KR101380111B1 - Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins - Google Patents

Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins Download PDF

Info

Publication number
KR101380111B1
KR101380111B1 KR1020130057914A KR20130057914A KR101380111B1 KR 101380111 B1 KR101380111 B1 KR 101380111B1 KR 1020130057914 A KR1020130057914 A KR 1020130057914A KR 20130057914 A KR20130057914 A KR 20130057914A KR 101380111 B1 KR101380111 B1 KR 101380111B1
Authority
KR
South Korea
Prior art keywords
moth
insecticidal
protein
composition
gene
Prior art date
Application number
KR1020130057914A
Other languages
Korean (ko)
Other versions
KR20130060251A (en
Inventor
신재호
장은경
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Priority to KR1020130057914A priority Critical patent/KR101380111B1/en
Publication of KR20130060251A publication Critical patent/KR20130060251A/en
Application granted granted Critical
Publication of KR101380111B1 publication Critical patent/KR101380111B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

Abstract

본 발명은 포토랍두스 템페라타 M1021(수탁번호: KACC91627P)로부터 분리한 것을 특징으로 하는 신규한 살충성 단백질에 관한 것이다. 또한, 본 발명은 상기 신규한 살충성 단백질를 포함하는 해충 방제용 조성물에 관한 것이며, 이를 이용한 해충 방제 방법에 관한 것이다. The present invention relates to a novel insecticidal protein, characterized in that it has been isolated from photolabdus temperata M1021 (Accession No .: KACC91627P). The present invention also relates to a pest control composition comprising the novel pesticidal protein, and to a pest control method using the same.

