NZ620566B2

NZ620566B2 - Recombinant feline leukemia virus vaccine containing optimized feline leukemia virus envelope gene

Info

Publication number: NZ620566B2
Application number: NZ620566A
Authority: NZ
Inventors: Thierry Heidmann; Herve Poulet
Original assignee: Centre National De La Recherche Scientifique; Institut Gustave Roussy; Merial Inc; Université Paris Sud; Université Parissud
Priority date: 2011-07-20
Filing date: 2012-02-02
Publication date: 2016-05-27

Abstract

Discloses a composition comprising an expression vector comprising a first polynucleotides encoding an optimised Feline Leukemia Virus (FeLV) envelope (ENV) polypeptide and a second polynucleotide encoding an FeLV GAG/PRO polypeptide, wherein the optimised FeLV ENV polypeptide comprises a mutation at amino acid position 527 or equivalent corresponding amino acid position of an FeLV ENV protein, and wherein the mutation comprises a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E), and wherein the polynucleotide encodes an optimised FeLV ENV polypeptide having the sequence as set forth in SEQ ID NO: 2, 4, 27, 28, 29, 30, 31, 32, 33 or 34, wherein the sequences are as defined in the complete specification. t amino acid position 527 or equivalent corresponding amino acid position of an FeLV ENV protein, and wherein the mutation comprises a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E), and wherein the polynucleotide encodes an optimised FeLV ENV polypeptide having the sequence as set forth in SEQ ID NO: 2, 4, 27, 28, 29, 30, 31, 32, 33 or 34, wherein the sequences are as defined in the complete specification.

Description

RECOMBINANT FELINE LEUKEMIA VIRUS VACCINE CONTAINING OPTIMIZED FELINE LEUKEMIA VIRUS ENVELOPE GENE CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. provisional application 61/509,912 filed July , 2011.

FIELD OF THE INVENTION 100021 The present invention relates to compositions or vaccines for combating feline leukemia virus infections in animals. Specifically, the present invention provides vectors that contain and express in vivo or in vitro optimized feline leukemia virus envelope antigens that elicit an immune response in animals against feline leukemia virus, including compositions comprising said vectors, methods of vaccination against feline leukemia virus, and kits for use with such methods and compositions.

BACKGROUND OF THE INVENTION Feline Leukemia Virus (FeLV) is a common cause of infection of domestic cats throughout the world and a cause of significant morbidity and mortality. The prevalence of antigenaemia may vary from I to 5 percent in healthy cats to 15 to 30 percent in sick cats (Hosie M.J. et al., Veterinary Records, 1989, 128, 293-297; Braley J., Feline Practice, 1994, 22, 25-29; Malik R. et aL, Australian Veterinary Journal, 1997, 75, 323-327; Arjona A. Journal et al., of Clinical Microbiology, 2000, 38, 3448-3449). The virus may establish a life-long infection characterized by a persistent viraemia and a fatal outcome. Most FeLV-related diseases occur persistently in infected animals, and they arc always serious and most likely fatal. Among the most frequently diagnosed conditions are lymphomas, myeloid leukaemias, immunodeficiency and non-regenerative anaemia. The infection can be controlled by the identification and isolation of persistently viraemic cats, which are the source of the infection. Vaccines have also helped to prevent the virus spreading. Several FeLV vaccines are available. Most of them contain either inactivated virus or recombinant subunits. Their efficacy is controversial (Sparkes A.H., Journal of Small Animal Practice, 1997, 38, 187-194). Vaccine breakdowns have been observed.

An alternative way would be to use recombinant viral vector, The canarypox virus al., commercial recombinant FeLV vaccine is also available (EURIFEL® FeLV, Merial).

The FeLV genome codes for three genes: a GAG gene coding for the major structural components of the virus, an ENV gene which codes for the envelope glycoprotein, and a POL gene cndoing the polymerase protein (Thomsen D.R., et al., Journal of General Virology, 73, 1819-1824, transmembrane protein p15E (DeNoronha, F., et al., 1978, Virology 85:617-621; Nunberg, J.H., et al., gammaretroviruses with immunosuppressive properties (Mathes, L.E. et al., 1978, Nature). FeLV envelope glycoprotein is one of the major immunogens and is the target of FeLV-specific cytotoxic T cell responses as well as neutralizing antibodies (Flynn, IN., et al., 2002, J. Virol.). US patent application US 2008/0008683 discussed a polypeptide that is capable of modulating the immunosuppressive properties of a viral protein against the host in which it is expressed. The FeLV GAG gene encodes a precursor polyprotein which is cleaved by the protease (FeLV PRO gene) to generate the capsid proteins. The capsid proteins are also a major immunogen inducing FeLV-specific cytotoxic T cell responses as well as neutralizing antibodies (Flynn, J.N., et al., 2002, J. Virol.). The POL gene encodes three proteins: gives rise to all three proteins of the POL region (Thomsen D.R., et al., 1992).

There is a general need for an improvement in efficacy and safety of the FeLV vaccines and SUMMARY OF THE INVENTION vaccines as well as methods for treatment and prophylaxis of infection by FeLV. vector and especially the ALVAC vector have been tested for the expression of FeLV genes (Tartaglia J.

Journal of Virology, 1993, 67, 2370-2375; Poulet H. et al., Veterinary Record, 2003, 153, 141-145). A 1992). The FeLV envelope (ENV) gene encodes a gp85 precursor protein which is proteolytically processed by cellular enzymes(s) to yield the major envelope glycoprotein gp70 and the associated 1983, PNAS 81:3675-3679). The transmembrane protein pl5E contains a sequence conserved among protease (PRO), reverse transcriptase and integrase. Autoprocessing by the protease portion of the gene for more effective protection in field conditions.

A preferred embodiment of this invention can be any one or all of providing recombinant vectors or viruses as well as methods for making such viruses, and providing compositions and/or The invention provides a recombinant vector, such as a recombinant virus, e.g., a recombinant poxvirus, that contains and expresses at least one exogenous nucleic acid molecule and, the at least one exogenous nucleic acid molecule may comprise a nucleic acid molecule encoding an immunogen or epitope of interest from FeLV proteins, such as FeLV ENV and/or FeLV GAG/PRO.

In particular, the present invention provides a recombinant vector, such as a recombinant virus, e.g., a recombinant poxvirus, that contains and expresses at least one exogenous nucleic acid molecule and, the at least one exogenous nucleic acid molecule may comprise FeLV polypeptides and/or variants or fragments thereof.

The invention further provides compositions or vaccine comprising such an expression vector or the expression product(s) of such an expression vector. [0010A] The invention provides a composition comprising an expression vector comprising a first polynucleotides encoding an optimized Feline Leukemia Virus (FeLV) envelope (ENV) polypeptide and a second polynucleotide encoding an FeLV GAG/PRO polypeptide, wherein the optimized FeLV ENV polypeptide comprises a mutation at amino acid position 527 or equivalent corresponding amino acid position of an FeLV ENV protein, and wherein the mutation comprises a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E), and wherein the polynucleotide encodes an optimized FeLV ENV polypeptide having the sequence as set forth in SEQ ID NO: 2, 4, 27, 28, 29, 30, 31, 32, 33 or 34.

The invention further provides methods for inducing an immunological (or immunogenic) or protective response against FeLV, as well as methods for preventing FeLV or disease state(s) caused by FeLV, comprising administering the expression vector or an expression product of the expression vector, or a composition comprising the expression vector, or a composition comprising an expression product of the expression vector.

The invention also relates to expression products from the virus as well as antibodies generated from the expression products or the expression thereof in vivo and uses for such products and antibodies, e.g., in diagnostic applications.

These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.

BRIEF DESCRIPTION OF DRAWINGS

[0014] The following detailed description, given by way of example, and which is not intended to limit the invention to specific embodiments described, may be understood in conjunction with the accompanying figures, incorporated herein by reference, in which: Figure 1 provides a table identifying the SEQ ID NO assigned to the polynucleotide and protein sequence.

Figure 2 depicts a plasmid map of pH6C5env (208.2).

Figure 3 provides the sequences for plasmid pCXL208.2 (pH6C5env) fragment containing FeLV ENV DNA and left and right arms (SEQ ID NO:36) and FeLV ENV protein (SEQ ID NO:7) from plasmid pHCMV-ENV FeLV.

[0018] Figure 4 provides the restriction map for plasmid pPB713.

Figure 5 provides the sequence alignments of the FeLV ENV DNA and proteins.

Figure 6 provides the plasmid pPB712 restriction map.

(SEQ ID NO:11) and codon-optimized GAG/PRO DNA (SEQ ID NO:10).

Figure 8 provides the cloning scheme.

[0023] Figure 11 shows the nucleotide sequence of the pJY1874.1 DNA fragment containing the arms and insert (SEQ ID NO:38).

[0027] Figure 13 shows the vCP2294 plasmid C3 region map with primer locations.

Figure 16 shows the vCP2296 plasmid C5 region map with primer locations.

Figure 19 is a graph showing the evolution of the mean proviremia per group after status after challenge.

[0035] Figure 23 shows the FeLV specific (ENV peptide pool No. 1) Figure 25 shows the FeLV specific (GAG/PRO peptide pools) — IL-20 response on D126.

(ENV stimulation) — IL-10 response on D126.

IL-10 response on D126.

Figure 7 shows the DNA sequence alignment between wild-type GAG/PRO DNA Figure 9 provides the restriction map of plasmid pJY1874.1.

Figure 10 provides the FeLV GAG-PRO protein sequence.

Figure 12 provides the cloning scheme for making vCP2294 plasmid.

Figure 14 depicts the vCP2294 plasmid sequence (annotated).

Figure 15 provides the cloning scheme for making vCP2296 plasmid.

Figure 17 provides the cloning scheme for making vCP2295 plasmid.

Figure 18 depicts the vCP2295 plasmid sequence. challenge.

Figure 20 is a graph showing the evolution of the mean proviremia per group and p27 Figure 21 is a graph showing the proviremia in marrow correlating to p27 status.

Figure 22 shows the FeLV specific- IFNy response on D35.

IFNy response on D35.

Figure 24 shows the FeLV specific (ENV peptide pools) IL-10 response on D35.

D35.

Figures 26a-b show the FeLV specific (ENV stimulation) — IFNy/IL-10 ratio on D35.

Figure 27 shows the FeLV specific (GAG/PRO stimulation) - IFNy response on Figure 28a shows the FeLV specific Figure 28b shows the FeLV specific (GAG/PRO stimulation) Figure 29 shows the FeLV specific IFNI/AL-10 ratio FeLV ENV and GAG/PRO DETAILED DESCRIPTION

[0044] terms such as "consisting essentially of and "consists essentially of have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V. 02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1569-8). indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context The term "FeLV ENV polypeptide or DNA" refers to any native or FeLV ENV DNA may be optimized to produce a single amino acid mutation in the FeLV as used herein may be selected from the group consisting of equine (e.g., horse), canine (e.g., big cats, and other felines including cheetahs and lynx), bovine (e.g., cattle), porcine (e.g., pig), peptide pools on D35.

It is noted that in this disclosure and particularly in the claims, terms such as "comprises", "comprised", "comprising" and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean "includes", "included", "including", and the like; and that Unless otherwise noted, technical terms are used according to conventional usage. published by Oxford University Press, 1994 (ISBN 0854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0 The singular terms "a," "an," and "the" include plural referents unless context clearly clearly indicate otherwise. The word "or" means any one member of a particular list and also includes any combination of members of that list. optimized/mutated FeLV ENV polypeptide or DNA, and their derivatives and variants. For example, the optimized/mutated FeLV ENV DNA may be codon-optimized FeLV DNA, the polypeptide. The optimized/mutated FeLV ENV polypeptide may comprise a single amino acid mutation, or a double amino acid mutation, or a multiple amino acid mutation.

The term "animal" is used herein to include all mammals, birds and fish. The animal dogs, wolves, foxes, coyotes, jackals), feline (e.g., lions, tigers, domestic cats, wild cats, other pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary), primate (e.g., prosimian, tarsier, monkey, gibbon, ape), humans, and fish. The term "animal" also includes an individual The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of consecutive amino acid residues. 100501 The term "nucleic acid", "nucleotide", and "polynucleotide" refers to RNA or DNA (e.g. by chemical synthesis, by gene cloning etc.) and can take various forms (e.g. linear or genomic sequence, or just the coding sequences as in cDNAs , such as an open reading frame such as transcription initiation, translation and transcription termination. Thus, also included are between 60 and 250 nucleotides upstream of the start codon of the coding sequence or gene; Doree S M et al.; Pandher K Chung J Y terminator is located within approximately 50 nucleotides downstream of the stop codon of the Gene or polynucleotide also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which The term "immunogenic polypeptide" or "immunogenic fragment" as used herein molecule and induce a cytotoxic T lymphocyte ("CTL") response, and/or a B (for ovine (e.g., sheep, goats, lamas, bisons), avian (e.g., chicken, duck, goose, turkey, quail, animal in all stages of development, including embryonic and fetal stages.

