WO2012169699A1 - Novel insecticidal protein, composition for controlling pests and method for controlling pests using same - Google Patents
Novel insecticidal protein, composition for controlling pests and method for controlling pests using same Download PDFInfo
- Publication number
- WO2012169699A1 WO2012169699A1 PCT/KR2011/006987 KR2011006987W WO2012169699A1 WO 2012169699 A1 WO2012169699 A1 WO 2012169699A1 KR 2011006987 W KR2011006987 W KR 2011006987W WO 2012169699 A1 WO2012169699 A1 WO 2012169699A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- moth
- pest control
- control composition
- insecticidal protein
- insecticidal
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
- A01N37/44—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a nitrogen atom attached to the same carbon skeleton by a single or double bond, this nitrogen atom not being a member of a derivative or of a thio analogue of a carboxylic group, e.g. amino-carboxylic acids
- A01N37/46—N-acyl derivatives
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/50—Isolated enzymes; Isolated proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
Definitions
- the present invention provides a novel insecticidal protein, a recombinant expression vector comprising a novel insecticidal protein gene, a novel insecticide comprising a novel insecticidal protein gene isolated from a novel strain of Poturaddus temperata M1021 (Accession Number: KCTC 12006BP). It relates to a loyal protein production transformant.
- the present invention also relates to a pest control composition comprising the novel pesticidal protein.
- the present invention also relates to a method for controlling pests using the composition for controlling pests.
- Insects and other pests cost farmers tens of millions of dollars each year in crop losses and the cost of controlling these pests. Losses caused by pests in the crop production environment include reduced crop yields, lower crop quality, and increased harvest costs.
- BHC which is made of chlorine or benzene
- BHC has attracted worldwide attention by leading development and synthesis in the United States because of its abundant raw materials, low cost, and strong insecticide, and less harmful to human beings.
- various countries such as Western countries and Australia are strictly restricting the use of the pesticides.
- organic chemical synthetic insecticides have been widely used to control pests, but over the decades of abuse, pest outbreaks or emergence of resistant pests, toxic expression of non-target insects including humans, and environmental systems It causes many side effects such as pollution.
- an international agreement was reached to refrain from using highly toxic organic synthetic pesticides in order to protect human health.
- the world reduced production by 50% of the chemical synthetic organophosphorus and chlorine pesticides used in the past 10 years in 2004, and again reduced production of organophosphorus and organochlorine insecticides by 50% by 2010. It is in the phase of implementation, agreeing to international agreements to be made.
- microorganisms have been able to reduce or replace the use of chemical fertilizers or pesticides, microorganisms capable of biological control techniques that are less harmful to livestock, do not harm crops, and have less damage to the environment, such as soil ecosystems.
- chemical fertilizers or pesticides microorganisms capable of biological control techniques that are less harmful to livestock, do not harm crops, and have less damage to the environment, such as soil ecosystems.
- biological pesticides that can complement the chemical pesticides.
- Bacillus thuringiensis soil microorganisms Bacillus thuringiensis
- Bacillus toxin genes Some Bacillus toxin genes have been isolated and sequenced, and products based on recombinant DNA have been produced and approved for use.
- new approaches are being developed to deliver these toxins to the agricultural environment with the use of genetic engineering techniques. These include the use of plants genetically engineered by toxin genes resistant to insects and the use of stabilized complete microbial cells as a means of toxin delivery.
- isolated Bacillus toxin genes are of increasing commercial value.
- Bacillus toxin has been attributed to insect B.t. It caused resistance to toxins. Some insects are less likely to benefit from Bacillus toxins, and examples of such insects include, but are not limited to, insects such as weevils or black cutworms. Adults of most species have been shown that have not shown markedly noticeable sensitivity to ⁇ -endotoxin. Thus, B.t. Although resistance management methods have been of great interest in transgenic plant engineering, there remains a need to develop additional genes that can be expressed in plants in order to effectively control various insects.
- the present inventors have made efforts to search for genes that can be used for pest control from new microorganisms with the aim of developing new biological pesticides using novel insecticidal proteins that can control pests on crops.
- the protein was discovered and the present invention was completed.
- Another object of the present invention to provide a pest control composition comprising a novel pesticidal protein and to provide a new biological pest control method using the same.
- the present invention provides an insecticidal protein having an amino acid sequence of SEQ ID NO: 1 or 3.
- insecticidal protein gene characterized by encoding the amino acid sequence of SEQ ID NO: 1 or 3.
- the present invention provides a recombinant expression vector comprising a novel insecticidal protein gene and a transformant manufacturing a pesticidal protein comprising the same.
- the present invention provides a pest control composition comprising the novel pesticidal protein.
- the present invention provides a pest control method using a pest control composition comprising a novel pesticidal protein.
- a novel insecticidal protein derived from a novel insecticidal photorhabdus temperata M1021 ( Photorhabdus temperate M1021, KCTC 12006BP) can be obtained and can be usefully used as a new biological insecticide.
- Figure 3 shows positive cosmid clones for tcd locus and tcc locus using pooling and subpooling PCR.
- M size marker ( ⁇ / HindIII), * PtC; Photorhabdus temperata M1021's cosmid library
- Figure 3a screens a group having a positive clone of tcdB2 by the pooling PCR method
- Figure 3b secures a positive clone of tcdB2 by the subpooling PCR method (PtC 49, 64, 267)
- Figure 3c shows a pooling PCR method. Screening of groups with positive clones of tccC by,
- FIG. 3D shows securing of positive clones of tccC (PtC 28) by Subpooling PCR method, respectively.
- Figure 4 shows the analysis of recombinant cosmid plasmid by restriction enzyme digestion.
- Figure 5 shows the configuration of ORFs in cosmid plasmids pS49 (A) and pS28 (B) (A: red, B: yellow C: green)
- Figure 6 shows the results of the insecticidal test for honeybees moth larvae of the positive cosmid clone.
- FIG. 7A shows A) TccA, B) TccB, C) TccC, FIG. 7B shows D) TcaC, E) TcdA1-like, and FIG. 7C shows F) TcdB2 and G) TccC3, respectively.
- Figure 10 shows the appearance of the insecticidal toxin protein in the honeybee moth larva (A) and brown mealworm larva (B). (Top: before treatment, bottom: after treatment)
- insecticidal proteins having the amino acid sequences represented by SEQ ID NO: 1 and SEQ ID NO: 3 are provided, and also nucleotide sequences encoding these amino acids are provided.
- the insecticidal protein may be characterized in that it is isolated from Photolabdus temperata M1021 (Accession Number: KCTC 12006BP).
- the protein according to the present invention is an insecticidal protein consisting of the amino acid sequence of SEQ ID NO: 1.
- the base sequence of SEQ ID NO: 2 may be used to encode the amino acid of SEQ ID NO: 1, but is not limited thereto.
- the present invention also relates to an insecticidal protein consisting of the amino acid sequence of SEQ ID NO.
- the base sequence of SEQ ID NO: 4 may be used to encode the amino acid of SEQ ID NO: 3, but is not limited thereto.
- a recombinant vector for intracellular delivery comprising a novel insecticidal protein gene.
- Recombinant refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid.
- Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form.
- Recombinant cells can also express genes found in natural cells, but the genes have been modified and reintroduced into cells by artificial means.
- the gene may be introduced into a variety of vectors, including plasmid vector, bacteriophage vector, cosmid vector, YAC (Yeast Artificial Chromosome) vector.
- plasmid vector bacteriophage vector
- cosmid vector cosmid vector
- YAC yeast Artificial Chromosome
- Vectors used in the art for expression of a target gene in a microorganism may be used without limitation.
- promoter refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.
- the present invention also provides a transformant expressing a pesticidal protein transformed with a recombinant vector comprising a TccB or TccC3 gene of the present invention.
- Preferred host cells for transformation into suitable host cells are prokaryotic cells. Suitable prokaryotic host cells are E. coli strain DH5a, E. coli strain JM101, E. coli K12 strain 294, E. coli strain W3110, E. coli strain X1776, E. coli XL-1Blue (Stratagene) and E. coli B And the like. However, E. coli strains such as FMB101, NM522, NM538 and NM539 and other prokaryotic species and genera may also be used.
- Agrobacterium sp in addition to E. coli, which is a preferred embodiment on the present specification, Agrobacterium sp. Strains such as Agrobacterium A4. Other enterobacteria such as bacilli such as Bacillus subtilis, Salmonella typhimurium or Serratia marcescens and various strains of Pseudomonas as host cells It can be used without limitation.
- the method for inserting the gene on the chromosome of the host cell in the present invention can be used a commonly known genetic engineering method, for example retrovirus vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector , Poxvirus vectors, lentiviral vectors or non-viral vectors.
- retrovirus vector for example retrovirus vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector , Poxvirus vectors, lentiviral vectors or non-viral vectors.
- Nucleic acids are "operably linked” when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to allow gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s).
- the DNA for a pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide;
- a promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence;
- the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence;
- the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation.
- "operably linked” means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame.
- enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.
- the term “expression vector” generally refers to a fragment of DNA that is generally double stranded as a recombinant carrier into which fragments of heterologous DNA have been inserted.
- heterologous DNA refers to heterologous DNA, which is DNA not naturally found in host cells.
- the expression vector can replicate independently of the host chromosomal DNA once it is in the host cell and produce several copies of the vector and the inserted (heterologous) DNA thereof.
- pET21a (+) vector but is not limited thereto.
- the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host.
- the expression control sequence and the gene of interest are included in one expression vector including the bacterial selection marker and the replication origin. If the host cell is a eukaryotic cell, the expression vector must further comprise an expression marker useful in the eukaryotic expression host.
- Host cells transformed or transfected with the above-described expression vectors constitute another aspect of the present invention.
- transformation means introducing DNA into a host so that the DNA is replicable as an extrachromosomal factor or by chromosomal integration.
- the present invention also provides a pest control composition comprising the novel pesticidal protein provided by the present invention.
- pests that can be controlled with the compositions of the present invention may preferably be butterfly neck pests or coleopteran pests, but are not limited thereto and may be used in all applicable general pests.
- Lepidoptera pests of the present invention is a beetle moth (Galleria mellonella), Chinese cabbage moth (Plutella xylostella), tobacco moth (Spodoptera litura), moth Antler (Alcis angulifera), mother-of-law leaf moth (Adoxophyes orana), persimmon tree Leafy Moth (Ptycholoma lecheana), Chestnut Leafy Moth (Cydia Kurokoi), Peach Nettle Moth (Grapholita molesta), Silver Moth (Lyonetia prunifoliella), Peach Core Moth (Carposina sasakii), Parrot Moth (Spodoptera exigua) Selected from the group consisting of Diaphania indica, Cnaphalocrocis medinalis, Chilo suppressalis, and Helicoverpa armigera, the coleopteran pest is Tenebrio molitor Linnaeus, Alder Leaf
- ester compounds for example, ester compounds, saturated hydrocarbons and esters and other pesticidal active ingredients, acaricide active ingredients, repulsive active ingredients, synergists, Flavors and the like can be prepared by mixing and dissolving at room temperature or under heating.
- the composition of the invention may be applied on its own or in the form of a pest control formulation comprising the composition of the invention, for example oils, emulsions, water Dispersible powders, flowable agents (aqueous suspensions, aqueous emulsions, etc.), powders, granules, aerosols, heated vaporizers (insecticide coils, electric insecticide mattes, liquid-absorbing shafts) heated insecticide-vaporizers with shafts), heated fumigants (self-burning fumigants, chemical-reactive fumigants, porous-ceramic fumigants, etc.), unheated vaporizers (resin vaporizers, impregnated paper vapors) And the like), sprays (fogging, etc.), ULV agents, and poisonous bait.
- oils, emulsions, water Dispersible powders, flowable agents aqueous suspensions, aqueous emulsions, etc.
- powders granules,
- the pest control method using the pest control composition of the present invention is carried out by applying the composition of the present invention or a formulation thereof to a pest or a place where the pests live.
- the method of applying the composition of the present invention or the formulation thereof may be appropriately selected and applied according to the shape, location of use, etc. of the composition of the present invention or formulation thereof.
- the chromosomal DNA of P. temperata M1021 for genomic library was isolated according to Wilson's method (Short Protocols in Molecular Biology, Unit 2.4). The total DNA isolated was partially digested with Sau3AI (Fermentas, USA), and then the size fraction of DNA fragments was averaged 35-45 kb by ultracentrifugation using a sucrose gradient, followed by cosmid vector SuperCos 1 cut with BamHI and XbaI. Ligation to (Stratagene, Germany). This was packaged using Epicentre's MaxPlax lambda Packaging Extracts (EPICENTRE, USA) and then infected with XL1-Blue MRF 'to prepare a cosmid library of M1021 strain. Clones of the prepared cosmid library were added to LB medium and glycerol (25% final concentration) and then 200 ⁇ l of each was stored in the deep freezer (-70 °C).
- PCR was performed under the same conditions as described above to obtain cosmid clones containing tcc, tcd, and tca from the cosmid library of the Photolaptus temperata M1021 strain (see FIG. 1), and PCR was performed stepwise through pooling and subpooling processes. Was carried out.
- Plasmids for the four cosmid clones (PtC 49, PtC 64, PtC 267, PtC 28) obtained by the PCR screening method were obtained using the alkaline lysis method (Birnboim and Doly, 1979) and inserted into each plasmid. Sequencing was performed using T3 and T7 primers in SuperCos1 to identify both ends of the prepared DNA (Gennote, Daejeon, Korea). In addition, each plasmid was analyzed by restriction enzyme patterns using restriction enzymes such as Not I, Bam HI, Hind III, EcoR I, Kpn I, and Pst I.
- Insecticidal test of the four cosmid clones obtained from the above was used beetle moth larvae (4-5 years old), each cosmid clone was incubated for 16 hours in 5 ml LB medium, followed by centrifugation ( 12,000rpm, 5min) to recover only the cell pellet was suspended in sterile saline solution and injected into the larval cavity of the larval body by using microsyringe 3 ⁇ l each.
- sterile saline solution As a control, the same amount of sterile LB broth and 0.85% NaCl solution was injected and stored in a 25 ° C. incubator, respectively.
- PET21a (+) was used as the expression vector of the toxin protein, and the primers (genotech, Daejeon, Korea) prepared for cloning each toxin gene are shown in Table 2. As shown in Table 2, the primer (C-ter 6His-tag / TEV primer) attached to the TEV sequence and the 6His tag sequence excluding the stop codon at the C-terminus and the C-terminus was finally attached for the purification of the toxin protein. Sal I or Hind III cassettes were prepared and used for restriction enzymes. PCR reaction was carried out as shown in Figure 1, the cloning process is as follows.
- PCR was performed using Pfu- X polymerase (Solgent, Daejeon, Korea) with each C primer which linked the TEV sequence to each N primer including start codon and C-terminal part except stop codon.