Description

신규의 살충성 단백질, 이를 이용한 해충 방제용 조성물 및 해충 방제 방법. {Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins}A novel insecticidal protein, a composition for controlling pests and a method for controlling pests using the same. {Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins}
본 발명은 신규한 균주인 포투랍두스 템페라타 M1021(수탁번호: KACC91627P)로부터 분리한 신규의 살충성 단백질, 신규의 살충성 단백질 유전자를 포함하는 재조합 발현 벡터, 발현 벡터를 포함하는 신규의 살충성 단백질 제조 형질 전환체에 관한 것이다. The present invention is a novel insecticidal protein isolated from a novel strain Poturabdus temperata M1021 (accession number: KACC91627P), a recombinant expression vector containing a novel insecticidal protein gene, a novel insecticidal effect including an expression vector It relates to a protein-producing transformant.
또한 본 발명은 상기 신규의 살충성 단백질을 포함하는 해충 방제용 조성물에 관한 것이다. In addition, the present invention relates to a composition for controlling pests comprising the novel insecticidal protein.
또한 본 발명은 상기 해충 방제용 조성물을 이용하여 해충을 방제하는 방법에 관한 것이다. In addition, the present invention relates to a method of controlling pests using the composition for controlling pests.
곤충 및 다른 해충들은 농작물 손실과 이러한 해충들을 방제(control)하는 비용에 있어서 농부에게 해마다 수천만 달러의 비용을 부담시킨다. 농작물 생산 환경에서 해충에 의하여 야기되는 손실은 농작물 수율의 감소, 농작물 질의 저하, 및 추수 비용 증가를 포함한다.Insects and other pests cost farmers tens of millions of dollars each year in crop loss and the cost of controlling these pests. The losses caused by pests in the crop production environment include a decrease in crop yield, a decrease in crop quality, and an increase in harvest costs.
원하는 수준의 방제를 보장하기 위하여 화학적인 살충제에 가장 많이 의존하고 있다. 이러한 살충제는 토양 위에 결합되거나 또는 토양 속으로 삽입되나 살충제의 지속적인 사용은 내성 곤충이 진화하는 것을 허용하여 왔다. 매우 많은 개체수의 유충, 폭우, 및 살충제 적용 장비의 부적절한 측정과 같은 상황들이 만족스럽지 못한 통제를 초래할 수 있다. 또한, 살충제의 사용은 종종 토양과 표면 및 지하 수원의 오염과 같은 환경적인 관심사를 야기한다. They rely most on chemical pesticides to ensure the desired level of control. These pesticides are either bound onto the soil or inserted into the soil, but the continued use of pesticides has allowed resistant insects to evolve. Situations such as very large populations of larvae, heavy rain, and improper measurement of pesticide application equipment can lead to unsatisfactory control. In addition, the use of pesticides often raises environmental concerns, such as contamination of soils and surfaces and underground water sources.
대중은 또한 음식에서 발견될 수 있는 합성 화학약품의 잔류량에 관심을 가져 왔다. 살충제를 가지고 작업하는 일은 또한 그것을 사용하는 사람에게 해를 끼친다. 따라서, 합성 화학약품은 그들의 잠재적인 유독성 환경 결과들에 대하여 점점 더 면밀히 검사되고 있다. 광범위하게 사용되는 합성 화학 살충제의 예에는 유기염화물, 예를 들면 DDT, 미렉스(mirex), 케폰(kepone), 린단(lindane), 알드린(aldrin), 클로르단 (chlordane), 알디카브(aldicarb), 및 디엘드린(dieldrin); 유기인산물, 예를 들면, 클로르피리포스 (chlorpyripos), 파라치온(parathion), 말라치온(malathion), 및 다이아지논(diazinon); 및 카바메이츠(carbamates)가 포함된다. The public has also been interested in the residual amounts of synthetic chemicals that can be found in food. Working with pesticides also harms the people who use them. Therefore, synthetic chemicals are increasingly being screened for their potential toxic environmental consequences. Examples of widely used synthetic chemical pesticides include organic chlorides such as DDT, mirex, kepone, lindane, aldrin, chlordane, aldicarb. ), and dieldrin; Organophosphates such as chlorpyripos, parathion, malathion, and diazinon; And carbamates.
현재 화학적 살충제에 대한 유해성에 대한 우려가 점점 높아지고 있다. 예를 들어 1957년부터 DDT의 유해성에 대한 의문이 제기되기 시작하였고, DDT의 반감기는 2년에서 15년으로 잘 분해되지 않으며 체내의 지방 성분에 주로 쌓이고, 땅이나 물에 남아 있던 DDT는 식물에 흡수된 후 인간이 이를 음식을 통해 섭취할 경우에는 암이 유발될 수 있다는 연구결과가 나오면서 1970년대부터 현재까지 대부분의 국가에서 DDT를 농약으로 사용하는 것을 금지하였다. Currently, there is a growing concern about the hazards of chemical pesticides. For example, from 1957, questions about the harmfulness of DDT began to be raised, and the half-life of DDT is not well decomposed from 2 to 15 years, and it is mainly accumulated in fat components in the body. When humans consume it through food after absorption, research has shown that cancer can be caused, and the use of DDT as a pesticide was prohibited in most countries from the 1970s to the present day.
또한 염소 또는 벤젠을 원료로 하는 BHC의 경우, 원료가 풍부하고 값이 저렴하고 살충력이 강하며, 인축에는 해가 적기 때문에 미국에서 개발 및 합성을 주도하여 전세계적인 관심을 끌었으나, 사용량의 증가와 함께 최근 환경 오염 문제가 대두되면서 서양 각국과 오스트레일리아 등 여러 나라에서는 엄격하게 상기 농약 사용을 제한하고 있다.In addition, in the case of BHC, which uses chlorine or benzene as a raw material, it is rich in raw materials, inexpensive, has strong insecticidal power, and is less harmful to humans. In addition, as the environmental pollution problem has recently emerged, various countries such as Western countries and Australia are strictly restricting the use of the pesticides.
이와 같이 그 동안 해충을 방제하기 위하여 유기 화학적 합성 살충제가 널리 사용되고 있으나, 수십 년에 걸친 남용으로 인하여 해충군의 이상격발 또는 저항성 해충의 출현, 인간을 비롯한 비 목적 충에 대한 독성발현 및 환경 계의 오염 등의 많은 부작용을 야기하고 있다. 전 세계적으로 농약의 잔류 독성과 환경오염으로 인하여 여러 가지 문제점이 나타나자 인류의 건강을 지키기 위하여 우선 독성이 강한 유기합성 농약의 사용을 자제하기로 국제적인 합의가 도출되기도 하였다. 이러한 국제 협약에 의하여 전 세계는 2004년에 지난 10년 전에 사용하던 화학합성 유기인계, 유기염소계 살충제의 50%까지 생산이 감축되었고, 2010년까지 다시 유기인계, 유기염소계 살충제의 생산을 50% 감소시키기로 한 국제적 협의에 동의하여 현재 실행 단계에 있다. As such, organic and chemically synthesized insecticides have been widely used to control pests, but due to abuse over decades, abnormal attacks of pest groups or the emergence of resistant pests, toxicity to non-objective insects including humans, and environmental issues. It causes many side effects such as contamination. As various problems appeared around the world due to residual toxicity and environmental pollution of pesticides, an international agreement was drawn to refrain from the use of highly toxic organic synthetic pesticides in order to protect human health. According to these international agreements, the world's production was reduced by 50% of the chemically synthesized organophosphorus and organochlorine pesticides used 10 years ago in 2004, and the production of organophosphorus and organochlorine pesticides again by 2010 was reduced by 50%. It is currently in the implementation phase, agreeing to the international agreements to be made.
그러나 독성농약 감축생산 협의 이후, 현재 전 세계적으로 많은 연구진이 환경 친화적 살충제를 개발하려고 많은 노력을 했음에도 불구하고, 이제까지 사용하였던 유기인계, 유기염소계 농약을 대체할 새롭고 안전한 살충제를 개발하지 못하였기 때문에 전 세계적인 농약감축회의 의결내용이 지켜지기 어려운 상황이며, 조만간 안전한 살충제가 개발되어 생산되지 않으면 해충방제용 살충제뿐만 아니라 식량을 비롯한 농산물 생산에 관련된 농업용 살충제의 부족으로 인해 국내외적으로 큰 문제가 대두될 것으로 예상된다. However, after the discussion on the reduction of toxic pesticide production, although many researchers around the world have made great efforts to develop environmentally friendly pesticides, they have not been able to develop new and safe pesticides to replace organophosphorus and organochlorine pesticides that have been used so far. It is difficult to comply with the resolutions of the Global Pesticide Reduction Council, and if safe pesticides are not developed and produced sooner or later, a major problem will arise at home and abroad due to the lack of pesticides for agricultural use related to the production of agricultural products including food as well as pesticides for pest control. It is expected.
최근에는 화학비료나 농약의 사용을 줄이거나 대체할 수 있으며, 인축에 위해가 적고 작물에 피해를 일으키지 않으며, 토양 생태계와 같은 환경에 대한 피해가 적은 생물학적 방제의 기술이 미생물에 의해 가능하다는 것이 국내외 여러 연구자들에 의해 입증됨에 따라, 화학농약의 폐단을 보완할 수 있는 생물 농약에 대한 관심과 연구가 증가하고 있는 추세이다. In recent years, it is possible to reduce or replace the use of chemical fertilizers and pesticides, it is possible to use microorganisms to control biological control technology that does not cause damage to crops, does not cause damage to humans, and has little damage to the environment such as soil ecosystem. As evidenced by several researchers, interest and research on biological pesticides that can supplement the evils of chemical pesticides are increasing.
이에 따라 최근 사용이 증가 중인 생물학적인 살충제는 토양 미생물인 바실러스 슈린지엔시스(Bacillus thuringiensis, "B.t.")이다. 어떤 바실러스 독소 유전자는 분리되어 서열이 밝혀졌으며, 재조합 DNA에 기초한 산물이 생산되고 사용이 승인되어 왔다. 게다가, 유전공학 기술의 사용과 함께 이러한 독소를 농경 환경에 전달하기 위한 새로운 접근 방법이 개발 중에 있다. 이들은 곤충에 내성을 가지는 독소 유전자에 의해 유전적으로 조작된 식물의 사용 및 독소 전달 수단으로서 안정화된 완전한 미생물 세포의 사용을 포함한다. 이와 같이, 분리된 바실러스 독소 유전자는 상업적으로 가치가 커지고 있다. Accordingly, a biological pesticide that has recently been increasing in use is a soil microorganism, Bacillus thuringiensis ("B.t."). Certain Bacillus toxin genes have been isolated and sequenced, and products based on recombinant DNA have been produced and approved for use. In addition, new approaches are being developed to deliver these toxins to the agricultural environment with the use of genetic engineering techniques. These include the use of plants genetically engineered by toxin genes that are resistant to insects and the use of stabilized intact microbial cells as a means of toxin delivery. As such, the isolated Bacillus toxin gene is of increasing commercial value.
그러나 성공적인 바실러스 독소의 사용은 곤충에 의한 B.t. 독소에 대한 내성을 유발하게 되었다. 어떤 곤충은 바실러스 독소의 효과가 잘 듣지 않으며, 이러한 곤충의 예에는 바구미 또는 검은색 뿌리 잘라먹는 벌레(black cutworm)와 같은 곤충뿐만 아니라, 이제까지 B.t. δ-엔도톡신에 대해 뚜렷한 주목할 만한 감수성을 보이지 않아 온 대부분 종의 성충이 포함된다. 따라서, B.t. 트랜스유전자 식물 공학에 있어서 내성 관리 방법이 큰 관심의 대상이 되어왔음에도 불구하고, 다양한 곤충을 효과적으로 방제하기 위해서 식물에서 발현될 수 있는 추가적인 유전자를 개발할 필요가 남아있다.However, the successful use of Bacillus toxin has been attributed to B.t. It has led to resistance to toxins. Some insects do not work well with the effects of Bacillus toxin, and examples of such insects include insects such as weevil or black cutworm, as well as B.t. Most species of adult worms that have not shown a pronounced and notable sensitivity to δ-endotoxin are included. Thus, B.t. Although resistance management methods have been of great interest in transgene plant engineering, there remains a need to develop additional genes that can be expressed in plants in order to effectively control various insects.
이에, 본 발명자들은 농작물에 대한 해충 방제를 할 수 있는 신규의 살충성 단백질 을 이용한 새로운 생물 농약의 개발을 목표로 신규한 미생물로부터 해충 방제용으로 사용 가능한 유전자의 탐색을 위하여 노력한 결과 신규한 살충성 단백질을 발견하고 본 발명을 완성하였다. Accordingly, the present inventors have tried to search for genes usable for pest control from new microorganisms with the aim of developing new biological pesticides using novel insecticidal proteins capable of controlling pests on agricultural crops. Protein was discovered and the present invention was completed.
본 발명의 목적은 신규한 생물학적인 살충제로 가치가 인정되는 살충성 단백질 및 이를 암호화하는 유전자, 유전자를 포함하는 발현 벡터, 신규한 살충성 단백질을 제조하는 형질 전환체를 제공하는데 있다. An object of the present invention is to provide an insecticidal protein that is recognized as a novel biological pesticide, a gene encoding the same, an expression vector containing the gene, and a transformant for producing a novel insecticidal protein.
본 발명의 또 다른 목적은 신규한 살충성 단백질을 포함하는 해충 방제용 조성물을 제공하고 이를 이용한 새로운 생물학적 해충 방제방법을 제공하는 데에 있다. Another object of the present invention is to provide a composition for controlling pests comprising a novel pesticidal protein, and to provide a novel method for controlling biological pests using the same.
상기 과제를 해결하기 위해 본 발명은 서열번호 1 또는 3의 아미노산 서열을 갖는 것을 특징으로 하는 살충성 단백질을 제공한다. In order to solve the above problems, the present invention provides a pesticidal protein, characterized in that it has the amino acid sequence of SEQ ID NO: 1 or 3.