[0049] and derivatives thereof, such as those containing modified backbones. It should be appreciated that the invention provides polynucleotides comprising sequences complementary to those described herein. Polynucleotides according to the invention can be prepared in different ways branched, single or double stranded, or a hybrid thereof, primers, probes etc.). 100511 The term "gene" is used broadly to refer to any segment of polynucleotide associated with a biological function. Thus, genes or polynucleotides include introns and exons as in (ORF), starting from the start codon (methionine codon) and ending with a termination signal (stop codon). Genes and polynucleotides can also include regions that regulate their expression, promoters and ribosome binding regions (in general these regulatory elements lie approximately et al.; et al.), transcription terminators (in general the coding sequence or gene; Ward C K et al.). includes regulatory sequences. [00521 refers to a polypeptide or a fragment of a polypeptide which comprises an allele-specific motif, an epitope or other sequence such that the polypeptide or the fragment will bind an MHC cell response example, antibody production), and/or T-helper lymphocyte response, and/or a delayed type hypersensitivity (DTH) response against the antigen from which the immunogenic polypeptide or the immunogenic fragment is derived. A DTH response is an immune reaction in which T cell-dependent macrophage activation and inflammation cause tissue injury. A DTH reaction to the subcutaneous injection of antigen is often used as an assay for cell-mediated immunity. the sense that once administered to the host, it is able to evoke an immune response of the humoral (B cells) and/or cellular type (T cells). These are particular chemical groups or peptide peptide sequence in a polypeptide, a tri- to penta-glycoside sequence in a polysaccharide. In the animal most antigens will present several or even many antigenic determinants simultaneously.

Such a polypeptide may also be qualified as an immunogenic polypeptide and the epitope may be identified as described further.

An "isolated" biological component (such as a nucleic acid or protein or organelle) instance, other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles.

Nucleic acids and proteins that have been "isolated" include nucleic acids and proteins purified

[0055] embodiments at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98%, or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, for By definition, an epitope is an antigenic determinant that is immunologically active in sequences on a molecule that are antigenic. An antibody specifically binds a particular antigenic epitope on a polypeptide. Specific, non-limiting examples of an epitope include a tetra- to penta- refers to a component that has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, for by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant technology as well as chemical synthesis.

The term "purified" as used herein does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified polypeptide preparation is one in which the polypeptide is more enriched than the polypeptide is in its natural environment. A polypeptide preparation is substantially purified such that the polypeptide represents several of the total polypeptide content of the preparation. The same applies to polynucleotides. The polypeptides disclosed herein can be purified by any of the means known in the art.

A recombinant polynucleotide is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis example, by genetic engineering techniques. In one embodiment, a recombinant poly -nucleotide In one aspect, the present invention provides optimized or mutated polypeptides from FeLV. In another aspect, the present invention provides optimized or mutated FeLV ENV NOs: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, 34, or 43 or amino acid position 533 of SEQ ID NO:7. In 32, 33, 34, or 43, or amino acid position 533 of SEQ ID NO:7, It is appreciated by a person skilled in the art that based on sequence alignment, the described mutation encompasses the amino acid position 533 of SEQ ID NO:7. The protein sequence alignment of some of the FeLV ENV polypeptides is exemplified in Figure id. In one embodiment, the optimized or mutated embodiment, the optimized or mutated FeLV ENV polypeptide comprises the amino acid substitution of R, D or M for E at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV polypeptide. In yet another embodiment, the optimized or mutated FeLV ENV polypeptide comprises the amino acid substitution of R for E at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV polypeptide. In yet another embodiment, the mutated FELV ENV polypeptide has the sequence as set forth in SEQ ID NO:2, 4, 7, or 43 .

Moreover, homologs of polypeptides from FeLV are intended to be within the scope paralogs. The tern "anologs" refers to two polynucleotides or polypeptides that have the same or encodes a fusion protein. polypeptides. In yet another aspect, the present invention provides an optimized FeLV ENV protein wherein a mutation occurs at, but not limited to, the amino acid position 527 of SEQ ID yet another aspect, the mutation is a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E) at amino acid position 527 of SEQ ID NOs: 2, 4, 6, 27, 28, 29, 30, 31, mutation at the corresponding amino acid position in other FeLV ENV polypeptides which are not listed in the present application, wherein the corresponding amino acid position is equivalent to the amino acid position 527 of SEQ ID NOs: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or FeLV ENV polypeptide comprises an amino acid mutation at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV proteins. In yet another of the present invention. As used herein, the term "homologs" includes orthologs, analogs and similar function, but that have evolved separately in unrelated organisms. The term "orthologs" refers to two polynucleotides or polypeptides from different species, but that have evolved from a common ancestral gene by speciation. Normally, orthologs encode polypeptides having the same or similar functions. The term "paralogs" refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. Analogs, orthologs, and paralogs of a wild-type FeLV polypeptide can differ from the wild-type FeLV polypeptide by post-translational modifications, by amino acid sequence differences, or by both. In particular, homologs of the invention will generally exhibit at least 80-85%, 85-90%, 90-95%, or 95%, 96%, 97%, 98% , 99% sequence identity, with all or part of the wild-type FeLV polypeptide or polynucleotide sequences, and will exhibit a similar function.

In another aspect, the present invention provides an optimized or mutated FeLV ENV polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, or 34.

In yet another aspect, the present invention provides fragments and variants of the optimized or mutated FeLV ENV polypeptides identified above, which may readily be prepared by one of skill in the art using well-known molecular biology techniques.

Variants are homologous polypeptides having an amino acid sequence at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence as set forth in SEQ ID NO: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, or 34.

Variants include allelic variants. The term "allelic variant" refers to a polynucleotide or a polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exist within a natural population (e.g., a virus species or variety). Such natural allelic variations can typically result in 1- 5% variance in a polynucleotide or a polypeptide.

Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different species, which can be readily carried out by using hybridization probes to identify the same gene genetic locus in those species. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity of gene if interest, are intended to be within the scope of the invention. 0063] As used herein, the term "derivative" or "variant" refers to a polypeptide, or a nucleic acid encoding a polypeptide, that has one or more conservative amino acid variations or other minor modifications such that (I) the corresponding polypeptide has substantially equivalent polypeptide is immunoreactive with the wild-type polypeptide. These variants or derivatives polypeptide primary amino acid sequences that may result in peptides which have substantially further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. The modifications may be any amino acid change at amino acid positions other than position 527 of 10064] basic--lysine, arginine, histidine; (3) non-polar--alanine, valine, leucine, isoleucine, proline, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution hydrophobic residue, or the substitution of one polar residue for another polar residue, such as asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. possessing minor amino acid substitutions that do not substantially affect the immunogenicity of variation" also includes the use of a substituted amino acid in place of an unsubstituted parent function when compared to the wild type polypeptide or (2) an antibody raised against the include polypeptides having minor modifications of the optimized or mutated FeLV ENV equivalent activity as compared to the unmodified counterpart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. The term "variant" SEQ ID NOs: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or amino acid position 533 of SEQ ID NO:7.

The term "conservative variation" denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidic--aspartate and glutamate; (2) phenylalanine, methionine, tryptophan; and (4) uncharged polar--glycine, asparagine, glutamine, of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for Proteins having substantially the same amino acid sequence as the reference molecule but the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term "conservative acids, or at least 30 amino acids of an FeLV ENV polypeptide having a sequence as set forth in SEQ ID NO: 2, 4, 6, 7, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or variants thereof. In another embodiment, a fragment of an FeLV ENV polypeptide includes a specific antigenic epitope 1985; Van der Zee R. et al.; et al.; T. Parker K. et al.), non-limiting examples of epitopes include a tetra- to penta- peptide sequence in a polypeptide, a protein fragment of a larger molecule it will have substantially the same immunological activity 100671 ENV polypeptide. In another aspect, the present invention provides an FeLV ENV 43, or amino acid position 533 of SEQ ID NO:7. In yet another aspect, the FeLV ENV amino acid position 527 of SEQ ID NOs: 2, 4, 6, 7, 28, 29, 30, 31, 32, 33, 34, or 43, or amino amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

An immunogenic fragment of an FeLV ENV polypeptide includes at least 8, 10, 15, or 20 consecutive amino acids, at least 21 amino acids, at least 23 amino acids, at least 25 amino found on a full-length FeLV ENV polypeptide.

Procedures to determine fragments of polypeptide and epitope such as, generating to overlapping peptide libraries (Hemmer a et al.), Pepscan (Geysen H. M. et 41984; Geysen H.

M. et al., Geysen H. M.) and algorithms (De Groot A.

Hoop et aL; can be used in the practice of the invention, without undue experimentation. Generally, antibodies specifically bind a particular antigenic epitope. Specific, tri- to penta glycoside sequence in a polysaccharide. In animals most antigens will present several or even many antigenic determinants simultaneously. Preferably wherein the epitope is a as the total protein.

In one aspect, the present invention provides a polynucleotide encoding an FeLV polynucleotide encoding an optimized or mutated FeLV ENV polypeptide, wherein the mutation occurs at the amino acid position 527 of SEQ ID NOs: 2, 4, 6, 27, 28, 29, 30, 31, 32, 33, 34, or polynucleotide encodes an optimized or mutated FeLV ENV polypeptide wherein the mutation is a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E) at the acid position 533 of SEQ ID NO:7. In yet another aspect, the FeLV ENV polynucleotide encodes an optimized or mutated FeLV ENV polypeptide having an amino acid mutation at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV proteins. In another aspect, the FeLV ENV polynucleotide encodes an optimized or mutated FeLV ENV polypeptide having the amino acid change of E to R, D or M at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV polypeptide, In yet another aspect, the FeLV ENV polynucleotide encodes an optimized or mutated FeLV ENV polypeptide having the amino acid change of E to R at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV ENV polypeptide. In yet another embodiment, the FeLV ENV polynucleotide encodes an FeLV ENV polypeptide having the sequence as set forth in SEQ ID NO:2, 4, 7, or 43. In yet another embodiment, the FeLV ENV polynucleotide encodes an FeLV ENV polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 2, 4, 6, 7, 27, 28, 29, 30, 31, 32, 33, 34, or 43, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at east ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. [00681 In another aspect, the present invention provides an FeLV GAG-PRO polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 12. [00691 In another aspect, the present invention provides an FeLV ENV polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 1, 3, or 5, or a variant thereof. In yet another aspect, the present invention provides an FeLV ENV polynucleotide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polynucleotide having a sequence as set forth in SEQ ID NO: 1, 3, or 5, or a variant thereof [00701 In yet another aspect, the present invention provides an FeLV GAG-PRO polynucleotide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polynucleotide having a sequence as set forth in SEQ ID NO: 10, or 11, or a variant thereof.

These polynucleotides may include DNA, eDNA, and RNA sequences that encode FeLV ENV or GAG-PRO polypeptides. It is understood that all polynucleotides encoding FeLV ENV or GAG-PRO polypeptides are also included herein, as long as they encode a polypeptide with the recognized activity, such as the binding to an antibody that recognizes the polypeptide, the induction of an immune response to the polypeptide, or an effect on survival of Leukemia sign or a symptom of FeLV infection. result of the genetic code, e.g., optimized codon usage for a specific host. As used herein, "optimized" refers to a polynucleotide that is genetically engineered to increase its expression in comprise codons preferred by highly expressed genes in a particular species; 2) comprise an A+T or G+C content in nucleotide base composition to that substantially found in said species; 3) form an initiation sequence of said species; or 4) eliminate sequences that cause destabilization, structure hairpins or RNA splice sites. Increased expression of FeLV protein in said species can be achieved by utilizing the distribution frequency of codon usage in eukaryotes and prokaryotes, There are 20 natural amino acids, most of which are specified by more than one codon. as the functionally unchanged.

[0073] The sequence identity between two amino acid sequences may be established by the NCBI (National Center for Biotechnology Information) pairwise blast and the blosum62 matrix, in Altschul and thus, this document speaks of using the algorithm or the BLAST or available via the Internet at sites thereon such as the NCBI site. disease when administered to a subject exposed to the parasite or who undergoes a decrease in a The polynucleotides of the disclosure include sequences that are degenerate as a a given species. To provide optimized polynucleotides coding for an FeLV ENV or GAG-PRO polypeptide, the DNA sequence of the FeLV ENV or GAG-PRO gene can be modified to 1) inappropriate polyadenylation, degradation and termination of RNA, or that form secondary or in a particular species. The term "frequency of preferred codon usage" refers to the preference exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid.

Therefore, all degenerate nucleotide sequences are included in the disclosure as long amino acid sequence of the FeLV polypeptide encoded by the nucleotide sequence is using the standard parameters (see, e.g., the BLAST or BLASTX algorithm available on the "National Center for Biotechnology Information" (NCBI, Bethesda, Md., USA) server, as well as et al.; BLASTX and BLOSUM62 matrix by the term "blasts").

Sequence identity between two nucleotide sequences also may be determined using the "Align" program of Myers and Miller, ("Optimal Alignments in Linear Space", CABIOS 4, 11-17, 1988) and available at NCBI, as well as the same or other programs Alternatively or additionally, the term "identity", for instance, with respect to a nucleotide or amino acid sequence, may indicate a quantitative measure of homology between two sequences. The percent sequence homology may be calculated as: (Nref Ndif)*100/N 100761 ref , wherein Nof is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences. Hence, the DNA sequence AGTCAGTC will have a sequence identity of 75% with the sequence AATCAATC (Nr f = 8; Ndr2).

Alternatively or additionally, "identity" with respect to sequences can refer to the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman), for instance, using a window size of 20 nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and computer-assisted analysis and interpretation of the sequence data including alignment can be conveniently performed using commercially available programs (e.g., Intel ligeneticsTm Suite, Intelligenetics Inc. CA). When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Thus, RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.

[0078] The sequence identity or sequence similarity of two amino acid sequences, or the sequence identity between two nucleotide sequences can be determined using Vector NTI software package (Invitrogen, 1600 Faraday Ave., Carlsbad, CA).