- PCR was performed using the C-ter 6His-tag / TEV primer and cassette primer in order to insert 6His tag, unique restriction enzyme and stop codon.
- the polymerase was Pfu- X polymerase (Solgent, Daejeon, Korea) .
- the annealing temperature was 50-60 °C and the extension time was 1kb / min. The reaction cycle of conditions was repeated 30 times.
- the reaction product was confirmed by 0.8% agarose gel (w / v) and the PCR product was purified using a PCR purification kit (solgent, Daejeon, Korea).
- PCR purification kit kit, Daejeon, Korea.
- Each purified PCR product and pET21a (+) were digested with specific restriction enzymes attached to the ends of the PCR product, linked with T4 DNA ligase (Fermentas, Canada), and transformed with Escherichia coli DH5 ⁇ . Plasmids were obtained.
- the obtained recombinant plasmid was confirmed by sequencing (T3 and T7 primers).
- the recombinant plasmids obtained above were transformed into E. coli BL21 (DE3), respectively, for the expression of toxin proteins.
- the transformed Escherichia coli was grown overnight in 3 ml LB broth (Ap r , 100 ⁇ g / ml) and inoculated 1% in 100 ml LB broth to raise the OD 600 value to 0.8 at 37 °C shake incubator (220rpm), followed by IPTG (Isopropyl ⁇ -D-1-thiogalactopyranoside) was added to the final 1 mM and then recovered over time to observe the expression level.
- E. coli BL21 (DE3) / pET21a (+) was used as a control.
- the expression of the recombinant protein was confirmed by SDS-PAGE.
- the supernatant was removed by centrifugation of the culture solution collected over time, and then suspended in a cell pellet with 1 ⁇ Laemmli loading dye, and the cells were disrupted by heating at 99 ° C. for 5 minutes. .
- the cell lysate was centrifuged (12,000 rpm, 10 min, 4 ° C.) to confirm the expression of the recombinant protein using the supernatant SDS-PAGE.
- IPTG concentration is 0.1mM, 0.5mM, 1mM
- the culture temperature is 15 °C, 25 °C, 37 °C
- the medium was tested using LB, 2 ⁇ YT, TB (Terrific broth), SB (Super broth), M9 Minimal medium (Table 3).
- Toxicity test for honeybee moth larvae was performed by centrifuging 2 ml of the culture medium at the time of maximum expression of the recombinant protein to remove the supernatant, washing the cell pellet twice with sterile 0.85% NaCl solution, and then 10 times the culture medium. Suspension was used to concentration.
- Cell suspensions were injected into the blood cavity of bee-lipped moth larvae using microsyringe (Hamilton, USA) at 10 ⁇ l each. The injected larvae were kept in a constant temperature room (25 ° C, 50% humidity) and observed for 24 hours.
- in order to check the cell concentration in the cell suspension was plated on LB agar plate containing empicillin and incubated in an incubator (37 °C). As a control, a sterilized 0.85% NaCl solution and E. coli BL21 (DE3) / pET21a (+) were treated in the same manner as the above method.
- a genomic cosmid library of the Photolaptose temperata M1021 strain was prepared to obtain 7.14 ⁇ 105 cosmid clones.
- the genome size of the Photolobus temperata M1021 strain belonging to the same family is expected to be between 5 and 6 Mb.
- the ideal number of clones required to contain 99.99% of the total genome is ( N) Substituting into the equation of FIG. 2, it appears as 1.28 ⁇ 10 3 clones. Therefore, the number of 7.14 ⁇ 10 5 cosmid clones obtained in this experiment was found to contain more than 99.99% of the entire genome of the Photolabtus temperata M1021 strain. Plasmids of some cosmid clones were isolated from the cosmid library and digested with restriction enzymes. As a result, the size of the inserted DNA fragment was about 35-45 kb and the restriction enzymes showed different patterns.
- PCR products were obtained using the tcc, Tcd and Tca pair primers of Table 1 on the genomic DNA of Photolabtus temperata M1021. Each PCR product was obtained through sequence analysis. It appears to be a loyal toxin complex protein.
- Table 4 Prime sets PCR amplicon (kb) % nucleotide homology Compared strain (protein) tcc F1 / tcc R1 0.84 87 P. luminescens strain TT01 (TccC) TcdF2 / TcdR2 0.77 84 P. luminescens strain TT01 (TcdF2) TcaC F3 / TcaC R3 1.64 82/83 P. luminescens TT01 P. asymbiotica ATCC43949 (TcaC)
- the configuration of the ORFs in pS49 and pS28 is shown in FIG. 5, the homology to each of the ORF and the expected genes and functions are shown in Table 5.
- Table 5 Comparing the composition of ORFs in pS49 with the previously reported strains of P. luminescens W14 and TT01 and the tcd islands of P. asymbiotica ATCC43949, the tcdA2, tcdB2 and tccC3 genes were transcribed in the same direction and also between tcdB2 and tccC3.
- tchA which encodes a phage holin protein, was also present.
- tcdA-like, tcdB-like, or tccC-like genes were identified in the sequence in pS49. Only the “core” region of the tcd locus (tcdA1-like, tcdA2, tcdB2 and tccC3) was identified. However, the tcdA1-like gene was found to be considerably smaller in size than the previously reported tcdA-like gene, and the gene encoding the hemolysins-related protein in the upstream direction of the tcdA1-like gene, ie, the insertion end of pS49. Appeared to contain some.
- composition of the tcd island of photolaptus temperata M1021 is similar to that of P. asymbiotica ATCC43949, which has fewer or one copies of the toxin gene than that of P. luminescens TT01, which has more copies of the toxin gene.
- Multidrug transporter proteins and polyphosphatase proteins have been identified. Amino acid homology with previously reported pesticidal proteins was 66% for TcdA2, 81% for TcdB2, and 57% for TccC3 (Table 5), which was significantly different from that of P. luminescens and P. asymbiotica. The difference was shown.
- the A component is tcdA2
- the B component is tcdB2
- the C component is tccC3, which has all three components (see FIG. 7).
- Type VI secretion system is a type 6 secretion system that causes pathogenicity of microorganisms belonging to Proteobacteria.
- T6SS is known to be composed of several proteins such as Hcp and VgrG. This type of secretion system is known to be highly related to toxin proteins of pathogenic microorganisms and a variety of virulence factors, and this type of secretion system was also found in the tcc locus of the Photolobus temperata M1021 strain (FIG. 5). ). Amino acid homology with the pesticidal protein was 89% for TccA, 90% for TccB and TccC, and it was found to have an A component, tccB (Table 5).
- Organism pS49 One insecticidal toxin, TcdA like 73 P. asymbiotica ATCC43949 2 insecticidal toxin, TcdA2 66 P. luminescens TT01 3 insecticidal toxin, TcdB2 81 P. luminescens TT01 4 insecticidal toxin, TccC3 70 P. luminescens TT01 5 peptide synthetase 87 P. luminescens TT01 6 thiothemplate mechanism natural product synthetase 58 Erwinia amylovora ATCC BAA-2158 7 polyketide synthase type I 46 E.
- amylovora ATCC49946 8 gramicidin S synthetase 2 45 E. amylovora ATCC BAA-2158 9 polyketide synthase 38 E. amylovora ATCC BAA-2158 10 peptide synthetase 86 P. luminescens TT01 11 hypothetical protein 87 P. luminescens TT01 12 5'-nucleotidase family protein 86 P. asymbiotica ATCC43949 pS28 One insecticidal toxin, TccA 89 P. luminescens TT01 2 insecticidal toxin, TccB 90 P. luminescens TT01 3 insecticidal toxin, TccC 90 P. luminescens TT01
- the insecticidal investigation result of the positive cosmid clone obtained above is as follows (FIG. 6).
- PtC28 clone had the highest insecticidal effect and was 100% killed at 7 days after injection.
- PtC49 showed 50% insecticidal at 6 days after injection, while PtC 64 and 267 clones reached 50% at 7 days after injection.
- the larval beetle larvae injected with XL-1 Blue MRF 'containing only sterile saline (0.85% NaCl) and the cosmid vector SuperCos1 showed no change in appearance.
- TccC3 57.5% TcdB2 showed a 35% insecticide (Fig. 9).
- honeybee moth larvae injected with sterile 0.85% NaCl or E. coli BL21 (DE3) / pET21a (+) 90% of the larvae develop into pupae after 7 days of injection. The steps were shown to proceed.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Pest Control & Pesticides (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Environmental Sciences (AREA)
- Agronomy & Crop Science (AREA)
- Microbiology (AREA)
- Dentistry (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention relates to a novel insecticidal protein, which is characterized by a separation from Photorhabdus temperata M1021 (accession number: KCTC 12006BP). Also, the present invention relates to a composition for controlling pests including the novel insecticidal protein, and to a method for controlling pests using same.
Description
본 발명은 신규한 균주인 포투랍두스 템페라타 M1021(수탁번호: KCTC 12006BP)로부터 분리한 신규의 살충성 단백질, 신규의 살충성 단백질 유전자를 포함하는 재조합 발현 벡터, 발현 벡터를 포함하는 신규의 살충성 단백질 제조 형질 전환체에 관한 것이다. The present invention provides a novel insecticidal protein, a recombinant expression vector comprising a novel insecticidal protein gene, a novel insecticide comprising a novel insecticidal protein gene isolated from a novel strain of Poturaddus temperata M1021 (Accession Number: KCTC 12006BP). It relates to a loyal protein production transformant.
또한 본 발명은 상기 신규의 살충성 단백질을 포함하는 해충 방제용 조성물에 관한 것이다. The present invention also relates to a pest control composition comprising the novel pesticidal protein.
또한 본 발명은 상기 해충 방제용 조성물을 이용하여 해충을 방제하는 방법에 관한 것이다. The present invention also relates to a method for controlling pests using the composition for controlling pests.
곤충 및 다른 해충들은 농작물 손실과 이러한 해충들을 방제(control)하는 비용에 있어서 농부에게 해마다 수천만 달러의 비용을 부담시킨다. 농작물 생산 환경에서 해충에 의하여 야기되는 손실은 농작물 수율의 감소, 농작물 질의 저하, 및 추수 비용 증가를 포함한다.Insects and other pests cost farmers tens of millions of dollars each year in crop losses and the cost of controlling these pests. Losses caused by pests in the crop production environment include reduced crop yields, lower crop quality, and increased harvest costs.
원하는 수준의 방제를 보장하기 위하여 화학적인 살충제에 가장 많이 의존하고 있다. 이러한 살충제는 토양 위에 결합되거나 또는 토양 속으로 삽입되나 살충제의 지속적인 사용은 내성 곤충이 진화하는 것을 허용하여 왔다. 매우 많은 개체수의 유충, 폭우, 및 살충제 적용 장비의 부적절한 측정과 같은 상황들이 만족스럽지 못한 통제를 초래할 수 있다. 또한, 살충제의 사용은 종종 토양과 표면 및 지하 수원의 오염과 같은 환경적인 관심사를 야기한다. It relies heavily on chemical pesticides to ensure the desired level of control. These pesticides are bound onto or inserted into the soil, but the continued use of pesticides has allowed the resistant insects to evolve. Situations such as very large numbers of larvae, heavy rains, and improper measurements of pesticide application equipment can lead to unsatisfactory control. In addition, the use of pesticides often raises environmental concerns such as contamination of soils and surfaces and underground water sources.
대중은 또한 음식에서 발견될 수 있는 합성 화학약품의 잔류량에 관심을 가져 왔다. 살충제를 가지고 작업하는 일은 또한 그것을 사용하는 사람에게 해를 끼친다. 따라서, 합성 화학약품은 그들의 잠재적인 유독성 환경 결과들에 대하여 점점 더 면밀히 검사되고 있다. 광범위하게 사용되는 합성 화학 살충제의 예에는 유기염화물, 예를 들면 DDT, 미렉스(mirex), 케폰(kepone), 린단(lindane), 알드린(aldrin), 클로르단 (chlordane), 알디카브(aldicarb), 및 디엘드린(dieldrin); 유기인산물, 예를 들면, 클로르피리포스 (chlorpyripos), 파라치온(parathion), 말라치온(malathion), 및 다이아지논(diazinon); 및 카바메이츠(carbamates)가 포함된다. The public has also been interested in the residual amounts of synthetic chemicals that can be found in food. Working with pesticides also harms those who use it. Thus, synthetic chemicals are increasingly being examined for their potential toxic environmental consequences. Examples of synthetic chemical pesticides that are widely used include organic chlorides such as DDT, mirex, kepone, lindane, aldrin, chlordane and aldicarb. ), And dieldrin; Organophosphates such as chlorpyripos, parathion, malathion, and diazinon; And carbamates.
현재 화학적 살충제에 대한 유해성에 대한 우려가 점점 높아지고 있다. 예를 들어 1957년부터 DDT의 유해성에 대한 의문이 제기되기 시작하였고, DDT의 반감기는 2년에서 15년으로 잘 분해되지 않으며 체내의 지방 성분에 주로 쌓이고, 땅이나 물에 남아 있던 DDT는 식물에 흡수된 후 인간이 이를 음식을 통해 섭취할 경우에는 암이 유발될 수 있다는 연구결과가 나오면서 1970년대부터 현재까지 대부분의 국가에서 DDT를 농약으로 사용하는 것을 금지하였다. There is a growing concern about the dangers of chemical pesticides. For example, questions about the dangers of DDT began to arise in 1957, and the half-life of DDT did not decompose well between two and fifteen years, and mainly accumulated in fatty components of the body. Research has shown that humans can induce cancer after they are absorbed after they are absorbed, prohibiting the use of DDT as a pesticide in most countries from the 1970s to the present.
또한 염소 또는 벤젠을 원료로 하는 BHC의 경우, 원료가 풍부하고 값이 저렴하고 살충력이 강하며, 인축에는 해가 적기 때문에 미국에서 개발 및 합성을 주도하여 전세계적인 관심을 끌었으나, 사용량의 증가와 함께 최근 환경 오염 문제가 대두되면서 서양 각국과 오스트레일리아 등 여러 나라에서는 엄격하게 상기 농약 사용을 제한하고 있다.In addition, BHC, which is made of chlorine or benzene, has attracted worldwide attention by leading development and synthesis in the United States because of its abundant raw materials, low cost, and strong insecticide, and less harmful to human beings. In addition, due to the recent environmental pollution problem, various countries such as Western countries and Australia are strictly restricting the use of the pesticides.
