were identical but were different from SEQ ID NO:4 (single amino acid mutation Glu to Arg). There are eight nucleotide mutations, leading to only one amino acid change.
  • FeLV Feline leukemia virus codon optimized GAG-PRO gene was used in making the vCP2294. FeLV GAG-PRO gene was optimized for gene expression in mammalian cells. The sequence comparison at the DNA level between the codon-optimized GAG-PRO gene (SEQ ID NO: 10) and the wild-type gap-pro gene (Genbank accession No. M18247, SEQ ID NO: l 1) is show in Figure 7. [0156] The construction scheme is outlined in Figure 8. The plasmid pJY1320.1 (Merial proprietary material) containing H6p-FeLV codon optimized GAG-PRO cassette was used as a template for PCR amplification. H6p is Vaccinia virus H6 promoter.
  • Nrul/Spel DNA fragment which contains 3 '-partial H6 promoter and full-length GAG-PRO, was isolated from pJYl 857.5 and ligated to Nru I/Spe I digested pJY1738.2 (Merial proprietary material) to create pJY1874.1 (as shown in Figures 9, 10 and 11), which was confirmed to have the correct sequences.
  • Nru I H6p SEQ ID NO : 15
  • GAG-PRO is produced by readthrough. GAG is further cleaved to MA (pi 5), CA (p30) and NC proteins during the later stage of virus assembly.
  • the IVR in vitro recombinant was performed by trans fection of Primary chicken embryo fibroblast cells (1°CEF) with 10 ⁇ g of Not I-linearized donor plasmid pJY1874.1 using FuGENE-6® reagent (Roche).
  • transfected cells were subsequently infected with ALVAC as rescue virus at MOI (multiplicity of infection) of 10 (ALVAC #HM1372 07 Apr 04). After 24 hours, the transfected-infected cells were harvested, sonicated and used for recombinant virus screening.
  • Recombinant plaques were screened based on the plaque lift hybridization method using a 1.4 kb FeLV GAG specific probe labeled with horse radish peroxidase (HRP) according to the manufacturer's protocol (Amersham Cat# RPN3001). After five sequential rounds of plaque purification, the recombinant designated as vCP2294.1.1.1.1.1 was generated and confirmed by hybridization as 100% positive for the FeLV GAG insert and 100% negative for the C3 ORF.
  • HRP horse radish peroxidase
  • Single plaque was selected from the 5 th round of plaque purification, and expanded to obtain PI (lx T25 flask), P2 (lxT75 flask) and P3 (6 x roller bottles).
  • the infected cell culture fluid from the roller bottles was harvested and concentrated to produce a virus stock
  • Genomic DNA from vCP2294.1.1.1.1.1 was extracted, digested with BamUl, Hindlll or Pst I and run on 0.8%> agarose gel. The gel with BamRl, Hindlll or Pstl digested genomic
  • DNA was transferred to a nylon membrane and Southern blot analysis was performed by probing with the 1.4 kb FeLV GAG probe. Multiple bands were observed at the expected sizes, indicating the correct insertion of FeLV GAG-PRO gene into the C3 locus.
  • the homogeneity of the population was 100% positive to the FeLV GAG protein for recombinant vCP2294.1.1.1.1.1 as evidenced by an immunoplaque assay, using anti-FeLV GAG antibodies.
  • 8103JY 5' GAGGCATCCAACATATAAAGAAGACTAAAG 3' (SEQ ID NO: 19)
  • Figure 13 shows the vCP2294 C3 region map showing primer locations.
  • the vCP2294 sequence is depicted in Figure 14.
  • Example 4 Generation and characterization of ALVAC recombinant containing FeLV modified ENV gene inserted at C5 locus of vCP2294, ALVAC C3 H6p FeLV codon optimized GAG-PRO
  • the IVR was performed by transfection of 1°CEF cells with 10 ⁇ g of Not I-linearized donor plasmid pPB713 using FuGENE-6® reagent (Roche).
  • the transfected cells were subsequently infected with vCP2294 (ALVAC C3 H6p FeLV codon optimized GAG-PRO, Example 2) as rescue virus at MOI of 10.
  • vCP2294 AVAC C3 H6p FeLV codon optimized GAG-PRO, Example 2
  • Recombinant plaques were screened based on the plaque lift hybridization method using a 503 bp FeLV ENV specific probe labeled with horse radish peroxidase (HRP) according to the manufacturer's protocol (Amersham Cat# RPN3001). After four sequential rounds of plaque purification, the recombinant designated as vCP2296.6.1.1.2 was generated and confirmed by hybridization as 100% positive for the FeLV ENV insert and 100% negative for the empty C5 sites.