The FeLV ENV or GAG-PRO polynucleotides may include a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (for example, a eDNA) independent of other sequences. 100801 Recombinant vectors disclosed herein may include a polynucleotide encoding a polypeptide, a variant thereof or a fragment thereof. Recombinant vectors may include plasmids and viral vectors and may be used for in vitro or in vivo expression. Recombinant vectors may include further a signal peptide. Signal peptides are short peptide chain (3-60 amino acids long) that direct the post -translational transport of a protein (which are synthesized in the cytosol) to certain organelles such as the nucleus, mitochondrial matrix, endoplasmic reticulurn, ehloroplast, apoplast and peroxisome. Typically, the naturally occurring FeLV ENV proteins may be translated as precursors, having an N-terminal signal peptide sequence and a "mature" protein domain. The signal peptide may be cleaved off rapidly upon translation. The signal sequence may be the natural sequence from the FeLV ENV protein or a peptide signal from a secreted protein e.g. the signal peptide from the tissue plasminogen activator protein (tPA), in particular the human tPA (S. Friezner Degen et al.; R. Rickles et al.; D. Berg. et al.), or the signal peptide from the Insulin-like growth factor I (IGF1), in particular the equine IGF1 (K. Otte et al.), the canine IGF I (P. Delafontaine et at), the feline IGF1 (W003/022886), the bovine IGF1 (S. Lien et al.), the porcine IGF1 (M. Muller et al.), the chicken IGF1 (Y. Kajimoto et al.), the turkey IGF I (GenBank accession number AF074980). The signal peptide from IGF1 may be natural or optimized which may be achieved by removing cryptic splice sites and/or by adapting the codon usage. Upon translation, the unprocessed polypeptide may be cleaved at a cleavage site to lead to the mature polypeptide. The cleavage site may be predicted using the method of Von Heijne (1986).

A plasmid may include a DNA transcription unit, for instance a nucleic acid sequence that permits it to replicate in a host cell, such as an origin of replication (prokaryotic or eukaryotic). A plasmid may also include one or more selectable marker genes and other genetic elements known in the art. Circular and linear forms of plasmids are encompassed in the present disclosure.

In a further aspect, the present invention relates to an in vivo expression vector comprising a polynucleotide sequence, which contains and expresses in viva in a host the optimized or mutated FeLV ENV polypeptides and/or variants or fragments thereof. The expression vector may further comprise a polynucleotide encoding an FeLV GAG-PRO polypeptide and/or variants or fragments thereof. in vivo expression vector may include any transcription unit containing a polynucleotide or a gene of interest and those essential elements for its in vivo expression. These expression vectors may be plasmids or recombinant viral vectors. For in vivo expression, the promoter may be of viral or cellular origin. In one embodiment, the promoter may be the cytomegalovirus (CMV) early promoter (CMV-IE promoter), the SV40 virus early or late promoter or the Rous Sarcoma virus LTR promoter, a promoter of a cytoskeleton gene, such as the desmin promoter (Kwissa M, et al.), or the actin promoter (Miyazaki J. et al.). When several genes are present in the same plasmid, they may be provided in the same transcription unit or in different units.

As used herein, the term "plasmid" may include any DNA transcription unit comprising a polynucleotide according to the invention and the elements necessary for its in vivo expression in a cell or cells of the desired host or target; and, in this regard, it is noted that a supercoiled or non-supercoiled, circular plasmid, as well as a linear form, are intended to be within the scope of the invention. The plasmids may also comprise other transcription-regulating elements such as, for example, stabilizing sequences of the intron type. In several embodiments, the plasmids may include the first intron of CMV-IE (WO 89/01036), the intron II of the rabbit beta-globin gene (van Ooyen et al.), the signal sequence of the protein encoded by the tissue plasminogen activator (tPA; Montgomery et al.), and/or a polyadenylation signal (polyA), in particular the polyA of the bovine growth hormone (bGH) gene (US 5,122,458) or the polyA of the rabbit beta-globin gene or of SV40 virus. 100851 In a further aspect, the present invention relates to a composition comprising: a) an in vivo expression vector, wherein the vector comprises a polynucleotide encoding one or more polypeptide selected from the group consisting of an FeLV ENV polypeptide, a variant or fragment of the FeLV ENV polypeptide, and a mixture thereof; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient. [00861 In another aspect, the present invention relates to a composition comprising: a) an in vivo expression vector, wherein the vector comprises a polynucleotide encoding one or more polypeptide selected from the group consisting of an FeLV ENV polypeptide, an FeLV GAG/PRO polypeptide, a variant or fragment of the FeLV ENV polypeptide, and a mixture thereof; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient. 100871 In yet another aspect, the present invention relates to a composition comprising: a) an in vivo expression vector, wherein the vector comprises a polynucleotide encoding an FeLV ENV polypeptide, an FeLV GAG/PRO polypeptide; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient.

The FeLV ENV and FeLV GAG/PRO polypeptides are described above.

In one embodiment, the present invention relates to a composition comprising: a) an in vivo expression vector, wherein the vector comprises a polynucleotide encoding an optimized or mutated FeLV ENV having the amino acid substitution of R, D or M for E at amino acid position 527 of SEQ ID NO:6 or at the corresponding amino acid position of FeLV polypeptide and a polynucleotide encoding an FeLV GAG/PRO polypeptide having at least 90% sequence identity to a polypeptide having the sequence as set forth in SEQ ID NO:12; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient. In yet another embodiment, the composition of the present invention comprises: a) an expression vector comprising a first polynucleotide encoding an FeLV ENV polypeptide having an amino acid sequence as set forth in SEQ ID NO:2 or 4 and a second polynucleotide encoding an FeLV GAG/PRO polypeptide having an amino acid sequence as set forth in SEQ ID NO:12; and b) a pharmaceutically or veterinary acceptable vehicle, diluent or excipient. 100901 The term "composition" comprises any vaccine or immunological composition, once it has been injected to a host, including canines, felines and humans, that induces an immune response in the host, and/or protects the host from leukemia, and/or which may prevent implantation of the parasite, and/or which may prevent disease progression in infected subjects, and/or which may limit the diffusion of runaway parasites to internal organs. This may be accomplished upon vaccination according to the present invention through the induction of cytokine secretion, notably IFN-gamma secretion (as example of a method of measurement of IFN-gamma secretion, the Quantikine® immunoassay from R&D Systems Inc. (catalog number# CAIF00) could be used (Djoba Siawaya JF et al.)).

[0091] The pharmaceutically acceptable vehicles or excipients of use are conventional.

Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the polypeptides, plasmids, viral vectors herein disclosed. In general, the nature of the vehicle or excipient will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, freeze- dried pastille, powder, pill, tablet, or capsule forms), conventional non-toxic solid vehicles or excipients can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral vehicles or excipients, immunogenic compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for 100921 [00931 Multiple insertions may be done in the same vector using different insertion sites or head-to- head, tail-to-head, or head-to-tail. IRES elements (Internal Ribosome Entry Site, see EP 0803573) can also be used to separate and to express multiple inserts operably linked to the same in vivo expression vector, or an polynucleotide aforementioned. The expression vector may be an in vivo 10095] P.) in vivo in a in vivo expression. 100961 et al.; pVR2001-TOPA (or pVR2001-TOPO) (Oliveira F. pAB110 (US 6,852,705) can be utilized as a vector for the insertion of a polynucleotide increases the likelihood of producing a secreted protein, (see Figure 1 in Oliveira F. 100971 Each plasmid may comprise or contain or consist essentially of, the polynucleotide example sodium acetate or sorbitan monolaurate.

The compositions or vaccines according to the instant invention may include vectors encoding any polynucleotide according to the present invention as described above. using the same insertion site. When the same insertion site is used, each polynucleotide insert, which may be any polynucleotide of the present invention aforementioned, may be inserted under the control of the same and/or different promoters. The insertion can be done tail-to-tail, and/or different promoters. 100941 In one embodiment, the present invention relates to an expression vector comprising a in vitro expression vector.

More generally, the present invention encompasses expression vectors including any plasmid (EP-A2-1001025; Chaudhuri containing and expressing host the polynucleotide or gene of FeLV ENV polypeptide, variant thereof or fragment thereof and elements necessary for its In a specific, non-limiting example, the pVR1020 or pVR1012 plasmid (VICAL Inc.; Hartikka J.

Luke C. et al.), et al.) or sequence. The pVR1020 plasmid is derived from pVR1012 and contains the human tPA signal sequence. The pVR1020 is a plasmid backbone available from Vical, Inc., (San Diego, CA) which has been previously used, see, e.g., US Patent Nos. 6,451,769 and 7,078,507. As described in Oliveira et al., plasmid pVR2001-TOPO (or pVR2001-TOPA) is pVR1020 modified by the addition of topoisomerases flanking the cloning site and containing coding for and expressing a signal secretory peptide, for example, tissue plasminogen activator signal peptide (tPA), that et al.). according to the present invention, operably linked to a promoter or under the control of a promoter or dependent upon a promoter, wherein the promoter may be advantageously adjacent to the polynucleotide for which expression is desired. In general, it is advantageous to employ a strong promoter that is functional in eukaryotic cells. One example of a useful promoter may be the immediate early cytomegalovirus promoter (CMV-IE) of human or murine origin, or it may optionally have another origin such as from rat or guinea pig, The CMV-IE promoter may viral or a cellular origin. A strong viral promoter other than CMV-IE that may be usefully promoter of the Rous sarcoma virus. A strong cellular promoter that may be usefully employed promoter (Kwissa M. et al.), or the actin promoter (Miyazaki J. et al.). Functional sub fragments of these promoters, i.e., portions of these promoters that maintain adequate promoter activity, are and/or the enhancer portion of the full-Length promoter, as well as derivatives and/or sub Advantageously, the plasmids comprise or consist essentially of other expression sequence(s), for example, the first intron of the hCMV-1E (WO 89/01036), the intron 11 of the rabbit 0-globin gene (van Ooyen plasmids and viral vectors other than poxviruses, use can be made of the poly(A) signal of the comprise the actual promoter part, which may or may not be associated with the enhancer part.

Reference can be made to EP 260 148, EP 323 597, US 5,168,062, 5,385,839, and 4,968,615, as well as to WO 87/03905. The CMV-IE promoter may advantageously be a human CMV-IE (Boshart M. et al.) or murine CMV-IE. In more general terms, the promoter may have either a ta employed in the practice of the invention is the early/late promoter of the SV40 virus or the LTR in the practice of the invention is the promoter of a gene of the cytoskeleton, such as the desmin included within the present invention, e.g. truncated CMV-IE promoters according to WO 98/00166 or US 6,156,567 and may be used in the practice of the invention. A promoter useful in the practice of the invention consequently may include derivatives and/or sub fragments of a full- length promoter that maintain adequate promoter activity and hence function as a promoter, and which may advantageously have promoter activity that is substantially similar to that of the actual or full-length promoter from which the derivative or sub fragment is derived, e.g., akin to the activity of the truncated CMV-IE promoters of US 6,156,567 in comparison to the activity of full-length CMV-IE promoters. Thus, a CMV-IE promoter in the practice of the invention may comprise or consist essentially of or consist of the promoter portion of the full-length promoter fragments thereof. 100981 control elements. It is especially advantageous to incorporate stabilizing sequence(s), e.g., intron et al.). As to the polyadenylation signal (polyA) for the bovine growth hormone (bGH) gene (see US 5,122,458), or the poly(A) signal of the rabbit 13- globin gene or the poly(A) signal of the SV40 virus. 100991 More generally, the present invention encompasses in vivo expression vectors including any recombinant viral vector containing a polynucleotide or gene encoding one or more FeLV ENV and/or variants or fragments thereof, including any elements necessary for its in vivo expression. [01001 Said recombinant viral vectors could be selected from, for example, the poxviruses, especially avipox viruses, such as fowlpox viruses or canarypox viruses. In one embodiment, the fowlpox virus is a TROVAC (see WO 96/40241). In another embodiment, the canarypox vector is an ALVAC. The use of these recombinant viral vectors and the insertion of polynucleotides or genes of interest are fully described in US 5,174,993; US 5,505,941 and US 5,766,599 for fowlpox, and in US 5,756,103 for canarypox. More than one insertion site inside the viral genome could be used for the insertion of multiple genes of interest. [01011 In one embodiment the viral vector is an adenovirus, such as a human adenovirus (HAV) or a canine adenovirus (CAV).

In another embodiment the viral vector is a human adenovirus, specifically a scrotype adenovirus, rendered incompetent for replication by a deletion in the El region of the viral genome, especially from about nucleotide 459 to about nucleotide 3510 by reference to the sequence of the hAd5 disclosed in Genbank under the accession number M73260 and in the referenced publication Chroboczek et al, 1992. The deleted adenovirus is propagated in El- expressing 293 (Graham et al., 1977) or PER cells, especially PER.C6 (Falloux et al, 1998). The human adenovirus can additionally or alternatively be deleted in the E3 region, especially from about nucleotide 28592 to about nucleotide 30470. The deletion in the E 1 region can be done in combination with a deletion in the E3 region (see, e.g. Shriver et al.; Graham et al.; Ilan et al.; U.S. Patent Nos. 6,133,028 and 6,692,956; Tripathy et al.; Tapnell; Danthinne et al.; Berkner; Berkner et al.; Chavier et al.).