또한 본 서열번호 1또는 3의 아미노산 서열을 코딩 하는 것을 특징으로 하는 살충성 단백질 유전자를 제공한다. In addition, it provides a pesticidal protein gene, characterized in that encoding the amino acid sequence of SEQ ID NO: 1 or 3.
또한 본 발명은 신규한 살충성 단백질 유전자를 포함하는 재조합 발현벡터 및 이를 포함하는 살충성 단백질 제조 형질 전환체를 제공한다. In addition, the present invention provides a recombinant expression vector comprising a novel insecticidal protein gene and a transformant for producing a pesticidal protein comprising the same.
본 발명의 또 다른 양태로써, 본 발명은 신규한 살충성 단백질을 포함하는 해충 방제용 조성물을 제공한다. As another aspect of the present invention, the present invention provides a composition for controlling pests comprising a novel insecticidal protein.
또한, 본 발명은 신규한 살충성 단백질을 포함하는 해충 방제용 조성물을 이용한 해충 방제 방법을 제공한다. In addition, the present invention provides a method for controlling pests using a composition for controlling pests comprising a novel pesticidal protein.
본 발명에 따르면, 신규의 살충성 포토랍두스 템퍼라타 M1021(포토랍투스 temperate M1021, KACC91627P) 유래의 신규한 살충성 단백질을 확보할 수 있으며 이를 이용하여 새로운 생물학적 살충제로써 유용하게 이용될 수 있다. In accordance with the present invention, a novel pesticidal picture drawer Douce tempering rata M1021 (picture drawer tooth temperate M1021, KACC91627P) can be secured to the novel pesticidal proteins of origin, and may be useful as a new biological insecticide with them.
도1은 PCR 조건표를 도시한다. (*Annealing temperature(AT): Tcc F1/R1; 50℃, TcdF2/R2; 54℃, TcaC F3/R3; 54℃)
도2는 이상적인 클론의 개수를 계산하기 위한 식을 도시한다.
도3은 Pooling 및 subpooling PCR을 이용한 tcd locus와 tcc locus에 대한 포짓티브 코스미드 클론을 도시한다. (M; size marker(λ/HindⅢ), A) Pooling PCR 방법에 의한 tcdB2의 포짓티브 클론을 가진 그룹의 스크리닝 B) Subpooling PCR 방법에 의한 tcdB2의 포짓티브 클론의 확보(PtC 49, 64, 267) C) Pooling PCR 방법에 의한 tccC의 포짓티브 클론을 가진 그룹의 스크리닝 D) Subpooling PCR 방법에 의한 tccC의 positive clone의 확보(PtC 28). *PtC; Photorhabdus temperata M1021's cosmid library)
도4는 제한효소 절단에 의한 재조합 코스미드 플라스미드의 분석 결과를 도시한다.
도5는 코스미드 플라스미드 pS49(A)와 pS28(B)에서의 ORF의 구성을 도시한다(A: 적색, B: 황색 C: 녹색)
도6은 포짓티브 코스미드 클론의 꿀벌부채명나방 유충에 대한 살충력 시험 결과를 나타낸다.
도7은 재조합 독소 단백질의 SDS-PAGE 분석 결과를 나타낸다. (M: 분자 단백질 표준, 화살표는 재조합 독소 단백질의 위치를 나타낸다, 6% SDS-PAGE 겔은 Coomassie brilliant blue를 나타낸다. A)TccA, B)TccB, C)TccC, D)TcaC, E)TcdA1-like, F)TcdB2, G)TccC3)
도8은 꿀벌부채명 나방 유충에 대한 살충력 결과를 도시한다.
도9는 갈색 거저리 유충에 대한 살충력 결과를 도시한다.
도10은 꿀벌부채명 나방 유충(A)과 갈색 거저리 유충(B)에 살충성 독소 단백질을 처리시의 모습을 나타낸다. (상단: 처리전, 하단:처리후)
1 shows a PCR condition table. (*Annealing temperature(AT): Tcc F1/R1; 50℃, TcdF2/R2; 54℃, TcaC F3/R3; 54℃)
2 shows an equation for calculating the number of ideal clones.
3 shows positive cosmid clones for tcd locus and tcc locus using pooling and subpooling PCR. (M; size marker (λ/HindⅢ), A) Screening of groups with tcdB2 positive clones by pooling PCR method B) Securing tcdB2 positive clones by subpooling PCR method (PtC 49, 64, 267) C) Screening of groups with positive clones of tccC by pooling PCR method D) Securing positive clones of tccC by subpooling PCR method (PtC 28). *PtC; Photorhabdus temperata M1021's cosmid library)
Figure 4 shows the analysis results of the recombinant cosmid plasmid by restriction enzyme digestion.
Figure 5 shows the composition of the ORF in the cosmid plasmid pS49 (A) and pS28 (B) (A: red, B: yellow C: green)
Figure 6 shows the results of the insecticidal power of the positive cosmid clone against the larvae of the bee larva moth.
7 shows the results of SDS-PAGE analysis of the recombinant toxin protein. (M: molecular protein standard, arrows indicate the location of the recombinant toxin protein, 6% SDS-PAGE gel indicates Coomassie brilliant blue. A)TccA, B)TccB, C)TccC, D)TcaC, E)TcdA1- like, F)TcdB2, G)TccC3)
Fig. 8 shows the results of insecticidal activity against the larvae of the moth of the name of the honey bee.
Fig. 9 shows the results of insecticidal activity against brown mealworm larvae.
Fig. 10 shows the state when the insecticidal toxin protein is treated on the moth larvae (A) and brown larvae (B). (Top: before treatment, bottom: after treatment)
본 발명에 따르면 서열번호 1 및 서열번호 3으로 표시되는 아미노산 서열을 갖는 살충성 단백질이 제공되며 또한 이들 아미노산을 코딩하는 뉴클레오티드 서열이 제공된다. According to the present invention, a pesticidal protein having an amino acid sequence represented by SEQ ID NO: 1 and SEQ ID NO: 3 is provided, and a nucleotide sequence encoding these amino acids is provided.
본 발명에 있어서, 상기 살충성 단백질은 포토랍두스 템페라타 M1021(수탁번호: KACC91627P)로부터 분리한 것을 특징으로 할 수 있다. In the present invention, the insecticidal protein may be characterized in that it is isolated from Photorhabdus temperata M1021 (accession number: KACC91627P).
또한 본 발명에 따른 상기 단백질은 서열번호 1의 아미노산 서열로 이루어진 살충성 단백질이다. 바람직하게는 서열번호 1의 아미노산을 코딩하기 위하여 서열번호 2의 염기서열을 사용할 수 있으나 이에 제한되는 것은 아니다. In addition, the protein according to the present invention is an insecticidal protein consisting of the amino acid sequence of SEQ ID NO: 1. Preferably, the nucleotide sequence of SEQ ID NO: 2 may be used to encode the amino acid of SEQ ID NO: 1, but is not limited thereto.
또한 본 발명은 서열번호 3의 아미노산 서열로 이루어진 살충성 단백질에 관한 것이다. 본 발명의 서열번호 3의 아미노산 서열은 포토랍투스 펩테라타 M1021로부터 분리한 TccC3 유사 단백질로, 이하, 이를 본 발명의 TccC3으로 한다. 바람직하게 서열번호 3의 아미노산을 코딩하기 위하여 서열번호 4의 염기서열을 사용가능하나 이에 제한되는 것은 아니다. In addition, the present invention relates to a pesticidal protein consisting of the amino acid sequence of SEQ ID NO: 3. The amino acid sequence of SEQ ID NO: 3 of the present invention is a TccC3-like protein isolated from Photoraptus pepterata M1021, hereinafter referred to as TccC3 of the present invention. Preferably, the nucleotide sequence of SEQ ID NO: 4 can be used to encode the amino acid of SEQ ID NO: 3, but is not limited thereto.
한편, 본 발명의 또 다른 양태로써 신규의 살충성 단백질 유전자를 포함하는 세포 내 전달을 위한 재조합 벡터를 제공할 수 있다. Meanwhile, as another aspect of the present invention, a recombinant vector for intracellular delivery containing a novel insecticidal protein gene may be provided.
용어 “재조합”은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 코딩된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로써 인위적인 수단에 의해 세포 내 재도입된 것이다.The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid. Recombinant cells may express genes or gene segments that are not found in the natural form of the cell in either a sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in a natural state, but the gene is modified and reintroduced into the cell by artificial means.
본 발명에 있어서, 상기 유전자는 플라스미드 벡터, 박테리오파지 벡터, 코스미드 벡터, YAC(Yeast Artificial Chromosome) 벡터를 포함한 다양한 벡터들에 도입될 수 있다. 본 발명의 목적상, 플라스미드 벡터를 이용하는 게 바람직하나 이에 제한되지 않으며 미생물 내에서 목적 유전자의 발현을 위하여 당업계에서 사용되는 벡터를 제한됨 없이 사용할 수 있다.In the present invention, the gene may be introduced into various vectors including a plasmid vector, a bacteriophage vector, a cosmid vector, and a YAC (Yeast Artificial Chromosome) vector. For the purposes of the present invention, it is preferable to use a plasmid vector, but is not limited thereto, and a vector used in the art for expression of a target gene in a microorganism may be used without limitation.
"프로모터"란 용어는 구조 유전자로부터의 DNA 업 스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.
본 발명은 또한, 본 발명의 TccB 또는 TccC3유전자를 포함하는 재조합 벡터로 형질 전환된 살충성 단백질을 발현하는 형질 전환체를 제공한다. 적절한 숙주 세포로 형질 전환을 위하여 선호되는 숙주 세포는 원핵 세포이다. 적합한 원핵 숙주세포는 E.coli균주 DH5a, E.coli균주 JM101, E.coli K12균주 294, E.coli균주 W3110, E.coli균주 X1776, E.coli XL-1Blue(Stratagene) 및 E.coli B 등을 포함한다. 그러나 FMB101, NM522, NM538 및 NM539와 같은 E. coli균주 및 다른 원핵생물의 종(speices) 및 속(genera)등이 또한 사용될 수 있다. 따라서 본 발명의 명세서 상의 바람직한 일 구현예인 E. coli에 덧붙여, 아그로박테리움 A4와 같은 아그로박테리움 속 균주. 바실루스 섭틸리스(Bacillus subtilis)와 같은 바실리(bacilli), 살모넬라 타이피뮤리움(Salmonella typhimurium) 또는 세라티아 마르게센스(Serratia marcescens)와 같은 또 다른 장내세균 및 다양한 슈도모나스(Pseudomonas) 속 균주가 숙주세포로서 제한 없이 이용될 수 있다. The present invention also, the TccB of the present invention or It provides a transformant expressing an insecticidal protein transformed with a recombinant vector containing the TccC3 gene. The preferred host cell for transformation into an appropriate host cell is a prokaryotic cell. Suitable prokaryotic host cells include E.coli strain DH5a, E.coli strain JM101, E.coli K12 strain 294, E.coli strain W3110, E.coli strain X1776, E.coli XL-1Blue (Stratagene) and E.coli B. And the like. However, E. coli strains such as FMB101, NM522, NM538 and NM539 and other prokaryotic species and genera can also be used. Therefore, in addition to E. coli, which is a preferred embodiment in the specification of the present invention, strains of the genus Agrobacterium such as A4 A4. Bacilli, such as Bacillus subtilis, Salmonella typhimurium, or Serratia marcescens, and various strains of the genus Pseudomonas as host cells. It can be used without limitation.
본 발명에서 상기 유전자를 숙주세포의 염색체상에 삽입하는 방법으로는 통상적으로 알려진 유전자조작방법을 사용할 수 있으며, 일례로는 레트로바이러스 벡터, 아데노바이러스 벡터, 아데노-연관 바이러스 벡터, 헤르페스 심플렉스 바이러스 벡터, 폭스바이러스 벡터, 렌티바이러스 벡터 또는 비바이러스성 벡터를 이용하는 방법을 들 수 있다. In the present invention, as a method of inserting the gene onto the chromosome of a host cell, a conventionally known gene manipulation method can be used, for example, a retroviral vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector , A method of using a poxvirus vector, a lentiviral vector, or a non-viral vector.
핵산은 다른 핵산 서열과 기능적 관계로 배치될 때 "작동 가능하게 연결 (operably linked)"된다. 이것은 적절한 분자 (예를 들면, 전사 활성화 단백질)은 조절 서열(들)에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 조절 서열(들)일 수 있다. 예를 들면, 전서열(pre-sequence) 또는 분비 리더 (leader)에 대한 DNA는 폴리펩타이드의 분비에 참여하는 전단백질로서 발현되는 경우 폴리펩타이드에 대한 DNA에 작동가능하게 연결되고; 프로모터 또는 인핸서는 서열의 전사에 영향을 끼치는 경우 코딩서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 서열의 전사에 영향을 끼치는 경우 코딩 서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 번역을 용이하게 하도록 배치되는 경우 코딩 서열에 작동가능하게 연결된다. 일반적으로, "작동가능하게 연결된"은 연결된 DNA 서열이 접촉하고, 또한 분비 리더의 경우 접촉하고 리딩 프레임 내에 존재하는 것을 의미한다. 그러나, 인핸서(enhancer)는 접촉할 필요가 없다. 이들 서열의 연결은 편리한 제한 효소 부위에서 라이게이션(연결)에 의해 수행된다. 그러한 부위가 존재하지 않는 경우, 통상의 방법에 따른 합성 올리고뉴클레오티드 어댑터 (oligonucleotide adaptor) 또는 링커(linker)를 사용한다.Nucleic acids are "operably linked" when placed into a functional relationship with another nucleic acid sequence. This can be a gene and regulatory sequence(s) linked in a manner that allows gene expression when the appropriate molecule (eg, a transcriptional activating protein) is bound to the regulatory sequence(s). For example, DNA for a pre-sequence or secretory leader is operably linked to the DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; The promoter or enhancer is operably linked to the coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence when arranged to facilitate translation. In general, "operably linked" means that the DNA sequence to which it is linked is in contact, and in the case of a secretory leader, is contacted and is in the reading frame. However, the enhancer does not need to be in contact. The ligation of these sequences is carried out by ligation (linkage) at a convenient restriction enzyme site. If such a site does not exist, a synthetic oligonucleotide adapter or linker according to a conventional method is used.