  • HRP horse radish peroxidase
  • Single plaque was selected from the 4 th round of plaque purification, and expanded to obtain PI (lx T25 flask), P2 (lxT75 flask) and P3 (6 x roller bottles) stocks.
  • the infected cell culture fluid from the roller bottles was harvested and concentrated to produce a virus stock VCP2296.6.1.1.2.
  • the donor plasmid pCXL208.2 contains the native ENV gene (SEQ ID NO:5).
  • the IVR was performed by transfection of 1°CEF cells with 10 ⁇ g of Not I-linearized donor plasmid pCXL208.2 using FuGENE-6® reagent (Roche).
  • the transfected cells were subsequently infected with vCP2294 (Example 2) as rescue virus at MOI of 10. After 24 hours, the transfected-infected cells were harvested, sonicated and used for recombinant virus screening.
  • Recombinant plaques were screened based on the plaque lift hybridization method using a 503bp FeLV ENV specific probe labeled with horse radish peroxidase (HRP) according to the manufacturer's protocol (Amersham Cat# RPN3001). After four sequential rounds of plaque purification, the recombinant designated as vCP2295.2.2.2.1 was generated and confirmed by hybridization as 100% positive for the FeLV ENV insert and 100% negative for the empty C5 sites.
  • HRP horse radish peroxidase
  • Single plaque was selected from the 4 th round of plaque purification, and expanded to obtain PI (lx T25 flask), P2 (lxT75 flask) and P3 (6 x roller bottles).
  • the infected cell culture fluid from the roller bottles was harvested and concentrated to produce a virus stock
  • vCP2295.2.2.2.1 The scheme to generate recombinant vCP2295 is shown in Figure 17. Analysis of recombinant: the following analyses were performed on the P3 stocks.
  • the homogeneity of the population was 100% positive to the FeLV ENV protein for recombinant vCP2295.2.2.2.1as evidenced by an immunoplaque assay, using anti-FeLV ENV antibody.
  • Cats in Group 1 were vaccinated subcutaneously (SQ) on Days 0 and 21 with 1ml of the FeLV-canarypox vector vaccine (vCP2296) at 10 6'2 Tissue Culture Doseso (TCID5o)/ml.
  • Cats in Group 2 received two doses of 1ml of the Placebo Vaccine containing Sterile Physiological Saline Solution on Days 0 and 21 and served as negative controls.
  • a cat was considered as having persistent FeLV p27 antigenemia when it was tested FeLV p27 positive for 3 consecutive weeks or 5 non-consecutive weeks.
  • Nineteen out of 22 cats (86.4%) from the placebo group became persistently FeLV antigenemic in comparison to 5/21 (23.8%) of the vaccinated group.
  • the estimated prevented fraction was 72.43% with a 95% confidence interval of 43.04% to 89.78%.
  • test vaccine was shown to be effective in preventing persistent FeLV antigenemia in 16 out of the 21 (76.2%) vaccinated-challenged cats with a significantly lower number of vaccinated cats developing a persistent antigenemia as compared to controls
  • Example 7 Comparison of the efficacy of the recombinant canarypox-FeLV with native ENV gene (VCP2295) and the recombinant canarypox-FeLV with optimized ENV gene (vCP2296) by challenge in cats
  • 0 no antigenemia (all the titrations were negative)
  • b) 1 transient antigenemia (less than three positive consecutive titrations and less than five positive titrations)
  • c) 2 persistent antigenemia (positive on at least five occasions or at least three positive consecutive titrations).
  • Leukocyte counts were used to express proviremia in provirus copy number / 50,000 WBC (white blood cell). Blood samples were collected in EDTA tubes on D44 before the challenge and every 3 w r eeks after the challenge, i.e., on D63, D84, D105, D126 and D147 for leukocyte count and FeLV proviremia monitoring on PBMC (peripheral blood mononucleated cells) using a quantitative PCR. Due to the repeated measurement nature of the criterion and the individual random effect, the proviremia data was analyzed using a mixed model with repeated measurements.