The insertion sites can be the El and/or E3 loci (region) eventually after a partial or complete deletion of the El and/or E3 regions. Advantageously, when the expression vector is an adenovirus, the polynucleotide to be expressed is inserted under the control of a promoter functional in eukaryotic cells, such as a strong promoter, advantageously a cytonnegalovirus immediate-early gene promoter (CMV-IE promoter), especially the enhancer / promoter region from about nucleotide —734 to about nucleotide +7 in et al., Boshart sequence can be located downstream of the enhancer / promoter region. For example, the intron 1 isolated from the CMV-IE gene (Stenberg P-globin gene, especially the intron 2 from the P-globin gene, the intron isolated from the immunoglobulin gene, a splicing sequence from the SV40 early gene or the chimeric intron sequence isolated from the pCI vector from Promege Corp. A poly(A) sequence and terminator sequence can be inserted downstream the polynucleotide to be expressed, e.g. a bovine growth with GenBank accession No. BOVGHRH, a rabbit P-globin gene or a SV40 late gene polyadenylation signal.

U.S. Patent Nos. 5,529,780 and 5,688,920; WO 95/14102). For CAV, the insertion sites can be in the E3 region and /or in the region located between the E4 region and the is under the control of a promoter, such as a cytornegalovirus immediate-early gene promoter sequence and terminator sequence can be inserted downstream the polynucleotide to be In another embodiment, the viral vector is a herpesvirus such as a feline herpesvirus For recombinant vectors based on a poxvirus vector, a vaccinia virus or an attenuated passages of the Ankara vaccine strain on chicken embryo fibroblasts; see Stick' & Hochstein- Mintzel; Sutter see US 5,494,807, and U.S. or the enhancer / promoter region from the pCI vector from Promega Corp. The CMV-IE promoter is advantageously of murine or human origin. The promoter of the elongation factor la can also be used. A muscle specific promoter can also be used (Li et al.). Strong promoters are also discussed herein in relation to plasmid vectors. In one embodiment, a splicing et al.), the intron isolated from the rabbit or human hormone gene, especially from about nucleotide 2339 to about nucleotide 2550 of the sequence In another embodiment the viral vector is a canine adenovirus, especially a CAV-2 (see, e.g. Fischer et al,; right ITR region (see U.S. Patent Nos. 6,090,393 and 6,156,567). In one embodiment the insert (CMV-IE promoter) or a promoter already described for a human adenovirus vector. A poly(A) expressed, e.g. a bovine growth hormone gene or a rabbit P-globin gene polyadenylation signal. 10104] (FHV). In one embodiment the polynucleotide to be expressed is inserted under the control of a promoter functional in eukaryotic cells, advantageously a CMV-IE promoter (murine or human).

A poly(A) sequence and terminator sequence can be inserted downstream the polynucleotide to be expressed, e.g. bovine growth hormone or a rabbit p-globin gene polyadenylation signal. vaccinia virus, (for instance, MVA, a modified Ankara strain obtained after more than 570 et al.; available as ATCC VR-1508; or NYVAC, Patent No. 5,494,807 which discuss the construction of NYVAC, as well as variations of NYVAC with additional ORFs deleted from the Copenhagen strain vaccinia virus genome, as well as the insertion of heterologous coding nucleic acid molecules into sites of this recombinant, and also, the use of matched promoters; see also WO 96/40241), an avipox virus or an attenuated avipox virus (e.g., canarypox, fowlpox, dovepox, pigeonpox, quailpox, ALVAC or TROVAC; see, e.g., U.S. Patent Nos. 5,505,941, 5,494,807) can be used. Attenuated canarypox viruses are described in US 5,756,103 (ALVAC) and WO 01/05934. Reference is also made to US5,766,599 which pertains to the attenuated fowlpox strain TROVAC. Reference is made to the canarypox available from the ATCC under access number VR-111. Numerous fowlpox virus vaccination strains are also available, e.g. the DIFTOSEC CT strain marketed by MERIAL and the NOBILIS VARIOLE vaccine marketed by INTERVET. For information on the method used to generate recombinants thereof and how to administer recombinants thereof, the skilled artisan can refer documents cited herein and to WO 90/12882, e.g., as to vaccinia virus, mention is made of U.S.

Patents Nos. 4,769,330, 4,722,848, 4,603,112, 5,110,587, 5,494,807, and 5,762,938 inter alia; as to fowlpox, mention is made of U.S. Patents Nos. 5,174,993, 5,505,941 and 5,766,599 inter alia; as to canarypox, mention is made of U.S. Patent No. 5,756,103 inter alia, When the expression vector is a vaccinia virus, insertion site or sites for the polynucleotide or polynucleotides to be expressed are advantageously at the thymidine kinase (TK) gene or insertion site, the hemagglutinin (HA) gene or insertion site, the region encoding the inclusion body of the A type (ATI); see also documents cited herein, especially those pertaining to vaccinia virus. In the case of canarypox, advantageously the insertion site or sites are ORF(s) C3, C5 and/or C6; see also documents cited herein, especially those pertaining to canarypox virus. In the case of fowlpox, advantageously the insertion site or sites are ORFs F7 and/or F8; see also documents cited herein, especially those pertaining to fowlpox virus. The insertion site or sites for MVA virus are advantageously as in various publications, including Carroll M. W. et al.; Stittelaar K. J. al.; Sutter G. et aL; and, in this regard it is also noted that the complete MVA genome is described in Antoine G., Virology, which enables the skilled artisan to use other insertion sites or other promoters. Advantageously, the polynucleotide to be expressed is inserted under the control of a specific poxvirus promoter, e.g., the vaccinia promoter 7.5 kDa (Cochran et al.), the vaccinia promoter 13L (Riviere et al.), the vaccinia promoter HA (Shida), the cowpox promoter ATI (Funah .ashi et al.), the vaccinia promoter H6 (Taylor J. et al.; Guo P. et al. J.; Perkus M. et al.), inter alia. 101061 Any of the polynucleotides disclosed here may be expressed in vitro by DNA transfer or expression vectors into a suitable host cell. The host cell may be prokaryotic or eukaryotic.

The term "host cell" also includes any progeny of the subject host cell. Methods of stable transfer, meaning that the foreign polynucleotide is continuously maintained in the host cell, are known in the art. Host cells may include bacteria (for example, Escherichia coil), yeast, insect cells, and vertebrate cells. Methods of expressing DNA sequences in eukaryotic cells are well known in the art. As a method for in vitro expression, recombinant Baculovirus vectors (for example, Autographa California Nuclear Polyhedrosis Virus (AcNPV)) may be used with the nucleic acids disclosed herein. For example, polyhedrin promoters may be utilized with insect cells (for example, Spodoptera,frugiperda cells, like Sf9 cells available at the ATCC under the Accession number CRL 1711, or Sf21 cells) (see for example, Smith et al.; Pennock et al.; Vialard et al.; Verne A.; O'Reilly et al.; Kidd I. M. & Emery V.C.; EP 0370573; EP 0265785; US 4,745,051). For expression, the BaculoGold Starter Package (Cat # 21001K) from Pharmingen (Becton Dickinson) may be used. As a method for in vitro expression, recombinant E. coil may be used with a vector. For example, when cloning in bacterial systems, inducible promoters such as arabinose promoter, pL of bacteriophage lambda, plac, ptrp, ptac (ptrp-lac hybrid promoter), and the like may be used. Transformation of a host cell with recombinant DNA may be carried out by conventional techniques are well known to those skilled in the art.

Where the host is prokaryotic, such as E. coli, competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl2 method using procedures well known in the art. Alternatively, MgCl2 or RbC1 can be used. Transformation can also be performed by electroporation. When the host is a eukaryote, such methods of transduction of DNA as calcium phosphate coprecipitates, conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in liposomes, or virus vectors may be used. Eukaryotic cells may also be cotransformed with L. longipalpis polynucleotide sequences, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector (see above), such as a herpes virus or adenovirus (for example, canine adenovirus 2), to transiently transduce eukaryotic cells and express the protein (Gluzman EA). In addition, a transfection agent can be utilized, such as dioleoyl-phosphatidyl-ethanolamme (Don).

Isolation and purification of recombinantly expressed polypeptide may be carried out by conventional means including preparative chromatography (for example, size exclusion, ion exchange, affinity), selective precipitation and ultra-filtration. Examples of state of the art techniques that can be used, but not limited to, may be found in "Protein Purification Applications", Second Edition, Edited by Simon Roe and available at Oxford University Press.

Such a recombinantly expressed polypeptide is part of the present disclosure. The methods for production of any polypeptide according to the present invention as described above are also encompassed, in particular the use of a recombinant expression vector comprising a polynucleotide according to the disclosure and of a host cell.

The vaccines containing recombinant viral vectors according to the invention may be freeze-dried, advantageously with a stabilizer. Freeze-drying can be done according to well- known standard freeze-drying procedures. The pharmaceutically or veterinary acceptable stabilizers may be carbohydrates (e.g. sorbitol, mannitol, lactose, sucrose, glucose, dextran, trehalose), sodium glutamate (Tsvetkov T et al.), proteins such as peptone, albumin, lactalbumin or casein, protein containing agents such as skimmed milk (Mills C K al.; et al.), and buffers (e.g. phosphate buffer, alkaline metal phosphate buffer). An adjuvant may be used to make soluble the freeze-dried preparations.

Any vaccine composition according to the invention can also advantageously contain one or more adjuvant.

The plasmid-based vaccines may be formulated with cationic lipids, advantageously with DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propananunonium ; W096/34109), and advantageously in association with a neutral lipid, for example DOPE (dioleoyl-phosphatidyl-ethanolamine ; Behr J. P.), in order to form DMRIE-DOPE. In one embodiment, the mixture is made extemporaneously, and before its administration it is advantageous to wait about 10 min to about 60 min, for example, about 30 min, for the appropriate mixture. When DOPE is used, the molar ratio of DMRIE/DOPE can be from 95/5 to /95 and is advantageously 1/1. The weight ratio plasmid/DMRIE or DMRIE-DOPE adjuvant is, for example, from 50/1 to 1/10, from 10/1 to 1/5 or from 1/1 to 1/2.

Optionally a cytokine may be added to the composition, especially GM-CSF or cytokines inducing Thl (e.g. IL12). These cytokines can be added to the composition as a plasmid encoding the cytokine protein. In one embodiment, the cytokines are from canine origin, et al.; Israeli E Wolff E [0HO] similar to what was made in WO 00/77210.

The recombinant viral vector-based vaccine may be combined with fMLP (N-formyl- groups, advantageously not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms. For example, the - -C (CH2) x -- (CH2) y COON methyl. The products sold under the name CARBOPOL® (BF Goodrich, Ohio, USA) are Among them, there may be advantageously mentioned CARBOPOL® 974P, 934P and 971P.

Among the copolymers of maleic anhydride and alkenyl derivative, the copolymers EMA® (Monsanto) which are copolymers of maleic anhydride and ethylene, linear or cross- linked, for example cross-linked with divinyl ether, are advantageous. Reference may be made to et al. for example, of basic units of the following formula in which: - R1 and - x = 0 or 1, preferably x = 1 - y = 1 or 2, with x + y = 2 e.g. canine GM-CSF which gene sequence has been deposited at the GenBank database (accession number S49738). This sequence can be used to create said plasmid in a manner methionyl-leucyl-phenylalanine; US 6,017,537) and/or Carbomer adjuvant (Phameuropa Vol. 8, No. 2, June 1996). Persons skilled in the art can also refer to US 2,909,462, which describes such acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as CCOH appropriate. The products are cross-linked with an ally1 sucrose or with ally! pentaerythritol.

J. Fields The polymers of acrylic or rnethacrylic acid and the copolymers EMA® are formed, R2, which are identical or different, represent H or CH3 For the copolymers EMA®, x = 0 and y = 2. For the carbomers, x = y =1.

The dissolution of these polymers in water leads to an acid solution, which is neutralized, advantageously to physiological pH, in order to provide the adjuvant solution into which the vaccine itself is incorporated. The carboxyl groups of the polymer are then partly in C00 - form.

In one embodiment, a solution of adjuvant, especially of carbomer (Phanneuropa, vol. 8, No.2, June 1996), is prepared in distilled water, advantageously in the presence of sodium chloride, the solution obtained being at an acidic pH. This stock solution is diluted by adding it to the desired quantity (for obtaining the desired final concentration), or a substantial part thereof, of water charged with NaCl, advantageously physiological saline (NaCI 9 g/1) all at once in several portions with concomitant or subsequent neutralization (pH 7.3 to 7.4), advantageously with NaOH. This solution at physiological pH is used for mixing with the vaccine, which may be especially stored in freeze-dried, liquid or frozen form.

The polymer concentration in the final vaccine composition can be from 0.01% to 2% w/v, from 0.06 to 1% w/v, or from 0.1 to 0.6% w/v.

[0118] The sub-unit vaccine may be combined with adjuvants, like oil-in-water, water-in-oil- in-water emulsions based on mineral oil and/or vegetable oil and non ionic surfactants such as block copolymers, TWEEN®, SPAN®. Such emulsions are notably those described in page 147 of "Vaccine Design — The Subunit and Adjuvant Approach", Pharmaceutical Biotechnology, 1995, or TS emulsions, notably the TS6 emulsion, and LF emulsions, notably LF2 emulsion (for both TS and LF emulsions, see WO 04/024027). Other suitable adjuvants are for example vitamin E, saponins, and CARBOPOL® (Noveon; see WO 99/51269; WO 99/44633), aluminium hydroxide or aluminium phosphate ("Vaccine Design, The subunit and adjuvant approach", Pharmaceutical Biotechnology, vol. 6, 1995), biological adjuvants (i.e. C4b, notably murine C4b (Ogata R T et al.) or equine C4b, GM-CSF, notably equine GM-CSF (US 6,645,740)), toxins (i.e. cholera toxins CTA or CTB, Escherichia colt heat-labile toxins LTA or et al.; LTB (Olsen C W Fingerut E et al.; Zurbriggen R et al. Peppoloni S et al.), and CpG (i.e.