이와 같이 그 동안 해충을 방제하기 위하여 유기 화학적 합성 살충제가 널리 사용되고 있으나, 수십 년에 걸친 남용으로 인하여 해충군의 이상격발 또는 저항성 해충의 출현, 인간을 비롯한 비 목적 충에 대한 독성발현 및 환경 계의 오염 등의 많은 부작용을 야기하고 있다. 전 세계적으로 농약의 잔류 독성과 환경오염으로 인하여 여러 가지 문제점이 나타나자 인류의 건강을 지키기 위하여 우선 독성이 강한 유기합성 농약의 사용을 자제하기로 국제적인 합의가 도출되기도 하였다. 이러한 국제 협약에 의하여 전 세계는 2004년에 지난 10년 전에 사용하던 화학합성 유기인계, 유기염소계 살충제의 50%까지 생산이 감축되었고, 2010년까지 다시 유기인계, 유기염소계 살충제의 생산을 50% 감소시키기로 한 국제적 협의에 동의하여 현재 실행 단계에 있다. As such, organic chemical synthetic insecticides have been widely used to control pests, but over the decades of abuse, pest outbreaks or emergence of resistant pests, toxic expression of non-target insects including humans, and environmental systems It causes many side effects such as pollution. As a result of various problems caused by pesticide residue toxicity and environmental pollution around the world, an international agreement was reached to refrain from using highly toxic organic synthetic pesticides in order to protect human health. Under these international agreements, the world reduced production by 50% of the chemical synthetic organophosphorus and chlorine pesticides used in the past 10 years in 2004, and again reduced production of organophosphorus and organochlorine insecticides by 50% by 2010. It is in the phase of implementation, agreeing to international agreements to be made.
그러나 독성농약 감축생산 협의 이후, 현재 전 세계적으로 많은 연구진이 환경 친화적 살충제를 개발하려고 많은 노력을 했음에도 불구하고, 이제까지 사용하였던 유기인계, 유기염소계 농약을 대체할 새롭고 안전한 살충제를 개발하지 못하였기 때문에 전 세계적인 농약감축회의 의결내용이 지켜지기 어려운 상황이며, 조만간 안전한 살충제가 개발되어 생산되지 않으면 해충방제용 살충제뿐만 아니라 식량을 비롯한 농산물 생산에 관련된 농업용 살충제의 부족으로 인해 국내외적으로 큰 문제가 대두될 것으로 예상된다. However, after the consultation on the reduction and production of toxic pesticides, many researchers around the world have tried to develop environmentally friendly pesticides, but have not been able to develop new and safe insecticides to replace the organophosphorus and organochlorine pesticides that have been used. The resolution of the World Pesticide Reduction Conference is difficult to keep. If a safe insecticide is not developed and produced soon, there will be a big problem at home and abroad due to the lack of pesticides for pest control as well as agricultural pesticides related to food and agricultural production. It is expected.
최근에는 화학비료나 농약의 사용을 줄이거나 대체할 수 있으며, 인축에 위해가 적고 작물에 피해를 일으키지 않으며, 토양 생태계와 같은 환경에 대한 피해가 적은 생물학적 방제의 기술이 미생물에 의해 가능하다는 것이 국내외 여러 연구자들에 의해 입증됨에 따라, 화학농약의 폐단을 보완할 수 있는 생물 농약에 대한 관심과 연구가 증가하고 있는 추세이다. In recent years, microorganisms have been able to reduce or replace the use of chemical fertilizers or pesticides, microorganisms capable of biological control techniques that are less harmful to livestock, do not harm crops, and have less damage to the environment, such as soil ecosystems. As evidenced by several researchers, there is a growing interest and interest in biological pesticides that can complement the chemical pesticides.
이에 따라 최근 사용이 증가 중인 생물학적인 살충제는 토양 미생물인 바실러스 슈린지엔시스(Bacillus thuringiensis, "B.t.")이다. 어떤 바실러스 독소 유전자는 분리되어 서열이 밝혀졌으며, 재조합 DNA에 기초한 산물이 생산되고 사용이 승인되어 왔다. 게다가, 유전공학 기술의 사용과 함께 이러한 독소를 농경 환경에 전달하기 위한 새로운 접근 방법이 개발 중에 있다. 이들은 곤충에 내성을 가지는 독소 유전자에 의해 유전적으로 조작된 식물의 사용 및 독소 전달 수단으로서 안정화된 완전한 미생물 세포의 사용을 포함한다. 이와 같이, 분리된 바실러스 독소 유전자는 상업적으로 가치가 커지고 있다. Accordingly, biological pesticides that are increasing in use recently are soil microorganisms Bacillus thuringiensis ("B.t."). Some Bacillus toxin genes have been isolated and sequenced, and products based on recombinant DNA have been produced and approved for use. In addition, new approaches are being developed to deliver these toxins to the agricultural environment with the use of genetic engineering techniques. These include the use of plants genetically engineered by toxin genes resistant to insects and the use of stabilized complete microbial cells as a means of toxin delivery. As such, isolated Bacillus toxin genes are of increasing commercial value.
그러나 성공적인 바실러스 독소의 사용은 곤충에 의한 B.t. 독소에 대한 내성을 유발하게 되었다. 어떤 곤충은 바실러스 독소의 효과가 잘 듣지 않으며, 이러한 곤충의 예에는 바구미 또는 검은색 뿌리 잘라먹는 벌레(black cutworm)와 같은 곤충뿐만 아니라, 이제까지 B.t. δ-엔도톡신에 대해 뚜렷한 주목할 만한 감수성을 보이지 않아 온 대부분 종의 성충이 포함된다. 따라서, B.t. 트랜스유전자 식물 공학에 있어서 내성 관리 방법이 큰 관심의 대상이 되어왔음에도 불구하고, 다양한 곤충을 효과적으로 방제하기 위해서 식물에서 발현될 수 있는 추가적인 유전자를 개발할 필요가 남아있다.However, the successful use of Bacillus toxin has been attributed to insect B.t. It caused resistance to toxins. Some insects are less likely to benefit from Bacillus toxins, and examples of such insects include, but are not limited to, insects such as weevils or black cutworms. Adults of most species have been shown that have not shown markedly noticeable sensitivity to δ-endotoxin. Thus, B.t. Although resistance management methods have been of great interest in transgenic plant engineering, there remains a need to develop additional genes that can be expressed in plants in order to effectively control various insects.
이에, 본 발명자들은 농작물에 대한 해충 방제를 할 수 있는 신규의 살충성 단백질 을 이용한 새로운 생물 농약의 개발을 목표로 신규한 미생물로부터 해충 방제용으로 사용 가능한 유전자의 탐색을 위하여 노력한 결과 신규한 살충성 단백질을 발견하고 본 발명을 완성하였다. Accordingly, the present inventors have made efforts to search for genes that can be used for pest control from new microorganisms with the aim of developing new biological pesticides using novel insecticidal proteins that can control pests on crops. The protein was discovered and the present invention was completed.
본 발명의 목적은 신규한 생물학적인 살충제로 가치가 인정되는 살충성 단백질 및 이를 암호화하는 유전자, 유전자를 포함하는 발현 벡터, 신규한 살충성 단백질을 제조하는 형질 전환체를 제공하는데 있다. It is an object of the present invention to provide a pesticidal protein and a gene encoding the same, an expression vector containing the gene, a transformant for producing a novel insecticidal protein which is recognized as a novel biological insecticide.
본 발명의 또 다른 목적은 신규한 살충성 단백질을 포함하는 해충 방제용 조성물을 제공하고 이를 이용한 새로운 생물학적 해충 방제방법을 제공하는 데에 있다. Another object of the present invention to provide a pest control composition comprising a novel pesticidal protein and to provide a new biological pest control method using the same.
상기 과제를 해결하기 위해 본 발명은 서열번호 1 또는 3의 아미노산 서열을 갖는 것을 특징으로 하는 살충성 단백질을 제공한다. In order to solve the above problems, the present invention provides an insecticidal protein having an amino acid sequence of SEQ ID NO: 1 or 3.
또한 본 서열번호1또는 3의 아미노산 서열을 코딩 하는 것을 특징으로 하는 살충성 단백질 유전자를 제공한다. Also provided is an insecticidal protein gene, characterized by encoding the amino acid sequence of SEQ ID NO: 1 or 3.
또한 본 발명은 신규한 살충성 단백질 유전자를 포함하는 재조합 발현벡터 및 이를 포함하는 살충성 단백질 제조 형질 전환체를 제공한다. In another aspect, the present invention provides a recombinant expression vector comprising a novel insecticidal protein gene and a transformant manufacturing a pesticidal protein comprising the same.
본 발명의 또 다른 양태로써, 본 발명은 신규한 살충성 단백질을 포함하는 해충 방제용 조성물을 제공한다. As another aspect of the present invention, the present invention provides a pest control composition comprising the novel pesticidal protein.
또한, 본 발명은 신규한 살충성 단백질을 포함하는 해충 방제용 조성물을 이용한 해충 방제 방법을 제공한다. In addition, the present invention provides a pest control method using a pest control composition comprising a novel pesticidal protein.
본 발명에 따르면, 신규의 살충성 포토랍두스 템페라타 M1021(Photorhabdus temperate M1021, KCTC 12006BP) 유래의 신규한 살충성 단백질을 확보할 수 있으며 이를 이용하여 새로운 생물학적 살충제로써 유용하게 이용될 수 있다. According to the present invention, a novel insecticidal protein derived from a novel insecticidal photorhabdus temperata M1021 ( Photorhabdus temperate M1021, KCTC 12006BP) can be obtained and can be usefully used as a new biological insecticide.
도1은 PCR 조건표를 도시한다. (*Annealing temperature(AT): Tcc F1/R1; 50℃, TcdF2/R2; 54℃, TcaC F3/R3; 54℃)1 shows a PCR condition table. (* Annealing temperature (AT): Tcc F1 / R1; 50 ° C, TcdF2 / R2; 54 ° C, TcaC F3 / R3; 54 ° C)
도2는 이상적인 클론의 개수를 계산하기 위한 식을 도시한다.2 shows an equation for calculating the ideal number of clones.
도3은 Pooling 및 subpooling PCR을 이용한 tcd locus와 tcc locus에 대한 포짓티브 코스미드 클론을 도시한다. (M; size marker(λ/HindⅢ),*PtC; Photorhabdus temperata M1021's cosmid library)Figure 3 shows positive cosmid clones for tcd locus and tcc locus using pooling and subpooling PCR. (M; size marker (λ / HindIII), * PtC; Photorhabdus temperata M1021's cosmid library)
도3a는 Pooling PCR 방법에 의한 tcdB2의 포짓티브 클론을 가진 그룹의 스크리닝, 도3b는 Subpooling PCR 방법에 의한 tcdB2의 포짓티브 클론의 확보(PtC 49, 64, 267), 도3c는 Pooling PCR 방법에 의한 tccC의 포짓티브 클론을 가진 그룹의 스크리닝을, 도3d는 Subpooling PCR 방법에 의한 tccC의 positive clone의 확보(PtC 28)를 각각 도시한다. Figure 3a screens a group having a positive clone of tcdB2 by the pooling PCR method, Figure 3b secures a positive clone of tcdB2 by the subpooling PCR method ( PtC 49, 64, 267), Figure 3c shows a pooling PCR method. Screening of groups with positive clones of tccC by, FIG. 3D shows securing of positive clones of tccC (PtC 28) by Subpooling PCR method, respectively.
도4는 제한효소 절단에 의한 재조합 코스미드 플라스미드의 분석 결과를 도시한다. Figure 4 shows the analysis of recombinant cosmid plasmid by restriction enzyme digestion.
도5는 코스미드 플라스미드 pS49(A)와 pS28(B)에서의 ORF의 구성을 도시한다(A: 적색, B: 황색 C: 녹색)Figure 5 shows the configuration of ORFs in cosmid plasmids pS49 (A) and pS28 (B) (A: red, B: yellow C: green)
도6은 포짓티브 코스미드 클론의 꿀벌부채명나방 유충에 대한 살충력 시험 결과를 나타낸다. Figure 6 shows the results of the insecticidal test for honeybees moth larvae of the positive cosmid clone.
도7은 재조합 독소 단백질의 SDS-PAGE 분석 결과를 나타낸다. (M: 분자 단백질 표준, 화살표는 재조합 독소 단백질의 위치를 나타낸다, 6% SDS-PAGE 겔은 Coomassie brilliant blue를 나타낸다.)7 shows the result of SDS-PAGE analysis of recombinant toxin protein. (M: Molecular protein standard, arrow indicates position of recombinant toxin protein, 6% SDS-PAGE gel indicates Coomassie brilliant blue.)
도7a는 A)TccA, B)TccB, C)TccC, 도7b는 D)TcaC, E)TcdA1-like, 도7c는 F)TcdB2, G)TccC3 을 각각 도시한다.FIG. 7A shows A) TccA, B) TccB, C) TccC, FIG. 7B shows D) TcaC, E) TcdA1-like, and FIG. 7C shows F) TcdB2 and G) TccC3, respectively.
도8은 꿀벌부채명 나방 유충에 대한 살충력 결과를 도시한다.8 shows insecticidal results for honeybee moth larvae.
도9는 갈색 거저리 유충에 대한 살충력 결과를 도시한다.9 shows insecticidal results for brown larva larvae.
도10은 꿀벌부채명 나방 유충(A)과 갈색 거저리 유충(B)에 살충성 독소 단백질을 처리시의 모습을 나타낸다. (상단: 처리전, 하단:처리후)Figure 10 shows the appearance of the insecticidal toxin protein in the honeybee moth larva (A) and brown mealworm larva (B). (Top: before treatment, bottom: after treatment)
본 발명에 따르면 서열번호 1 및 서열번호3으로 표시되는 아미노산 서열을 갖는 살충성 단백질이 제공되며 또한 이들 아미노산을 코딩하는 뉴클레오티드 서열이 제공된다. According to the present invention, insecticidal proteins having the amino acid sequences represented by SEQ ID NO: 1 and SEQ ID NO: 3 are provided, and also nucleotide sequences encoding these amino acids are provided.
본 발명에 있어서, 상기 살충성 단백질은 포토랍두스 템페라타 M1021(수탁번호: KCTC 12006BP)로부터 분리한 것을 특징으로 할 수 있다. In the present invention, the insecticidal protein may be characterized in that it is isolated from Photolabdus temperata M1021 (Accession Number: KCTC 12006BP).
또한 본 발명에 따른 상기 단백질은 서열번호1의 아미노산 서열로 이루어진 살충성 단백질이다. 바람직하게는 서열번호 1의 아미노산을 코딩하기 위하여 서열번호2의 염기서열을 사용할 수 있으나 이에 제한되는 것은 아니다. In addition, the protein according to the present invention is an insecticidal protein consisting of the amino acid sequence of SEQ ID NO: 1. Preferably, the base sequence of SEQ ID NO: 2 may be used to encode the amino acid of SEQ ID NO: 1, but is not limited thereto.
또한 본 발명은 서열번호3의 아미노산 서열로 이루어진 살충성 단백질에 관한 것이다. 바람직하게 서열번호3의 아미노산을 코딩하기 위하여 서열번호4의 염기서열을 사용가능하나 이에 제한되는 것은 아니다. The present invention also relates to an insecticidal protein consisting of the amino acid sequence of SEQ ID NO. Preferably, the base sequence of SEQ ID NO: 4 may be used to encode the amino acid of SEQ ID NO: 3, but is not limited thereto.