본원 명세서에 사용된 용어 "발현 벡터"는 통상 이종의 DNA의 단편이 삽입된 재조합 캐리어 (recombinant carrier)로서 일반적으로 이중 가닥의 DNA의 단편을 의미한다. 여기서, 이종 DNA는 숙주 세포에서 천연적으로 발견되지 않는 DNA인 이형 DNA를 의미한다. 발현 벡터는 일단 숙주 세포 내에 있으면 숙주 염색체 DNA와 무관하게 복제할 수 있으며 벡터의 수 개의 카피 및 그의 삽입된 (이종) DNA가 생성될 수 있다. 본 발명의 바람직한 일 실시예로 pET21a(+) 벡터를 사용할 수 있으나 이에 제한되지 않는다.The term "expression vector" as used herein is a recombinant carrier into which a fragment of a heterologous DNA is inserted, and generally refers to a fragment of double-stranded DNA. Here, heterologous DNA refers to heterologous DNA, which is DNA that is not naturally found in host cells. Once in the host cell, the expression vector can replicate independently of the host chromosomal DNA and several copies of the vector and its inserted (heterologous) DNA can be generated. A pET21a(+) vector may be used as a preferred embodiment of the present invention, but is not limited thereto.
당업계에 주지된 바와 같이, 숙주세포에서 형질감염 유전자의 발현 수준을 높이기 위해서는, 해당 유전자가, 선택된 발현 숙주 내에서 기능을 발휘하는 전사 및 해독 발현 조절 서열에 작동 가능하도록 연결되어야만 한다. 바람직하게는 발현 조절서열 및 해당 유전자는 세균 선택 마커 및 복제 개시점 (replication origin)을 같이 포함하고 있는 하나의 발현 벡터 내에 포함되게 된다. 숙주세포가 진핵 세포인 경우에는, 발현 벡터는 진핵 발현 숙주 내에서 유용한 발현 마커를 더 포함하여야만 한다.As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and translational expression control sequence that exerts a function in the selected expression host. Preferably, the expression control sequence and the corresponding gene are included in one expression vector that includes a bacterial selection marker and a replication origin. When the host cell is a eukaryotic cell, the expression vector must further contain an expression marker useful in the eukaryotic expression host.
상술한 발현 벡터에 의해 형질전환 또는 형질 감염된 숙주 세포는 본 발명의 또 다른 측면을 구성한다. 본원 명세서에 사용된 용어 "형질전환"은 DNA를 숙주로 도입하여 DNA가 염색체외 인자로서 또는 염색체 통합완성에 의해 복제 가능하게 되는 것을 의미한다.Host cells transformed or transfected with the above-described expression vector constitute another aspect of the present invention. As used herein, the term "transformation" refers to the introduction of DNA into a host so that the DNA becomes replicable as an extrachromosomal factor or by chromosomal integrity completion.
본 발명은 또한, 본 발명에서 제공하는 신규한 살충성 단백질을 포함하는 해충 방제용 조성물을 제공한다. 본 발명의 조성물로 방제될 수 있는 해충의 예에는 바람직하게는 나비 목 해충 또는 딱정벌레목 해충일 수 있으나 이에 제한되지 않고 적용 가능한 모든 일반적인 해충에 사용 가능하다. The present invention also provides a composition for controlling pests comprising the novel insecticidal protein provided by the present invention. Examples of pests that can be controlled with the composition of the present invention may preferably be butterfly neck pests or coleoptera pests, but are not limited thereto and can be used for all applicable general pests.
본 발명의 나비목 해충은 꿀벌부채명나방(Galleria mellonella), 배추좀나방(Plutella xylostella), 담배거세미나방(Spodoptera litura), 털뿔가지나방(Alcis angulifera), 애모무늬잎말이나방(Adoxophyes orana), 감나무잎말이나방(Ptycholoma lecheana), 밤애기잎말이나방(Cydia Kurokoi), 복숭아순나방(Grapholita molesta), 은무늬굴나방(Lyonetia prunifoliella), 복숭아심식나방(Carposina sasakii), 파밤나방(Spodoptera exigua), 목화바둑나방(Diaphania indica), 혹명나방(Cnaphalocrocis medinalis), 이화명나방(Chilo suppressalis), 및 왕담배나방(Helicoverpa armigera)으로 이루어진 군으로부터 선택가능하며, 딱정벌레목 해충은 갈색거저리(Tenebrio molitor Linnaeus), 오리나무잎벌레(Agelastica coerulea Baly), 사과둥근나무좀(Xyleborus apicalis Blandford ),서울나무좀(Scolytus seulensis ), 쌀 바구미(Scolytus seulensis ), 소나무좀Tomicus piniperda), 밤바구미(Culculio sikkimensis)로 이루어진 군으부터 선택된 해충일 수 있다. The pests of the Lepidoptera of the present invention are the bee moth (Galleria mellonella), the Chinese cabbage moth (Plutella xylostella), the tobacco caster moth (Spodoptera litura), the Alcis angulifera, the apex leaf moth (Adoxophyes orana), persimmon tree Ptycholoma lecheana, Cydia Kurokoi, Grapholita molesta, Lyonetia prunifoliella, Carposina sasakii, Spodoptera exigua, cotton go It can be selected from the group consisting of Diaphania indica, Cnaphalocrocis medinalis, Chilo suppressalis, and Helicoverpa armigera. Leaf beetle (Agelastica coerulea Baly), apple round tree beetle (Xyleborus apicalis Blandford), Seoul tree beetle (Scolytus seulensis), rice weevil (Scolytus seulensis), pine beetle (Tomicus piniperda), chest weevil (Culculio sikkimensis). have.
또한 본 발명의 신규한 살충성 단백질을 해충 방제용 조성물로 제조함에 있어서 예를 들어, 에스테르 화합물, 포화 탄화수소 및 에스테르 그리고 필요에 따라 기타 살충 활성 성분, 살비 활성 성분, 반발적 활성 성분, 상승제, 향미제 등을 실온 또는 가열 하에 혼합 및 용해함으로써 제조될 수 있다.In addition, in preparing the novel insecticidal protein of the present invention as a composition for controlling pests, for example, ester compounds, saturated hydrocarbons and esters, and other insecticidal active ingredients, acaricidal active ingredients, repellent active ingredients, synergists, It can be prepared by mixing and dissolving a flavoring agent or the like at room temperature or under heating.
본 발명의 조성물이 해충 방제를 위해 사용되는 경우, 본 발명의 조성물은 그 자체로 또는 본 발명의 조성물을 포함하는 해충 방제제 제형의 형태로 적용될 수 있는데 제형에는 예를 들어, 오일, 유제, 수-분산가능한 분말, 플로어블제 (flowable agent) (수성 현탁액, 수성 유제 등), 분말, 과립, 에어로솔, 가열된 증기화제 (살충 코일 (insecticide coil), 전기 살충 매트 (matt), 액체-흡수 샤프트 (shaft)를 가진 가열된 살충-증기화제 등), 가열된 훈증제 (자기-연소형 훈증제, 화학-반응형 훈증제, 다공-세라믹판 훈증제 등), 비가열된 증기화제 (수지 증기화제, 함침지 증기화제 등), 분무제 (포깅(fogging) 등), ULV 제, 및 유독성 먹이 (poisonous bait)가 포함된다.When the composition of the present invention is used for pest control, the composition of the present invention may be applied as such or in the form of a pest control formulation comprising the composition of the present invention. -Dispersible powder, flowable agent (aqueous suspension, aqueous emulsion, etc.), powder, granules, aerosol, heated vaporizer (insecticide coil), electric insecticide mat, liquid-absorbing shaft ( shaft), heated fumigants (self-combustion type fumigants, chemical-reactive fumigants, porous-ceramic plate fumigants, etc.), unheated vaporizers (resin vaporizers, impregnated paper vapors, etc.) Agents, etc.), sprays (fogging, etc.), ULV agents, and poisonous bait.
본 발명의 해충 방제용 조성물을 이용하여 해충을 방제하는 방법은 본 발명의 조성물 또는 이의 제형을 해충 또는 해충이 서식하는 장소에 적용하여 실행된다. 본 발명의 조성물 또는 이의 제형을 적용하는 방법은 본 발명의 조성물 또는 이의 제형의 형상, 사용 위치 등에 따라 적절하게 선택되어 적용 가능하다.The method of controlling pests using the composition for controlling pests of the present invention is carried out by applying the composition of the present invention or a formulation thereof to a place where pests or pests inhabit. The method of applying the composition or formulation thereof of the present invention may be appropriately selected and applied according to the shape of the composition or formulation of the present invention, the location of use, and the like.
이하, 본 발명을 실험예에 의해 상세히 설명한다. 단, 하기 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실험예에 의해 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail by experimental examples. However, the following experimental examples are only illustrative of the present invention, and the contents of the present invention are not limited by the following experimental examples.
[실험 예1] 포토랍두스 템페라타 M1021(KACC91627p)로부터 genomic 코스미드 라이브러리 제작.[Experimental Example 1] Construction of a genomic cosmid library from Photorhabdus Temperata M1021 (KACC91627p).
Genomic library를 제작하기 위한 P. temperata M1021의 chromosomal DNA는 Wilson의 방법(Short Protocols in Molecular Biology, Unit 2.4)에 따라 분리하였다. 분리한 total DNA는 Sau3AI (Fermentas, USA)으로 partial digestion 한 후, sucrose gradient를 이용한 초원심 분리에 의하여 DNA 단편의 크기가 평균 35∼45kb되게 size fraction 한 다음, BamHI과 XbaI으로 잘려진 cosmid vector SuperCos 1(Stratagene, Germany)에 ligation 하였다. 이것을 Epicentre 사의 MaxPlaxTM lambda Packaging Extracts(EPICENTRE, USA)를 이용하여 packaging한 다음 XL1-Blue MRF'로 infection 하여 M1021 균주의 코스미드 라이브러리를 제작하였다. 제작한 코스미드 라이브러리의 클론은 LB배지와 glycerol(최종농도 25%)을 첨가한 다음 각각 200㎕ 분주하여 deep freezer(-70℃)에 보관하였다.
The chromosomal DNA of P. temperata M1021 for constructing the genomic library was isolated according to Wilson's method (Short Protocols in Molecular Biology, Unit 2.4). After partial digestion of the isolated total DNA with Sau3AI (Fermentas, USA), the size of the DNA fragment is averaged 35-45 kb by ultracentrifugation using sucrose gradient, and then the cosmid vector SuperCos 1 cut with BamHI and XbaI. (Stratagene, Germany) was ligation. This was packaged using Epicentre's MaxPlaxTM lambda Packaging Extracts (EPICENTRE, USA), and then infected with XL1-Blue MRF' to produce a cosmid library of M1021 strain. The clones of the produced cosmid library were added with LB medium and glycerol (final concentration 25%), and then 200 μl of each were dispensed and stored in a deep freezer (-70° C.).
[실험 예2] 코스미드 라이브러리로부터의 독소 콤플렉스 관련 클론의 확보 및 분석.[Experimental Example 2] Acquisition and analysis of toxin complex-related clones from the cosmid library.
2.1 독소 콤플렉스(tc) 관련 프라이머 제작.2.1 Toxin complex (tc) related primer production.
P. temperata M1021 균주의 코스미드 라이브러리로부터 toxin complex(tc)를 가진 코스미드 클론을 확보하기에 앞서, genome sequence가 이미 알려진 Photorhabdus luminescens W14와 TT01 균주의 두 개의 genomic data를 기본으로 하여 표1 과 같이 프라이머를 제작하였다(제노텍, 대전, 한국). tccF1과 tccR1 primer는 toxin complex 중의 tcc locus에 대한 것이며, TcdF2와 TcdR2 프라이머는 tcd locus, TcaC F3와 TcaC R3 primer는 tca locus를 확인하기 위하여 제작하였다. 제작한 프라이머는 M1021의 genomic DNA를 대상으로 PCR(도1)을 수행하여 그 존재 여부를 확인하였으며, 각각의 PCR product는 PCR purification kit(솔젠트, 대전, 한국)로 정제한 다음, 서열 확인은 솔젠트사(대전, 한국)에 의뢰하였다.
Prior to securing a cosmid clone with toxin complex (tc) from the cosmid library of P. temperata M1021 strain, based on two genomic data of the known genome sequence Photorhabdus luminescens W14 and TT01 strain, as shown in Table 1. A primer was prepared (Genotech, Daejeon, Korea). The tccF1 and tccR1 primers were for tcc locus in the toxin complex, the TcdF2 and TcdR2 primers were for tcd locus, and the TcaC F3 and TcaC R3 primers were designed to identify tca locus. The prepared primers were subjected to PCR (Fig. 1) for the genomic DNA of M1021 to confirm their presence, and each PCR product was purified with a PCR purification kit (Solgent, Daejeon, Korea), and the sequence confirmation was I commissioned Solgent (Daejeon, Korea).
OligonucleotideOligonucleotide Relevant sequence (5'→3')Relevant sequence (5'→3')
Tcc F1
Tcc R1
TcdF2
TcdR2
TcaC F3
TcaC R3
Tcc F1
Tcc R1
TcdF2
TcdR2
TcaC F3
TcaC R3
AARYTGCGTGAAGAGCAY
GTGCAATACCCTTACCTGTGC
ARGACCGTTTTTCCCGTTATGARTA
ATCACCGGATTGCACCACATC
AGCGCATTCAACTGCAACAAGATAT
CTATGGGGTTCTTGAYGCGGTATC
AARYTGCGTGAAGAGCAY
GTGCAATACCCTTACCTGTGC
ARGACCGTTTTTCCCGTTATGARTA
ATCACCGGATTGCACCACATC
AGCGCATTCAACTGCAACAAGATAT
CTATGGGGTTCTTGAYGCGGTATC
2.2 포토랍투스 템퍼라타 M1021의 게놈 코스미드 클론에서의 tc 포짓티드 클론확보.2.2 Secured tc positive clones from genomic cosmid clones of Photoraptus temperata M1021.
포토랍투스 템퍼라타 M1021 균주의 cosmid library로부터 tcc , tcd , tca를 포함하는 코스미드 클론을 확보하기 위하여 상기와 같은 조건으로 PCR을 실시하였으며(도1 참조), PCR은 pooling과 subpooling 과정을 통하여 단계적으로 실시하였다.
In order to obtain a cosmid clone containing tcc , tcd, and tca from the cosmid library of Photoraptus temperata M1021 strain, PCR was performed under the same conditions as described above (see Fig. 1), and PCR was performed step by step through pooling and subpooling processes. It was carried out.