CpG #2395 (see Jurk M et al.), CpG #2142 (see SEQ. ID. NO; 890 in EP 1,221,955). 101191 The composition or vaccine may also contain or comprise one or more FeLV antigens, for example, ENV, or ENV and GAG, or ENV and GAG and PRO gene.

[0120] The composition or vaccine may also be associated with at least one FeLV antigen, for example inactivated FeLV. In a particular embodiment, the FeLV strain may be an FeLV type A strain, or a combination of FeLV type A and type B, or a combination of FeLV type A and type C, or a combination of type A, type B and type C strains. These strains of FeLV may be inactivated by chemical or physical methods. The chemical methods are notably BPL, formaldehyde. The physical methods may notably be sonication. One method for inactivating FeLV for use in a vaccine is described in R. Cordeiro Giunchetti et al., Vaccine, 2007. The inactivated FeLV vaccine may be combined with adjuvants, like those described previously for sub-unit vaccines.

Another aspect of the present invention relates to methods of vaccinating a host against FeLV using the vaccine compositions disclosed herein.

[0122] The host may be any one or all of felines (for example, domesticated cats, kittens, big cats and wild cats). In one embodiment, the host is a feline.

The routes of administration may be, for example, intramuscular (IM) or intradermal (ID) or transdermal (TD) or subcutaneous (SC). The means of administration may be, for example, a syringe with a needle, or needle free apparatus, or a syringe with a needle coupled to eleetrotransfer (ET) treatment, or needle free apparatus coupled to ET treatment. 101241 Another aspect of the invention relates to the use of a plasmid-based vaccine according to the present invention for administration to a host, wherein this administration is coupled to ET treatment. The administration of a plasmid-based vaccine is advantageously intramuscular. The means of administration is, for example, a syringe and a needle. One or several injections may be administered successively. In the case of several injections, they may be carried out 2 to 6 weeks apart, for example, about 3 weeks apart. In one embodiment, a semi- annual booster or an annual booster is further administered.

For plasmid-based vaccines, advantageous routes of administration may be ID or IM.

This administration may be through use of a syringe with a needle or with a needle free apparatus like Dermojet or Biojector (Bioject, Oregon, USA) or VetjetTM (Merial) or ViajetTM (Bioject Inc.), see US 2006/0034867. The dosage may be from 50 pig to 500 )1g per plasmid.

When DMRIE-DOPE is added, 100 p.g per plasmid may be utilized. When GM-CSF or other cytokines are used, the plasmid encoding this protein may be present at a dosage of from about 200 pg to about 500 lag and may be 200 jug.

The volume of doses can be between 0.01 ml and 0.5 ml, for example, 0.25 ml. Administration may be provided with multiple points of injection.

Alternatively, plasmid-based vaccines may be administered via the IM route coupled to electrotransfer (ET) treatment. The ET treatment may be performed using an apparatus for electrotransfer and the specifications of the manufacturer (i.e. Sphergen G250 generator (Sphergen SARL, Evry Genopole, France); MedPulser® DNA electroporation system (Innovio Biomedical Corporation, San Diego, California, USA)). In one embodiment, the apparatus for electrotransfer has a unipolar field. The field intensity may be from about 50 to about 250 V/cm, from about 50 to about 200 V/em, or from about 50 to about 175 V/cm. The pulse duration may be from about 1 to about 50 msec, or from about 15 to about 25 msec. The frequency may be from about 1 to about 50 Hz, or from about 5 to about 15 Hz. The interpulse interval may be from about 1 to 1000 msec, or from about 1 to about 200 msec. The number of pulses may be from 1 to 20, or from 5 to 10. The Ultra tissular intensity may advantageously be up to about 2 A.

The distance between electrodes may be from about 0.2 to about 1 cm, or from about 0.2 to about 0.5 cm.

For recombinant viral vector-based vaccines, the routes of administration may advantageously be SC or IM or TD or ID. This administration may be made by a syringe with a needle or with a needle free apparatus like Dermojet or Biojector (Bioject, Oregon, USA) or VetjetTM (Merial) or VitajetTM (Bioject Inc.). The dosage may be from about 10 3 pfu to about 10 9 pfu per recombinant poxvirus vector. When the vector is a canarypox virus, the dosage may be, for example, from about 10 5 pfu to about 10 9 pfu, from about 10 6 pfu to about 10 8 pfu, or from about 10 6 pfu to about 10 7 pfu. The volume of doses may be from about 0.01 ml to 0.2 ml, and is advantageously 0.1 ml. Administration may comprise multiple points of injection. 101281 For the IM route the volume of the vaccine provided may be from 0.2 to 2 ml, in particular from about 0.5 to 1 ml. The same dosages are utilized for any of the vectors of the present invention.

[0129] For sub-unit vaccines, the route of administration may advantageously be via SC or IM or TD or ID. This administration may be made by a syringe with a needle or with a needle free apparatus like Dermojet or Biojector (Bioject, Oregon, USA) or VetjetTM (Merial) or Vitajetim (Bioject Inc.). The dosage may be from about 50 to about 500 p.g, in particular from about 50 to about 150 iug, and more particularly from about 50 to about 100 lig. The volume of the sub-unit vaccine provided is from 0.2 to 2 ml, in particular from about 0.5 to 1 ml. on a prime-boost administration regimen, where the primo-administration and the boost administration regimen, comprising a primo-administration of a vaccine comprising a in vivo pharmaceutically or veterinary acceptable vehicle, diluent or excipient, an expression vector containing a polynucleotide sequence for expressing, variants or fragments thereof, followed by a boost administration of a vaccine comprising a pharmaceutically or veterinary acceptable vehicle or excipient, an in vivo, booster vaccine. The primo-administration may comprise one or more administrations. Similarly, the boost administration may comprise one or more administrations.

The routes of administration, doses and volumes are as previously disclosed herein.

The prime-boost administrations may be advantageously carried out 2 to 6 weeks prime-administration of a plasmid-based vaccine according to the present invention and at least In another aspect, the present invention relates to a vaccine strategy, which is based administration(s) utilize a composition comprising a pharmaceutically or veterinary acceptable excipient, diluent or vehicle and an in vivo expression vector comprising a polynucleotide sequence, that contains and expresses the FeLV polypeptide and/or variants or fragments thereof.

The present invention relates to the use of in vivo expression vectors in a prime-boost in vivo, FeLV polypeptides and/or in vivo expression vector containing a polynucleotide sequence for expressing, FeLV polypeptides and/or variants or fragments thereof as described above, to protect a host from FeLV and/or to prevent disease progression in infected hosts.

A prime-boost regimen comprises at least one primo-administration and at least one boost administration using at Least one common polypeptide and/or variants or fragments thereof.

The vaccine used in primo-administration may be different in nature from those used as a later

[0133] apart, for example, about 3 weeks apart. According to one embodiment, a semi-annual booster or an annual booster, advantageously using the viral vector-based vaccine, is also envisaged. The animals may be at least 6 to 8 weeks old at the time of the first administration.

In one embodiment, the prime-boost administration regimen comprises at least one one boost-administration of a recombinant viral vector-based vaccine according to the present invention.

In another embodiment, the prime-boost administration regimen comprises at least one prime-administration of a recombinant viral vector-based vaccine according to the present invention and at least one boost-administration of a sub-unit vaccine according to the present In another embodiment, the prime boost administration regimen comprises at least one prime-administration of a recombinant viral vector-based vaccine according to the present invention and at least one boost-administration of a plasmid-based vaccine according to the present invention. to or veterinary acceptable vehicle, diluent or excipient, a plasmid containing a polynucleotide for expressing, in vivo, an FeLV polypeptide, a variant or fragment of the FeLV polypeptide, pharmaceutically or veterinary acceptable vehicle or excipient, a recombinant viral vector comprising a polynucleotide for expressing, in vivo, the same FeLV polypeptide(s), variant in infected subject.

In another embodiment, the present invention relates to a method vaccinating a pharmaceutically or veterinary acceptable vehicle, diluent or excipient, a recombinant viral vector comprising a polynucleotide for expressing, plasmid containing a polynucleotide for expressing, in vivo, the FeLV polypeptide(s), variant thereof, fragment thereof, to protect the subject from FeLV and/or to prevent disease progression in infected subject. regiment comprises a prime-administration of a vaccine or composition comprising, in a invention.

In one embodiment, the present invention relates to a method of vaccinating a subject susceptible to FeLV comprising a prime-boost administration regimen wherein said regiment comprises a prime-administration of a vaccine or composition comprising, in a pharmaceutically or a mixture thereof, followed by a boost administration of a vaccine comprising, in a thereof, fragment thereof, to protect the subject from FeLV and/or to prevent disease progression subject susceptible to FeLV comprising a prime-boost administration regimen wherein said regiment comprises a prime-administration of a vaccine or composition comprising, in a in vivo, an FeLV polypeptide, a variant or fragment of the FeLV polypeptide, or a mixture thereof, followed by a boost administration of a vaccine comprising, in a pharmaceutically or veterinary acceptable vehicle or excipient, a In yet another embodiment, the present invention related to a method of vaccinating a subject susceptible to FeLV comprising a prime-boost administration regimen wherein said pharmaceutically or veterinary acceptable vehicle, diluent or excipient, a recombinant viral vector comprising a polynucleotide for expressing, in vivo, a an FeLV polypeptide, a variant or FeLV polypeptide(s), variant thereof, fragment thereof, to protect the subject from FeLV and/or Another aspect of the present invention relates to a kit for prime-boost vaccination invention.

In another embodiment, the kit may comprise two vials, one containing a recombinant viral vector-based vaccine for the prime-vaccination according to the present invention, the other In another embodiment, the kit may comprise two vials, one containing a recombinant viral vector-based vaccine for the prime-vaccination according to the present invention, the other 10146] examples are to be construed as merely illustrative, and not limitations of the preceding fragment of the FeLV polypeptide, or a mixture thereof, followed by a boost administration of a vaccine comprising, in a pharmaceutically or veterinary acceptable vehicle or excipient, the same to prevent disease progression in infected subject. according to the present invention. The kit may comprise at least two vials: a first vial containing a vaccine for the prime-vaccination according to the present invention, and a second vial containing a vaccine for the boost-vaccination according to the present invention. The kit may advantageously contain additional first or second vials for additional prime-vaccinations or additional boost-vaccinations.

In one embodiment, the kit may comprise two vials, one containing a plasmid-based vaccine for the prime-vaccination according to the present invention, the other vial containing a recombinant viral vector-based vaccine for the boost-vaccination according to the present vial containing a sub-unit vaccine for the boost-vaccination according to the present invention. vial containing a plasmid-based vaccine for the boost-vaccination according to the present invention.

The invention will now be further described by way of the following non-limiting examples.

EXAMPLES Without further elaboration, it is believed that one skilled in the art can, using the preceding descriptions, practice the present invention to its fullest extent. The following detailed disclosure in any way whatsoever. Those skilled in the art will promptly recognize appropriate variations from the procedures both as to reactants and as to reaction conditions and techniques.

Construction of DNA inserts, plasmids and recombinant viral vectors was carried out using the standard molecular biology techniques described by J. (Molecular isolated using the "Geneclean" kit Construction of pH6C5env plasmid pPB713 ENV/ALVAC(2) recombinants An ALVAC(1) recombinant virus which contains FeLV ENV inserted at C5 locus and GAG/POL (-FT5NT) inserted at C3 locus (Merial proprietary material) was used to amplify the FeLV ENV gene. Primers 7862CXL and 7847CXL were used for the PCR amplification. 7862CXL: ACG CCG CTC GAG CGG GGA TCT CTT TAT TCT ATA CTT A (SEQ ID NO:25) Xho I H6 promoter Barn HI T5NT stop 101491 The amplified PCR fragment (2.1Kb) contains the FeLV ENV gene, H6 promoter The PCR fragment was then digested with Xho1/BamHI and ligated to XhoI/BamHI digested pH6C5ALVAC donor plasmid (Merial proprietary material) to generate pCXL208.2, which was [01501 Construction of pH6C5env plasmid pPB713 mutation is the substitution of Arg for Glu at position 527 of the FeLV ENV gene. [01521 provided contains 5 mutations (in nucleotides) by comparison with the reference sequence Sambrook et al.

Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989). All the restriction fragments used for the present invention were (B10 101 Inc., La Jolla, Calif.).

Example 1 Construction of pH6C5env - pCXL208.2, a C5 insertion plasmid for the generation of FeLV- 7847CXL: CTC GGA TCC AGAAAAA TCA TGG TCG GTC CGG ATC (SEQ ID NO:26) immediately upstream of the ENV and a T5NT sequence followed by stop codon of the ENV. sequence confirmed.

The plasmid map of pCXL208.2 and its sequence are shown in Figures 2 and 3.

FeLV ENV is glycosylated and cleaved to produce glycoprotein gp70 ENV and pl5E ENV. The protein sequence of mutated FeLV ENV gene of strain 82K is shown in Figure 5. The Plasmid pHCMV- ENV FeLV was received from Institut Gustave-Roussy (Villejuif, France). The sequence of the mutated FeLV ENV fragment (SEQ ID NO:3) (Glasgow, GenBank accession No. M12500, SEQ ID NO:35). Among the five nucleotide mutations, two mutations are silent mutations (no amino-acid change), but introduced a new restriction site (= FspI); three mutations introduced a mutation in the amino-acid sequence of FeLV ENV (Arg in place of Glu; as shown in Figure 5, SEQ ID NO:4).