  • Figure 19 displays the evolution of the mean proviremia per group after challenge.
  • Figure 17 displays the evolution of the mean proviremia per group and p27 antigenemia status after challenge. In both vaccinated groups, p27 antigenemia was well correlated to proviremia (Figure 20).
  • the level of proviremia in marrow of p27 negative cats was between 3 and 5 log] 0 whereas it reached 8 to 9 log 10 in p27 positive cats.
  • the level of proviremia was well correlated with the p27 antigenemia individual status and with individual blood proviremia (as shown in Figure 21).
  • PBMCs were isolated by PAN COL L * density-gradient centrifugation (600g for
  • RPMI Pen icil 1 in-Streptomycinc
  • FCS fetal calf serum
  • Dendritic cells were loaded with peptide pools encoding for FeLV ENV and GAG proteins at D+15, D+35 and D+126. Briefly, 100.10' DC were re-stimulated individually by peptide pools n°l and 2 for FeLV ENV or peptide pools No. 2, 3, 6 and 8 FeLV GAG-PRO at l ⁇ g/ml in a final volume of 100 ⁇ 1 completed RPMi 10% FCS. Loaded dendritic cells were transferred into ELISpot plates and 500.10 3 PBMCs were added into each well. Dendritic cells were loaded with an irrelevant peptide as a negative control. Cells were stimulated during 20-24h at 37°C + 5%) CO?.
  • the ELI Spot I L- 10 was performed according to the manufacturer Instructions (R&D systems, M inneapolis, MN, USA ).
  • 500.10 3 purified PBMCs were di ectly re-stimulated using overlapping peptide pools encoding for FeLV ENV and GAG-PRO sequences, at l ⁇ ig/ml in a final volume of 200 ⁇ 1 completed RPMI 10% FCS, and set down in ELIspot IFNy coated plates.
  • 500.10 3 PBMCs were re-stimulated with an irrelevant peptide as a negative control.
  • number of peptide pool-specific I L-10 SFC number of IL-10 SFC upon individual FeLV peptide pool re-stimulation - number of I L-10 SFC upon irrelevant peptide re-stimulation.
  • FeLV-specific IL-IO secreting cells monitoring analysis of FeLV ENV-specific responses in blood
  • FeLV-specific I L-10 secreting cells monitoring analysis of FeL V GAG-PRO specific responses in blood
  • vCP2295 vaccination (group A) induced a higher frequency of FeLV specific IL-10 secreting cells in peripheral blood, in comparison to vCP2296 vaccination (group B) and control group (group C).
  • FeLV ENV or GAG-PRO peptides pools re-stimulation was analyzed using an IL-10 ELIspot assay.
  • FeLV challenge specifically boosted the FeLV ENV-specific I L- 10 cell response in all groups, as compared to the response at day 35, with no ditTerence between the 3 groups ( Figure 28a).
  • the challenge did not affect the antigen-specific response di ected against FeLV GAG- PRO region, and vCP2295-vaccinated cats maintained their FeLV GAG-PRO -specific I L- 10 response ( Figure 28b).
  • vCP2295 vaccinated cats (group A) exhibited only a FeLV-specific IL-10 immune response whereas vCP2296-vaccinated cats (group B) developed a FeLV-specific I L-10 immune response but also maintained their FeLV-specific IFNy response, c) Frequency of FeLV-specific IFNy and IL-10 producing cells in protected and infected animals
  • vCP2295 vaccinated group eight cats out of 10 presented a low IFNy/IL-IO ratio related to a high IL-10 response and a low IFNy response. Six of them were infected and two of them were protected. Two cats out of 10 presented both IFNy and IL-10 responses and a high IFNy/lL-10 ratio. These cats were protected. [0217] Protected cats either from vCP2295- or vCP2296-vaccinated group displayed a higher IFNy/IL-10 ratio in blood ( Figures 26) as compared to infected cats. Moreover, protected cats from vC 2296-vacc!nated group have a higher IFNy/IL-l 0 SFC ratio as compared to protected cats from vCP2295 -vaccinated group.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mycology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Communicable Diseases (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2012/023658 2011-07-20 2012-02-02 Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene Ceased WO2013012446A1 (en)