2.3 포짓티브 코스미드 클론의 플라스미드 분석.2.3 Plasmid analysis of positive cosmid clones.
PCR 스크리닝 방법에서 확보한 4개의 코스미드 클론(PtC 49, PtC 64, PtC 267, PtC 28)에 대한 플라스미드는 alkaline lysis method(Birnboim and Doly, 1979)를 이용하여 각각 확보하였으며, 각각의 플라스미드 내에 삽입된 DNA의 양쪽 말단을 확인하기 위하여 SuperCos1 내의 T3와 T7 프라이머를 이용하여 시퀀싱을 실시하였다(제노텍, 대전, 한국). 또한 각각의 플라스미드를 NotI, BamHI, HindⅢ, EcoRI, KpnI, PstI 과 같은 제한효소를 이용하여 제한효소에 의한 패턴을 분석하였다.
Plasmids for the four cosmid clones (PtC 49, PtC 64, PtC 267, PtC 28) obtained by the PCR screening method were each obtained using alkaline lysis method (Birnboim and Doly, 1979), and inserted into each plasmid. To confirm both ends of the DNA, sequencing was performed using T3 and T7 primers in SuperCos1 (Genotech, Daejeon, Korea). In addition, each plasmid was analyzed for pattern by restriction enzymes using restriction enzymes such as Not I, Bam HI, Hind III, EcoR I, Kpn I, and Pst I.
2.4 포짓티브 코스미드 클론의 살충력 조사.2.4 Investigation of insecticidal power of positive cosmid clones.
상기에서 확보한 4개의 코스미드 클론의 살충성 시험은 꿀벌부채명나방 유충(4∼5령)을 사용하였으며, 각각의 코스미드 클론을 5 ㎖ LB 배지에서 16시간이상 배양한 다음, 원심분리(12,000rpm, 5min)를 통하여 cell pellet만을 회수하여 멸균생리식염수에 현탁시킨 다음 유충의 혈체강에 microsyringe을 사용하여 3 ㎕씩 주사하였다. 대조군으로는 멸균된 LB broth와 0.85% NaCl 용액을 동량 주사하여 각각 25℃ 인큐베이터에 보관하면서 시간에 따른 사멸 정도를 조사하였다.
The insecticidal test of the four cosmid clones obtained above was performed using bee larvae larvae (4-5 in.), and each cosmid clone was cultured in 5 ml LB medium for 16 hours or longer, and then centrifuged ( 12,000rpm, 5min), the cell pellet was recovered and suspended in sterile physiological saline, and then 3 µl was injected into the blood body cavity of the larva using a microsyringe. As a control group, an equal amount of sterilized LB broth and 0.85% NaCl solution were injected and stored in an incubator at 25°C, respectively, and the degree of death over time was investigated.
2.5 포짓티브 코스미드 플라스미드의 서열 및 ORF 분석.2.5 Sequence and ORF analysis of positive cosmid plasmid.
tcd locus와 tcc locus에 대한 각각의 플라스미드에 대한 유전 정보를 확인하기 위하여 코스미드 플라스미드에 대한 서열 분석을 제노텍(대전, 한국)에 의뢰하였으며, pS49와 pS28에 대한 서열분석은 primer walking과 shot gun 분석을 통하여 실시하였다. 확보한 DNA 서열은 DNA star(DNASTAR, USA)를 이용하여 모두 assembly 하였으며, 완성된 콘티그는 벡터 NTI program(Invitrogen, USA)의 ORF finder와 NCBI(National Center for Biotechnology Information)의 ORF finder를 이용하여 open reading frame(ORF) 구성을 확인하였다. 각각의 ORF는 NCBI의 BLAST를 이용하여 염기서열과 아미노산 서열의 상동성을 비교하였다.
In order to confirm the genetic information of each plasmid for the tcd locus and tcc locus, the sequencing of the cosmid plasmid was requested to Genotech (Daejeon, Korea), and the sequence analysis of pS49 and pS28 was carried out by primer walking and shot gun. It was carried out through analysis. The obtained DNA sequences were all assembled using DNA star (DNASTAR, USA), and the finished contigs were opened using the ORF finder of the vector NTI program (Invitrogen, USA) and the ORF finder of the NCBI (National Center for Biotechnology Information). The reading frame (ORF) configuration was confirmed. For each ORF, the homology of the nucleotide sequence and the amino acid sequence was compared using BLAST of NCBI.
[실험 예3] 독소 유전자 클로닝 및 재조합 발현.][Experimental Example 3] Toxin gene cloning and recombinant expression.]
3.1 독소 단백질 발현 벡터의 제조.3.1 Preparation of the toxin protein expression vector.
독소 단백질의 발현벡터로는 pET21a(+)를 사용하였으며, 각각의 독소 유전자를 클로닝하기 위해 제작한 프라이머(제노텍, 대전, 한국)는 표 2에 나타내었다. 표 2에서 보는 것과 같이 독소 단백질의 정제를 위하여 C 말단에 stop codon을 제외한 TEV 서열 및 6His·tag서열을 부착한 프라이머(C-ter 6His-tag/TEV 프라이머)와 마지막으로 C-말단에 부착할 제한효소를 위하여 SalI 또는 HindⅢ cassette를 제작하여 사용하였다. PCR 반응은 도1과 같이 실시하였으며, 클로닝 과정은 다음과 같다. 개시코돈을 포함하는 각각의 N 프라이머와 정지코돈을 제외한 C-terminal 부분에 TEV 서열을 연결시킨 각각의 C 프라이머로 Pfu-X polymerase(솔젠트, 대전, 한국)를 이용하여 PCR을 실시한 다음, C-terminal 부분은 6His·tag과 unique restriction enzyme 및 정지 코돈을 넣어주기 위하여 C-ter 6His-tag/TEV 프라이머 와 cassette 프라이머를 순차적으로 사용하여 PCR을 실시하였다. PCR template로는 각각의 코스미드 플라스미드 및 genomic DNA를, polymerase는 Pfu-X polymerase(솔젠트, 대전, 한국)를 이용하였으며, PCR 반응 시 annealing temperature는 50-60℃, extension time은 1kb/min, 이들 조건의 반응 cycle은 30회 반복하였다. 반응이 끝난 PCR 산물은 0.8% 아가로오스 겔(w/v)에서 확인하였으며 PCR 산물은 PCR purification kit(솔젠트, 대전, 한국)를 이용하여 정제하였다. 정제한 각각의 PCR product와 pET21a(+)를 PCR product 말단에 부착한 각각의 특정 제한효소로 절단한 다음 T4 DNA ligase(Fermentas, Canada)를 이용하여 연결한 후, Escherichia coli DH5α로 형질전환시켜 재조합 플라스미드를 확보하였다. 확보한 재조합 플라스미드는 sequencing(T3과 T7 프라이머)을 통하여 확인하였다. As the expression vector of the toxin protein, pET21a(+) was used, and the primers (Genotech, Daejeon, Korea) prepared to clone each toxin gene are shown in Table 2. As shown in Table 2, for purification of the toxin protein, a primer (C-ter 6His-tag/TEV primer) with a TEV sequence excluding the stop codon and a 6His tag sequence attached to the C-terminus and finally attached to the C-terminus. For the restriction enzyme, a Sal I or Hind III cassette was prepared and used. The PCR reaction was carried out as shown in Fig. 1, and the cloning process is as follows. PCR was performed using Pfu -X polymerase (Solgent, Daejeon, Korea) with each of the N primers including the start codon and each C primer with the TEV sequence linked to the C-terminal part excluding the stop codon, and then C In the -terminal part, PCR was performed using C-ter 6His-tag/TEV primers and cassette primers sequentially in order to insert 6His·tag, unique restriction enzyme, and stop codon. Each cosmid plasmid and genomic DNA were used as the PCR template, and Pfu- X polymerase (Solgent, Daejeon, Korea) was used as the polymerase. During the PCR reaction, the annealing temperature was 50-60°C and the extension time was 1kb/min. The reaction cycle of the conditions was repeated 30 times. The PCR product after the reaction was confirmed on a 0.8% agarose gel (w/v), and the PCR product was purified using a PCR purification kit (Solgent, Daejeon, Korea). Each purified PCR product and pET21a(+) were digested with each specific restriction enzyme attached to the end of the PCR product, and then ligated using T4 DNA ligase (Fermentas, Canada), and then Escherichia coli Transformed with DH5α to obtain a recombinant plasmid. The obtained recombinant plasmid was confirmed through sequencing (T3 and T7 primers).
GeneGene OligonucleotideOligonucleotide Relevant sequence (5'→3')Relevant sequence (5'→3')
tcdB2tcdB2 TcdB2-N
TcdB2-C
C-ter 6His-tag/TEV
SalI cassette
TcdB2-N
TcdB2-C
C-ter 6His-tag/TEV
SalI cassette
GCGGGATCCATGCAAAATTCACAAGAA
CTGAAAGTACAGGTTCTCCATTTTCACCTCAGCAGC
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
ACGCGTCGACCGAATTCATTAGTGGTGG
GCG GGATCC ATGCAAAATTCACAAGAA
CTGAAAGTACAGGTTCTCCATTTTCACCTCAGCAGC
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
ACGC GTCGAC CGAATTCATTAGTGGTGG
tccC3tccC3 TccC3-N
TccC3-C
C-ter 6His-tag/TEV
HindⅢ cassette
TccC3-N
TccC3-C
C-ter 6His-tag/TEV
HindⅢ cassette
CCTGCAGCATATGATGGAAAACTTTGACCCC
CTGAAAGTACAGGTTCTCGCTATATCTATGTTTAGG
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
CGCAAGCTTCGAATTCATTAGTGGTGG
CCTGCAG CATATG ATGGAAAACTTTGACCCC
CTGAAAGTACAGGTTCTCGCTATATCTATGTTTAGG
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
CGC AAGCTT CGAATTCATTAGTGGTGG
tccAtccA TccA-N
TccB-C
C-ter 6His-tag/TEV
TccA-N
TccB-C
C-ter 6His-tag/TEV
GGAATTCGCTAGCATGAATCAACTCGCCAGT
CTGAAAGTACAGGTTCTCATGACTGCCCTTGACATG
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
GGAATTC GCTAGC ATGAATCAACTCGCCAGT
CTGAAAGTACAGGTTCTCATGACTGCCCTTGACATG
C GAATTC ATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
tccBtccB TccB-N
TccB-C
C-ter 6His-tag/TEV
TccB-N
TccB-C
C-ter 6His-tag/TEV
CCTGCAGCATATGATGTTATCGACAATGGAA
CTGAAAGTACAGGTTCTCAATAAGTGTTTTCTTGAC
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
CCTG CAGCAT ATGATGTTATCGACAATGGAA
CTGAAAGTACAGGTTCTCAATAAGTGTTTTCTTGAC
C GAATTC ATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
tccCtccC TccC-N
TccC-C
C-ter 6His-tag/TEV
HindⅢ cassette
TccC-N
TccC-C
C-ter 6His-tag/TEV
HindⅢ cassette
CCTGCAGCATATGAGTACGTCTGATACCA
CTGAAAGTACAGGTTCTCCAAAGAAATAACCCGTCG
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
CGCAAGCTTCGAATTCATTAGTGGTGG
CCTGCAG CATATG AGTACGTCTGATACCA
CTGAAAGTACAGGTTCTCCAAAGAAATAACCCGTCG
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
CGC AAGCTT CGAATTCATTAGTGGTGG
tcaCtcaC TcaC-N
TcaC-C
C-ter 6His-tag/TEV
TcaC-N
TcaC-C
C-ter 6His-tag/TEV
GGAATTCGCTAGCATGCAGGATTCATCAGAA
CTGAAAGTACAGGTTCTCTGGGGTTCTTGACGCGGT
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
GGAATTC GCTAGC ATGCAGGATTCATCAGAA
CTGAAAGTACAGGTTCTCTGGGGTTCTTGACGCGGT
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
3.2 재조합 독소 단백질의 발현.3.2 Expression of the recombinant toxin protein.
상기에서 확보한 재조합 플라스미드는 독소 단백질의 발현을 위하여 E. coli BL21(DE3)에 각각 형질전환하였다. 형질전환한 대장균은 3 ㎖ LB broth(Apr, 100㎍/㎖)에서 밤새 키운 다음 100 ㎖ LB broth에 1% 되게 접종하여 37℃의 진탕배양기(220rpm)에서 OD600값이 0.8되게 키운 후 IPTG(Isopropyl β-D-1-thiogalactopyranoside)를 최종 1mM 되게 첨가 한 후 시간별로 회수하여 발현정도를 관찰하였다. 대조구로는 E. coli BL21(DE3)/pET21a(+)를 사용하였다. 재조합단백질의 발현은 SDS-PAGE를 통하여 확인하였으며 시간별로 회수한 배양액을 원심 리하여 상등액을 제거하고 난 다음 cell pellet에 1×Laemmli loading dye를 넣어서 현탁시킨 후 99℃에서 5분간 가열하여 세포를 파쇄하였다. 세포 파쇄액은 원심분리(12,000rpm, 10min, 4℃)하여 상등액을 SDS-PAGE를 이용하여 재조합 단백질의 발현을 확인하였다. The recombinant plasmid obtained above is E. coli Each was transformed into BL21 (DE3). The transformed E. coli was grown overnight in 3 ㎖ LB broth (Ap r , 100 ㎍/ ㎖), then inoculated at 1% in 100 ㎖ LB broth, and raised the OD 600 value to 0.8 in a shaking incubator at 37°C (220 rpm). (Isopropyl β-D-1-thiogalactopyranoside) was added to the final 1 mM, and then recovered every hour to observe the degree of expression. As a control, E. coli BL21(DE3)/pET21a(+) was used. Expression of the recombinant protein was confirmed through SDS-PAGE, and the culture medium collected by time was centrifuged to remove the supernatant, and then 1×Laemmli loading dye was added to the cell pellet and suspended, followed by heating at 99°C for 5 minutes to disrupt the cells. . The cell lysate was centrifuged (12,000 rpm, 10 min, 4° C.), and the supernatant was subjected to SDS-PAGE to confirm the expression of the recombinant protein.
재조합 독소 단백질의 활성형 발현 양상을 확인하기 위한 실험에는 배양온도, IPTG 첨가농도 및 배지조성을 변화시켜 확인하였으며 IPTG 첨가 농도는 0.1mM, 0.5mM, 1mM, 배양온도는 15℃, 25℃, 37℃, 배지는 LB, 2×YT, TB(Terrific broth), SB(Super broth), M9 Minimal 배지(표 3)를 사용하여 실험하였다. In the experiment to confirm the expression pattern of the active form of the recombinant toxin protein, the culture temperature, the concentration of IPTG addition, and the composition of the medium were changed. The concentration of IPTG added was 0.1mM, 0.5mM, 1mM, and the culture temperature was 15℃, 25℃, 37℃. , The medium was tested using LB, 2×YT, TB (Terrific broth), SB (Super broth), M9 Minimal medium (Table 3).
LBLB 2×YT2×YT TBTB SBSB M9M9
배지조성Medium composition Tryptone 10 g
Yeast extract 5 g
NaCl 10 g