한편, 본 발명의 또 다른 양태로써 신규의 살충성 단백질 유전자를 포함하는 세포 내 전달을 위한 재조합 벡터를 제공할 수 있다. On the other hand, as another aspect of the present invention can provide a recombinant vector for intracellular delivery comprising a novel insecticidal protein gene.
용어 “재조합”은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 코딩된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로써 인위적인 수단에 의해 세포 내 재도입된 것이다.The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes have been modified and reintroduced into cells by artificial means.
본 발명에 있어서, 상기 유전자는 플라스미드 벡터, 박테리오파지 벡터, 코스미드 벡터, YAC(Yeast Artificial Chromosome) 벡터를 포함한 다양한 벡터들에 도입될 수 있다. 본 발명의 목적상, 플라스미드 벡터를 이용하는 게 바람직하나 이에 제한되지 않으며 미생물 내에서 목적 유전자의 발현을 위하여 당업계에서 사용되는 벡터를 제한됨 없이 사용할 수 있다.In the present invention, the gene may be introduced into a variety of vectors, including plasmid vector, bacteriophage vector, cosmid vector, YAC (Yeast Artificial Chromosome) vector. For the purposes of the present invention, it is preferable to use a plasmid vector, but is not limited thereto. Vectors used in the art for expression of a target gene in a microorganism may be used without limitation.
"프로모터"란 용어는 구조 유전자로부터의 DNA 업 스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.
본 발명은 또한, 본 발명의 TccB 또는 TccC3유전자를 포함하는 재조합 벡터로 형질 전환된 살충성 단백질을 발현하는 형질 전환체를 제공한다. 적절한 숙주 세포로 형질 전환을 위하여 선호되는 숙주 세포는 원핵 세포이다. 적합한 원핵 숙주세포는 E.coli균주 DH5a, E.coli균주 JM101, E.coli K12균주 294, E.coli균주 W3110, E.coli균주 X1776, E.coli XL-1Blue(Stratagene) 및 E.coli B 등을 포함한다. 그러나 FMB101, NM522, NM538 및 NM539와 같은 E. coli균주 및 다른 원핵생물의 종(speices) 및 속(genera)등이 또한 사용될 수 있다. 따라서 본 발명의 명세서 상의 바람직한 일 구현예인 E. coli에 덧붙여, 아그로박테리움 A4와 같은 아그로박테리움 속 균주. 바실루스 섭틸리스(Bacillus subtilis)와 같은 바실리(bacilli), 살모넬라 타이피뮤리움(Salmonella typhimurium) 또는 세라티아 마르게센스(Serratia marcescens)와 같은 또 다른 장내세균 및 다양한 슈도모나스(Pseudomonas) 속 균주가 숙주세포로서 제한 없이 이용될 수 있다. The present invention also provides a transformant expressing a pesticidal protein transformed with a recombinant vector comprising a TccB or TccC3 gene of the present invention. Preferred host cells for transformation into suitable host cells are prokaryotic cells. Suitable prokaryotic host cells are E. coli strain DH5a, E. coli strain JM101, E. coli K12 strain 294, E. coli strain W3110, E. coli strain X1776, E. coli XL-1Blue (Stratagene) and E. coli B And the like. However, E. coli strains such as FMB101, NM522, NM538 and NM539 and other prokaryotic species and genera may also be used. Thus, in addition to E. coli, which is a preferred embodiment on the present specification, Agrobacterium sp. Strains such as Agrobacterium A4. Other enterobacteria such as bacilli such as Bacillus subtilis, Salmonella typhimurium or Serratia marcescens and various strains of Pseudomonas as host cells It can be used without limitation.
본 발명에서 상기 유전자를 숙주세포의 염색체상에 삽입하는 방법으로는 통상적으로 알려진 유전자조작방법을 사용할 수 있으며, 일례로는 레트로바이러스 벡터, 아데노바이러스 벡터, 아데노-연관 바이러스 벡터, 헤르페스 심플렉스 바이러스 벡터, 폭스바이러스 벡터, 렌티바이러스 벡터 또는 비바이러스성 벡터를 이용하는 방법을 들 수 있다. As the method for inserting the gene on the chromosome of the host cell in the present invention can be used a commonly known genetic engineering method, for example retrovirus vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector , Poxvirus vectors, lentiviral vectors or non-viral vectors.
핵산은 다른 핵산 서열과 기능적 관계로 배치될 때 "작동 가능하게 연결 (operably linked)"된다. 이것은 적절한 분자 (예를 들면, 전사 활성화 단백질)은 조절 서열(들)에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 조절 서열(들)일 수 있다. 예를 들면, 전서열(pre-sequence) 또는 분비 리더 (leader)에 대한 DNA는 폴리펩타이드의 분비에 참여하는 전단백질로서 발현되는 경우 폴리펩타이드에 대한 DNA에 작동가능하게 연결되고; 프로모터 또는 인핸서는 서열의 전사에 영향을 끼치는 경우 코딩서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 서열의 전사에 영향을 끼치는 경우 코딩 서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 번역을 용이하게 하도록 배치되는 경우 코딩 서열에 작동가능하게 연결된다. 일반적으로, "작동가능하게 연결된"은 연결된 DNA 서열이 접촉하고, 또한 분비 리더의 경우 접촉하고 리딩 프레임 내에 존재하는 것을 의미한다. 그러나, 인핸서 (enhancer)는 접촉할 필요가 없다. 이들 서열의 연결은 편리한 제한 효소 부위에서 라이게이션(연결)에 의해 수행된다. 그러한 부위가 존재하지 않는 경우, 통상의 방법에 따른 합성 올리고뉴클레오티드 어댑터 (oligonucleotide adaptor) 또는 링커(linker)를 사용한다.Nucleic acids are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to allow gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s). For example, the DNA for a pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, "operably linked" means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.
본원 명세서에 사용된 용어 "발현 벡터"는 통상 이종의 DNA의 단편이 삽입된 재조합 캐리어 (recombinant carrier)로서 일반적으로 이중 가닥의 DNA의 단편을 의미한다. 여기서, 이종 DNA는 숙주 세포에서 천연적으로 발견되지 않는 DNA인 이형 DNA를 의미한다. 발현 벡터는 일단 숙주 세포 내에 있으면 숙주 염색체 DNA와 무관하게 복제할 수 있으며 벡터의 수 개의 카피 및 그의 삽입된 (이종) DNA가 생성될 수 있다. 본 발명의 바람직한 일 실시예로 pET21a(+) 벡터를 사용할 수 있으나 이에 제한되지 않는다.As used herein, the term “expression vector” generally refers to a fragment of DNA that is generally double stranded as a recombinant carrier into which fragments of heterologous DNA have been inserted. Here, heterologous DNA refers to heterologous DNA, which is DNA not naturally found in host cells. The expression vector can replicate independently of the host chromosomal DNA once it is in the host cell and produce several copies of the vector and the inserted (heterologous) DNA thereof. As a preferred embodiment of the present invention can be used pET21a (+) vector, but is not limited thereto.
당업계에 주지된 바와 같이, 숙주세포에서 형질감염 유전자의 발현 수준을 높이기 위해서는, 해당 유전자가, 선택된 발현 숙주 내에서 기능을 발휘하는 전사 및 해독 발현 조절 서열에 작동 가능하도록 연결되어야만 한다. 바람직하게는 발현 조절서열 및 해당 유전자는 세균 선택 마커 및 복제 개시점 (replication origin)을 같이 포함하고 있는 하나의 발현 벡터 내에 포함되게 된다. 숙주세포가 진핵 세포인 경우에는, 발현 벡터는 진핵 발현 숙주 내에서 유용한 발현 마커를 더 포함하여야만 한다.As is well known in the art, to raise the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host. Preferably, the expression control sequence and the gene of interest are included in one expression vector including the bacterial selection marker and the replication origin. If the host cell is a eukaryotic cell, the expression vector must further comprise an expression marker useful in the eukaryotic expression host.
상술한 발현 벡터에 의해 형질전환 또는 형질 감염된 숙주 세포는 본 발명의 또 다른 측면을 구성한다. 본원 명세서에 사용된 용어 "형질전환"은 DNA를 숙주로 도입하여 DNA가 염색체외 인자로서 또는 염색체 통합완성에 의해 복제 가능하게 되는 것을 의미한다.Host cells transformed or transfected with the above-described expression vectors constitute another aspect of the present invention. As used herein, the term “transformation” means introducing DNA into a host so that the DNA is replicable as an extrachromosomal factor or by chromosomal integration.
본 발명은 또한, 본 발명에서 제공하는 신규한 살충성 단백질을 포함하는 해충 방제용 조성물을 제공한다. 본 발명의 조성물로 방제될 수 있는 해충의 예에는 바람직하게는 나비 목 해충 또는 딱정벌레목 해충일 수 있으나 이에 제한되지 않고 적용 가능한 모든 일반적인 해충에 사용 가능하다. The present invention also provides a pest control composition comprising the novel pesticidal protein provided by the present invention. Examples of pests that can be controlled with the compositions of the present invention may preferably be butterfly neck pests or coleopteran pests, but are not limited thereto and may be used in all applicable general pests.
본 발명의 나비목 해충은 꿀벌부채명나방(Galleria mellonella), 배추좀나방(Plutella xylostella), 담배거세미나방(Spodoptera litura), 털뿔가지나방(Alcis angulifera), 애모무늬잎말이나방(Adoxophyes orana), 감나무잎말이나방(Ptycholoma lecheana), 밤애기잎말이나방(Cydia Kurokoi), 복숭아순나방(Grapholita molesta), 은무늬굴나방(Lyonetia prunifoliella), 복숭아심식나방(Carposina sasakii), 파밤나방(Spodoptera exigua), 목화바둑나방(Diaphania indica), 혹명나방(Cnaphalocrocis medinalis), 이화명나방(Chilo suppressalis), 및 왕담배나방(Helicoverpa armigera)으로 이루어진 군으로부터 선택가능하며, 딱정벌레목 해충은 갈색거저리(Tenebrio molitor Linnaeus), 오리나무잎벌레(Agelastica coerulea Baly), 사과둥근나무좀(Xyleborus apicalis Blandford ),서울나무좀(Scolytus seulensis ), 쌀 바구미(Scolytus seulensis ), 소나무좀Tomicus piniperda), 밤바구미(Culculio sikkimensis)로 이루어진 군으부터 선택된 해충일 수 있다. Lepidoptera pests of the present invention is a beetle moth (Galleria mellonella), Chinese cabbage moth (Plutella xylostella), tobacco moth (Spodoptera litura), moth Antler (Alcis angulifera), mother-of-law leaf moth (Adoxophyes orana), persimmon tree Leafy Moth (Ptycholoma lecheana), Chestnut Leafy Moth (Cydia Kurokoi), Peach Nettle Moth (Grapholita molesta), Silver Moth (Lyonetia prunifoliella), Peach Core Moth (Carposina sasakii), Parrot Moth (Spodoptera exigua) Selected from the group consisting of Diaphania indica, Cnaphalocrocis medinalis, Chilo suppressalis, and Helicoverpa armigera, the coleopteran pest is Tenebrio molitor Linnaeus, Alder Leaf beetle (Agelastica coerulea Baly), apple tree beetle (Xyleborus apicalis Blandford), Seoul tree beetle (Scolytus seulensis), rice weevil (Scolytus seulensis), pine beetle Tomicus piniperda, chestnut weevil (Culculi) o may be a pest selected from the group consisting of sikkimensis).
또한 본 발명의 신규한 살충성 단백질을 해충 방제용 조성물로 제조함에 있어서 예를 들어, 에스테르 화합물, 포화 탄화수소 및 에스테르 그리고 필요에 따라 기타 살충 활성 성분, 살비 활성 성분, 반발적 활성 성분, 상승제, 향미제 등을 실온 또는 가열 하에 혼합 및 용해함으로써 제조될 수 있다.In addition, in the preparation of the novel pesticidal proteins of the present invention in pest control compositions, for example, ester compounds, saturated hydrocarbons and esters and other pesticidal active ingredients, acaricide active ingredients, repulsive active ingredients, synergists, Flavors and the like can be prepared by mixing and dissolving at room temperature or under heating.
본 발명의 조성물이 해충 방제를 위해 사용되는 경우, 본 발명의 조성물은 그 자체로 또는 본 발명의 조성물을 포함하는 해충 방제제 제형의 형태로 적용될 수 있는데 제형에는 예를 들어, 오일, 유제, 수-분산가능한 분말, 플로어블제 (flowable agent) (수성 현탁액, 수성 유제 등), 분말, 과립, 에어로솔, 가열된 증기화제 (살충 코일 (insecticide coil), 전기 살충 매트 (matt), 액체-흡수 샤프트 (shaft)를 가진 가열된 살충-증기화제 등), 가열된 훈증제 (자기-연소형 훈증제, 화학-반응형 훈증제, 다공-세라믹판 훈증제 등), 비가열된 증기화제 (수지 증기화제, 함침지 증기화제 등), 분무제 (포깅(fogging) 등), ULV 제, 및 유독성 먹이 (poisonous bait)가 포함된다.When the composition of the invention is used for pest control, the composition of the invention may be applied on its own or in the form of a pest control formulation comprising the composition of the invention, for example oils, emulsions, water Dispersible powders, flowable agents (aqueous suspensions, aqueous emulsions, etc.), powders, granules, aerosols, heated vaporizers (insecticide coils, electric insecticide mattes, liquid-absorbing shafts) heated insecticide-vaporizers with shafts), heated fumigants (self-burning fumigants, chemical-reactive fumigants, porous-ceramic fumigants, etc.), unheated vaporizers (resin vaporizers, impregnated paper vapors) And the like), sprays (fogging, etc.), ULV agents, and poisonous bait.
본 발명의 해충 방제용 조성물을 이용하여 해충을 방제하는 방법은 본 발명의 조성물 또는 이의 제형을 해충 또는 해충이 서식하는 장소에 적용하여 실행된다. 본 발명의 조성물 또는 이의 제형을 적용하는 방법은 본 발명의 조성물 또는 이의 제형의 형상, 사용 위치 등에 따라 적절하게 선택되어 적용 가능하다.The pest control method using the pest control composition of the present invention is carried out by applying the composition of the present invention or a formulation thereof to a pest or a place where the pests live. The method of applying the composition of the present invention or the formulation thereof may be appropriately selected and applied according to the shape, location of use, etc. of the composition of the present invention or formulation thereof.
이하, 본 발명을 실험예에 의해 상세히 설명한다. 단, 하기 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실험예에 의해 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by experimental examples. However, the following experimental examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following experimental examples.