Priority Applications (22)

Application Number Priority Date Filing Date Title
DK12705199.3T DK2734230T3 (en) 2011-07-20 2012-02-02 RECOMBINANT FELINE LEUKEMIA VIRUS VACCINE CONTAINING OPTIMIZED FELINE LEUKEMIA VIRUS ENVELOPE GENE
PL12705199T PL2734230T3 (pl) 2011-07-20 2012-02-02 Rekombinowana szczepionka przeciwko wirusowi białaczki kotów zawierająca zoptymalizowany gen otoczki wirusa białaczki kotów
NZ620566A NZ620566B2 (en) 2011-07-20 2012-02-02 Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
HRP20190271TT HRP20190271T1 (hr) 2011-07-20 2012-02-02 Rekombinantno cjepivo protiv virusa mačje leukemije koje sadrži optimirajući gen proteina omotača virusa mačje leukemije
JP2014521612A JP6084970B2 (ja) 2011-07-20 2012-02-02 最適化ネコ白血病ウイルスエンベロープ遺伝子を含む組換えネコ白血病ウイルスワクチン
SI201231522T SI2734230T1 (sl) 2011-07-20 2012-02-02 Rekombinantno cepivo proti virusu mačje levkemije, ki vsebuje optimiziran gen ovojnice virusa mačje levkemije
LTEP12705199.3T LT2734230T (lt) 2011-07-20 2012-02-02 Rekombinantinė kačių leikemijos viruso vakcina, turinti optimizuotą kačių leukemijos viruso apvalkalo geną
RS20190039A RS58289B1 (sr) 2011-07-20 2012-02-02 Rekombinantna vakcina protiv virusa mačje leukemije koja sadrži optimizovani gen omotača virusa mačje leukemije
CN201280041551.1A CN103957932B (zh) 2011-07-20 2012-02-02 包含最优化的猫白血病病毒包膜基因的重组猫白血病病毒疫苗
MX2014000625A MX351642B (es) 2011-07-20 2012-02-02 Vacuna para virus de leucemia felina recombinante que contiene gen de envoltura del virus de leucemia felina optimizado.
EP12705199.3A EP2734230B1 (en) 2011-07-20 2012-02-02 Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
CA2842055A CA2842055C (en) 2011-07-20 2012-02-02 Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
SM20190129T SMT201900129T1 (it) 2011-07-20 2012-02-02 Vaccino ricombinante contro il virus della leucemia felina contenente un gene ottimizzato dell'involucro del virus della leucemia felina
IN547CHN2014 IN2014CN00547A (https=) 2011-07-20 2012-02-02
AU2012284558A AU2012284558B2 (en) 2011-07-20 2012-02-02 Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
ES12705199T ES2720150T3 (es) 2011-07-20 2012-02-02 Vacuna recombinante contra el virus de la leucemia felina que contiene un gen optimizado de la envoltura del virus de la leucemia felina
RU2014106295/15A RU2591817C2 (ru) 2011-07-20 2012-02-02 Рекомбинантная вакцина вируса лейкемии кошек, содержащая оптимизированный ген оболочки вируса лейкемии кошек
BR112014001287-3A BR112014001287B1 (pt) 2011-07-20 2012-02-02 vacina recombinante do vírus da leucemia felina contendo gene otimizado do envelope do vírus da leucemia felina
IL230460A IL230460B (en) 2011-07-20 2014-01-14 A recombinant feline leukemia virus component containing an effective feline leukemia virus envelope gene
ZA2014/00349A ZA201400349B (en) 2011-07-20 2014-01-16 Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
AU2017204298A AU2017204298A1 (en) 2011-07-20 2017-06-26 Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
CY20191100209T CY1125328T1 (el) 2011-07-20 2019-02-14 Ανασυνδυασμενο εμβολιο ιου λευχαιμιας αιλουροειδων περιεχοντας βελτιστοποιημενο γονιδιο φακελου ιου λευχαιμιας αιλουροειδων