per 1 liter
Tryptone 10 g
5 g of Yeast extract
NaCl 10 g




per 1 liter
Tryptone 12 g
Yeast extract 10 g
NaCl 5 g




per 1 liter
Tryptone 12 g
Yeast extract 10 g
NaCl 5 g




per 1 liter
Tryptone 12 g
Yeast extract 24 g
K2HPO4 12.54 g
KH2PO4 2.31 g
Glycerol 4 ㎖


per 1 liter
Tryptone 12 g
Yeast extract 24 g
K 2 HPO 4 12.54 g
KH 2 PO 4 2.31 g
4 ml of Glycerol


per 1 liter
Tryptone 32 g
Yeast extract 20 g
NaCl 5 g




per 1 liter
Tryptone 32 g
Yeast extract 20 g
NaCl 5 g




per 1 liter
Na2HPO4·7H2O 6 g
KH2PO4 3 g
NaCl 0.5 g
NH4Cl 1 g
20% glucose 10 ㎖
0.1M CaCl2 1 ㎖
1M MgSO4 1 ㎖
per 1 liter
Na 2 HPO 4 7H 2 O 6 g
KH 2 PO 4 3 g
NaCl 0.5 g
NH 4 Cl 1 g
20% glucose 10 ml
0.1M CaCl2 1ml
1M MgSO4 1ml
per 1 liter
[실험 예4] 재조합 단백질을 가진 대장균을 이용한 살충성 검사.[Experimental Example 4] Insecticide test using E. coli with recombinant protein.
꿀벌부채명나방 유충에 대한 독성 검사는 재조합 단백질의 발현이 최대인 시점의 배양액 2㎖을 원심 리하여 상층액을 제거하고 멸균된 0.85% NaCl 용액으로 cell pellet을 두 번 세척한 다음, 배양액의 10배 농도로 현탁시켜 사용하였다. 세포 현탁액은 microsyringe(Hamilton, USA)를 이용하여 3㎕씩 꿀벌부채명나방 유충의 혈체강 속으로 주사하였으며, 각각 10마리의 유충을 사용하였다. 주사한 유충은 항온실(25℃, 습도 50%)에 보관하면서 24시간 단위로 변화양상을 관찰하였다. 또한 세포 현탁액내의 cell 농도를 확인하기 위하여 엠피실린이 포함된 LB agar plate에 도말하여 항온배양기(37℃)에서 배양하였다. 대조구로는 멸균한 0.85% NaCl 용액과 E. coli BL21(DE3)/pET21a(+)를 상기의 방법과 동일하게 처리하여 사용하였다.
Toxicity test on the larvae of the bee larvae is to remove the supernatant by centrifuging 2 ml of the culture medium at the time when the expression of the recombinant protein is maximum, and wash the cell pellet twice with sterilized 0.85% NaCl solution, and then 10 times the culture medium. It was used after being suspended in concentration. The cell suspension was injected into the blood body cavity of the larvae of the bee larvae by using microsyringe (Hamilton, USA), and 10 larvae were each used. The injected larvae were kept in a constant temperature room (25°C, humidity 50%), and changes were observed every 24 hours. In addition, in order to check the cell concentration in the cell suspension, it was plated on an LB agar plate containing mpicillin and cultured in an incubator (37° C.). As a control, a sterilized 0.85% NaCl solution and E. coli BL21(DE3)/pET21a(+) were treated in the same manner as the above.
[실험 예5] 결과.[Experimental Example 5] Results.
5.1. 포토랍투스 템퍼라타 M1021균주의 코스미드 라이브러리.5.1. Cosmid library of Photoraptus temperata M1021 strain.
포토랍투스 템퍼라타M1021 균주의 genomic 코스미드 라이브러리를 제작한 결과 7.14×105 코스미드 클론을 확보하였다. 현재 보고된 P. luminescens subsp. laumondii TT01과 P. asymbiotica subsp. asymbiotica ATCC43949의 전체 게놈크기가 각각 5.69Mb와 5.06Mb 인 점을 감안할 때 같은 속(family)에 속하는 포토랍투스 템퍼라타M1021 균주의 게놈 크기도 5∼6Mb 사이 일 것으로 예상된다. 포토랍투스 템퍼라타M1021 균주의 전체 게놈 크기가 약 5.6Mb이라고 가정한다면, 또한 코스미드 벡터 내에 삽입된 M1021의 genomic DNA fragment 크기가 40kb일 경우 전체 게놈을 99.99% 포함하는데 필요한 이상적인 클론의 개수는(N) 도 2의 식에 대입하면 1.28×103 클론으로 나타난다. 따라서 본 실험에서 확보한 7.14×105 코스미드 클론의 수는 포토랍투스 템퍼라타M1021 균주의 전체 게놈을 99.99%이상 포함하는 것으로 나타났다. 코스미드 라이브러리로부터 일부 코스미드 클론의 플라스미드를 분리하여 제한효소(restriction enzyme)로 절단한 결과, 삽입되어 있는 DNA 절편의 크기는 약 35-45kb로 나타났고 제한효소에 의한 양상도 서로 다른 것으로 나타났다.
As a result of constructing a genomic cosmid library of the strain Photoraptus temperata M1021, 7.14×105 cosmid clones were obtained. Currently reported P. luminescens subsp. laumondii TT01 and P. asymbiotica subsp. Considering that the total genome sizes of asymbiotica ATCC43949 are 5.69Mb and 5.06Mb, respectively, the genome size of the photolabtus temperata M1021 strain belonging to the same family is expected to be between 5-6Mb. Assuming that the total genome size of the strain Photoraptus temperata M1021 is about 5.6 Mb, and if the size of the genomic DNA fragment of M1021 inserted in the cosmid vector is 40 kb, the ideal number of clones required to include 99.99% of the entire genome is ( N) Substituting into the equation of FIG. 2 results in 1.28×10 3 clones Therefore, the number of 7.14×10 5 cosmid clones obtained in this experiment was found to contain more than 99.99% of the entire genome of the strain Photoraptus temperata M1021. As a result of separating the plasmids of some of the cosmid clones from the cosmid library and digesting them with a restriction enzyme, the size of the inserted DNA fragment was about 35-45 kb, and the pattern by the restriction enzymes was also different.
5.2 코스미드 라이브러리로부터 독소 콤플렉스 관련 클론의 분석결과.5.2 Analysis results of toxin complex-related clones from the cosmid library.
5.2.1 tc 포짓티브 클론의 확보.5.2.1 Acquisition of tc positive clones.
포토랍투스 템퍼라타M1021의 genomic DNA를 대상으로 표1의 tcc, Tcd와 Tca pair 프라이머를 이용하여 PCR을 한 결과 각각의 PCR product를 확보하였으며, 서열 분석을 통하여 그 서열을 확인한 결과, 모두 다 살충성 독소 콤플렉스 단백질로 나타났다. As a result of PCR using the tcc, Tcd and Tca pair primers in Table 1 for genomic DNA of Photoraptus temperata M1021, each PCR product was obtained. It has been shown to be a loyal toxin complex protein.
Primer setsPrimer sets PCR amplicon (kb)PCR amplicon (kb) % nucleotide homology% nucleotide homology Compared strain(protein)Compared strain(protein)
tcc F1 / tcc R1tcc F1 / tcc R1 0.840.84 8787 P. luminescens strain TT01 (TccC) P. luminescens strain TT01 (TccC)
TcdF2 / TcdR2TcdF2 / TcdR2 0.770.77 8484 P. luminescens strain TT01 (TcdF2) P. luminescens strain TT01 (TcdF2)
TcaC F3 / TcaC R3TcaC F3 / TcaC R3 1.641.64 82/8382/83 P. luminescens TT01
P. asymbiotica ATCC43949 (TcaC)
P. luminescens TT01
P. asymbiotica ATCC43949 (TcaC)
5.2.2 플라스미드 분석 결과.5.2.2 Plasmid Analysis Results.
상기의 플라스미드에 대한 유전 정보를 확인하기 위하여 전체 시퀀싱 작업은 유전체분석전문기관인 제노텍(Genotech, Daejeon, Korea)에 의뢰하였으며, pS49와 pS28에 대한 전체 시퀀싱은 primer walking과 shot gun 분석을 통하여 실시하였다. pS49와 pS28내에 삽입된 DNA의 서열은 상기와 같은 서열분석을 통하여 모두 확보하였으며, 확보한 DNA 서열은 DNA star를 이용하여 모두 assembly 하였으며, 완성된 콘티그는 Vector NTI program (Invitrogen, USA)의 ORF finder와 NCBI(National Center for Biotechnology Information)의 ORF finder를 이용하여 open reading frame (ORF) 구성을 확인하였다. 각각의 ORF는 NCBI의 BLAST를 이용하여 염기서열과 아미노산 서열의 상동성을 비교하였다. pS49와 pS28내에 있는 ORF의 구성은 도. 5과 같으며, 이들 각각 ORF에 대한 상동성과 예상되는 유전자 및 기능은 표 5에 나타내었다. pS49내에 있는 ORFs의 구성을 기존에 보고된 P. luminescens W14 및 TT01 균주와 P. asymbiotica ATCC43949의 tcd island와 비교해 볼 때, tcdA2, tcdB2 및 tccC3 유전자들이 동일한 방향으로 전사되어 있었으며 또한 tcdB2와 tccC3 사이에 phage holin protein을 암호화하는 tchA도 존재하는 것으로 나타났다. pS49내의 서열에서는 tcdA-like, tcdB-like, tccC-like 유전자들의 또 다른 copies는 확인되지 않았으며, tcd locus의 “core” region (tcdA1-like, tcdA2, tcdB2와 tccC3)만이 확인되었다. 그러나 tcdA1-like gene의 경우 기존에 보고된 tcdA-like gene과 비교하여 크기가 상당히 작은 것으로 나타났으며, tcdA1-like 유전자의 upstream 방향, 즉 pS49의 insert 말단부위에는 hemolysins-related protein을 암호화하는 유전자의 일부가 포함되어있는 것으로 나타났다. 포토랍투스 템퍼라타M1021의 tcd island의 구성은 독소유전자의 copy 수가 많은 P. luminescens TT01의 것보다는 독소유전자의 copy 수가 적거나 하나인 P. asymbiotica ATCC43949의 것과 유사하였으며, 독소 단백질의 하류 방향으로는 multidrug transporter proteins와 polyphosphatase protein 등이 존재하는 것으로 확인되었다. 기존에 보고된 살충성 단백질과의 아미노산 상동성은 TcdA2의 경우 66%, TcdB2는 81%, TccC3는 57%로 나타났으며(표 5), P. luminescens 및 P. asymbiotica의 살충성 단백질과는 상당한 차이를 나타내었다. 또한 독소단백질의 구성요소인 A, B, C component의 경우 A component는 tcdA2, B component는 tcdB2, C component는 tccC3로 3개의 구성요소를 모두 가지는 것으로 나타났다(도 7 참조). In order to confirm the genetic information of the above plasmid, the entire sequencing work was requested to Genotech (Daejeon, Korea), a specialized genomic analysis agency, and the entire sequencing for pS49 and pS28 was performed through primer walking and shot gun analysis. . The sequences of the DNA inserted into pS49 and pS28 were all obtained through sequencing as described above, and all the obtained DNA sequences were assembled using DNA star, and the finished contigs were ORF finder of Vector NTI program (Invitrogen, USA). And NCBI (National Center for Biotechnology Information)'s ORF finder was used to confirm the composition of the open reading frame (ORF). For each ORF, the homology of the nucleotide sequence and the amino acid sequence was compared using BLAST of NCBI. The composition of ORFs in pS49 and pS28 is shown in Fig. It is the same as 5, and the homology to each of these ORFs, and the predicted genes and functions are shown in Table 5. When comparing the composition of ORFs in pS49 with the previously reported P. luminescens W14 and TT01 strains and the tcd island of P. asymbiotica ATCC43949, the tcdA2, tcdB2 and tccC3 genes were transcribed in the same direction, and also between tcdB2 and tccC3. It has also been shown that tchA, which encodes the phage holin protein, is also present. Other copies of the tcdA-like, tcdB-like, and tccC-like genes were not identified in the sequence in pS49, and only the “core” regions (tcdA1-like, tcdA2, tcdB2 and tccC3) of the tcd locus were identified. However, the tcdA1-like gene was found to be significantly smaller in size compared to the previously reported tcdA-like gene, and the upstream direction of the tcdA1-like gene, i.e., at the insertion end of pS49, is a gene encoding a hemolysins-related protein. It turns out that some are included. The composition of the tcd island of Photoraptus temperata M1021 was similar to that of P. asymbiotica ATCC43949, which has less or one copy of the toxin gene than that of P. luminescens TT01, which has a large number of copies of the toxin gene. It was confirmed that multidrug transporter proteins and polyphosphatase proteins exist. The previously reported amino acid homology with insecticidal proteins was 66% for TcdA2, 81% for TcdB2, and 57% for TccC3 (Table 5), and significantly compared to the insecticidal proteins of P. luminescens and P. asymbiotica. Showed a difference. In addition, in the case of components A, B, and C, which are components of the toxin protein, it was found that the A component had all three components as tcdA2, the B component was tcdB2, and the C component was tccC3 (see FIG. 7).