[실험 예1] 포토랍두스 템페라타 M1021(KCTC 12006BP)로부터 genomic 코스미드 라이브러리 제작Experimental Example 1 Preparation of a Genomic Cosmid Library from Photorabdus Temperata M1021 (KCTC 12006BP)
Genomic library를 제작하기 위한 P. temperata M1021의 chromosomal DNA는 Wilson의 방법(Short Protocols in Molecular Biology, Unit 2.4)에 따라 분리하였다. 분리한 total DNA는 Sau3AI (Fermentas, USA)으로 partial digestion 한 후, sucrose gradient를 이용한 초원심 분리에 의하여 DNA 단편의 크기가 평균 35∼45kb되게 size fraction 한 다음, BamHI과 XbaI으로 잘려진 cosmid vector SuperCos 1(Stratagene, Germany)에 ligation 하였다. 이것을 Epicentre 사의 MaxPlaxTM lambda Packaging Extracts(EPICENTRE, USA)를 이용하여 packaging한 다음 XL1-Blue MRF'로 infection 하여 M1021 균주의 코스미드 라이브러리를 제작하였다. 제작한 코스미드 라이브러리의 클론은 LB배지와 glycerol(최종농도 25%)을 첨가한 다음 각각 200㎕ 분주하여 deep freezer(-70℃)에 보관하였다.The chromosomal DNA of P. temperata M1021 for genomic library was isolated according to Wilson's method (Short Protocols in Molecular Biology, Unit 2.4). The total DNA isolated was partially digested with Sau3AI (Fermentas, USA), and then the size fraction of DNA fragments was averaged 35-45 kb by ultracentrifugation using a sucrose gradient, followed by cosmid vector SuperCos 1 cut with BamHI and XbaI. Ligation to (Stratagene, Germany). This was packaged using Epicentre's MaxPlax lambda Packaging Extracts (EPICENTRE, USA) and then infected with XL1-Blue MRF 'to prepare a cosmid library of M1021 strain. Clones of the prepared cosmid library were added to LB medium and glycerol (25% final concentration) and then 200µl of each was stored in the deep freezer (-70 ℃).
[실험 예2] 코스미드 라이브러리로부터의 독소 콤플렉스 관련 클론의 확보 및 분석Experimental Example 2 Acquisition and Analysis of Toxin Complex-Related Clones from Cosmid Library
2.1 독소 콤플렉스(tc) 관련 프라이머 제작2.1 Preparation of Toxin Complex (tc) Related Primer
P. temperata M1021 균주의 코스미드 라이브러리로부터 toxin complex(tc)를 가진 코스미드 클론을 확보하기에 앞서, genome sequence가 이미 알려진 Photorhabdus luminescens W14와 TT01 균주의 두 개의 genomic data를 기본으로 하여 표1 과 같이 프라이머를 제작하였다(제노텍, 대전, 한국). tccF1과 tccR1 primer는 toxin complex 중의 tcc locus에 대한 것이며, TcdF2와 TcdR2 프라이머는 tcd locus, TcaC F3와 TcaC R3 primer는 tca locus를 확인하기 위하여 제작하였다. 제작한 프라이머는 M1021의 genomic DNA를 대상으로 PCR(도1)을 수행하여 그 존재 여부를 확인하였으며, 각각의 PCR product는 PCR purification kit(솔젠트, 대전, 한국)로 정제한 다음, 서열 확인은 솔젠트사(대전, 한국)에 의뢰하였다. Prior to obtaining cosmid clones with toxin complex (tc) from the cosmid library of P. temperata M1021 strain, two genomic data of photorhabdus luminescens W14 and TT01 strains with known genome sequences are shown in Table 1 Primers were prepared (Gennotek, Daejeon, Korea). The tccF1 and tccR1 primers were for the tcc locus in the toxin complex, and the TcdF2 and TcdR2 primers were prepared to identify the tcd locus, TcaC F3 and TcaC R3 primers for the tca locus. The prepared primers were subjected to PCR (FIG. 1) on genomic DNA of M1021 to confirm their presence. Each PCR product was purified using a PCR purification kit (solgent, Daejeon, Korea), and then sequence confirmation was performed. Commissioned by Solgent (Daejeon, Korea).
표 1
Table 1
Oligonucleotide | Relevant sequence (5'→3') |
Tcc F1Tcc R1TcdF2TcdR2TcaC F3TcaC R3 | AARYTGCGTGAAGAGCAYGTGCAATACCCTTACCTGTGCARGACCGTTTTTCCCGTTATGARTAATCACCGGATTGCACCACATCAGCGCATTCAACTGCAACAAGATATCTATGGGGTTCTTGAYGCGGTATC |
Oligonucleotide | Relevant sequence (5 '→ 3') |
Tcc F1Tcc R1TcdF2TcdR2TcaC F3TcaC R3 | AARYTGCGTGAAGAGCAYGTGCAATACCCTTACCTGTGCARGACCGTTTTTCCCGTTATGARTAATCACCGGATTGCACCACATCAGCGCATTCAACTGCAACAAGATATCTATGGGGTTCTTGAYGCGGTATC |
2.2 포토랍투스 템페라타 M1021의 게놈 코스미드 클론에서의 tc 포짓티드 클론확보.2.2 Acquisition of a tc positioned clone from the genome cosmid clone of Photolabtus temperata M1021.
포토랍투스 템페라타 M1021 균주의 cosmid library로부터 tcc, tcd, tca를 포함하는 코스미드 클론을 확보하기 위하여 상기와 같은 조건으로 PCR을 실시하였으며(도1 참조), PCR은 pooling과 subpooling 과정을 통하여 단계적으로 실시하였다. PCR was performed under the same conditions as described above to obtain cosmid clones containing tcc, tcd, and tca from the cosmid library of the Photolaptus temperata M1021 strain (see FIG. 1), and PCR was performed stepwise through pooling and subpooling processes. Was carried out.
2.3 포짓티브 코스미드 클론의 플라스미드 분석.2.3 Plasmid Analysis of Positive Cosmid Clones.
PCR 스크리닝 방법에서 확보한 4개의 코스미드 클론(PtC 49, PtC 64, PtC 267, PtC 28)에 대한 플라스미드는 alkaline lysis method(Birnboim and Doly, 1979)를 이용하여 각각 확보하였으며, 각각의 플라스미드 내에 삽입된 DNA의 양쪽 말단을 확인하기 위하여 SuperCos1 내의 T3와 T7 프라이머를 이용하여 시퀀싱을 실시하였다(제노텍, 대전, 한국). 또한 각각의 플라스미드를 NotI, BamHI, HindⅢ, EcoRI, KpnI, PstI 과 같은 제한효소를 이용하여 제한효소에 의한 패턴을 분석하였다. Plasmids for the four cosmid clones (PtC 49, PtC 64, PtC 267, PtC 28) obtained by the PCR screening method were obtained using the alkaline lysis method (Birnboim and Doly, 1979) and inserted into each plasmid. Sequencing was performed using T3 and T7 primers in SuperCos1 to identify both ends of the prepared DNA (Gennote, Daejeon, Korea). In addition, each plasmid was analyzed by restriction enzyme patterns using restriction enzymes such as Not I, Bam HI, Hind III, EcoR I, Kpn I, and Pst I.
2.4 포짓티브 코스미드 클론의 살충력 조사.2.4 Investigation of the insecticide of positive cosmid clones.
상기에서 확보한 4개의 코스미드 클론의 살충성 시험은 꿀벌부채명나방 유충(4∼5령)을 사용하였으며, 각각의 코스미드 클론을 5 ㎖ LB 배지에서 16시간이상 배양한 다음, 원심분리(12,000rpm, 5min)를 통하여 cell pellet만을 회수하여 멸균생리식염수에 현탁시킨 다음 유충의 혈체강에 microsyringe을 사용하여 3 ㎕씩 주사하였다. 대조군으로는 멸균된 LB broth와 0.85% NaCl 용액을 동량 주사하여 각각 25℃ 인큐베이터에 보관하면서 시간에 따른 사멸 정도를 조사하였다. Insecticidal test of the four cosmid clones obtained from the above was used beetle moth larvae (4-5 years old), each cosmid clone was incubated for 16 hours in 5 ml LB medium, followed by centrifugation ( 12,000rpm, 5min) to recover only the cell pellet was suspended in sterile saline solution and injected into the larval cavity of the larval body by using microsyringe 3 ㎕ each. As a control, the same amount of sterile LB broth and 0.85% NaCl solution was injected and stored in a 25 ° C. incubator, respectively.
2.5 포짓티브 코스미드 플라스미드의 서열 및 ORF 분석.2.5 Sequence and ORF Analysis of Positive Cosmid Plasmids.
tcd locus와 tcc locus에 대한 각각의 플라스미드에 대한 유전 정보를 확인하기 위하여 코스미드 플라스미드에 대한 서열 분석을 제노텍(대전, 한국)에 의뢰하였으며, pS49와 pS28에 대한 서열분석은 primer walking과 shot gun 분석을 통하여 실시하였다. 확보한 DNA 서열은 DNA star(DNASTAR, USA)를 이용하여 모두 assembly 하였으며, 완성된 콘티그는 벡터 NTI program(Invitrogen, USA)의 ORF finder와 NCBI(National Center for Biotechnology Information)의 ORF finder를 이용하여 open reading frame(ORF) 구성을 확인하였다. 각각의 ORF는 NCBI의 BLAST를 이용하여 염기서열과 아미노산 서열의 상동성을 비교하였다.In order to confirm the genetic information of each plasmid for tcd locus and tcc locus, sequencing of cosmid plasmid was commissioned by Genotech (Daejeon, Korea) .Sequencing of pS49 and pS28 was carried out using primer walking and shot gun. The analysis was carried out. The obtained DNA sequences were assembled using DNA star (DNASTAR, USA), and the completed contigs were opened using ORF finder of vector NTI program (Invitrogen, USA) and ORF finder of National Center for Biotechnology Information (NCBI). We confirmed the reading frame (ORF) configuration. Each ORF compared the homology between the nucleotide sequence and the amino acid sequence using BLAST of NCBI.
[실험 예3] 독소 유전자 클로닝 및 재조합 발현.]Experimental Example 3 Toxin Gene Cloning and Recombinant Expression.
3.1 독소 단백질 발현 벡터의 제조.3.1 Preparation of Toxin Protein Expression Vectors.
독소 단백질의 발현벡터로는 pET21a(+)를 사용하였으며, 각각의 독소 유전자를 클로닝하기 위해 제작한 프라이머(제노텍, 대전, 한국)는 표 2에 나타내었다. 표 2에서 보는 것과 같이 독소 단백질의 정제를 위하여 C 말단에 stop codon을 제외한 TEV 서열 및 6His·tag서열을 부착한 프라이머(C-ter 6His-tag/TEV 프라이머)와 마지막으로 C-말단에 부착할 제한효소를 위하여 SalI 또는 HindⅢ cassette를 제작하여 사용하였다. PCR 반응은 도1과 같이 실시하였으며, 클로닝 과정은 다음과 같다. 개시코돈을 포함하는 각각의 N 프라이머와 정지코돈을 제외한 C-terminal 부분에 TEV 서열을 연결시킨 각각의 C 프라이머로 Pfu-X polymerase(솔젠트, 대전, 한국)를 이용하여 PCR을 실시한 다음, C-terminal 부분은 6His·tag과 unique restriction enzyme 및 정지 코돈을 넣어주기 위하여 C-ter 6His-tag/TEV 프라이머 와 cassette 프라이머를 순차적으로 사용하여 PCR을 실시하였다. PCR template로는 각각의 코스미드 플라스미드 및 genomic DNA를, polymerase는 Pfu-X polymerase(솔젠트, 대전, 한국)를 이용하였으며, PCR 반응 시 annealing temperature는 50-60℃, extension time은 1kb/min, 이들 조건의 반응 cycle은 30회 반복하였다. 반응이 끝난 PCR 산물은 0.8% 아가로오스 겔(w/v)에서 확인하였으며 PCR 산물은 PCR purification kit(솔젠트, 대전, 한국)를 이용하여 정제하였다. 정제한 각각의 PCR product와 pET21a(+)를 PCR product 말단에 부착한 각각의 특정 제한효소로 절단한 다음 T4 DNA ligase(Fermentas, Canada)를 이용하여 연결한 후, Escherichia coli DH5α로 형질전환시켜 재조합 플라스미드를 확보하였다. 확보한 재조합 플라스미드는 sequencing(T3과 T7 프라이머)을 통하여 확인하였다. PET21a (+) was used as the expression vector of the toxin protein, and the primers (genotech, Daejeon, Korea) prepared for cloning each toxin gene are shown in Table 2. As shown in Table 2, the primer (C-ter 6His-tag / TEV primer) attached to the TEV sequence and the 6His tag sequence excluding the stop codon at the C-terminus and the C-terminus was finally attached for the purification of the toxin protein. Sal I or Hind III cassettes were prepared and used for restriction enzymes. PCR reaction was carried out as shown in Figure 1, the cloning process is as follows. PCR was performed using Pfu- X polymerase (Solgent, Daejeon, Korea) with each C primer which linked the TEV sequence to each N primer including start codon and C-terminal part except stop codon. PCR was performed using the C-ter 6His-tag / TEV primer and cassette primer in order to insert 6His tag, unique restriction enzyme and stop codon. As the PCR template, each cosmid plasmid and genomic DNA were used, and the polymerase was Pfu- X polymerase (Solgent, Daejeon, Korea) .The annealing temperature was 50-60 ℃ and the extension time was 1kb / min. The reaction cycle of conditions was repeated 30 times. The reaction product was confirmed by 0.8% agarose gel (w / v) and the PCR product was purified using a PCR purification kit (solgent, Daejeon, Korea). Each purified PCR product and pET21a (+) were digested with specific restriction enzymes attached to the ends of the PCR product, linked with T4 DNA ligase (Fermentas, Canada), and transformed with Escherichia coli DH5α. Plasmids were obtained. The obtained recombinant plasmid was confirmed by sequencing (T3 and T7 primers).