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161509912P 2011-07-20 2011-07-20
US61/509,912 2011-07-20

Publications (1)

Publication Number Publication Date
WO2013012446A1 true WO2013012446A1 (en) 2013-01-24

Family

ID=45722710

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/023658 Ceased WO2013012446A1 (en) 2011-07-20 2012-02-02 Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene

Country Status (25)

Country Link
US (2) US8895027B2 (https=)
EP (1) EP2734230B1 (https=)
JP (2) JP6084970B2 (https=)
CN (1) CN103957932B (https=)
AU (2) AU2012284558B2 (https=)
BR (1) BR112014001287B1 (https=)
CA (1) CA2842055C (https=)
CY (1) CY1125328T1 (https=)
DK (1) DK2734230T3 (https=)
ES (1) ES2720150T3 (https=)
HR (1) HRP20190271T1 (https=)
HU (1) HUE043547T2 (https=)
IL (1) IL230460B (https=)
IN (1) IN2014CN00547A (https=)
LT (1) LT2734230T (https=)
MX (1) MX351642B (https=)
PL (1) PL2734230T3 (https=)
PT (1) PT2734230T (https=)
RS (1) RS58289B1 (https=)
RU (1) RU2591817C2 (https=)
SI (1) SI2734230T1 (https=)
SM (1) SMT201900129T1 (https=)
TR (1) TR201901466T4 (https=)
WO (1) WO2013012446A1 (https=)
ZA (1) ZA201400349B (https=)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016073410A1 (en) 2014-11-03 2016-05-12 Merial, Inc. Methods of using microneedle vaccine formulations to elicit in animals protective immunity against rabies virus
WO2019068905A2 (en) * 2017-10-06 2019-04-11 Virbac Feline vaccines conferring early protection
EP3706789A1 (en) * 2017-11-06 2020-09-16 Intervet International B.V. Feline calicivirus vaccine
CN111848785B (zh) * 2020-07-10 2022-09-06 青岛博隆基因工程有限公司 猫疱疹病毒抗体序列、四肽链分子、免疫球蛋白分子