tcc locus를 포함하는 pS28의 경우는 tccA, tccB와 tccC를 모두 포함하였으며, 독소유전자의 하류 부분에는 Type Ⅵ secretion system (T6SS)을 가지는 것으로 나타났다. Type Ⅵ secretion system은 Proteobacteria에 속하는 미생물의 병원성을 유발하는 제6형 유형 분비체계로, 이러한 T6SS는 Hcp와 VgrG와 같은 여러 개의 단백질로 구성되어있는 것으로 알려져 있다. 이러한 유형의 분비체계는 병원성 미생물의 독소단백질 및 여러 가지의 virulence factors 등과 관련이 매우 높은 것으로 알려져 있으며, 포토랍투스 템퍼라타M1021 균주의 tcc locus에서도 이와 같은 형태의 분비체계가 있는 것으로 나타났다(도 5). 살충성 단백질과의 아미노산 상동성은 TccA의 경우 89%, TccB와 TccC는 90%의 상동성을 나타내었으며, A component인 tccB를 가지는 것으로 나타났다(표5).In the case of pS28 containing tcc locus, all of tccA, tccB and tccC were included, and the downstream part of the toxin gene was found to have a Type VI secretion system (T6SS). The Type VI secretion system is a type 6 secretion system that induces pathogenicity of microorganisms belonging to Proteobacteria, and this T6SS is known to be composed of several proteins such as Hcp and VgrG. This type of secretion system is known to be highly related to toxin proteins of pathogenic microorganisms and various virulence factors, and the same type of secretion system was found in the tcc locus of the photolabtus temperata M1021 strain (Fig. 5). ). The amino acid homology with the insecticidal protein was 89% for TccA and 90% for TccB and TccC, and it was found to have the A component tccB (Table 5).
No.No. Predicted productPredicted product Homology
   (%)
Homology
(%)
OrganismOrganism
pS49pS49
1One insecticidal toxin, TcdA likeinsecticidal toxin, TcdA like 7373 P. asymbiotica ATCC43949 P. asymbiotica ATCC43949
22 insecticidal toxin, TcdA2insecticidal toxin, TcdA2 6666 P. luminescens TT01 P. luminescens TT01
33 insecticidal toxin, TcdB2insecticidal toxin, TcdB2 8181 P. luminescens TT01 P. luminescens TT01
44 insecticidal toxin, TccC3(서열번호 3)insecticidal toxin, TccC3 (SEQ ID NO: 3) 7070 P. luminescens TT01 P. luminescens TT01
55 peptide synthetasepeptide synthetase 8787 P. luminescens TT01 P. luminescens TT01
66 thiothemplate mechanism natural product synthetasethiothemplate mechanism natural product synthetase 5858 Erwinia amylovora ATCC BAA-2158 Erwinia amylovora ATCC BAA-2158
77 polyketide synthase type Ipolyketide synthase type I 4646 E. amylovora ATCC49946 E. amylovora ATCC49946
88 gramicidin S synthetase 2gramicidin S synthetase 2 4545 E. amylovora ATCC BAA-2158 E. amylovora ATCC BAA-2158
99 polyketide synthasepolyketide synthase 3838 E. amylovora ATCC BAA-2158 E. amylovora ATCC BAA-2158
1010 peptide synthetasepeptide synthetase 8686 P. luminescens TT01 P. luminescens TT01
1111 hypothetical proteinhypothetical protein 8787 P. luminescens TT01 P. luminescens TT01
1212 5'-nucleotidase family protein5'-nucleotidase family protein 8686 P. asymbiotica ATCC43949 P. asymbiotica ATCC43949
pS28pS28
1One insecticidal toxin, TccAinsecticidal toxin, TccA 8989 P. luminescens TT01 P. luminescens TT01
22 insecticidal toxin, TccBinsecticidal toxin, TccB 9090 P. luminescens TT01 P. luminescens TT01
33 insecticidal toxin, TccCinsecticidal toxin, TccC 9090 P. luminescens TT01 P. luminescens TT01
5.2.3 살충력 실험결과.5.2.3 Insecticide test results.
상기에서 확보한 포짓티브 코스미드 클론에 대한 살충력 조사 결과는 다음과 같다(도 6). 도 6에서와 같이 PtC28 클론의 살충력이 가장 높았으며 주사 후 7일 때에 100% 사멸하는 것으로 나타났다. PtC49의 경우 주사 후 6일 때에 50%의 살충력을 나타내었고 PtC 64와 267 클론은 주사 후 7일 때에 살충력이 50%에 도달하였다. 본 실험에서 대조군으로 사용한 멸균 생리식염수(0.85% NaCl)와 코스미드 벡터인 SuperCos1만을 가진 XL-1 Blue MRF'을 주사한 꿀벌부채명나방 유충에서는 외관상 변화가 전혀 없는 것으로 나타났다.
The results of the investigation of the insecticidal power of the positive cosmid clone obtained above are as follows (Fig. 6). As shown in FIG. 6, the insecticidal power of the PtC28 clone was the highest, and it was found to be 100% killed 7 days after injection. PtC49 showed 50% insecticidal power at 6 days after injection, and PtC 64 and 267 clones reached 50% insecticidal power at 7 days after injection. In this experiment, there was no change in appearance in the larvae of the honey bee larva injected with sterilized physiological saline (0.85% NaCl) used as a control and XL-1 Blue MRF' with only the cosmid vector, SuperCos1.
5.3 독소 유전자 클로닝 및 재조합 발현 결과.5.3 Toxin gene cloning and recombinant expression results.
현재까지 확보한 9종의 독소 콤플렉스(toxin complex, tc) 관련 유전자를 각각 대장균 E. coli BL21(DE3)에서 발현시킨 결과, TcdA-like를 제외한 대부분의 독소단백질들은 isopropyl-β-D-thiogalactoside (IPTG)에 의해서만 유도되었으며, 예상되는 단백질의 크기는 SDS-PAGE를 통하여 확인하였다(도 7). 대부분의 독소 단백질이 효과적으로 과발현되었으며 발현 시 온도, IPTG 첨가농도 및 배지조건을 변화시켜 이에 따른 발현 양상을 관찰하였다. 발현온도는 TccB와 TcdB2의 경우 30℃에서, TccC3의 경우는 37℃에서 가장 적합한 것으로 나타났다. IPTG 농도는 0.5∼1mM로 나타났으며, 배지의 경우 SB(Super broth)로 나타났다.
Each of the 9 genes related to the toxin complex (tc ) obtained so far was identified in E. coli. As a result of expression in BL21 (DE3), most of the toxin proteins except TcdA-like were induced only by isopropyl-β-D-thiogalactoside (IPTG), and the expected protein size was confirmed through SDS-PAGE (Fig. 7 ). Most of the toxin proteins were effectively overexpressed, and the expression patterns were observed by changing the temperature, the concentration of IPTG addition, and the medium conditions at the time of expression. The expression temperature was found to be most suitable at 30°C for TccB and TcdB2 and 37°C for TccC3. The IPTG concentration was 0.5 to 1 mM, and in the case of the medium, it was shown as SB (Super broth).
5.4 살충성 검사5.4 Insecticide testing
각각의 독소 단백질이 가장 많이 발현된 상태의 재조합 대장균을 꿀벌부채명나방의 유충에게 주사한 경우 도 9에서와 같이 TccB가 발현된 대장균에서 가장 높은 살충력을 나타내었으며 주사 후 5일 때에 85%의 유충이 사멸하는 것으로 나타났다. 또한 본 발명의 서열번호 3의 아미노산 서열로 구성되는 단백질인 TccC3의 경우, 주사 후 7일 때에 62.5%, TccC는 주사 후 6일 때에 57.5%의 살충력을 나타내었으나, 그 이외의 독소 단백질은 살충력이 20% 미만으로 매우 낮게 나타났다(도 8). 갈색거저리 유충의 경우에도 TccB가 발현된 대장균에서 가장 높은 살충력을 나타내었으며 주사 후 5일 때에 유충이 모두 사멸하였다. 또한 주사농도를 50% 줄인 경우에도 80%의 높은 살충력을 나타내었다. 본 발명의 TccC3의 경우는 57.5%, TcdB2는 35%의 살충력을 나타내었다(도 9). 유충에게 주사한 cell의 양은 TccB의 경우 2.7×104 cells, TccC3은 1.4×105 cells, TcdB2는 3.7×104 cells를 나타내었으며 대조구인 pET21a(+)를 함유하는 대장균의 경우는 3.6×104 cells를 나타내었다. 멸균된 0.85% NaCl이나 E. coli BL21(DE3)/pET21a(+)를 주사한 꿀벌부채명나방 유충의 경우, 주사 7일 후에는 유충의 90%가 번데기 (pupae)로 성장하는 것으로 보아 정상적인 발달 단계가 진행되는 것으로 나타났다. 그러나 살충력을 나타낸 4종의 독소 단백질 이외의 재조합 대장균의 경우에는 살충성을 나타내지는 않았으나 번데기로의 진행이 일어나지 않는 것으로 보아 직접적인 살충력보다는 유충의 발달저해에 관여할 것으로 여겨진다. 두 종류의 유충에게 높은 살충력을 나타낸 E. coli BL21(DE3)/pETccB를 주사한 경우 도 10에서와 같이 멜라닌화되면서 죽는 것으로 나타났다.
When the recombinant E. coli in which each toxin protein was expressed the most was injected into the larvae of the bee moth, it showed the highest insecticidal power in the E. coli expressing TccB, as shown in FIG. 9, and 85% of the larvae were 5 days after the injection. It has been shown to perish. In addition, in the case of TccC3, a protein composed of the amino acid sequence of SEQ ID NO: 3 of the present invention, 62.5% at 7 days after injection, and 57.5% at 6 days after injection, but other toxin proteins have insecticidal power. It was very low, less than 20% (FIG. 8). In the case of the larvae of the brown snapper, E. coli expressing TccB showed the highest insecticidal power, and all larvae died 5 days after injection. In addition, even when the injection concentration was reduced by 50%, it showed a high insecticidal power of 80%. In the case of TccC3 of the present invention, 57.5% and TcdB2 exhibited an insecticidal power of 35% (FIG. 9). The amount of cells injected into the larvae was 2.7×10 4 cells for TccB, 1.4×10 5 cells for TccC3, and 3.7×10 4 cells for TcdB2, and 3.6×104 cells for E. coli containing the control pET21a(+). cells are shown. In the case of larvae of honey bee larvae injected with sterilized 0.85% NaCl or E. coli BL21(DE3)/pET21a(+), 90% of the larvae grow into pupae 7 days after injection, so normal development. It turns out that the steps are going on. However, in the case of recombinant Escherichia coli other than the four types of toxin proteins that showed insecticidal properties, they did not show insecticidal properties, but did not progress to the pupa, so it is believed that they may be involved in the inhibition of the development of larvae rather than direct insecticidal properties. In the case of injection of E. coli BL21(DE3)/pETccB, which showed high insecticidal power to two types of larvae, it was found to die while being melaninized as shown in FIG. 10.
농업생명공학연구원Institute of Agricultural Biotechnology KACC91627PKACC91627P 2011010420110104
서열목록 전자파일 첨부Attach electronic file of sequence list