표 2
TABLE 2
Gene | Oligonucleotide | Relevant sequence (5'→3') |
tcdB2 | TcdB2-NTcdB2-CC-ter 6His-tag/TEVSalI cassette | GCGGGATCCATGCAAAATTCACAAGAACTGAAAGTACAGGTTCTCCATTTTCACCTCAGCAGCCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTCACGCGTCGACCGAATTCATTAGTGGTGG |
tccC3 | TccC3-NTccC3-CC-ter 6His-tag/TEVHindⅢ cassette | CCTGCAGCATATGATGGAAAACTTTGACCCCCTGAAAGTACAGGTTCTCGCTATATCTATGTTTAGGCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTCCGCAAGCTTCGAATTCATTAGTGGTGG |
tccA | TccA-NTccB-CC-ter 6His-tag/TEV | GGAATTCGCTAGCATGAATCAACTCGCCAGTCTGAAAGTACAGGTTCTCATGACTGCCCTTGACATGCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC |
tccB | TccB-NTccB-CC-ter 6His-tag/TEV | CCTGCAGCATATGATGTTATCGACAATGGAACTGAAAGTACAGGTTCTCAATAAGTGTTTTCTTGACCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC |
tccC | TccC-NTccC-CC-ter 6His-tag/TEVHindⅢ cassette | CCTGCAGCATATGAGTACGTCTGATACCACTGAAAGTACAGGTTCTCCAAAGAAATAACCCGTCGCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTCCGCAAGCTTCGAATTCATTAGTGGTGG |
tcaC | TcaC-NTcaC-CC-ter 6His-tag/TEV | GGAATTCGCTAGCATGCAGGATTCATCAGAACTGAAAGTACAGGTTCTCTGGGGTTCTTGACGCGGTCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC |
Gene | Oligonucleotide | Relevant sequence (5 '→ 3') |
tcdB2 | TcdB2-NTcdB2-CC-ter 6His-tag / TEVSalI cassette | GCG GGATCC ATGCAAAATTCACAAGAACTGAAAGTACAGGTTCTCCATTTTCACCTCAGCAGCCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTCACGC GTCGAC CGAATTCATTAGTGGTGG |
tccC3 | TccC3-NTccC3-CC-ter 6His-tag / TEVHindIII cassette | CCTGCAG CATATG ATGGAAAACTTTGACCCCCTGAAAGTACAGGTTCTCGCTATATCTATGTTTAGGCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTCCGC AAGCTT CGAATTCATTAGTGGTGG |
tccA | TccA-NTccB-CC-ter 6His-tag / TEV | GGAATTC GCTAGC ATGAATCAACTCGCCAGTCTGAAAGTACAGGTTCTCATGACTGCCCTTGACATGC GAATTC ATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC |
tccB | TccB-NTccB-CC-ter 6His-tag / TEV | CCTG CAGCAT ATGATGTTATCGACAATGGAACTGAAAGTACAGGTTCTCAATAAGTGTTTTCTTGACC GAATTC ATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC |
tccC | TccC-NTccC-CC-ter 6His-tag / TEVHindIII cassette | CCTGCAG CATATG AGTACGTCTGATACCACTGAAAGTACAGGTTCTCCAAAGAAATAACCCGTCGCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTCCGC AAGCTT CGAATTCATTAGTGGTGG |
tcaC | TcaC-NTcaC-CC-ter 6His-tag / TEV | GGAATTC GCTAGC ATGCAGGATTCATCAGAACTGAAAGTACAGGTTCTCTGGGGTTCTTGACGCGGTCGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC |
3.2 재조합 독소 단백질의 발현.3.2 Expression of Recombinant Toxin Protein.
상기에서 확보한 재조합 플라스미드는 독소 단백질의 발현을 위하여 E. coli BL21(DE3)에 각각 형질전환하였다. 형질전환한 대장균은 3 ㎖ LB broth(Apr, 100㎍/㎖)에서 밤새 키운 다음 100 ㎖ LB broth에 1% 되게 접종하여 37℃의 진탕배양기(220rpm)에서 OD600값이 0.8되게 키운 후 IPTG(Isopropyl β-D-1-thiogalactopyranoside)를 최종 1mM 되게 첨가 한 후 시간별로 회수하여 발현정도를 관찰하였다. 대조구로는 E. coli BL21(DE3)/pET21a(+)를 사용하였다. 재조합단백질의 발현은 SDS-PAGE를 통하여 확인하였으며 시간별로 회수한 배양액을 원심 리하여 상등액을 제거하고 난 다음 cell pellet에 1×Laemmli loading dye를 넣어서 현탁시킨 후 99℃에서 5분간 가열하여 세포를 파쇄하였다. 세포 파쇄액은 원심분리(12,000rpm, 10min, 4℃)하여 상등액을 SDS-PAGE를 이용하여 재조합 단백질의 발현을 확인하였다. The recombinant plasmids obtained above were transformed into E. coli BL21 (DE3), respectively, for the expression of toxin proteins. The transformed Escherichia coli was grown overnight in 3 ml LB broth (Ap r , 100㎍ / ml) and inoculated 1% in 100 ml LB broth to raise the OD 600 value to 0.8 at 37 ℃ shake incubator (220rpm), followed by IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to the final 1 mM and then recovered over time to observe the expression level. As a control, E. coli BL21 (DE3) / pET21a (+) was used. The expression of the recombinant protein was confirmed by SDS-PAGE. The supernatant was removed by centrifugation of the culture solution collected over time, and then suspended in a cell pellet with 1 × Laemmli loading dye, and the cells were disrupted by heating at 99 ° C. for 5 minutes. . The cell lysate was centrifuged (12,000 rpm, 10 min, 4 ° C.) to confirm the expression of the recombinant protein using the supernatant SDS-PAGE.
재조합 독소 단백질의 활성형 발현 양상을 확인하기 위한 실험에는 배양온도, IPTG 첨가농도 및 배지조성을 변화시켜 확인하였으며 IPTG 첨가 농도는 0.1mM, 0.5mM, 1mM, 배양온도는 15℃, 25℃, 37℃, 배지는 LB, 2×YT, TB(Terrific broth), SB(Super broth), M9 Minimal 배지(표 3)를 사용하여 실험하였다. Experiments to confirm the active expression pattern of recombinant toxin protein were confirmed by changing the culture temperature, IPTG concentration and medium composition, IPTG concentration is 0.1mM, 0.5mM, 1mM, the culture temperature is 15 ℃, 25 ℃, 37 ℃ , The medium was tested using LB, 2 × YT, TB (Terrific broth), SB (Super broth), M9 Minimal medium (Table 3).
표 3
TABLE 3
LB | 2×YT | TB | SB | M9 | |
배지조성 | Tryptone 10 gYeast extract 5 gNaCl 10 gper 1 liter | Tryptone 12 gYeast extract 10 gNaCl 5 gper 1 liter | Tryptone 12 gYeast extract 24 gK2HPO4 12.54 gKH2PO4 2.31 gGlycerol 4 ㎖per 1 liter | Tryptone 32 gYeast extract 20 gNaCl 5 gper 1 liter | Na2HPO4·7H2O 6 gKH2PO4 3 gNaCl 0.5 gNH4Cl 1 g20% glucose 10 ㎖0.1M CaCl2 1 ㎖1M MgSO4 1 ㎖per 1 liter |
LB | 2 x YT | TB | SB | M9 | ||||
| Tryptone | 10 | Tryptone | 12 | Tryptone | 12 | Tryptone 32 | Na 2 HPO 4 7H 2 O 6 gKH 2 PO 4 3 gNaCl 0.5 gNH 4 Cl 1 |
[실험 예4] 재조합 단백질을 가진 대장균을 이용한 살충성 검사.Experimental Example 4 Insecticidal Test Using Escherichia Coli with Recombinant Protein.
꿀벌부채명나방 유충에 대한 독성 검사는 재조합 단백질의 발현이 최대인 시점의 배양액 2㎖을 원심 리하여 상층액을 제거하고 멸균된 0.85% NaCl 용액으로 cell pellet을 두 번 세척한 다음, 배양액의 10배 농도로 현탁시켜 사용하였다. 세포 현탁액은 microsyringe(Hamilton, USA)를 이용하여 3㎕씩 꿀벌부채명나방 유충의 혈체강 속으로 주사하였으며, 각각 10마리의 유충을 사용하였다. 주사한 유충은 항온실(25℃, 습도 50%)에 보관하면서 24시간 단위로 변화양상을 관찰하였다. 또한 세포 현탁액내의 cell 농도를 확인하기 위하여 엠피실린이 포함된 LB agar plate에 도말하여 항온배양기(37℃)에서 배양하였다. 대조구로는 멸균한 0.85% NaCl 용액과 E. coli BL21(DE3)/pET21a(+)를 상기의 방법과 동일하게 처리하여 사용하였다.Toxicity test for honeybee moth larvae was performed by centrifuging 2 ml of the culture medium at the time of maximum expression of the recombinant protein to remove the supernatant, washing the cell pellet twice with sterile 0.85% NaCl solution, and then 10 times the culture medium. Suspension was used to concentration. Cell suspensions were injected into the blood cavity of bee-lipped moth larvae using microsyringe (Hamilton, USA) at 10 μl each. The injected larvae were kept in a constant temperature room (25 ° C, 50% humidity) and observed for 24 hours. In addition, in order to check the cell concentration in the cell suspension was plated on LB agar plate containing empicillin and incubated in an incubator (37 ℃). As a control, a sterilized 0.85% NaCl solution and E. coli BL21 (DE3) / pET21a (+) were treated in the same manner as the above method.
[실험 예5] 결과.Experimental Example 5 Results.
5.1. 포토랍투스 템페라타 M1021균주의 코스미드 라이브러리.5.1. Cosmid library of Photorabbitus temperata M1021 strain.
포토랍투스 템페라타M1021 균주의 genomic 코스미드 라이브러리를 제작한 결과 7.14×105 코스미드 클론을 확보하였다. 현재 보고된 P. luminescens subsp. laumondii TT01과 P. asymbiotica subsp. asymbiotica ATCC43949의 전체 게놈크기가 각각 5.69Mb와 5.06Mb 인 점을 감안할 때 같은 속(family)에 속하는 포토랍투스 템페라타M1021 균주의 게놈 크기도 5∼6Mb 사이 일 것으로 예상된다. 포토랍투스 템페라타M1021 균주의 전체 게놈 크기가 약 5.6Mb이라고 가정한다면, 또한 코스미드 벡터 내에 삽입된 M1021의 genomic DNA fragment 크기가 40kb일 경우 전체 게놈을 99.99% 포함하는데 필요한 이상적인 클론의 개수는(N) 도 2의 식에 대입하면 1.28×103 클론으로 나타난다. 따라서 본 실험에서 확보한 7.14×105 코스미드 클론의 수는 포토랍투스 템페라타M1021 균주의 전체 게놈을 99.99%이상 포함하는 것으로 나타났다. 코스미드 라이브러리로부터 일부 코스미드 클론의 플라스미드를 분리하여 제한효소(restriction enzyme)로 절단한 결과, 삽입되어 있는 DNA 절편의 크기는 약 35-45kb로 나타났고 제한효소에 의한 양상도 서로 다른 것으로 나타났다. A genomic cosmid library of the Photolaptose temperata M1021 strain was prepared to obtain 7.14 × 105 cosmid clones. P. luminescens subsp. laumondii TT01 and P. asymbiotica subsp. Given that the total genome sizes of the asymbiotica ATCC43949 are 5.69 Mb and 5.06 Mb, respectively, the genome size of the Photolobus temperata M1021 strain belonging to the same family is expected to be between 5 and 6 Mb. Assuming that the total genome size of the Photolobus temperata M1021 strain is about 5.6 Mb, and the genomic DNA fragment size of M1021 inserted into the cosmid vector is 40 kb, the ideal number of clones required to contain 99.99% of the total genome is ( N) Substituting into the equation of FIG. 2, it appears as 1.28 × 10 3 clones. Therefore, the number of 7.14 × 10 5 cosmid clones obtained in this experiment was found to contain more than 99.99% of the entire genome of the Photolabtus temperata M1021 strain. Plasmids of some cosmid clones were isolated from the cosmid library and digested with restriction enzymes. As a result, the size of the inserted DNA fragment was about 35-45 kb and the restriction enzymes showed different patterns.
5.2 코스미드 라이브러리로부터 독소 콤플렉스 관련 클론의 분석결과.5.2 Analysis of Toxin Complex-Related Clones from Cosmid Library.
5.2.1 tc 포짓티브 클론의 확보.5.2.1 Acquisition of tc positive clones.
포토랍투스 템페라타M1021의 genomic DNA를 대상으로 표1의 tcc, Tcd와 Tca pair 프라이머를 이용하여 PCR을 한 결과 각각의 PCR product를 확보하였으며, 서열 분석을 통하여 그 서열을 확인한 결과, 모두 다 살충성 독소 콤플렉스 단백질로 나타났다. PCR products were obtained using the tcc, Tcd and Tca pair primers of Table 1 on the genomic DNA of Photolabtus temperata M1021. Each PCR product was obtained through sequence analysis. It appears to be a loyal toxin complex protein.
표 4
Table 4
Primer sets | PCR amplicon (kb) | % nucleotide homology | Compared strain(protein) |
tcc F1 / tcc R1 | 0.84 | 87 | P. luminescens strain TT01 (TccC) |
TcdF2 / TcdR2 | 0.77 | 84 | P. luminescens strain TT01 (TcdF2) |
TcaC F3 / TcaC R3 | 1.64 | 82/83 | P. luminescens TT01 P. asymbiotica ATCC43949 (TcaC) |
Prime sets | PCR amplicon (kb) | % nucleotide homology | Compared strain (protein) |
tcc F1 / tcc R1 | 0.84 | 87 | P. luminescens strain TT01 (TccC) |
TcdF2 / TcdR2 | 0.77 | 84 | P. luminescens strain TT01 (TcdF2) |
TcaC F3 / TcaC R3 | 1.64 | 82/83 | P. luminescens TT01 P. asymbiotica ATCC43949 (TcaC) |
5.2.2 플라스미드 분석 결과.5.2.2 Plasmid Assay.