Plasmid phCMV-ENV FeLV was digested with Rsril/Sacli to generate an RsrII- SacIl fragment (fragment B: 520 bp). Plasmid pCXL208.2 was digested with RsrII/SacII to generate a Rsr11-Saell fragment (fragment A: 6231 bp). Fragments A and B were ligated to generate plasmid pPB713 (6756 bp). The identity of pPB713 was confirmed by an FspI digestion. The restriction map of pPB713 and the pPB713 sequences are shown in Figure 4.

Construction of pH6C5env plasmid pPB7I2 Plasmid PhCMV-ENV FeLV was digested with RsrIESaclI to generate an RsrII- SacII fragment (fragment A: 520 bp). Plasmid pPB575 (Merial proprietary material) was digested with Rsril/Sacil to generate an RsrII-SacII fragment (fragment B: 5971 bp).

Fragments A and B were ligated to generate plasmid pPB712 (6496 bp). The identity of pPB7I2 was confirmed by an EcoRI digestion. The sequence of the mutated region of FeLV present in pPB712 clone was controlled by DNA sequencing (Cogenics, France) with universal M13 primer and reverse M13 primer. Two candidates were selected (n°1 and n°2).

The sequences of the 2 clones were identical but were different from SEQ ID NO:4 (single amino acid mutation Glu to Arg). There are eight nucleotide mutations, leading to only one amino acid change. The DNA and protein sequence comparisons between the mutated FeLV (SEQ ID NO:1) in pPB712 and the mutated FeLV (SEQ ID NO:3) in pHCMV-ENV FeLV are shown in Figure 5. The sequence comparison of FeLV ENV proteins of different strains is shown in Figure 5.

Example 2 Construction of C3 ALVAC donor plasmid for generation of an ALVAC recombinant expressing FeLV codon optimized GAG-PRO FeLV (Feline leukemia virus) codon optimized GAG-PRO gene was used in making the vCP2294. FeLV GAG-PRO gene was optimized for gene expression in mammalian cells.

The sequence comparison at the DNA level between the codon-optimized GAG-PRO gene (SEQ ID NO:10) and the wild-type gap-pro gene (Genbank accession No. M18247, SEQ 113 NO:11) is show in Figure 7.

The construction scheme is outlined in Figure 8. The plasmid pJY1320.1 (Merial proprietary material) containing H6p-FeLV codon optimized GAG-PRO cassette was used as a template for PCR amplification. H6p is Vaccinia virus H6 promoter. Primers 13301JY and 13302JY were used for the PCR amplification. The PCR fragment was cloned to a pCR2, TOPO vector. The resulting plasmid pJY1857.5 was sequenced and confirmed to have correct sequences of H6p-FeLV GAG-PRO. In order to construct pC3 FeLV 146p-GAG-PRO, an NruI/SpeI DNA fragment, which contains 3'-partial H6 promoter and full-length GAG-PRO, was isolated from pJY1857.5 and ligated to Nru I/Spe I digested pJY1738.2 (Merial proprietary material) to create p1Y1874.1 (as shown in Figures 9, 10 and 11), which was confirmed to have the correct sequences.

Primer forward 13301JY (SEQ ID NO:13) 1 H6p (SEQ ID NO :15) ' ATTA TCGCGA! TATCCGTTAAGTTTGTATCGTA ATG GGA CAG ACC ATC ACC ACC CCC CTG T Primer reverse 13302JY (SEQ ID NO :14) ' ATTA ACTAGT CAAGAAAAA TCA TTA CAG CAC CTG CAG GGG CAG TCC TCT In FeLV infected cells, GAG-PRO is produced by readthrough. GAG is further cleaved to MA (p15), CA (p30) and NC proteins during the later stage of virus assembly.

Example 3. Generation and characterization of ALVAC recombinant containing H6p FeLV codon optimized GAG-PRO inserted in C3 locus of ALVAC (vFP2294) The IVR (in vitro recombinant) was performed by transfection of Primary chicken embryo fibroblast cells (1°CEF) with 10 tg of Not I-linearized donor plasmid p.TY1874.1 using FuGENE-6® reagent (Roche). The primary chicken embryo fibroblast cells (1°CEF) used for in vitro recombination were grown in 10% FBS (JRH: y-irradiated # 12107-500M), DMEM (BRL/Gibco#11960-051 or 11960-044) supplemented with 4 mM Glutamine (BRL/Gibco#25030-081) and 1 inM Sodium Pyruvate (BRL/Gibco#11360-070) in the presence of lx antibiotics/antimycotics (P/S/A/A, BRL/Gibco#15240-062).The transfected cells were subsequently infected with ALVAC as rescue virus at MOI (multiplicity of infection) of 10 (ALVAC #HM1372 07 Apr 04). After 24 hours, the transfected-infected cells were harvested, Recombinant plaques were screened based on the plaque lift hybridization method using a 1.4 kb FeLV GAG specific probe labeled with horse radish peroxidase (HRP) according to the manufacturer's protocol (Amersham Cat# RPN3001). After five sequential rounds of plaque purification, the recombinant designated as vCP2294.1.1.I.1.1 was generated and confirmed by hybridization as 100% positive for the FeLV GAG insert and 100% negative for round of plaque purification, and expanded to obtain P1 (lx T25 flask), P2 (1xT75 flask) and P3 (6 x roller bottles). The infected cell culture fluid from the roller bottles was harvested and concentrated to produce a virus stock vCP2294,1.1.1.1.1.

The scheme to generate recombinant vCP2294 is depicted in Figure 12.

Analysis of recombinant: the following analyses were performed on the P3 stocks.

Confirmation of genetic purity The P3 stocks were re-confirmed by hybridization, as 100% positive for the FeLV GAG and 100% negative for the C3 ORF.

Genomic analysis Genomic DNA from vCP2294.1.1.1.1.1 was extracted, digested with BamHI, HindIII and run on 0.8% agarose gel. The gel with BamHI, or Pstl DNA was transferred to a nylon membrane and Southern blot analysis was performed by probing indicating the correct insertion of FeLV GAG-PRO gene into the C3 locus. 4152 4885 Pst I 681 2444 sonicated and used for recombinant virus screening. the C3 ORF.

Single plaque was selected from the 5 th or Pst I Hind111 digested genomic with the 1.4 kb FeLV GAG probe. Multiple bands were observed at the expected sizes, Restriction enzyme Fragment (bp) Barn HI 13961 Hind III 17783 12041 Expression analysis 1) Western blot Primary CEF cells were infected with the P3 stock of vCP2294.1.1.1.1.1at MO1 of 10 and incubated at 37°C for 24 hrs. The culture supernatant and cells were then harvested. Cell pellet was lysed with Reporter Gene Assay Lysis Buffer manufactured by Roche (Cat. 1 897 675). Both Supernatant and lysate were prepared with the NuPage® System with antioxidant added. Proteins were separated on a NuPage® 10% Bis-Tris Pre-cast gel, and then transferred to a PVDF membrane. Anti FeLV GAG antibodies revealed a —70kDa protein detected in both supernatant and cell pellet, and a —57 kDa protein, which was detected only in the cell pellet. 2) Immunoplaque assay The homogeneity of the population was 100% positive to the FeLV GAG protein for recombinant vCP2294.1.1.1.1.1 as evidenced by an immunoplaque assay, using anti-FeLV GAG antibodies.

Sequence analysis A more detailed analysis of the P3 stock genomic DNA was performed by PCR amplification and sequence analysis of the flanking arms of the C3 locus and the FeLV insert.

Primers 8103JY and 8104JY, located beyond the arms of the C3 locus in the ALVAC genome were used to amplify the entire C3L-FeLV-C3R fragment. The results showed that the sequences of the FeLV insert and C3L and C3R of ALVAC are correct.

Primers for amplifying the FeLV GAG probe: 11369JY: 5' ATGATGAACGTGGGCTGGCCT 3' (SEQ ID NO:17) 11377.1Y: 5' TCTCCTAAGTTGAGCAGGGTG 3' (SEQ ID NO:18) [01681 Primers for PCR amplification of C3L-FeLV GAG-PRO cassette-C3R: 8103JY: 5' GAGGCATCCAACATATAAAGAAGACTAAAG 3' (SEQ ID NO:19) 8104JY: 5' TAGTTAAATACTCATAACTCATATCTG 3' (SEQ ID NO:20) 101691 Figure 13 shows the vCP2294 C3 region map showing primer locations. The vCP2294 sequence is depicted in Figure 14.

Example 4 Generation and characterization of ALVAC recombinant containing FeLV modified ENV gene inserted at C5 locus of vCP2294, ALVAC C3 H6p FeLV codon optimized GAG-PRO — vCP2296

[0170] The IVR was performed by transfection of 1°CEF cells with 10 [ig of Not I-linearized donor plasmid pPB713 using FuGENE-6® reagent (Roche). The transfeeted cells were subsequently infected with vCP2294 (ALVAC C3 H6p FeLV codon optimized GAG-PRO, Recombinant plaques were screened based on the plaque lift hybridization method using a 503 by FeLV ENV specific probe labeled with horse radish peroxidase (HRP) according confirmed by hybridization as culture fluid from the roller bottles was harvested and concentrated to produce a virus stock The construction of vCP2296 is depicted in Figure 15. 100% Expression analysis Primary CEF cells were infected with the P3 stock of vCP2296.6.1.1.2 at MOI of 10 Example 2) as rescue virus at MOI of 10. After 24 hours, the transfected infected cells were harvested, sonicated and used for recombinant virus screening. to the manufacturer's protocol (Amersham Cat# RPN3001). After four sequential rounds of plaque purification, the recombinant designated as vCP2296.6.1.1.2 was generated and 100% positive for the FeLV ENV insert and 100% negative for the empty C5 sites.

[0172] Single plaque was selected from the 4 round of plaque purification, and expanded to obtain P1 (lx T25 flask), P2 (1xT75 flask) and P3 (6 x roller bottles) stocks. The infected cell vCP2296.6.1.1.2.

P3 stocks.

Analysis of recombinant: the following analyses were performed on the Confirmation of genetic purity The P3 stocks were re-confirmed by hybridization, as 100% positive for both FeLV GAG and FeLV ENV and negative for both C3 and C5 ORF. 1) Western blot: and incubated at 37 C for 24 hrs. The culture supernatant and cells were then harvested. Cell pellet was lysed with Reporter Gene Assay Lysis Buffer manufactured by Roche (Cat. 1 897 675). Both supernatant and lysate were prepared with the NuPage® System with antioxidant added. Proteins were separated on a NuPage® 10% Bis-Tris Pre-cast gel, and then transferred to a PVDF membrane. Anti FeLV GAG antibodies revealed a —70kDa protein detected in both supernatant and cell pellet, and a —80 kDa protein was also expressed in both the supernatant and cell pellet by incubating with anti FeLV ENV antibody. 2) Immunoplaque assay: The homogeneity of the population was 100% positive to the FeLV ENV protein for recombinant vCP2296.1.1.2 as evidenced by an immunoplaque assay, using anti-FeLV ENV antibody (see IP confirmation scan picture in attachment vCP2296 Immunoplaque,doc).

Insertion of the FeLV ENV gene at the C5 sites of vCP2296.6.1.1.2 was amplified by PCR. Primers 7931DC and 7932DC, located beyond the arms of the C5 locus in the ALVAC genome (see Figure 16), were used to amplify the entire C5L-FeLV-05R fragment, Primers for amplifying the FeLV ENV probe: Primers for PCR amplification of C5L-FeLV ENV cassette-05R: 7931DC 'TGATTATAGCTATTATCACAGACTC 3' Example 5 Generation and characterization of ALVAC recombinant containing FeLV native ENV gene inserted at C5 locus of vCP2294, ALVAC C3 H6p FeLV codon optimized GAG-PRO — vCP2295 The donor plasmid pCXL208.2 contains the native ENV gene (SEQ ID NO:5). donor plasmid pCXL208.2 using FuGENE-6® reagent (Roche). The transfected cells were subsequently infected with vCP2294 (Example 2) as rescue virus at MOI of 10. After 24 hours, the transfected-infected cells were harvested, sonicated and used for recombinant virus Recombinant plaques were screened based on the plaque lift hybridization method using a 503bp FeLV ENV specific probe labeled with horse radish peroxidase (HRP) according to the manufacturer's protocol (Arnersham Cat# RPN3001). After four sequential rounds of plaque purification, the recombinant designated as vCP2295.2.2.2.1 was generated and confirmed by hybridization as 100% positive for the FeLV ENV insert and 100% negative for Single plaque was selected from the 4 round of plaque purification, and expanded to fluid from the roller bottles was harvested and concentrated to produce a virus stock scheme to generate recombinant vCP2295 is shown in Figure 17.

Sequence analysis 7900CXL 5 'AGGAGGGCTTTAGTCCCTGTTCCGA 3' (SEQ ID NO:21) 7934CXL 5 'ACTAAAGACTGTTGGCTCTGCCTG 3' (SEQ ID NO:22) 'GAATCTGTTAGTTAGTTACTTGGAT 3' (SEQ ID NO:23) (SEQ ID NO:24) 7932DC The IVR was performed by transfection of 1°CEF cells with 10 j.tg of Not I-linearized screening. the empty C5 sites. obtain PI (lx T25 flask), P2 (1xT75 flask) and P3 (6 x roller bottles). The infected cell culture vCP2295.2.2.2.1.

Confirmation of genetic purity The P3 stocks were re-confirmed by hybridization, as 100% positive for both FeLV GAG and FeLV ENV and 100% negative for both C3 and C5 ORF.