Citations (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2909462A (en) 1955-12-08 1959-10-20 Bristol Myers Co Acrylic acid polymer laxative compositions
US4603112A (en) 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
WO1987003905A1 (en) 1985-12-18 1987-07-02 Genetics Institute, Inc. Promoter system
US4722848A (en) 1982-12-08 1988-02-02 Health Research, Incorporated Method for immunizing animals with synthetically modified vaccinia virus
EP0260148A2 (en) 1986-09-12 1988-03-16 Genentech, Inc. Improved recombinant expression method, vector and transformed cells
EP0265785A2 (en) 1986-10-16 1988-05-04 Microgenesys, Inc. Polypeptides derived from the envelope gene of human immunodeficiency virus in recombinant baculovirus infected insect cells
US4745051A (en) 1983-05-27 1988-05-17 The Texas A&M University System Method for producing a recombinant baculovirus expression vector
US4769330A (en) 1981-12-24 1988-09-06 Health Research, Incorporated Modified vaccinia virus and methods for making and using the same
WO1989001036A1 (en) 1987-07-23 1989-02-09 Celltech Limited Recombinant dna expression vectors
EP0323597A1 (de) 1987-12-18 1989-07-12 Christian Mayr GmbH & Co. KG Schleifringlose, elektromagnetische Schaltkupplung mit überlastfunktion
EP0370573A2 (en) 1988-11-21 1990-05-30 Microgenesys, Inc. Skin test and test kit for AIDS
WO1990012882A1 (en) 1989-04-17 1990-11-01 Health Research, Inc. Herpes virus recombinant poxvirus vaccine
US4968615A (en) 1985-12-18 1990-11-06 Ciba-Geigy Corporation Deoxyribonucleic acid segment from a virus
US5110587A (en) 1981-12-24 1992-05-05 Health Research, Incorporated Immunogenic composition comprising synthetically modified vaccinia virus
US5122458A (en) 1984-08-24 1992-06-16 The Upjohn Company Use of a bgh gdna polyadenylation signal in expression of non-bgh polypeptides in higher eukaryotic cells
WO1992015672A1 (en) * 1991-03-07 1992-09-17 Virogenetics Corporation Genetically engineered vaccine strain
US5168062A (en) 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
US5174993A (en) 1981-12-24 1992-12-29 Health Research Inc. Recombinant avipox virus and immunological use thereof
WO1995014102A1 (fr) 1993-11-18 1995-05-26 Rhone-Poulenc Rorer S.A. Adenovirus recombinants codant pour la thymidine kinase lors de therapie genique
US5505941A (en) 1981-12-24 1996-04-09 Health Research, Inc. Recombinant avipox virus and method to induce an immune response
US5529780A (en) 1994-03-30 1996-06-25 Virogenetics Corporation Nucleotide and amino acid sequences of canine herpesvirus gB and gC
WO1996034109A1 (en) 1995-04-25 1996-10-31 Vical Incorporated Single-vial formulations of dna/lipid complexes
WO1996040241A1 (en) 1995-06-07 1996-12-19 Virogenetics Corporation Recombinant poxvirus-rabies compositions and combination compositions and uses
EP0803573A1 (en) 1996-04-25 1997-10-29 Gesellschaft für Biotechnologische Forschung mbH (GBF) Polycistronic expression construct with cytokines for multivalent vaccines
WO1998000166A1 (en) 1996-07-03 1998-01-08 Merial, Inc. Recombinant canine adenovirus (cav) containing exogenous dna
WO1999044633A1 (fr) 1998-03-03 1999-09-10 Merial Vaccins vivants recombines et adjuves
WO1999051269A1 (fr) 1998-04-03 1999-10-14 Merial Vaccins adn adjuves
US6017537A (en) 1998-12-18 2000-01-25 Connaught Laboratories, Inc. Formyl methionyl peptide vaccine adjuvant
EP1001025A2 (en) 1998-10-22 2000-05-17 Pfizer Products Inc. Outer membrane proteins from actinobacillus pleuropneumoniae
US6090393A (en) 1996-07-03 2000-07-18 Merial Recombinant canine adenoviruses, method for making and uses thereof
US6133028A (en) 1993-05-28 2000-10-17 Transgene S.A. Defective adenoviruses and corresponding complementation lines
US6156567A (en) 1996-07-03 2000-12-05 Merial Truncated transcriptionally active cytomegalovirus promoters
WO2000077210A1 (fr) 1999-06-10 2000-12-21 Merial Gm-csf equin
WO2001005934A2 (fr) 1999-07-16 2001-01-25 Merial Genes de calicivirus felin et vaccins recombines les contenant
EP1221955A2 (en) 1999-09-25 2002-07-17 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US6451769B1 (en) 1996-06-14 2002-09-17 Pasteur Merieux Serums Et Vaccins Compositions and methods for administering Borrelia DNA
WO2003022886A1 (en) 2001-09-11 2003-03-20 Merial Igf-1 as feline vaccine adjuvant, in particular against feline retroviruses
US6692956B2 (en) 2000-10-06 2004-02-17 Transgene S.A. Recombinant adenoviral vectors
WO2004024027A2 (en) 2002-06-07 2004-03-25 University Of Florida Endodontic files made using bulk metallic glasses
US6852705B2 (en) 2000-01-21 2005-02-08 Merial DNA vaccines for farm animals, in particular bovines and porcines
WO2005095442A1 (en) * 2004-03-30 2005-10-13 Institut Gustave Roussy Polypeptide sequence involved in the modulation of the immunosuppresive effect of viral proteins
US20060034867A1 (en) 2004-06-04 2006-02-16 Tesfai Tseggai Needle-free administration of FeLV vaccines
US7078507B2 (en) 2001-11-09 2006-07-18 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Synthetic genes for malarial proteins and methods of use
WO2008150404A1 (en) * 2007-05-30 2008-12-11 Wyeth Raccoon poxvirus expressing genes of feline antigens