Claims (10)

  1. 포토랍두스 템페라타 M1021(수탁번호: KACC91627P)로부터 분리한 서열번호 3의 아미노산 서열로 구성된 살충성 단백질.
    Insecticidal protein consisting of the amino acid sequence of SEQ ID NO: 3 isolated from photolapus temperata M1021 (Accession No. KACC91627P).
  2. 서열번호 3의 아미노산 서열을 코딩하는 것을 특징으로 하는 살충성 단백질 유전자.
    Insecticidal protein gene, characterized by encoding the amino acid sequence of SEQ ID NO: 3.
  3. 제2항에 있어서, 상기 유전자는 서열번호 4의 염기서열로 구성된 살충성 단백질 유전자
    According to claim 2, wherein the gene is an insecticidal protein gene consisting of the nucleotide sequence of SEQ ID NO: 4
  4. 제2항의 살충성 단백질 유전자를 포함하는 재조합 발현 벡터
    Recombinant expression vector comprising the pesticidal protein gene of claim 2
  5. 제4항의 재조합 발현벡터로 형질전환된 살충성 단백질을 발현하는 형질 전환체.
    A transformant expressing a pesticidal protein transformed with the recombinant expression vector of claim 4.
  6. 제1항의 살충성 단백질 또는 제5항의 형질 전환체를 유효성분으로 포함하는 해충 방제용 조성물.
    A pest control composition comprising the pesticidal protein of claim 1 or the transformant of claim 5 as an active ingredient.
  7. 제6항에 있어서, 상기 조성물은 나비목 해충에 대해 살충활성을 갖는 것을 특징으로 하는 해충 방제용 조성물.
    The composition for controlling pests according to claim 6, wherein the composition has insecticidal activity against lepidopteran pests.
  8. 제7항에 있어서, 상기 나비목 해충은 꿀벌부채명나방(Galleria mellonella), 배추좀나방(Plutella xylostella), 담배거세미나방(Spodoptera litura), 털뿔가지나방(Alcis angulifera), 애모무늬잎말이나방(Adoxophyes orana), 감나무잎말이나방(Ptycholoma lecheana), 밤애기잎말이나방(Cydia Kurokoi), 복숭아순나방(Grapholita molesta), 은무늬굴나방(Lyonetia prunifoliella), 복숭아심식나방(Carposina sasakii), 파밤나방(Spodoptera exigua), 목화바둑나방(Diaphania indica), 혹명나방(Cnaphalocrocis medinalis), 이화명나방(Chilo suppressalis), 및 왕담배나방(Helicoverpa armigera)으로 이루어진 군으로부터 선택된 해충임을 특징으로 하는 해충 방제용 조성물.
    According to claim 7, wherein the lepidopteran pest is Galleria beetle moth ( Galleria) mellonella ), Chinese cabbage moth ( Plutella) xylostella , Tobacco coccinella ( Spodoptera) litura ), Downy Moth ( Alcis) angulifera ), a patterned leaf moth ( Adoxophyes) orana ), persimmon leaf moth ( Ptycholoma) lecheana ), chestnut leaf horse moth ( Cydia) Kurokoi ), Peach pure moth ( Grapholita molesta ), Sliver moth ( Lyonetia) prunifoliella ), Peach Core Moth ( Carposina) sasakii ), night beetle ( Spodoptera) exigua ), cotton monarch moth ( Diaphania indica ), or moth moth ( Cnaphalocrocis) medinali s), yihwamyeong Moths (Chilo suppressalis ), and a pest control composition characterized in that the pest selected from the group consisting of Helicoverpa armigera .
  9. 제6항에 있어서, 상기 조성물은 딱정벌레목 해충에 대해 살충활성을 갖는 것을 특징으로 하는 해충 방제용 조성물.
    The composition for controlling pests according to claim 6, wherein the composition has insecticidal activity against coleopteran pests.
  10. 제9항에 있어서, 상기 딱정벌레목 해충은 갈색거저리(Tenebrio molitor Linnaeus), 오리나무잎벌레(Agelastica coerulea Baly), 사과둥근나무좀(Xyleborus apicalis Blandford), 서울나무좀(Scolytus seulensis), 쌀 바구미(Scolytus seulensis ), 소나무좀Tomicus piniperda), 밤바구미(Culculio sikkimensis)로 이루어진 군으로부터 선택된 해충임을 특징으로 하는 해충 방제용 조성물.
    10. The method of claim 9, wherein the coleopteran pests are brown goose (Tenebrio molitor Linnaeus), alder leaf beetle (Agelastica coerulea Baly), Xylborus apicalis Blandford, Skolytus seulensis, rice weevil (Scolytus seulensis) , Pine needles Tomicus piniperda), chestnut weevil (Culculio sikkimensis) pest control composition characterized in that the pest selected from the group consisting of.
KR1020130057914A 2013-05-22 2013-05-22 Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins KR101380111B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130057914A KR101380111B1 (en) 2013-05-22 2013-05-22 Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130057914A KR101380111B1 (en) 2013-05-22 2013-05-22 Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020110055507A Division KR101314263B1 (en) 2011-06-09 2011-06-09 Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins

Publications (2)

Publication Number Publication Date
KR20130060251A KR20130060251A (en) 2013-06-07
KR101380111B1 true KR101380111B1 (en) 2014-03-31

Family

ID=48858813

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130057914A KR101380111B1 (en) 2013-05-22 2013-05-22 Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins

Country Status (1)

Country Link
KR (1) KR101380111B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018225917A1 (en) * 2017-06-08 2018-12-13 전정배 Pyralid moth egg, producing method thereof, and method for producing recombinant protein by using pyralid moth egg

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999003328A1 (en) 1997-07-17 1999-01-28 Commonwealth Scientific And Industrial Research Organisation TOXIN GENES FROM THE BACTERIA XENORHABDUS NEMATOPHILUS AND $i(PHOTORHABDUS LUMINESCENS)
WO1999042589A2 (en) 1998-02-20 1999-08-26 Novartis Pharma Ag. Insecticidal toxins from photorhabdus
KR100522667B1 (en) 2003-06-04 2005-10-20 김용균 Photorhabdus temperata subsp. temperata ANU101

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999003328A1 (en) 1997-07-17 1999-01-28 Commonwealth Scientific And Industrial Research Organisation TOXIN GENES FROM THE BACTERIA XENORHABDUS NEMATOPHILUS AND $i(PHOTORHABDUS LUMINESCENS)
WO1999042589A2 (en) 1998-02-20 1999-08-26 Novartis Pharma Ag. Insecticidal toxins from photorhabdus
KR100522667B1 (en) 2003-06-04 2005-10-20 김용균 Photorhabdus temperata subsp. temperata ANU101

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GenBank Accession #: AAO17204(2003. 07. 17.) *
GenBank Accession #: AAO17204(2003. 07. 17.)*

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018225917A1 (en) * 2017-06-08 2018-12-13 전정배 Pyralid moth egg, producing method thereof, and method for producing recombinant protein by using pyralid moth egg

Also Published As

Publication number Publication date
KR20130060251A (en) 2013-06-07

Similar Documents

Publication Publication Date Title
Ruffner et al. Oral insecticidal activity of plant‐associated pseudomonads
AU675628B2 (en) Novel microorganism and insecticide
JP3657593B2 (en) Hotaruhabudas insecticidal protein toxin
KR910001059A (en) Gene encoding a new Bacillus thuringiensis isolate and a new Lepidoptera-active toxin that is active against lepidopteran pests
CN107074974A (en) There are the Novel chimeric insecticidal proteins of toxicity or inhibition to lepidoptera pest
Margalith et al. Biological control by Bacillus thuringiensis subsp. israelensis
Chattopadhyay et al. Recent trends of modern bacterial insecticides for pest control practice in integrated crop management system
JP2011526150A5 (en)
JP2010131021A (en) Plant-optimized polynucleotide encoding approximately 15 kda and approximately 45 kda pesticidal protein
JP2009131256A (en) Plant-optimized gene encoding pesticidal toxin
KR900017483A (en) Novel Bacillus, Turingiensis Isolates and Novel Lepidoptera-Active Toxins Active Against Lepidoptera Pests
KR101676917B1 (en) Inhibitor cysteine knot(AcICK) from Apis cerana having antifungal and insecticidal activity
KR101380111B1 (en) Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins
AU778146B2 (en) Biological control of nematodes
Mathur et al. A 37 kDa Txp40 protein characterized from Photorhabdus luminescens sub sp. akhurstii conferred injectable and oral toxicity to greater wax moth, Galleria mellonella
Sezen et al. Identification and pathogenicity of bacteria from European shot-hole borer, Xyleborus dispar Fabricius (Coleoptera: Scolytidae)
KR101314263B1 (en) Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins
BR112019014278A2 (en) TOXIC PROTEINS ACTIVE PESTICIDES AGAINST LEPIDOPTERA INSECTS
AU768073B2 (en) Insecticidal agents
Kaelin et al. Activity of Bacillus thuringiensis isolates on Lasioderma serricorne (F.)(Coleoptera: Anobiidae)
Amorim et al. Development of Culex quinquefasciatus resistance to Bacillus sphaericus strain IAB59 needs long term selection pressure
CN100523195C (en) Cultivated silkworm glutathione-S-transferase BmGSTe5 gene
ES2435079T3 (en) New bacterial proteins with pesticide activity
Abbas et al. A chimeric protein encoded by synthetic genes shows toxicity to Helicoverpa armigera and Spodotera littoralis larvae
WO2001016305A2 (en) Nucleotide sequences encoding an insectidal protein complex from serratia

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
FPAY Annual fee payment
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20170203

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180220

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190304

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20200302

Year of fee payment: 7