상기의 플라스미드에 대한 유전 정보를 확인하기 위하여 전체 시퀀싱 작업은 유전체분석전문기관인 제노텍(Genotech, Daejeon, Korea)에 의뢰하였으며, pS49와 pS28에 대한 전체 시퀀싱은 primer walking과 shot gun 분석을 통하여 실시하였다. pS49와 pS28내에 삽입된 DNA의 서열은 상기와 같은 서열분석을 통하여 모두 확보하였으며, 확보한 DNA 서열은 DNA star를 이용하여 모두 assembly 하였으며, 완성된 콘티그는 Vector NTI program (Invitrogen, USA)의 ORF finder와 NCBI(National Center for Biotechnology Information)의 ORF finder를 이용하여 open reading frame (ORF) 구성을 확인하였다. 각각의 ORF는 NCBI의 BLAST를 이용하여 염기서열과 아미노산 서열의 상동성을 비교하였다. pS49와 pS28내에 있는 ORF의 구성은 도. 5과 같으며, 이들 각각 ORF에 대한 상동성과 예상되는 유전자 및 기능은 표 5에 나타내었다. pS49내에 있는 ORFs의 구성을 기존에 보고된 P. luminescens W14 및 TT01 균주와 P. asymbiotica ATCC43949의 tcd island와 비교해 볼 때, tcdA2, tcdB2 및 tccC3 유전자들이 동일한 방향으로 전사되어 있었으며 또한 tcdB2와 tccC3 사이에 phage holin protein을 암호화하는 tchA도 존재하는 것으로 나타났다. pS49내의 서열에서는 tcdA-like, tcdB-like, tccC-like 유전자들의 또 다른 copies는 확인되지 않았으며, tcd locus의 “core” region (tcdA1-like, tcdA2, tcdB2와 tccC3)만이 확인되었다. 그러나 tcdA1-like gene의 경우 기존에 보고된 tcdA-like gene과 비교하여 크기가 상당히 작은 것으로 나타났으며, tcdA1-like 유전자의 upstream 방향, 즉 pS49의 insert 말단부위에는 hemolysins-related protein을 암호화하는 유전자의 일부가 포함되어있는 것으로 나타났다. 포토랍투스 템페라타M1021의 tcd island의 구성은 독소유전자의 copy 수가 많은 P. luminescens TT01의 것보다는 독소유전자의 copy 수가 적거나 하나인 P. asymbiotica ATCC43949의 것과 유사하였으며, 독소 단백질의 하류 방향으로는 multidrug transporter proteins와 polyphosphatase protein 등이 존재하는 것으로 확인되었다. 기존에 보고된 살충성 단백질과의 아미노산 상동성은 TcdA2의 경우 66%, TcdB2는 81%, TccC3는 57%로 나타났으며(표 5), P. luminescens 및 P. asymbiotica의 살충성 단백질과는 상당한 차이를 나타내었다. 또한 독소단백질의 구성요소인 A, B, C component의 경우 A component는 tcdA2, B component는 tcdB2, C component는 tccC3로 3개의 구성요소를 모두 가지는 것으로 나타났다(도 7 참조). In order to confirm the genetic information on the plasmid, the entire sequencing operation was commissioned by Genotech, Daejeon, Korea, a genome analysis institute. The overall sequencing of pS49 and pS28 was performed through primer walking and shot gun analysis. . The sequences of DNA inserted into pS49 and pS28 were all secured through the above sequencing analysis, and the obtained DNA sequences were assembled using DNA star. The completed contigs were ORF finder of Vector NTI program (Invitrogen, USA). And the ORF finder of the National Center for Biotechnology Information (NCBI) to determine the open reading frame (ORF) configuration. Each ORF compared the homology between the nucleotide sequence and the amino acid sequence using BLAST of NCBI. The configuration of the ORFs in pS49 and pS28 is shown in FIG. 5, the homology to each of the ORF and the expected genes and functions are shown in Table 5. Comparing the composition of ORFs in pS49 with the previously reported strains of P. luminescens W14 and TT01 and the tcd islands of P. asymbiotica ATCC43949, the tcdA2, tcdB2 and tccC3 genes were transcribed in the same direction and also between tcdB2 and tccC3. tchA, which encodes a phage holin protein, was also present. No other copies of tcdA-like, tcdB-like, or tccC-like genes were identified in the sequence in pS49. Only the “core” region of the tcd locus (tcdA1-like, tcdA2, tcdB2 and tccC3) was identified. However, the tcdA1-like gene was found to be considerably smaller in size than the previously reported tcdA-like gene, and the gene encoding the hemolysins-related protein in the upstream direction of the tcdA1-like gene, ie, the insertion end of pS49. Appeared to contain some. The composition of the tcd island of photolaptus temperata M1021 is similar to that of P. asymbiotica ATCC43949, which has fewer or one copies of the toxin gene than that of P. luminescens TT01, which has more copies of the toxin gene. Multidrug transporter proteins and polyphosphatase proteins have been identified. Amino acid homology with previously reported pesticidal proteins was 66% for TcdA2, 81% for TcdB2, and 57% for TccC3 (Table 5), which was significantly different from that of P. luminescens and P. asymbiotica. The difference was shown. In addition, in the case of the A, B, and C components of the toxin protein, the A component is tcdA2, the B component is tcdB2, and the C component is tccC3, which has all three components (see FIG. 7).
tcc locus를 포함하는 pS28의 경우는 tccA, tccB와 tccC를 모두 포함하였으며, 독소유전자의 하류 부분에는 Type Ⅵ secretion system (T6SS)을 가지는 것으로 나타났다. Type Ⅵ secretion system은 Proteobacteria에 속하는 미생물의 병원성을 유발하는 제6형 유형 분비체계로, 이러한 T6SS는 Hcp와 VgrG와 같은 여러 개의 단백질로 구성되어있는 것으로 알려져 있다. 이러한 유형의 분비체계는 병원성 미생물의 독소단백질 및 여러 가지의 virulence factors 등과 관련이 매우 높은 것으로 알려져 있으며, 포토랍투스 템페라타M1021 균주의 tcc locus에서도 이와 같은 형태의 분비체계가 있는 것으로 나타났다(도 5). 살충성 단백질과의 아미노산 상동성은 TccA의 경우 89%, TccB와 TccC는 90%의 상동성을 나타내었으며, A component인 tccB를 가지는 것으로 나타났다(표5).The pS28 containing tcc locus contained all of tccA, tccB and tccC, and it was shown to have a Type VI secretion system (T6SS) downstream of the toxin gene. Type VI secretion system is a type 6 secretion system that causes pathogenicity of microorganisms belonging to Proteobacteria. T6SS is known to be composed of several proteins such as Hcp and VgrG. This type of secretion system is known to be highly related to toxin proteins of pathogenic microorganisms and a variety of virulence factors, and this type of secretion system was also found in the tcc locus of the Photolobus temperata M1021 strain (FIG. 5). ). Amino acid homology with the pesticidal protein was 89% for TccA, 90% for TccB and TccC, and it was found to have an A component, tccB (Table 5).
표 5
Table 5
No. | Predicted product | Homology (%) | Organism |
pS49 | |||
1 | insecticidal toxin, TcdA like | 73 | P. asymbiotica ATCC43949 |
2 | insecticidal toxin, TcdA2 | 66 | P. luminescens TT01 |
3 | insecticidal toxin, TcdB2 | 81 | P. luminescens TT01 |
4 | insecticidal toxin, TccC3 | 70 | P. luminescens TT01 |
5 | peptide synthetase | 87 | P. luminescens TT01 |
6 | thiothemplate mechanism natural product synthetase | 58 | Erwinia amylovora ATCC BAA-2158 |
7 | polyketide synthase type I | 46 | E. amylovora ATCC49946 |
8 | gramicidin S synthetase 2 | 45 | E. amylovora ATCC BAA-2158 |
9 | polyketide synthase | 38 | E. amylovora ATCC BAA-2158 |
10 | peptide synthetase | 86 | P. luminescens TT01 |
11 | hypothetical protein | 87 | P. luminescens TT01 |
12 | 5'-nucleotidase family protein | 86 | P. asymbiotica ATCC43949 |
pS28 | |||
1 | insecticidal toxin, TccA | 89 | P. luminescens TT01 |
2 | insecticidal toxin, TccB | 90 | P. luminescens TT01 |
3 | insecticidal toxin, TccC | 90 | P. luminescens TT01 |
No. | Predicted product | Homology (%) | Organism |
pS49 | |||
One | insecticidal toxin, TcdA like | 73 | |
2 | insecticidal toxin, | 66 | P. luminescens |
3 | insecticidal toxin, | 81 | P. luminescens |
4 | insecticidal toxin, | 70 | |
5 | peptide synthetase | 87 | |
6 | thiothemplate mechanism natural product synthetase | 58 | Erwinia amylovora ATCC BAA-2158 |
7 | polyketide synthase type I | 46 | |
8 | | 45 | E. amylovora ATCC BAA-2158 |
9 | polyketide synthase | 38 | E. amylovora ATCC BAA-2158 |
10 | peptide synthetase | 86 | |
11 | hypothetical protein | 87 | P. luminescens |
12 | 5'-nucleotidase family protein | 86 | P. asymbiotica ATCC43949 |
pS28 | |||
One | insecticidal toxin, | 89 | P. luminescens |
2 | insecticidal toxin, | 90 | P. luminescens |
3 | insecticidal toxin, | 90 | P. luminescens TT01 |
5.2.3 살충력 실험결과.5.2.3 Results of insecticidal experiments.
상기에서 확보한 포짓티브 코스미드 클론에 대한 살충력 조사 결과는 다음과 같다(도 6). 도 6에서와 같이 PtC28 클론의 살충력이 가장 높았으며 주사 후 7일 때에 100% 사멸하는 것으로 나타났다. PtC49의 경우 주사 후 6일 때에 50%의 살충력을 나타내었고 PtC 64와 267 클론은 주사 후 7일 때에 살충력이 50%에 도달하였다. 본 실험에서 대조군으로 사용한 멸균 생리식염수(0.85% NaCl)와 코스미드 벡터인 SuperCos1만을 가진 XL-1 Blue MRF'을 주사한 꿀벌부채명나방 유충에서는 외관상 변화가 전혀 없는 것으로 나타났다. The insecticidal investigation result of the positive cosmid clone obtained above is as follows (FIG. 6). As shown in FIG. 6, PtC28 clone had the highest insecticidal effect and was 100% killed at 7 days after injection. PtC49 showed 50% insecticidal at 6 days after injection, while PtC 64 and 267 clones reached 50% at 7 days after injection. In this experiment, the larval beetle larvae injected with XL-1 Blue MRF 'containing only sterile saline (0.85% NaCl) and the cosmid vector SuperCos1 showed no change in appearance.
5.3 독소 유전자 클로닝 및 재조합 발현 결과.5.3 Toxin Gene Cloning and Recombinant Expression Results.
현재까지 확보한 9종의 독소 콤플렉스(toxin complex, tc) 관련 유전자를 각각 대장균 E. coli BL21(DE3)에서 발현시킨 결과, TcdA-like를 제외한 대부분의 독소단백질들은 isopropyl-β-D-thiogalactoside (IPTG)에 의해서만 유도되었으며, 예상되는 단백질의 크기는 SDS-PAGE를 통하여 확인하였다(도 7). 대부분의 독소 단백질이 효과적으로 과발현되었으며 발현 시 온도, IPTG 첨가농도 및 배지조건을 변화시켜 이에 따른 발현 양상을 관찰하였다. 발현온도는 TccB와 TcdB2의 경우 30℃에서, TccC3의 경우는 37℃에서 가장 적합한 것으로 나타났다. IPTG 농도는 0.5∼1mM로 나타났으며, 배지의 경우 SB(Super broth)로 나타났다. As a result of expressing nine toxin complex ( tc ) -related genes so far, which were expressed in E. coli BL21 (DE3), most of the toxin proteins except TcdA-like were isopropyl-β-D-thiogalactoside ( IPTG) only, the expected protein size was confirmed by SDS-PAGE (Fig. 7). Most of the toxin proteins were effectively overexpressed, and the expression patterns were observed by changing the temperature, IPTG concentration and media conditions. The expression temperature of TccB and TcdB2 was found to be most suitable at 30 ° C and TccC3 at 37 ° C. The concentration of IPTG was 0.5-1 mM, and the medium was SB (Super broth).
5.4 살충성 검사5.4 Insecticidal Testing
각각의 독소 단백질이 가장 많이 발현된 상태의 재조합 대장균을 꿀벌부채명나방의 유충에게 주사한 경우 도9에서와 같이 TccB가 발현된 대장균에서 가장 높은 살충력을 나타내었으며 주사 후 5일 때에 85%의 유충이 사멸하는 것으로 나타났다. 또한 TccC3의 경우 주사 후 7일 때에 62.5%, TccC는 주사 후 6일 때에 57.5%의 살충력을 나타내었으나, 그 이외의 독소 단백질은 살충력이 20% 미만으로 매우 낮게 나타났다(도. 8). 갈색거저리 유충의 경우에도 TccB가 발현된 대장균에서 가장 높은 살충력을 나타내었으며 주사 후 5일 때에 유충이 모두 사멸하였다. 또한 주사농도를 50% 줄인 경우에도 80%의 높은 살충력을 나타내었다. TccC3의 경우는 57.5%, TcdB2는 35%의 살충력을 나타내었다(도 9). 유충에게 주사한 cell의 양은 TccB의 경우 2.7×104 cells, TccC3은 1.4×105 cells, TcdB2는 3.7×104 cells를 나타내었으며 대조구인 pET21a(+)를 함유하는 대장균의 경우는 3.6×104 cells를 나타내었다. 멸균된 0.85% NaCl이나 E. coli BL21(DE3)/pET21a(+)를 주사한 꿀벌부채명나방 유충의 경우, 주사 7일 후에는 유충의 90%가 번데기 (pupae)로 성장하는 것으로 보아 정상적인 발달 단계가 진행되는 것으로 나타났다. 그러나 살충력을 나타낸 4종의 독소 단백질 이외의 재조합 대장균의 경우에는 살충성을 나타내지는 않았으나 번데기로의 진행이 일어나지 않는 것으로 보아 직접적인 살충력보다는 유충의 발달저해에 관여할 것으로 여겨진다. 두 종류의 유충에게 높은 살충력을 나타낸 E. coli BL21(DE3)/pETccB를 주사한 경우 도10에서와 같이 멜라닌화되면서 죽는 것으로 나타났다. Recombinant Escherichia coli with the highest expression of each toxin protein was injected to the larvae of honey bee moths, which showed the highest insecticidal activity in TccB-expressed Escherichia coli as shown in FIG. It appeared to die. In addition, TccC3 showed 62.5% insecticidal at 7 days after injection and 57.5% at 6 days after injection, but other toxin proteins showed very low insecticides with less than 20% (Fig. 8). Brown larvae showed the highest insecticidal activity in TccB-expressing Escherichia coli, and all larvae were killed at 5 days after injection. In addition, even when the injection concentration was reduced by 50%, it showed high insecticidality of 80%. In the case of TccC3 57.5%, TcdB2 showed a 35% insecticide (Fig. 9). The amount of cells injected into the larvae was 2.7 × 10 4 cells for TccB, 1.4 × 10 5 cells for TccC3, and 3.7 × 10 4 cells for TcdB2, and 3.6 × 104 for E. coli containing pET21a (+). cells. In the case of honeybee moth larvae injected with sterile 0.85% NaCl or E. coli BL21 (DE3) / pET21a (+), 90% of the larvae develop into pupae after 7 days of injection. The steps were shown to proceed. However, the recombinant Escherichia coli other than the four toxin proteins that exhibited insecticidal properties did not show insecticidality but did not progress to pupa, so it is thought to be involved in larval development rather than direct insecticidal activity. Injecting E. coli BL21 (DE3) / pETccB with high insecticidal properties to both larvae showed melaninization as shown in FIG. 10.
본 발명에 따르면 살충성 포토랍두스 템페라타 M1021 균주로부터 분리된 새로운 단백질을 활용하여 친환경적인 생물학적 살충제를 제공할 수 있어 해충에 대한 새로운 생물학적 해충 방제에 이용할 수 있다. According to the present invention, it is possible to provide an environmentally friendly biological insecticide by utilizing a new protein isolated from the insecticidal photolabduus temperata M1021 strain, and thus can be used for new biological pest control against pests.
Claims (24)
- 서열번호1의 아미노산 서열을 갖는 것을 특징으로 하는 살충성 단백질.An insecticidal protein having the amino acid sequence of SEQ ID NO: 1.