Expression analysis 1) Western blot Primary CEF cells were infected with the P3 stock of vCP229.5.2.2.2.1at MOI of 10 and incubated at 37°C for 24 hrs. The culture supernatant and cells were then harvested. Cell pellet was lysed with Reporter Gene Assay Lysis Buffer manufactured by Roche (Cat. 1 897 675). Both Supernatant and lysate were prepared with the NuPage® System with antioxidant added. Proteins were separated on a NuPage® 10% Bis-Tris Pre-cast gel, and then transferred to a PVDF membrane. Anti FeLV gag antibodies revealed a —70kDa protein detected in both supernatant and cell pellet, and a —80 kDa protein was also expressed in both the supernatant and cell pellet by incubating with anti FeLV ENV antibody. 2) Immunoplaque assay: The homogeneity of the population was 100% positive to the FeLV ENV protein for recombinant vCP2295.2.2.2.1as evidenced by an immunoplaque assay, using anti-FeLV ENV antibody.

Sequence analysis

[0185] A detailed analysis of the P3 stock genomic DNA was performed by PCR amplification and sequence analysis of the flanking arms of the C5 locus and the FeLV insert.

Primers 7931DC and 7932DC, located beyond the arms of the C5 locus in the ALVAC genome, were used to amplify the entire C5L-FeLV-05R fragment. The results showed that the sequences of the FeLV insert and C5L and C5R of ALVAC are correct.

[0186] Recombinant vCP2295 sequence is depicted in Figures 18.

Example 6 Efficacy Evaluation of Canarypox Vectored Vaccine (vCP2296, FeLV ENV) Administered Subcutaneously Via a Vaccination/Challenge Model Materials/Methods

[0187] Forty-four cats, male and female, between 57 and 63 days of age at first vaccination (average 58 days; standard deviation 1.3 days) were randomly allocated into two groups of twenty-two animals. Cats in Group 1 were vaccinated subcutaneously (SQ) on Days 0 and 21 6'2 Tissue Culture Dose50 (TCID50)/ml. Cats in Group 2 received two doses of lml of the Placebo Vaccine containing 42 and 43 (3 weeks following the 2nd vaccination), all cats were challenged with 1 ml of a virulent strain of FeLV (61-E) suspension containing 10 5 and 104 ' 50/m1; (Days 42 and 43 (prior to challenge), and at approximately 3 weeks post-challenge and at weekly intervals for up to 12 consecutive weeks (Days 62-Day 146) and the sera tested for FeLV antigenemia (FeLV p27 protein).

Clinical evaluation was conducted starting 2 days prior to the 1st vaccination up to Day 42. Rectal temperature was recorded daily on Days 0 (prior to vaccination), 1-2, 19-21 Results: Persistence of FeLV p27 antigenemia after challenge [01891 (86.4%) from the placebo group became persistently FeLV antigenemic in comparison to 5/21 (23.R%) of the vaccinated group. The incidence of cats with persistent FeLV antigenemia following results: 1. Upon challenge, the test vaccine was shown to be effective in preventing persistent FeLV with 1ml of the FeLV-canarypox vector vaccine (vCP2296) at 10 Sterile Physiological Saline Solution on Days 0 and 21 and served as negative controls, On Days 4' 7 TC1D respectively) administered by the oro-nasal route. Blood samples were collected on Days -6, 42 (prior to vaccination) and 22-23. In addition, injection sites were assessed the first 2 days following each vaccination and at weekly intervals post-vaccination until the day of challenge and included the evaluation for swelling, redness and pain upon palpation.

A cat was considered as having persistent FeLV p27 antigenemia when it was tested FeLV p27 positive for 3 consecutive weeks or 5 non-consecutive weeks. Nineteen out of 22 cats attributable to the FeLV challenge was significantly lower (p=0.00005) in the vaccinated group than in the placebo group. The estimated prevented fraction was 72.43% with a 95% confidence interval of 43.04% to 89.78%. Thus, there was a 72% reduction in the chance of an animal becoming persistent FeLV antigenemic in a vaccinated Placebo animal compared to that of a animal.

Conclusion Two doses of Medal's FeLV-Canarypox Vectored Vaccine (vCP2296) administered by the SQ route were found to be efficacious against an FeLV challenge as evidenced by the antigenemia in 16 out of the 21 (76.2%) vaccinated-challenged cats with a significantly lower number of vaccinated cats developing a persistent antigenemia as compared to controls 2. An effective challenge was validated, as evidenced by the development of persistent FeLV 3. None of the vaccinated cats showed local or systemic reactions following vaccination.

Example 7 Comparison of the efficacy of the recombinant canarypox-FeLV with native ENV Total of thirty SPF (specific pathogen free) kittens, 15 male and 15 female, aged kittens according to their sex, litter and age.

Table I. Experimental design of the study Group Vaccination DO — D28 Challenge vaccine Target Route D44 volume SC** B 1 0 tmL vCP2296 Glasgow-1 Not vaccinated * group C: # of cats = 9 from DI to the end due to the death of one cat on DI ** in log 1 OCCID50/mL BS: blood sampling Cats from groups A and B were then vaccinated under general anesthesia by subcutaneous injection in inter-scapular area. On D44, the challenge strain was thawed at 37 ° were mixed with 8mL of F15 medium with 10% foetal calf serum and kept on crushed ice before inoculation. All cats underwent general anesthesia. Then each cat was inoculated via the oro- (p=0.00005; prevented fraction 72%; primary efficacy variable). antigenemia in 86% (19/22) of the control cats. gene (vCP2295) and the recombinant canarypox-FeLV with optimized ENV gene (vCP2296) by challenge in cats Materials/Methods between 8 and 12 weeks (9 weeks on average on DO), were randomly assigned to 3 groups of 10 # of cats titre** vCP2295 6.0 FeLV-A- Oro-Nasal route SC: subcutaneous DO and D28, prior to vaccination, all kittens were monitored for body condition.

C, 32mL of strain nasal route with ImL of inoculum (0.25mL in each nasal cavity) and 0.5mL orally (tongue, pharynx and tonsil).

Results Blood samplings were performed on vigil cats on DO, D5, D7, D15, D26, D35, D49, D70, D77, DB4, D91, D96, D105, D112, D133 and under general anesthesia (0.1 to 0.2naLlkg of Zoletll" 50, Intramuscular route) on D44, D56, D63, D119, D126, DI40 and D147. 1...4 tztigetionia test Blood samples were collected in dry tubes on DO, before the vaccination, on D44 before the challenge and every week from the third week post challenge, i.e., on D63, D70, D77, D84, D91, D98, D105, D112, D119, D126, D133, D140 and D147 for FeLV p27 antigen titration with Witness FeLV kit (Synbiotics Corporation, MO, USA). The response was a binary one (presence/absence). Three categories of response were defined: a) 0: no antigenemia (all the titrations were negative), b) 1: transient antigenemia (less than three positive consecutive ti.trations and less than five positive titrations), c) 2: persistent antigenemia (positive on at least five occasions or at least three positive consecutive titrations).

In the vCP2295-vaccinated group (group A), 40% of cats were protected against persistent antigenemia: 4/10 cats were never found positive and 6/10 cats presented a persistent antigenemia. In the vCP2296-vaccinated group (group 8), 60% of cats were protected against p27 persistent antigenemia. 5/10 were never found positive and 1/10 cat presented a transient antigenemia: p27 could be detected in the serum of this cat on D63 and D84, 4/10 cats presented a persistent antigenemia. In the control group (group C), 100% of cats had persistent antlgencmia. The results are shown in Table 2.

Table 2. p27 antigenemia results (rates) Group Persistent Transient No positive Protection* antigenemia antigenemia antigenemia rate A 6/10** 0/10 4/10 4/10 vCP2295 vaccinated 60% 0% 40% 40% 4/10 1/10 5/10 6/10 vCP2296 vaccinated 40% % 50% 60% C 9/9 0/9 0/9 NA control 100% ** One cat which died during the study was found positive 4 consecutive times 0), transient (antigenemia = 1) or persistent (antigenemia = 2) antigenemy gave a significant p- value ("Fisher's exact test": p = 0.028). A trend to the significance was evidenced between group and group C (adjusted p-value with Bonferroni's method: A vs C: p = 0.260, B vs C: p = 0.056, Proviremia 10197] Leukocyte counts were used to express proviremia in provirus copy number / 50,000 cells) using a quantitative PC II_ Due to the repeated measurement nature of the criterion and the Figure 19 displays the evolution of the mean proviremia per group after challenge. after challenge. In both vaccinated groups, p27 antigenemia was well correlated to proviremia Immune response was monitored by EllSpot after stimulation of PBMC by dendritic cells (DC) * Number of non persistently infected cats / Number of cats NA: not applicable: control group The comparison of the 3 groups on the frequency of cats presenting no (antigenemia A vs B: p 1). 2. test WBC (white blood cell). Blood samples were collected in EDTA tubes on D44 before the challenge and every 3 weeks after the challenge, i.e., on D63, D84, D105, D126 and D147 for leukocyte count and FeLV proviremla monitoring on PBMC (peripheral blood mononucleated individual random effect, the proviremia data was analyzed using a mixed model with repeated measurements, a) Proviremia in blood Figure 17 displays the evolution of the mean proviremia per group and p27 antigenemia status (Figure 20). b) proviremia in marrow The level of proviremia in marrow of p27 negative cats was between 3 and 5 log10 whereas reached 8 to 9 log10 in p27 positive cats. The level of proviremia was well correlated with the p27 antigenemia individual status and with individual blood proviremia (as shown in Figure 21). 3. Cellular immune response Blood samples were collected on heparin treated tubes on. D5, D7, Dl5, D28, D35, D49, D56, D63, D119, and.

D126 for FeLV immunological monitoring. IFN-y -Cell Mediated loaded with FeLV pools of peptides on D35 and D126. IL 10 mediated Immunity was monitored Regulatory T cells were monitored on D5, D15, D35, D49, D63 and 13126.

[0201] 30minutes without brake). PBMCs were washed twice in sterile PBS (Phosphate-buffered saline) (centrifugation 400g for 10minutes) and subsequently counted with a robotized ABX Pentra 120 cell counter. The cells were washed one last time in PBS and resuspended at concentration of /m1 in sterile complete RPMI (=RPMI + Penicillin-Streptomycine (PS) +13Mercaptoethanol b). Dendritic cells generation adherent cells were removed and fresh completed medium supplemented with feline IL-4 and feline GM-CSF was added to wells. The differentiation of monocytes into DC lasted 7 days. c). IFNy ELISpot assay: [02031 animals was quantified by utilizing IFNy ELISPOT assays. HA ELISPOT plates were coated overnight at +4°C with 100pliwell of purified Anti-canine IFNy mAb diluted (1/25) in sterile PBS and unoccupied sites were blocked with sterile complete RPMI 10% FCS for 2h at Room Temperature (RT). proteins at D+15, D+35 and D+126. Briefly, 100.10 peptide pools n 1 and 2 for FeLV ENV or peptide pools No. 2, 3, 6 and 8 FeLV GAG-PRO at transferred into ELISpot plates and 500.10 3 PBMCs were added into each well. Dendritic cells were loaded with an irrelevant peptide as a negative control. Cells were stimulated during 20-24h at 37°C + 5% CO2. Cells were then eliminated and to allow cellular lysis. Cold distilled water by ELISpot after stimulation of PBMC by FeLV pools of peptides on D35,1363 and D126.

A) Methods Feline PBMCs isolation PBMCs were isolated by PANCOLL® density-gradient centrifugation (600g for .10 6 (OM)) + 10% of fetal calf serum (FCS). 102021 Ficoll-Isolated PBMCs were cultivated during 20 hours in flat 6-wells plates. Non The intensity of FeLV-specific cellular immune responses in the different groups of carbonate/bicarbonate buffer (0. 2M, pH9.6). The coated plates were washed three times in Dendritic cells were loaded with peptide pools encoding for FeLV ENV and GAG 3 DC were re-stimulated individually by 1p.g/m1 in a final volume of 100p1 completed RPMi 10% FCS. Loaded den dritic cells were was added to each well (2000) for 5min at RT. The plates were then washed three times in PBS- 0.05% Tween and incubated at +4°C with 100 pi of biotinylated Anti-feline yIFN MAb (diluted at 1/100 in PBS-0.05% Tween). The plates were then washed three times in PBS-0.05% Tween and 1001.1.1 of diluted HRP-Streptavidine solution were added to each well for 1 h at 37°C. Plates were then washed three times in P13S-0.05%Tween and incubated for 15minutes at RT in dark with the AEC substrate solution. The plates were extensively washed with tap water and dried.

The spots were counted with a CCD camera system (Microvision, Redmond, WA, USA) . The frequency of peptide-specific IFNy-spot forming cells (SFC) was calculated as follow: number of peptide-specific 1FNy SFC = number of IFNy SFC upon individual FeLV peptide pool re- stimulation - number of IFNy SFC upon irrelevant peptide pool re-stimulation. Results were expressed as the log10. d). 1L-10 ELI Spot assay 102051 The ELISpot IL-10 was performed according to the manufacturer Instructions (R&D systems, Minneapolis, MN, USA). 500.103 purified PBMCs were directly re-stimulated using overlapping peptide pools encoding for FeLV ENV and GAG-PRO sequences, at li.tg/m1 in a final volume of 2000 completed RPMI 10% FCS, and set down in ELIspot IFNy coated plates. 500.103 PBMCs were re-stimulated with an irrelevant peptide as a negative control. The frequency of peptide-specific IL-10 spot forming cells (SFC) was calculated as follow: number of peptide pool-specific 1L-10 SFC = number of IL-10 SFC upon individual FeLV peptide pool re-stimulation - number of IL-10 SFC upon irrelevant peptide re-stimulation.