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2179854T3 (es) * 1988-12-13 2003-02-01 Harvard College Materiales aislados de felv prototipos para uso en modelos de enfermedades y vacunas.
EP1434859A2 (en) * 2001-07-25 2004-07-07 New York University Use of glycosylceramides as adjuvants for vaccines against infections and cancer
DE10393824D2 (de) * 2002-09-23 2005-08-11 Mologen Ag Impfstoff gegen Infektionen mit Onkoviren, wie dem felinen Leukosevirus der Katze
US7998733B2 (en) * 2004-10-05 2011-08-16 Merial Limited Chimeric vectors
EP1954308B1 (en) * 2005-09-16 2011-09-07 Merial Ltd. Stabilizers for freeze-dried vaccines

Patent Citations (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2909462A (en) 1955-12-08 1959-10-20 Bristol Myers Co Acrylic acid polymer laxative compositions
US5505941A (en) 1981-12-24 1996-04-09 Health Research, Inc. Recombinant avipox virus and method to induce an immune response
US5110587A (en) 1981-12-24 1992-05-05 Health Research, Incorporated Immunogenic composition comprising synthetically modified vaccinia virus
US4603112A (en) 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
US5174993A (en) 1981-12-24 1992-12-29 Health Research Inc. Recombinant avipox virus and immunological use thereof
US4769330A (en) 1981-12-24 1988-09-06 Health Research, Incorporated Modified vaccinia virus and methods for making and using the same
US4722848A (en) 1982-12-08 1988-02-02 Health Research, Incorporated Method for immunizing animals with synthetically modified vaccinia virus
US4745051A (en) 1983-05-27 1988-05-17 The Texas A&M University System Method for producing a recombinant baculovirus expression vector
US5122458A (en) 1984-08-24 1992-06-16 The Upjohn Company Use of a bgh gdna polyadenylation signal in expression of non-bgh polypeptides in higher eukaryotic cells
US5168062A (en) 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
US5385839A (en) 1985-01-30 1995-01-31 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter regulatory DNA sequence
US4968615A (en) 1985-12-18 1990-11-06 Ciba-Geigy Corporation Deoxyribonucleic acid segment from a virus
WO1987003905A1 (en) 1985-12-18 1987-07-02 Genetics Institute, Inc. Promoter system
EP0260148A2 (en) 1986-09-12 1988-03-16 Genentech, Inc. Improved recombinant expression method, vector and transformed cells
EP0265785A2 (en) 1986-10-16 1988-05-04 Microgenesys, Inc. Polypeptides derived from the envelope gene of human immunodeficiency virus in recombinant baculovirus infected insect cells
WO1989001036A1 (en) 1987-07-23 1989-02-09 Celltech Limited Recombinant dna expression vectors
EP0323597A1 (de) 1987-12-18 1989-07-12 Christian Mayr GmbH & Co. KG Schleifringlose, elektromagnetische Schaltkupplung mit überlastfunktion
EP0370573A2 (en) 1988-11-21 1990-05-30 Microgenesys, Inc. Skin test and test kit for AIDS
WO1990012882A1 (en) 1989-04-17 1990-11-01 Health Research, Inc. Herpes virus recombinant poxvirus vaccine
US5494807A (en) 1991-03-07 1996-02-27 Virogenetics Corporation NYVAC vaccinia virus recombinants comprising heterologous inserts
US5766599A (en) 1991-03-07 1998-06-16 Virogenetics Corporation Trova fowl pox virus recombinants comprising heterologous inserts
WO1992015672A1 (en) * 1991-03-07 1992-09-17 Virogenetics Corporation Genetically engineered vaccine strain
US5756103A (en) 1991-03-07 1998-05-26 Virogenetics Corporation Alvac canarypox virus recombinants comprising heterlogous inserts
US5762938A (en) 1991-03-07 1998-06-09 Virogenetics Corporation Modified recombinant vaccinia virus and expression vectors thereof
US6133028A (en) 1993-05-28 2000-10-17 Transgene S.A. Defective adenoviruses and corresponding complementation lines
WO1995014102A1 (fr) 1993-11-18 1995-05-26 Rhone-Poulenc Rorer S.A. Adenovirus recombinants codant pour la thymidine kinase lors de therapie genique
US5529780A (en) 1994-03-30 1996-06-25 Virogenetics Corporation Nucleotide and amino acid sequences of canine herpesvirus gB and gC
US5688920A (en) 1994-03-30 1997-11-18 Virogenetics Corporation Nucleotide and amino acid sequences for canine herpesvirus GB, GC and GD and uses therefor
WO1996034109A1 (en) 1995-04-25 1996-10-31 Vical Incorporated Single-vial formulations of dna/lipid complexes
WO1996040241A1 (en) 1995-06-07 1996-12-19 Virogenetics Corporation Recombinant poxvirus-rabies compositions and combination compositions and uses
EP0803573A1 (en) 1996-04-25 1997-10-29 Gesellschaft für Biotechnologische Forschung mbH (GBF) Polycistronic expression construct with cytokines for multivalent vaccines
US6451769B1 (en) 1996-06-14 2002-09-17 Pasteur Merieux Serums Et Vaccins Compositions and methods for administering Borrelia DNA
WO1998000166A1 (en) 1996-07-03 1998-01-08 Merial, Inc. Recombinant canine adenovirus (cav) containing exogenous dna
US6090393A (en) 1996-07-03 2000-07-18 Merial Recombinant canine adenoviruses, method for making and uses thereof
US6156567A (en) 1996-07-03 2000-12-05 Merial Truncated transcriptionally active cytomegalovirus promoters
WO1999044633A1 (fr) 1998-03-03 1999-09-10 Merial Vaccins vivants recombines et adjuves
WO1999051269A1 (fr) 1998-04-03 1999-10-14 Merial Vaccins adn adjuves
EP1001025A2 (en) 1998-10-22 2000-05-17 Pfizer Products Inc. Outer membrane proteins from actinobacillus pleuropneumoniae
US6017537A (en) 1998-12-18 2000-01-25 Connaught Laboratories, Inc. Formyl methionyl peptide vaccine adjuvant
WO2000077210A1 (fr) 1999-06-10 2000-12-21 Merial Gm-csf equin
US6645740B1 (en) 1999-06-10 2003-11-11 Merial Limited Nucleic acids encodings equine GM-CSF
WO2001005934A2 (fr) 1999-07-16 2001-01-25 Merial Genes de calicivirus felin et vaccins recombines les contenant
EP1221955A2 (en) 1999-09-25 2002-07-17 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US6852705B2 (en) 2000-01-21 2005-02-08 Merial DNA vaccines for farm animals, in particular bovines and porcines
US6692956B2 (en) 2000-10-06 2004-02-17 Transgene S.A. Recombinant adenoviral vectors
WO2003022886A1 (en) 2001-09-11 2003-03-20 Merial Igf-1 as feline vaccine adjuvant, in particular against feline retroviruses
US7078507B2 (en) 2001-11-09 2006-07-18 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Synthetic genes for malarial proteins and methods of use
WO2004024027A2 (en) 2002-06-07 2004-03-25 University Of Florida Endodontic files made using bulk metallic glasses
WO2005095442A1 (en) * 2004-03-30 2005-10-13 Institut Gustave Roussy Polypeptide sequence involved in the modulation of the immunosuppresive effect of viral proteins
US20080008683A1 (en) 2004-03-30 2008-01-10 Institut Gustave Roussy Polypeptide Sequence Involved in the Modulation of the Immunosuppresive Effect of Viral Proteins
US20060034867A1 (en) 2004-06-04 2006-02-16 Tesfai Tseggai Needle-free administration of FeLV vaccines
WO2008150404A1 (en) * 2007-05-30 2008-12-11 Wyeth Raccoon poxvirus expressing genes of feline antigens