- 제1항에 있어서, 상기 살충성 단백질은 포토랍두스 템페라타 M1021(수탁번호: KCTC 12006BP)로부터 분리한 것을 특징으로 하는 살충성 단백질.According to claim 1, wherein the insecticidal protein is insecticidal protein, characterized in that isolated from Photorabdus temperata M1021 (Accession Number: KCTC 12006BP).
- 서열번호1의 아미노산 서열을 코딩하는 것을 특징으로 하는 살충성 단백질 유전자.An insecticidal protein gene encoding the amino acid sequence of SEQ ID NO: 1.
- 제3항에 있어서, 상기 유전자는 서열번호2의 염기서열을 갖는 것을 특징으로 하는 살충성 단백질 유전자.The insecticidal protein gene according to claim 3, wherein the gene has a nucleotide sequence of SEQ ID NO.
- 제3항 또는 제4항의 살충성 단백질 유전자를 포함하는 재조합 발현 벡터.A recombinant expression vector comprising the insecticidal protein gene of claim 3 or 4.
- 제5항의 발현벡터를 포함하는 살충성 단백질 제조 형질 전환체.A pesticidal protein preparation transformant comprising the expression vector of claim 5.
- 제1항 또는 제2항의 살충성 단백질을 포함하는 해충 방제용 조성물.A pest control composition comprising the insecticidal protein of claim 1.
- 제7항에 있어서, 상기 해충 방제용 조성물은 나비목 해충에 대해 살충활성을 갖는 것을 특징으로 하는 해충 방제용 조성물.8. The pest control composition according to claim 7, wherein the pest control composition has insecticidal activity against lepidopteran pests.
- 제8항에 있어서, 상기 나비목 해충은 꿀벌부채명나방(Galleria mellonella), 배추좀나방(Plutella xylostella), 담배거세미나방(Spodoptera litura), 털뿔가지나방(Alcis angulifera), 애모무늬잎말이나방(Adoxophyes orana), 감나무잎말이나방(Ptycholoma lecheana), 밤애기잎말이나방(Cydia Kurokoi), 복숭아순나방(Grapholita molesta), 은무늬굴나방(Lyonetia prunifoliella), 복숭아심식나방(Carposina sasakii), 파밤나방(Spodoptera exigua), 목화바둑나방(Diaphania indica), 혹명나방(Cnaphalocrocis medinalis), 이화명나방(Chilo suppressalis), 및 왕담배나방(Helicoverpa armigera)으로 이루어진 군으로부터 선택된 해충임을 특징으로 하는 해충 방제용 조성물.According to claim 8, The lepidoptera pests are Galleria mellonella , Chinese cabbage moth ( Plutella xylostella ), Tobacco coarse moth ( Spodoptera litura ), Alcis angulifera , Amoxophyte moth ( Adoxophyes) orana), persimmon ipmalyi moth (Ptycholoma lecheana), the night the baby ipmalyi moth (Cydia Kurokoi), peach net moth (Grapholita molesta), is patterned oysters moth (Lyonetia prunifoliella), peach simsik moth (Carposina sasakii), beet armyworm (Spodoptera exigua ), A cotton monarch moth ( Diaphania indica ), a dead moth ( Cnaphalocrocis medinali s), a moth ( chilo suppressalis ), and a pest control composition characterized in that the pest selected from the group consisting of Helicoverpa armigera .
- 제7항에 있어서, 상기 해충 방제용 조성물은 딱정벌레목 해충에 대해 살충활성을 갖는 것을 특징으로 하는 해충 방제용 조성물.8. The pest control composition according to claim 7, wherein the pest control composition has insecticidal activity against coleopteran pests.
- 제10항에 있어서, 상기 딱정벌레목 해충은 갈색거저리(Tenebrio molitor Linnaeus), 오리나무잎벌레(Agelastica coerulea Baly), 사과둥근나무좀(Xyleborus apicalis Blandford), 서울나무좀(Scolytus seulensis), 쌀 바구미(Scolytus seulensis), 소나무좀Tomicus piniperda), 밤바구미(Culculio sikkimensis)로 이루어진 군으로부터 선택된 해충임을 특징으로 하는 해충 방제용 조성물. 11. The method of claim 10, wherein the coleopteran pests are brown goose (Tenebrio molitor Linnaeus), alder leaf beetle (Agelastica coerulea Baly), apple tree beetle (Xyleborus apicalis Blandford), Seoul beetle (Scolytus seulensis), rice weevil (Scolytus seulensis) , Pine needles Tomicus piniperda), chestnut weevil (Culculio sikkimensis) pest control composition characterized in that the pest selected from the group consisting of.
- 제7항의 해충 방제용 조성물을 이용하는 것을 특징으로 하는 해충 방제 방법.A pest control method comprising using the pest control composition according to claim 7.
- 서열번호3의 아미노산 서열을 갖는 것을 특징으로 하는 살충성 단백질.Insecticidal protein having the amino acid sequence of SEQ ID NO: 3.
- 제13항에 있어서, 상기 살충성 단백질은 포토랍두스 템페라타 M1021(수탁번호: KCTC 12006BP)로부터 분리한 것을 특징으로 하는 살충성 단백질.According to claim 13, wherein the insecticidal protein is insecticidal protein, characterized in that isolated from Photorabdus temperata M1021 (Accession Number: KCTC 12006BP).
- 서열번호3의 아미노산 서열을 코딩 하는 것을 특징으로 하는 살충성 단백질 유전자.An insecticidal protein gene, characterized by encoding the amino acid sequence of SEQ ID NO: 3.
- 제15항에 있어서, 상기 유전자는 서열번호4의 염기서열을 갖는 것을 특징으로 하는 살충성 단백질 유전자.The insecticidal protein gene according to claim 15, wherein the gene has a nucleotide sequence of SEQ ID NO.
- 제15항 또는 제16항의 살충성 단백질 유전자를 포함하는 재조합 발현 벡터.A recombinant expression vector comprising the insecticidal protein gene of claim 15.
- 제17항의 발현벡터를 포함하는 살충성 단백질 제조 형질 전환체.A pesticidal protein preparation transformant comprising the expression vector of claim 17.
- 제13항 또는 제14항의 살충성 단백질을 포함하는 해충 방제용 조성물.A pest control composition comprising the insecticidal protein of claim 13 or 14.
- 제19항에 있어서, 상기 해충 방제용 조성물은 나비목 해충에 대해 살충활성을 갖는 것을 특징으로 하는 해충 방제용 조성물.The pest control composition according to claim 19, wherein the pest control composition has insecticidal activity against Lepidoptera pests.
- 제20항에 있어서, 상기 나비목 해충은 꿀벌부채명나방(Galleria mellonella), 배추좀나방(Plutella xylostella), 담배거세미나방(Spodoptera litura), 털뿔가지나방(Alcis angulifera), 애모무늬잎말이나방(Adoxophyes orana), 감나무잎말이나방(Ptycholoma lecheana), 밤애기잎말이나방(Cydia Kurokoi), 복숭아순나방(Grapholita molesta), 은무늬굴나방(Lyonetia prunifoliella), 복숭아심식나방(Carposina sasakii), 파밤나방(Spodoptera exigua), 목화바둑나방(Diaphania indica), 혹명나방(Cnaphalocrocis medinalis), 이화명나방(Chilo suppressalis), 및 왕담배나방(Helicoverpa armigera)으로 이루어진 군으로부터 선택된 해충임을 특징으로 하는 해충 방제용 조성물.The method of claim 20, wherein the lepidoptera pests are Galleria mellonella , Plutella xylostella , moth Spodoptera litura , Alcis angulifera , Amoxophyte moth ( Adoxophyes) orana), persimmon ipmalyi moth (Ptycholoma lecheana), the night the baby ipmalyi moth (Cydia Kurokoi), peach net moth (Grapholita molesta), is patterned oysters moth (Lyonetia prunifoliella), peach simsik moth (Carposina sasakii), beet armyworm (Spodoptera exigua ), A cotton monarch moth ( Diaphania indica ), a dead moth ( Cnaphalocrocis medinali s), a moth ( chilo suppressalis ), and a pest control composition characterized in that the pest selected from the group consisting of Helicoverpa armigera .
- 제19항에 있어서, 상기 해충 방제용 조성물은 딱정벌레목 해충에 대해 살충활성을 갖는 것을 특징으로 하는 해충 방제용 조성물.The pest control composition according to claim 19, wherein the pest control composition has insecticidal activity against coleopteran pests.
- 제22항에 있어서, 상기 딱정벌레목 해충은 갈색거저리(Tenebrio molitor Linnaeus), 오리나무잎벌레(Agelastica coerulea Baly), 사과둥근나무좀(Xyleborus apicalis Blandford),서울나무좀(Scolytus seulensis ), 쌀 바구미(Scolytus seulensis ), 소나무좀Tomicus piniperda), 밤바구미(Culculio sikkimensis)로 이루어진 군으로부터 선택된 해충임을 특징으로 하는 해충 방제용 조성물. 23. The method of claim 22, wherein the coleopteran pests are brown goose (Tenebrio molitor Linnaeus), alder leaf beetle (Agelastica coerulea Baly), apple tree beetle (Xyleborus apicalis Blandford), Seoul beetle (Scolytus seulensis), rice weevil (Scolytus seulensis) , Pine bark Tomicus piniperda), Bum weevil (Culculio sikkimensis) pest control composition characterized in that the pest selected from the group consisting of.
- 제19항의 해충 방제용 조성물을 이용하는 것을 특징으로 하는 해충 방제 방법.The pest control method using the pest control composition of Claim 19.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020110055507A KR101314263B1 (en) | 2011-06-09 | 2011-06-09 | Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins |
KR10-2011-0055507 | 2011-06-09 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2012169699A1 true WO2012169699A1 (en) | 2012-12-13 |
Family
ID=47296238
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2011/006987 WO2012169699A1 (en) | 2011-06-09 | 2011-09-22 | Novel insecticidal protein, composition for controlling pests and method for controlling pests using same |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR101314263B1 (en) |
WO (1) | WO2012169699A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2024136542A1 (en) * | 2022-12-22 | 2024-06-27 | 주식회사 남보 | Photorhabdus cinerea nb-yg4-3 strain, pest control composition comprising same, and pest control method using same |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999003328A1 (en) * | 1997-07-17 | 1999-01-28 | Commonwealth Scientific And Industrial Research Organisation | TOXIN GENES FROM THE BACTERIA XENORHABDUS NEMATOPHILUS AND $i(PHOTORHABDUS LUMINESCENS) |
WO1999042589A2 (en) * | 1998-02-20 | 1999-08-26 | Novartis Pharma Ag. | Insecticidal toxins from photorhabdus |
KR20000037116A (en) * | 1996-08-29 | 2000-07-05 | 케네쓰 엘. 로에르트셔 | Insecticidal Protein Toxins from Photorhabdus |
KR100522667B1 (en) * | 2003-06-04 | 2005-10-20 | 김용균 | Photorhabdus temperata subsp. temperata ANU101 |
-
2011
- 2011-06-09 KR KR1020110055507A patent/KR101314263B1/en active IP Right Grant
- 2011-09-22 WO PCT/KR2011/006987 patent/WO2012169699A1/en active Application Filing
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20000037116A (en) * | 1996-08-29 | 2000-07-05 | 케네쓰 엘. 로에르트셔 | Insecticidal Protein Toxins from Photorhabdus |
WO1999003328A1 (en) * | 1997-07-17 | 1999-01-28 | Commonwealth Scientific And Industrial Research Organisation | TOXIN GENES FROM THE BACTERIA XENORHABDUS NEMATOPHILUS AND $i(PHOTORHABDUS LUMINESCENS) |
WO1999042589A2 (en) * | 1998-02-20 | 1999-08-26 | Novartis Pharma Ag. | Insecticidal toxins from photorhabdus |
KR100522667B1 (en) * | 2003-06-04 | 2005-10-20 | 김용균 | Photorhabdus temperata subsp. temperata ANU101 |
Non-Patent Citations (2)
Title |
---|
DATABASE NCBI 13 July 2011 (2011-07-13), accession no. EJ87813.1 * |
DATABASE NCBI 30 August 2011 (2011-08-30), accession no. EN04143.1 * |
Also Published As
Publication number | Publication date |
---|---|
KR101314263B1 (en) | 2013-10-02 |
KR20120136523A (en) | 2012-12-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Chattopadhyay et al. | Recent trends of modern bacterial insecticides for pest control practice in integrated crop management system | |
AU675628B2 (en) | Novel microorganism and insecticide | |
Berry | The bacterium, Lysinibacillus sphaericus, as an insect pathogen | |
Ruffner et al. | Oral insecticidal activity of plant‐associated pseudomonads | |
JP3657593B2 (en) | Hotaruhabudas insecticidal protein toxin | |
AU755389B2 (en) | Insecticidal protein toxins from xenorhabdus | |
Ciche et al. | Photobactin: a catechol siderophore produced by Photorhabdus luminescens, an entomopathogen mutually associated with Heterorhabditis bacteriophora NC1 nematodes | |
US10039286B2 (en) | Insecticidal yersinia entomophaga compositions and uses thereof | |
NZ334847A (en) | Oral insecticidal composition containing protein fragments derived from a Xenorhabdus species | |
Teoh et al. | Multifaceted interactions between the pseudomonads and insects: mechanisms and prospects | |
Berry et al. | The Bacillus sphaericus toxins and their potential for biotechnological development | |
US20040055036A1 (en) | Toxin genes from the bacteria xenorhabdus nematophilus and photorhabdus luminescens | |
Mathur et al. | A 37 kDa Txp40 protein characterized from Photorhabdus luminescens sub sp. akhurstii conferred injectable and oral toxicity to greater wax moth, Galleria mellonella | |
KR101380111B1 (en) | Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins | |
WO2012169699A1 (en) | Novel insecticidal protein, composition for controlling pests and method for controlling pests using same | |
AU778146B2 (en) | Biological control of nematodes | |
Abd-Elgawad | Toxic secretions of Photorhabdus and their efficacy against crop insect pests. | |
Stahly et al. | The genus Bacillus-insect pathogens | |
Amorim et al. | Development of Culex quinquefasciatus resistance to Bacillus sphaericus strain IAB59 needs long term selection pressure | |
Sezen et al. | Identification and pathogenicity of bacteria from European shot-hole borer, Xyleborus dispar Fabricius (Coleoptera: Scolytidae) | |
MURATOĞLU et al. | An entomopathogenic bacterium, Pseudomonas putida, from Leptinotarsa decemlineata | |
Sezen et al. | Characterisation and toxicity of Bacillus thuringiensis strains from hazelnut pests and fields | |
CN101300268A (en) | Novel bacterial proteins with pesticidal activity | |
WO2001016305A2 (en) | Nucleotide sequences encoding an insectidal protein complex from serratia | |
Paliwal | Identification and characterisation of new aphid killing bacteria for use as biological pest control agents |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11867147 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 11867147 Country of ref document: EP Kind code of ref document: A1 |