Results were expressed as the log10.

B) Results a) Cellular immune response after vaccination i) Monitoring of FeLV-specific IFNy secreting cell responses after vaccination The ability of PBMCs to produce IFNy In response to re-stimulation with FeLV ENV and GAG-PRO peptide pools-loaded DC was analyzed using an IFNy-ELISpot assay. Analysis of the sum of IFNy + SFC (spots forming cells) induced upon in vitro activation with dendritic cells loaded with peptide pools encoding for FeLV ENV and GAG-PRO sequences showed that vCP2296 vaccination induced a higher frequency of FeLV-specific IFNy secreting cells at day35 compared to vCP2295 vaccination. The non-vaccinated groups did riot induce any IFNy secreting cells (Figure 22).

The differences between vCP2295 and vCP2296 in their ability to induce IFNy- producing cells were clearer when focusing on Fel..V ENV pools No.1 and No.2 specific response. Analysis of the frequency of IFN y SFC within PBMCs upon in vitro activation with dendritie cells loaded with peptide pool No. 1 of FeLV ENV (encoding for the beginning of the vaccination (group A) at day 35, in blood. The non-vaccinated groups did not induce any IFNy secreting cells (Figure 23). ii) Monitoring of FeLV-specific IL-10 secreting cells after vaccination FeLV-specific IL-10 secreting cells monitoring: analysis of FeLV EN V-specific responses 102081 At day 35 post-vaccination, the ability of PBMCs to produce IL-TO in response to vaccination induced a higher frequency of FeLV ENV-specific IL-10 secreting cells in in blood At day35 post-vaccination, the ability of PBMCs to produce IL-10 in response to vCP2295 vaccination tended to induce more FeLV GAG-PRO specific IL .l0 secreting cells than, vCP2296 vaccination (Figure 25). 102101 In conclusion, vCP2295 vaccination (group A) induced a higher frequency of FeLV B) and control group (group C).

In order to further evaluate the two recombinant vaccines and the balance between 'T'h 1 response and regulatory response, the ratio between the number of FeLV-specific IFNy SFC each vaccinated group was calculated. Comparison of the FeLV-specific TT:Ny IL-10 SR.' ratio for each group demonstrated that vCP2296 vaccination induced a more balanced response as compared to the immune response induced by vCP2295 vaccination which was biased toward 1L-10 response. 'This difference was more apparent in response to FeLV ENV re-stimulation than to GAG-PRO re-stimulation (Figures 26a and 26b).

FeLV ENV sequence) showed a difference between vCP2296 (group B) and vCP2295 blood FeLV ENV peptide pools re-stimulation was analyzed using an IL-10 Filspot assay. vCP2295 comparison to vCP2296 vaccination and control group (Figure 24).

FeLV-specific IL-10 secreting cells monitoring: analysis of FeLV GAG-PRO specific responses FeLV GAG-PRO peptides pools re-stimulation was analyzed using an IL-10 ELlspot assay. specific IL-10 secreting cells in peripheral blood, in comparison to vCP2296 vaccination (group iii) FeLV-specific IFNy and IL-10 producing cells ratio after vaccination. and the number of FeLV specific IL-10 SFC after ENV or GAG-PRO in vitro re-stimulation for b) Cellular immune response monitoring after experimental challenge i) Monitoring of FeLV-specific IFNy secreting cell responses after challenge After the challenge (D126) the ability of PBMCs to produce IFNy in response to re- stimulation with FeV ENV and GAG-PRO peptide pools-loaded OC was analyzed using an specific IFNy secreting cells in PBMCs lately after the challenge (D126) as compared to vCP2295-vaccinated cats. No FeLV GAG-PRO-specific IFNy secreting cells could be observed at this time point, for any group (Figure 27). ii) Monitoring of FeLV-specific IL-10 secreting cell responses after challenge After the challenge (D126), the ability of PBMCs to produce IL-10 in response to FeLV ENV or GAG-PRO peptides pools re-stimulation was analyzed using an IL-10 ELlspot assay. FeLV challenge specifically boosted the FeLV ENV-specific IL-10 cell response in all groups, as compared to the response at day 35, with no difference between the 3 groups (Figure 28a). The challenge did not affect the antigen-specific response directed against FeLV GAG- PRO region, and vCP2295-vaccinated cats maintained their FeLV GAG-PRO -specific IL-10 response (Figure 28b). After the challenge, vCP2295 vaccinated cats (group A) exhibited only a FeLV-specific IL-10 immune response whereas vCP2296-vaccinated cats (group B) developed a FeLV-specific IL-10 immune response but also maintained their FeLV-specific IFNy response. c) Frequency of FeLV-specific IFNy and IL-10 producing cells in protected and infected animals Protected and Infected animals were identified according to p27 antigenemia results.

Protected and infected animals were separated within each group (Figure 29) and the IFNy/IL-I0 ratio for each sub-group was calculated to evaluate if the IFNy/IL-I0 SFC ratio after the vaccination could be indicative of protection. of 10 did not present any IFNy or IL10 response and were protected. Four cats out of 10 presented a low IFNy/11,10 ratio related to a high IL-10 response. Three of these cats presented a high IFNy response and one of them did not present any IFNy response. These cats were not protected. 102161 In the vCP2295 vaccinated group: eight cats out of 10 presented a lowIFNy/IL-1.0 ratio related to a high IL-10 response and a low IFNy response. Six of them were infected and IFNy-El.,Ispot assay. vCP2296-vaccinated cats maintained a higher frequency of FeLV ENV- In the vCP2296 vaccinated group: four cats out of 10 presented a high IFNy/IL-10 ratio related to a high IFNy response and a low IL- I 0 response and were protected. Two cats out two of them were protected. Two cats out of 10 presented both IFNy and 11.-10 responses and a high IFNy/1L-10 ratio. These cats were protected. 102171 Protected cats either from vCP2295- or vCP2296-vaccinated group displayed a higher IFNy/IL-10 ratio in blood (Figures 26) as compared to infected cats, Moreover, protected cats from vCP2296-vaccinated group have a higher :IFNy/IL-10 SFC ratio as compared to protected eats from vCP2295-vaccinated group. 10218] Protection was correlated with an increased IFN7/1L-10 ratio and protected cats from vCP2296 vaccination developed a FeLV-specific cell mediated immunity biased toward 1FNy production as compared to vCP2295-vaccinated cats.

Conclusion 102191 Sixty percent of cats vaccinated with vCP2296 (optimized ENV gene) were protected against persistent antigenemia and 40% of cats vaccinated with vCP2295 (native ENV gene) were protected against persistent antigenemia. The comparison of the three groups displayed a significant difference of protection between vaccinated and non-vaccinated groups and a trend to a significant difference between group B vaccinated with the optimized ENV gene (vCP2296) and group A vaccinated with the native ENV gene (vCP2295). 102201 Proviremia and antigenemia results were well correlated: cats with persistent antigenemia had a strong and sustained proviremia until the end of the study. Non-antigenemia cats had lower and regressing proviremia. P27 negative cats were able to control the proviremia.

Differences between vCP2295 and vCP2296 vaccination, according to the induction of FeLV specific IFNy and IL-10 producing cells during the vaccination and challenge phases were evidenced. The induction of FeLV-specific IFNy producing cells by FeLV canarypox vaccines especially when the ENV gene was mutated in its immunosuppressive sequence (vCP2296) was demonstrated. Interestingly, these IFNy producing FeLV-specific cells induced by vCP2296 vaccination were still detected more than 100 days after challenge demonstrating that the vCP2296 vaccination induced the generation of FeLV-specific memory T cells. Conversely, vCP2295 was more potent to induce the differentiation of FeLV-specific IL-JO-producing cells.

The frequency of FeLV-specific IL-10 producing cells was higher in vCP2295 vaccinated cats as compared to vCP2296 and non-vaccinated control cats after the vaccination. IL-1.0 is known for its regulatoty properties, participating either in the inhibition of the immune response or in its termination. The higher FeLV-specific IFNy/IL-10 SFC ratio after the vaccination was correlated to protection (evaluated by antigenemia). All cats presenting a high IFNy/II.,-10 ratio and a low IL-10 response were protected. This observation was in line with the potentially immune- cells. Modification of the ENV gene in the vCP2296 vaccine decreased the imrnunosuppressive properties of the construct and provided an immunological advantage to this construct as compared to the native ENV gene in vCP2295. 10221] This study showed that the modification of the ENV gene of FeLV resulted in a different quality of the immune response associated with a better protection against persistent antigenemia. The modification of the ENV gene of FeLV allows the canarypox-FeLV to work at lower dose than the same construct with native ENV FeLV gene. 102221 It will be apparent that the precise details of the methods described may be varied or modified without departing from the spirit of the described disclosure. We claim all such modifications and variations that fall within the scope and spirit of the claims below.

I0223j All documents cited or referenced herein ("herein cited documents"), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. suppressive role of the ILproducing cells and with an anti-viral function of IFNy-producing

Claims

What we claim is:

1. A composition comprising an expression vector comprising a first polynucleotides encoding an optimized Feline Leukemia Virus (FeLV) envelope (ENV) polypeptide and a second polynucleotide encoding an FeLV GAG/PRO polypeptide, wherein the 5 optimized FeLV ENV polypeptide comprises a mutation at amino acid position 527 or equivalent corresponding amino acid position of an FeLV ENV protein, and wherein the mutation comprises a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E), and wherein the polynucleotide encodes an optimized FeLV ENV polypeptide having the sequence as set forth in SEQ ID NO: 2, 4, 27, 28, 29, 30, 31, 32, 10 33 or 34.

2. The composition of claim 1, wherein the mutation comprises a substitution of arginine (R) for glutamic acid (E).

3. The composition of claim 1 or claim 2, wherein the polynucleotide has at least 70% sequence identity to the sequence as set forth in SEQ ID NO:1, 3, or 5. 15

4. The composition of any one of claims 1 to 3, wherein the second polynucleotide encodes an FeLV GAG/PRO polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO:12.

5. The composition of claim 1, wherein the first polynucleotide encodes an optimized FeLV ENV polypeptide having an amino acid sequence as set forth in SEQ ID NO:2 or 4, and 20 wherein the second polynucleotide encodes an FeLV GAG/PRO polypeptide having an amino acid sequence as set forth in SEQ ID NO:12.

6. The composition of claim 1, wherein the polynucleotide encoding the optimized FeLV ENV polypeptide has the sequence as set forth in SEQ ID NO:1, 3, or 5, and the polynucleotide encoding FeLV GAG/PRO polypeptide has the sequence as set forth in 25 SEQ ID NO: 10 or 11.

7. The composition of any one of claims 1-6, wherein the expression vector is an avipox vector.

8. The composition of any one of claims 1-7, wherein the composition is administered to an animal at a dosage range from about 10 pfu to about 10 pfu. 30

9. An expression vector comprising a first polynucleotide encoding an optimized FeLV ENV polypeptide and a second polynucleotide encoding an FeLV GAG/PRO polypeptide, wherein the optimized FeLV ENV polypeptide comprises a mutation at amino acid position 527, and wherein the mutation comprises a substitution of arginine (R), aspartic acid (D), or methionine (M) for glutamic acid (E), and wherein the polynucleotide encodes an optimized FeLV ENV polypeptide having the sequence as set forth in SEQ ID NO: 2, 4, 27, 28, 29, 30, 31, 32, 33 or 34. 5

10. The expression vector of claim 9, wherein the second polynucleotide encodes an FeLV GAG/PRO polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO:12.

11. The expression vector of claim 9 or 10, wherein the first polynucleotide encodes an FeLV ENV polypeptide having an amino acid sequence as set forth in SEQ ID NO:2 or 10 4, and wherein the second polynucleotide encodes an FeLV GAG/PRO polypeptide having an amino acid sequence as set forth in SEQ ID NO:12.

12. The expression vector of claim 9 or 10, wherein the polynucleotide encoding FeLV ENV polypeptide has the sequence as set forth in SEQ ID NO:1, 3, or 5, and the polynucleotide encoding FeLV GAG/PRO polypeptide has the sequence as set forth in 15 SEQ ID NO: 10 or 11.

13. The expression vector of any one of claims 9-12, wherein the expression vector is an avipox vector.

14. A method of vaccinating a non-human animal comprising at least one administration of the composition or expression vector of any one of claims 1-13. 20

15. The method of claim 14, wherein the method comprises a prime-boost administration regime.

16. The method of claim 14 or 15, wherein the composition is administered at a dosage range from about 10 pfu to about 10 pfu.

17. Use of the composition or expression vector of any one of claims 1 to 13 in the 25 preparation of a medicament for vaccinating an animal.

18. A kit for prime-boost vaccination comprising at least two vials: a first vial containing a composition or expression vector of any one of claims 1-13 for the prime-vaccination, and a second vial containing a composition or expression vector of any one of claims 1- 13, or a subunit FeLV vaccine, or a plasmid FeLV vaccine for the boost-vaccination. 30

19. The kit of claim 18, wherein the first vial contains the composition of claim 5 and the second vial contains the composition of claim 5, and wherein the composition is administered at a dosage range from about 10 pfu to about 10 pfu.

20. A composition according to any one of claims 1 to 8, substantially as described herein with reference to the examples and/or figures.

21. A method or use according to any one of claims 14 to 17, substantially as described herein with reference to the examples and/or figures. 5

22. An expression vector of any one of claims 9 to 13, substantially as described herein with reference to the examples and/or figures.

23. A kit for prime-boost vaccination of claim 18 or 19 substantially described herein with reference to examples and/or figures.