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
"Molecular Biology and Biotechnology: a Comprehensive Desk Reference", 1995, VCH PUBLISHERS, INC.
"Protein Purification Applications", OXFORD UNIVERSITY PRESS
"The Encyclopedia of Molecular Biology", 1994, BLACKWELL SCIENCE LTD.
"Vaccine Design - The Subunit and Adjuvant Approach", PHARMACEUTICAL BIOTECHNOLOGY, 1995, pages 147
"Vaccine Design, The subunit and adjuvant approach", PHARMACEUTICAL BIOTECHNOLOGY, vol. 6, 1995
ARJONA A. ET AL., JOURNAL OF CLINICAL MICROBIOLOGY, vol. 38, 2000, pages 3448 - 3449
BENJAMIN LEWIN: "Genes V.", 1994, OXFORD UNIVERSITY PRESS
BRALEY J., FELINE PRACTICE, vol. 22, 1994, pages 25 - 29
DENORONHA, F. ET AL., VIROLOGY, vol. 85, 1978, pages 617 - 621
E. W. MARTIN: "Remington's Pharmaceutical Sciences", 1975, MACK PUBLISHING CO.
FLYNN, J.N. ET AL., J. VIROL., 2002
HOSIE M.J., VETERINARY RECORDS, vol. 128, 1989, pages 293 - 297
J. SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY
MALIK R. ET AL., AUSTRALIAN VETERINARY JOURNAL, vol. 75, 1997, pages 323 - 327
MATHES, L.E. ET AL., NATURE, 1978
MYERS; MILLER: "Optimal Alignments in Linear Space", CABIOS, vol. 4, 1988, pages 11 - 17, XP009076513, DOI: doi:10.1093/bioinformatics/4.1.11
NUNBERG, J.H. ET AL., PNAS, vol. 81, 1983, pages 3675 - 3679
PHAMEUROPA, vol. 8, no. 2, June 1996 (1996-06-01)
PHARMEUROPA, vol. 8, no. 2, June 1996 (1996-06-01)
POULET H. ET AL., VETERINARY RECORD, vol. 153, 2003, pages 141 - 145
R. CORDEIRO GIUNCHETTI ET AL., VACCINE, 2007
SPARKES A.H., JOURNAL OF SMALL ANIMAL PRACTICE, vol. 38, 1997, pages 187 - 194
TARTAGLIA J. ET AL., JOURNAL OF VIROLOGY, vol. 67, 1993, pages 2370 - 2375
THOMSEN D.R. ET AL., JOURNAL OF GENERAL VIROLOGY, vol. 73, 1992, pages 1819 - 1824

Also Published As

Publication number Publication date
RU2014106295A (ru) 2015-08-27
BR112014001287A2 (pt) 2017-02-21
LT2734230T (lt) 2019-03-25
DK2734230T3 (en) 2019-01-28
EP2734230B1 (en) 2018-11-21
PL2734230T3 (pl) 2019-07-31
AU2012284558A1 (en) 2014-02-20
JP6084970B2 (ja) 2017-02-22
EP2734230A1 (en) 2014-05-28
AU2017204298A1 (en) 2017-07-13
ZA201400349B (en) 2015-08-26
JP2014528699A (ja) 2014-10-30
CN103957932A (zh) 2014-07-30
IN2014CN00547A (https=) 2015-04-03
HRP20190271T1 (hr) 2019-03-22
SI2734230T1 (sl) 2019-04-30
TR201901466T4 (tr) 2019-02-21
CN103957932B (zh) 2017-06-23
US20130022632A1 (en) 2013-01-24
US8895027B2 (en) 2014-11-25
AU2012284558B2 (en) 2017-06-29
CA2842055A1 (en) 2013-01-24
US9856295B2 (en) 2018-01-02
IL230460A0 (en) 2014-03-31
CA2842055C (en) 2019-04-02
HUE043547T2 (hu) 2019-08-28
US20150030623A1 (en) 2015-01-29
BR112014001287B1 (pt) 2020-12-08
MX351642B (es) 2017-10-23
ES2720150T3 (es) 2019-07-18
JP6240294B2 (ja) 2017-11-29
JP2017052774A (ja) 2017-03-16
CY1125328T1 (el) 2023-03-24
RS58289B1 (sr) 2019-03-29
SMT201900129T1 (it) 2019-05-10
PT2734230T (pt) 2019-02-27
RU2591817C2 (ru) 2016-07-20
IL230460B (en) 2018-11-29
MX2014000625A (es) 2015-06-02
NZ620566A (en) 2016-02-26

Similar Documents

Publication Publication Date Title
AU2013221502B2 (en) Recombinant poxviral vectors expressing both rabies and OX40 proteins, and vaccines made therefrom
EP2827897B1 (en) Recombinant equine herpesvirus-1 vaccine containing mutated glycoprotein c and uses thereof
JP2012506699A (ja) アフリカウマ病ウイルスに対するワクチン
JP6240294B2 (ja) 最適化ネコ白血病ウイルスエンベロープ遺伝子を含む組換えネコ白血病ウイルスワクチン
US9682138B2 (en) Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
CA2837582A1 (en) Genetic vaccines against hendra virus and nipah virus
AU2014218358B2 (en) Vaccine against african horse sickness virus
NZ620566B2 (en) Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
HK1192454B (en) Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
HK1192454A (en) Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene
HK40007462B (en) Recombinant poxviral vectors expressing both rabies and ox40 proteins, and vaccines made therefrom
HK40007462A (en) Recombinant poxviral vectors expressing both rabies and ox40 proteins, and vaccines made therefrom

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12705199

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2842055

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2014/000625

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2014521612

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012705199

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2012284558

Country of ref document: AU

Date of ref document: 20120202

Kind code of ref document: A

Ref document number: 2014106295

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014001287

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014001287

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20140117